Am J Physiol Renal Physiol 290: F52–F60, 2006.
First published August 16, 2005; doi:10.1152/ajprenal.00001.2004.
Branching ducts similar to mesonephric ducts or ureteric buds in teratomas
originating from mouse embryonic stem cells
Makoto Yamamoto, Li Cui, Kohei Johkura, Kazuhiko Asanuma,
Yasumitsu Okouchi, Naoko Ogiwara, and Katsunori Sasaki
Department of Anatomy and Organ Technology, Shinshu University School of Medicine, Matsumoto, Japan.
Submitted 2 January 2004; accepted in final form 13 August 2005
differentiated structures, and once
damaged, they rarely recover their function. Renal tubules regenerate in the case of acute tubular necrosis (12), but the glomeruli
do not in many kidney diseases. This failure to fully regenerate
gives rise to patients with end-stage renal failure. Due to a lack
of donors, only a limited number of such patients can receive
kidney transplants, and most must undergo dialysis for the
remainder of their lives. Despite outstanding progress in regenerative medicine and tissue engineering, no means to regenerate kidney tissues have been established. There is a need,
therefore, to develop regenerative medicine for the kidney.
Nephrogenesis is initiated and continued as a result of
reciprocal inductive interaction between two primordial tissues, namely, the metanephric mesenchyme and the ureteric
bud (36). First, the ureteric bud grows out from the mesonephric duct into the metanephric mesenchyme. When these two
elements come into contact, the ureteric bud undergoes branching morphogenesis, generating much of the collecting duct
system. Meanwhile, the metanephric mesenchyme undergoes
nephrogenesis (36). Control genes involved in the early stages
of metanephrogenesis have been elucidated (19). Knockout
studies have resulted in a lack of metanephric kidney, showing
that these control genes are essential for kidney development.
In brief, Pax-2 (44), Lim-1 (39), c-Ret (6, 37), and Emx2 (22)
are expressed in the invading ureteric bud, whereas Sall1 (25),
WT-1 (18), Eya-1 (46), GDNF (23, 29, 35), and Wnt-4 (41) are
expressed in the metanephric mesenchyme. Pax-2 is also
expressed in induced mesenchymal cells (44).
Recent progress in embryonic stem (ES) cell technology for
regenerative medicine has been significant. ES cells derived
from the inner cell mass of blastocyst-stage early mammalian
embryos (5, 7) can proliferate indefinitely and differentiate into
derivatives of all three primary germ layers in vitro (24). The
pluripotency of mouse ES cells has been demonstrated in
knockout mice in which ES cells integrated into early embryos
produce all cell lineages in the chimeras. Except for these cases
of integration into ontogenic processes, the cell lineages induced from ES cells have been restricted. For ES cell-derived
kidney cells and structures, limited information is available.
Thomson et al. (43) reported the induction of mesonephric
nephron-like structures in teratoma tissues originating from
human ES cells. This is a noteworthy step in the ability to
induce regeneration of the nephron, the functional unit of the
kidney. However, it is not certain whether the ES cell-derived
nephrons belonged to the mesonephros or the metanephros. It
is also not clear whether the collecting duct system was
simultaneously induced. The ureteric bud and its origin, the
mesonephric duct, are a key element in the induction of
metanephric nephrogenesis.
Teratoma formation, particularly in vivo, is a useful experimental model for surveying the potency of ES cells because it
allows various cell lineages to develop with three-dimensional
architecture. To gain access to kidney tissue regeneration, in
the present study we searched for renal primordial structures
originating from mouse ES cells in vitro and in vivo. Gene
expression essential for metanephrogenesis was investigated in
embryoid body (EB) outgrowths and in teratomas originating
Address for reprint requests and other correspondence: K. Johkura, Dept. of
Anatomy and Organ Technology, Shinshu Univ. School of Medicine, 3-1-1
Asahi, Matsumoto 390-8621, Japan (e-mail: [email protected]).
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
branching morphology; mesonephric nephrons; renal primordia; development; kidney regeneration
RENAL NEPHRONS ARE HIGHLY
F52
0363-6127/06 $8.00 Copyright © 2006 the American Physiological Society
http://www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on June 14, 2017
Yamamoto, Makoto, Li Cui, Kohei Johkura, Kazuhiko
Asanuma, Yasumitsu Okouchi, Naoko Ogiwara, and Katsunori
Sasaki. Branching ducts similar to mesonephric ducts or ureteric buds
in teratomas originating from mouse embryonic stem cells. Am J
Physiol Renal Physiol 290: F52–F60, 2006. First published August
16, 2005; doi:10.1152/ajprenal.00001.2004.—Ureteric bud epithelial
cells and metanephric mesenchymal cells that comprise the metanephric kidney primordium are capable of producing nephrons and collecting ducts through reciprocal inductive interaction. Once these cells
are induced from pluripotent embryonic stem (ES) cells, they have the
potential to become powerful tools in the regeneration of kidney
tissues. In this study, we investigated these renal primordial cells and
structures in mouse ES cell outgrowths and their transplants. Gene
expression essential for early kidney development was examined by
RT-PCR in embryoid body (EB) outgrowths and their transplants in
adult mice. Histochemical detection of kidney primordial structures
and gene expression analysis coupled with laser microdissection were
performed in transplant tissues. RT-PCR analysis detected gene expression of Pax-2, Lim-1, c-Ret, Emx2, Sall1, WT-1, Eya-1, GDNF,
and Wnt-4 in the EB outgrowths from days 6 –9 of expansion onward,
and also in the teratoma tissues 14 and 28 days after transplantation.
Histochemical analysis 14 days after transplantation showed that
some ducts were positive for Pax-2, endo A cytokeratin, kidneyspecific cadherin, and Dolichos biflorus agglutinin and that dichotomous branching of these ducts had occurred. These staining patterns
and morphological features are intrinsic for mesonephric ducts and
ureteric buds. In long-term survival of 28 days, Pax-2-immunoreactivity disappeared in some renal primordia-like structures, indicating
their differentiation. Some ducts were accompanied by mesonephric
nephron-like convoluted tubules. RT-PCR analysis of those structures
collected by microdissection confirmed that they expressed kidney
development-related genes. In conclusion, these data suggest the
potential of ES cells to produce renal primordial duct structures and
provides an insight into the regeneration of kidney tissues.
F53
RENAL PRIMORDIA-LIKE DUCTS OF ES CELL ORIGIN
Table 1. Antibodies and lectin used and gene expression pattern in kidney development
Antibody/Lectin*
Pax-2
Endo-A
Ksp
DBA
WT-1
Pax-2
Lim-1
c-Ret
Emx2
Sall1
WT-1
Eya-1
GDNF
Wnt-4
⫹
⫹
⫹
⫺⫹
⫹
⫺⫹
⫺
⫹
⫹
⫺
⫺
⫺
⫺
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫺
⫹
⫹
⫹
⫹
⫹
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫹
⫺⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫺
⫺
⫹
⫹
⫺
⫺
⫺
⫺
⫹
⫹
⫹
⫺
⫺
⫹
⫹
⫺
⫹
⫹
⫹
⫹
⫹
⫺
⫹
⫹
⫹
⫹
⫺
⫹
⫹
⫹
⫹
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫹
⫺
⫺
⫺
⫺
⫺
⫺
⫹
⫹
⫹
⫹
⫹
⫹
⫺
⫹
⫹
⫹
⫹
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫺
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫹
⫺
⫹
⫺
⫺
⫺
⫺
⫹
⫹
⫺
⫺
⫺
⫺
⫺
⫺
12
32
33
34
⫺
⫺
⫺
⫹
⫺
17
34
45
⫺
⫹
⫹
⫹
⫹
11
38
⫺
⫺
⫺
⫺
⫺
20
⫹
⫺
⫺
⫺
⫺
33
⫺
⫺
⫺
⫺
⫺
12
32
33
34
⫹
⫹
⫹
⫹
⫹
⫹
⫺
⫹
⫹
⫹
9
40
28
25
⫹
⫺
⫺
⫺
⫺
33
⫹
⫹
⫹
⫺
⫺
16
42
41
*Data are primarily in accordance with references and are modified based on control findings in the staining condition employed. ⫹, Detectable; ⫺,
undetectable; ⫺⫹, weak reactivity; blank, no information. †Data are based on references and the Kidney Development Database by Davies JA and Brandli AW
(http://golgi.ana.ed.ac.uk/kidhome.html). ⫹, Expressed; ⫺, not expressed; blank, no information.
from ES cells. In addition, histochemical detection of renal
primordial structures was carried out in the teratoma tissues. In
this report, we describe the potency of mouse ES cells to
generate the primordium of the collecting duct system, that is,
the mesonephric duct and ureteric bud.
MATERIALS AND METHODS
Cells and animals. Three lines of mouse ES cells were used in the
study. ES cell line R1 was a gift from Dr. Andras Nagy. ES cell line
D3, developed by Doetschman et al. (5), was obtained from the
American Type Culture Collection (Manassas, VA) and previously
Table 2. Primer sets for PCR analysis
Gene
Pax-2
Lim-1
c-Ret
Emx2
Sall1
WT-1
Eya-1
GDNF
Wnt-4
HNF3␤
␤-Actin
Primer Sequence
Size, bp
Annealing Temperature, °C
Reference
ATGTCTTCCAGGCATCAGAGC
TGCCTGAAGCTTGATGTGGTC
CAACATGCGTGTTATCCAGG
CTTGCGGGAAGAAGTCGTAG
CAGGGCTTCCCAATCAGTTA
GCCTTCTCCCAGAGTTTTCC
CCGAGAGTTTCCTTTTGCACAACGC
GCCTGCTTGGTAGCAATTCTCCACC
GTACACGTTTCTCCTCAGGAC
TCTCCAGTGTGAGTTCTCTCG
CCAGTGTAAAACTTGTCAGCGA
TGGGATGCTGGACTGTCT
GATCTACAACACCTACAAAA
CAGGTACTCTAATTCCAAGG
GTTATGGGATGTCGTGGCTGTC
CCGTTTAGCGGAATGCTTTCTTAG
AGGTGATGGACTCAGTGCGC
CCCGCATGTGTGTCAAGATG
GTATGCTGGGAGCCGTGAAG
CAGCGCCCACATAGGATGAC
TTCCTTCTTGGGTATGGAAT
GAGCAATGATCTTGATCTTC
458
62
8
239
63
159
63
301
68
47
200
58
25
234
58
10
448
61
15
616
67
2
426
67
3
216
70
200
55
AJP-Renal Physiol • VOL
290 • JANUARY 2006 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on June 14, 2017
Duct system
Mesonephric duct
Uninduced ureteric bud
Duct tip
Duct trunk
Adult kidney
Medullary collecting duct
Cortical collecting duct
Nephron
Mesonephric tubule
Mesonephric glomerulus
Developing metanephros
Uninduced mesenchyme
Induced mesenchyme
Vesicle
Comma-shaped body
S-shaped body
Developing nephrons
Adult kidney
Glomerulus
Bowman’s capsule
Proximal tubule
Thin limb of Henle’s loop
Distal tubule
Reference
Gene†
F54
RENAL PRIMORDIA-LIKE DUCTS OF ES CELL ORIGIN
Fig. 1. Morphology and RT-PCR analysis of 129/sv-embryonic stem (ES) cell
differentiation. Similar patterns of growth, development, and gene expression
were seen in all 3 ES cell lines. A: undifferentiated mouse ES cells form
dome-shaped colonies on culture day 3. Bar ⫽ 70 ␮m. B: embryoid body (EB)
on day 5 of a suspension culture by the hanging-drop method. Bar ⫽ 70 ␮m.
C: EB outgrowths on day 7 of expansion. By this stage, differentiation of ES
cells into a wide variety of lineages occurred. Bar ⫽ 200 ␮m. D: an expression
pattern of genes essential for kidney development during the differentiation of
129/sv-ES cells. In this case, Lim-1, Emx2, Sall1, Eya-1, and GDNF are
expressed in EBs before expansion (EB), and WT-1 and Wnt-4 expressions are
detected in EB outgrowths from day 3 of expansion onward. Pax-2 and c-Ret
appear on day 6. All these gene expressions are also detected in the transplants
14 days after transplantation (T14). ␤-Actin served as internal standard.
Numbers at the top indicate the day of expansion of EB outgrowths.
used by us (4). The ES cell line developed from 129/sv-strain mouse
(129/sv-ES) was purchased from Cell and Molecular Technologies
(Phillipsburg, NJ). BALB/c nu/nu male mice at postnatal week 5, at
least three animals for each survival time in each cell line, were used
as hosts. Embryos on embryonic day 12 (E12) and adult ICR-strain
mice at postnatal week 6 were used as controls for histochemical
staining. All animals were purchased from SLC (Hamamatsu, Japan).
The investigation was approved by the Animal Care Committee of
Shinshu University.
Antibodies and lectin. For detection of the primordial kidney duct
system, antibodies specific for Pax-2 (rabbit polyclonal, Zymed Laboratories, San Francisco, CA), endo A cytokeratin, the mouse homolog of cytokeratin 8 (clone TROMA-1, rat IgG, Developmental
Studies Hybridoma Bank, Iowa City, IA), and kidney-specific cadherin (Ksp-cadherin; clone 4H6/F9, mouse IgG1, Zymed Laboratories), and FITC- or biotin-labeled Dolichos biflorus agglutinin (DBA;
Vector Laboratories, Burlingame, CA) were employed (Table 1).
Pax-2 antibody detects the mesonephric duct and nephron, ureteric
bud and its derivatives, induced metanephric mesenchyme, and metanephric nephron at comma- and S-shaped body stages (12, 32–34).
Endo A cytokeratin antibody detects the endodermal epithelia and
also mesodermal epithelia such as the mesonephric duct and nephron
and ureteric bud (17, 34, 45). Ksp-cadherin antibody detects the
ureteric bud, mesonephric duct, Müllerian duct, and developing tubules in the mesonephros and metanephros in embryos (11, 38). DBA
AJP-Renal Physiol • VOL
Table 3. Gene expression essential for kidney development
during ES cell differentiation
129sv-ES
Lim-1
Pax-2
c-ret
Emx-2
Sall1
WT-1
Eya-1
GDNF
Wnt-4
␤-Actin
D3
Lim-1
Pax-2
c-ret
Emx-2
Sall1
WT-1
Eya-1
GDNF
Wnt-4
␤-Actin
R1
Lim-1
Pax-2
c-ret
Emx-2
Sall1
WT-1
Eya-1
GDNF
Wnt-4
␤-Actin
EB
⫹⫹⫹
⫺⫺⫺
⫺⫺⫺
⫹⫺⫺
⫹⫹⫹
⫺⫺⫹
⫹⫹⫹
⫹⫺⫹
⫺⫹⫺
⫹⫹⫹
EB
⫹⫹⫹
⫺⫺⫺
⫺⫺⫺
⫹⫺⫹
⫹⫹⫹
⫹⫹⫺
⫹⫹⫹
⫹⫹⫹
⫹⫺⫹
⫹⫹⫹
EB
⫹⫹⫹
⫺⫺⫺
⫺⫺⫺
⫹⫹⫹
⫹⫹⫹
⫺⫺⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫺
⫹⫹⫹
3
⫹⫹⫹
⫺⫹⫺
⫺⫺⫺
⫹⫺⫺
⫹⫹⫹
⫹⫺⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫺
⫹⫹⫹
3
⫹⫹⫹
⫺⫺⫺
⫺⫺⫺
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
3
⫹⫹⫹
⫺⫺⫺
⫺⫹⫺
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
6
⫹⫹⫹
⫹⫺⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
6
⫹⫹⫹
⫺⫺⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
6
⫹⫹⫹
⫹⫺⫺
⫺⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
9
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
9
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
9
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
15
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
15
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
15
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
21
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
21
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
21
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
T14
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
T14
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
T14
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
T28
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
T28
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
T28
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
⫹⫹⫹
ES, embryonic stem; EB, embryoid body; T14 and T28, transplants 14 and
28 days after transplantation; ⫹, Detectable; ⫺, undetectable; numbers at the
top of the columns indicate the day of expansion of EB outgrowths; EB refers
to EBs on suspension culture day 5.
290 • JANUARY 2006 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on June 14, 2017
also binds to the epithelia of ureteric bud branches (20). Antibody for
WT-1 (rabbit polyclonal, Santa Cruz Biotechnology, Santa Cruz, CA)
was employed to evaluate the induction of metanephric mesenchymal
cells (33).
Cell culture. ES cells were cultured in 5% CO2 at 37°C for 72 h in
DMEM (GIBCO, Grand Island, NY) supplemented with 20% Knockout SR (GIBCO), 100 ␮M nonessential amino acids (GIBCO), 1 mM
sodium pyruvate (GIBCO), 100 ␮M ␤-mercaptoethanol (Sigma, St.
Louis, MO), and 103 units/ml of leukemia inhibitory factor (Chemicon, Temecula, CA) on feeder cells of mitomycin C-inactivated STO
fibroblasts (13). To induce EB formation, the cultures were dissociated with 0.05% trypsin-EDTA, and the cells were resuspended in
Iscove’s modified Dulbecco’s medium (GIBCO) containing 20% FBS
(GIBCO), 100 ␮M nonessential amino acids, 1 mM sodium pyruvate,
and 100 ␮M ␤-mercaptoethanol without leukemia inhibitory factor in
a concentration of 1,000 cells/50-␮l drop, and cultured in 5% CO2 at
37°C for 5 days using the hanging-drop method (21). The EBs formed
in the drops were replated onto a gelatin-coated 96-well dish with one
EB/well and cultured in the same medium up to 21 days for RT-PCR
analysis. EB outgrowths on day 7 of expansion were taken for
transplantation to make teratoma tissues.
RNA extraction and RT-PCR analysis. Using an RNeasy Mini Kit
(Qiagen, Valencia, CA), total RNA was extracted from EBs on culture
day 5, from the EB outgrowths every 3 days of expansion, and from
the teratomas 14 and 28 days after transplantation. DNase-treated total
RNA was used for the first-strand cDNA. This reaction was performed
using SuperScript II and RNase OUT recombinant ribonuclease inhibitor (Qiagen) in accordance with the manufacturer’s protocol.
RENAL PRIMORDIA-LIKE DUCTS OF ES CELL ORIGIN
1 h. Antibodies for Pax-2 and WT-1 were detected by goat anti-rabbit
IgG conjugated with horseradish peroxidase (diluted 1:100). Avidinbiotin-peroxidase complex was used to visualize the cytokeratin
endo-A antibody reacted with biotinylated goat anti-rat IgG antibody
(diluted 1:200) and biotinylated DBA. After incubation with 3,3⬘diaminobenzidine tetrahydrochloride, the specimens were observed
with a Nikon Microphot FXA light microscope.
Confocal laser-scanning microscopy. After antigen retrieval, the
specimens were doubly stained with a mixture of primary antibodies,
i.e., Pax-2/endo A cytokeratin or Pax-2/Ksp-cadherin. Then they were
reacted with a mixture of goat anti-rabbit IgG labeled with Alexa
Fluor 568 and goat anti-rat IgG/mouse IgG labeled with Alexa Fluor
488. Double staining for Pax-2 and DBA was also performed with a
mixture of Pax-2 antibody and FITC-labeled DBA followed by
incubation with goat anti-rabbit IgG-Alexa Fluor 568. Fluorescentlabeled antibodies were purchased from Molecular Probes (Eugene,
OR). All Alexa Fluor-conjugated secondary antibodies were diluted
1:1,000, and FITC-labeled DBA was diluted 1:100. The specificity of
each antibody and lectin was verified by controls with E12 mouse
embryos and adult mouse kidneys, and negative controls included
omission of the primary antibody or lectin. After nuclear counterstaining with 4⬘,6-diamidino-2-phenylindole dihydrochloride (Molecular
Probes), specimens were observed with an Olympus FluoView confocal laser-scanning microscope equipped with Ar and He/Ne lasers
or a Leica LSM TCS SP2 AOBS confocal laser-scanning microscope
with Ar, He/Ne, and blue diode lasers.
Laser microdissection. Freshly frozen slices of the teratomas 28
days after transplantation were serially cut into 7-␮m-thick cryosections. Every seven sections were subjected to immunofluorescence
double staining for Ksp-cadherin and Pax-2 as mentioned earlier for
detecting renal primordia-like structures. The other sections were
mounted on a polyethylene membrane film (PALM Microlaser Technologies, Bernried, Germany) fixed on glass slides. After fixation in
methanol for 3 min, specimens were stained with a toluidine blue
solution, dehydrated in 100% ethanol, air-dried, and subjected to laser
microdissection. The structures corresponding to the Ksp-cadherin-
Fig. 2. Immunohistochemical staining of ducts in teratoma
tissues originating from 129/sv-ES cells 14 days after transplantation. A–D: images from serial sections. A: nuclear staining for Pax-2 is visible in the epithelial cells of the duct
(arrowheads). The 2 sectional images are of a single duct (see
also Fig. 3, A and B). Endodermal epithelium is negative for
Pax-2 (arrow). B: duct is positive for endo A cytokeratin in the
epithelium (arrowheads). Endodermal epithelium is also positive for endo A cytokeratin (arrow). C: duct is positive for
Dolichos biflorus agglutinin (DBA) staining in the membranes
of the epithelial cells (arrowheads). D: surrounding cells of the
duct are negative for WT-1 (*), indicating that there are no
metanephric mesenchymal cells. E–H: branching morphology
of the duct in serial sections. Note that this duct branches in 2
regions in a dichotomous manner, so that the single duct (E)
yields 3 branches (H). Dichotomous branching is seen in F and
G (arrowheads). E and G: endo A cytokeratin staining. F and H:
Pax-2 staining. Bars ⫽ 50 ␮m.
AJP-Renal Physiol • VOL
290 • JANUARY 2006 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on June 14, 2017
cDNA samples were subjected to PCR amplification with specific
primers for genes essential for kidney development (Table 1) and for
control genes. Amplification consisted of denaturation at 94°C for 3
min followed by 35 cycles, each consisting of denaturation at 94°C for
1 min, annealing at the temperatures specified for each of the primer
sets for 1 min, and extension at 72°C for 1 min. Finally, the product
was extended at 72°C for 7 min. The PCR primers, annealing
temperatures, and size of the amplified products are shown in Table 2.
PCR reaction products were separated on 1.5% agarose gels, stained
with ethidium bromide, and visualized with UV light.
Cell transplantation. Cultured EB outgrowths on day 7 of expansion were washed with PBS to remove dead cells. After detachment
from the culture dish with PBS containing 0.05% trypsin-EDTA, cells
were collected in a 15-ml tube and centrifuged at 1,000 rpm for 5 min
at 4°C. The cell pellet was resuspended within Iscove’s modified
Dulbecco’s medium with the same supplements as the above at 4°C.
The host mice were anesthetized with an injection of Nembutal (0.05
mg/g body wt) dissolved in physiological saline. Cells (1.5 ⫻ 108)
from EB outgrowths were injected into the host retroperitoneum using
a 1.0-ml syringe with a 26-gauge needle.
Light microscopic histochemistry. The teratomas derived from
injected EB outgrowth cells were excised from the host mice under
deep anesthesia with Nembutal 14 and 28 days after transplantation,
fixed in 4% paraformaldehyde/0.1 M phosphate buffer, pH 7.4, for
24 h at 4°C, and incubated within a graded concentration of sucrose
solution (15, 20, and 30%). Samples were embedded in Tissue Tek
OCT compound (Sakura Finetek, Torrance, CA) and frozen rapidly.
Cryosections were cut at a thickness of 5 ␮m in each teratoma by a
Cryostat CM1900 (Leica, Heidelberg, Germany), pasted on slides,
and air-dried. Before histochemical staining, specimens were boiled in
10 mM sodium citrate buffer, pH 6.0, for 5 min in a microwave oven,
and cooled down for 15 min at room temperature for antigen retrieval.
The specimens were stained with a primary antibody or lectin (Pax-2,
cytokeratin endo-A, and Ksp-cadherin diluted 1:100; WT-1 diluted
1:200; biotinylated DBA diluted 1:1,000) at 4°C overnight and then
incubated in a secondary antibody solution at room temperature for
F55
F56
RENAL PRIMORDIA-LIKE DUCTS OF ES CELL ORIGIN
positive ducts/tubules in the serial sections were excised by laser
beam and subsequently laser-catapulted into the lid of a 0.5-ml
reaction tube coated by mineral oil (Sigma) using the PALM-MB K
laser microdissection system (PALM). Total RNA was extracted from
the collected cells with an RNA extraction kit (PALM) in accordance
with the manufacturer’s protocol and subjected to RT-PCR analysis of
the kidney development-related genes as mentioned earlier. Amplification was done with 50 cycles.
RESULTS
RT-PCR analysis of ES outgrowths. In hanging-drop suspension cultures, cells harvested from undifferentiated ES
cell cultures (Fig. 1A) developed into EBs (Fig. 1B). Expansion outgrowths in vitro (Fig. 1C) provided cells for
RT-PCR and teratoma formation. The EB outgrowths expressed genes essential for kidney development, i.e., Pax-2,
Lim-1, c-Ret, and Emx2 in the mesonephric duct and ureteric
bud and Sall1, WT-1, Eya-1, GDNF, and Wnt-4 in the
metanephric mesenchyme (Fig. 1D). The overall expression
pattern was basically comparable among ES cell lines with
some variance (Table 3). Pax-2 expression, which regulates
the first step in kidney development, became detectable
⬃days 6 –9 of expansion, following the expression of other
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on June 14, 2017
Fig. 3. Confocal laser scanning microscopy of the ducts in teratoma tissues 14 days after transplantation and of control tissue. All sections were stained for Pax-2
(red) and either endo A cytokeratin, Ksp-cadherin, or DBA (green). A and B: same duct shown in Fig. 2, A–D. Epithelial cells are Pax-2 positive and
simultaneously exhibit Ksp-cadherin immunoreactivity (A) or DBA-binding (B) in their membranes. C and D: Pax-2-positive ducts in the transplants originating
from ES cell line D3 (C) or R1 (D) cells are simultaneously positive for Ksp-cadherin or endo A cytokeratin. E: some ducts, ⬃7.5–35 ␮m along the short axis,
are compacted in a small area. The surrounding tissues are negative for Pax-2. F: image of a section at a distance from Fig. 3E. Note that these ducts run in a
straight manner and that some ducts have the appearance of blind ends (arrowheads). G: mesonephric nephron-like convoluted tubules. Epithelial cells are
positive for Pax-2 and endo A cytokeratin. H–O: control staining of E12 mouse embryos. H and I: in the metanephric region, the ureteric bud branch is positive
for both Pax-2 and endo A cytokeratin (H) or Ksp-cadherin (I). Induced mesenchymal cells surrounding the ureteric bud branch are positive for Pax-2 alone.
J and K: mesonephric region. Mesonephric tubules are positive for both Pax-2 and endo A cytokeratin (J) or Ksp-cadherin (K). L: urogenital sinus is positive
for endo A cytokeratin alone (*). In contrast, the caudal part of the mesonephric duct (arrowhead) is positive for both Pax-2 and endo A cytokeratin. M: ureter
is positive for Pax-2 and Ksp-cadherin. N: bile duct is positive for DBA staining, showing the reliability of lectin binding. Endodermal epithelium is negative
for Pax-2. O: negative control in the metanephric region. Omitting the step of staining with primary antibody or lectin significantly reduces the staining intensity.
Only a few cells in the uninduced mesenchyme show autofluorescence. Bars ⫽ 20 ␮m.
AJP-Renal Physiol • VOL
290 • JANUARY 2006 •
www.ajprenal.org
RENAL PRIMORDIA-LIKE DUCTS OF ES CELL ORIGIN
for Pax-2 was observed mainly in the neural cells (not shown).
In contrast, renal primordia-like structures were few at both
survival times, although they were detectable in most transplants.
Fourteen days after transplantation, a small number of ducts
with simple columnar or cuboidal epithelium were positive for
both Pax-2 in the nuclei and endo A cytokeratin in the cytoplasm, as well as for DBA lectin binding in the cell membranes
(Fig. 2, A–C). This staining pattern is similar to that of
mesonephric ducts or ureteric buds (Table 1). No nuclear
staining for WT-1 was observed in the tissues adjacent to the
ducts (Fig. 2D), indicating that metanephric mesenchyme had
not been induced. Branching morphology of the ducts was
evident in serial sections, with the ducts branching in a dichotomous manner (Fig. 2, E–H).
Confocal laser-scanning microscopy confirmed that Pax-2positive epithelial cells of the ducts were simultaneously positive for Ksp-cadherin and DBA binding in their cell membranes (Fig. 3, A–D). In some cases, several ducts varied in
Fig. 4. Confocal laser scanning microscopy of renal primordium-like structures in teratoma tissues 28 days after transplantation. All sections were stained for
Pax-2 (red) and Ksp-cadherin (green), and with 4⬘,6-diamidino-2-phenylindole dihydrochloride (blue). A–C: renal primordium-like ducts originating from D3 (A),
R1 (B), and 129/sv-ES (C) cells. They are doubly positive for Ksp-cadherin and Pax-2. Note that the duct in A branches in a dichotomous manner (*). Convoluted
tubules with Pax-2 immunoreactivity (arrow) are also seen near the ducts (arrowheads) in B. D–G: Pax-2-negative ducts (D and E) and tubules (F and G). They
appear to be differentiated judging from the disappearance of Pax-2 immunoreactivity. Mesonephric nephron-like structure (F) has a presumptive rudimental
renal corpuscle (arrowhead), in which a small avascular glomerulus can be seen. Bars ⫽ 50 ␮m in A, B, G; 20 ␮m in C and D; 10 ␮m in E and F.
AJP-Renal Physiol • VOL
290 • JANUARY 2006 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on June 14, 2017
genes. All gene expression continued up to day 21, the last
time point examined.
RT-PCR analysis of ES cell-derived teratomas. To detect
developing kidney primordia and their derivatives, transplants
of EB outgrowths were analyzed 14 and 28 days after transplantation. Each transplant developed into a teratoma in the
host retroperitoneum. RT-PCR analysis detected expression of
all the above genes in the transplants at both survival times in
each cell line (Fig. 1D, Table 3). Each gene expression,
however, cannot be regarded as direct evidence demonstrating
the induction of renal primordial cells because it is not specific
for kidney development. Thus we subsequently attempted the
histochemical detection of renal primordial structures.
Histochemical analyses of ES cell-derived teratomas. Multidifferentiated teratoma tissues were formed in all transplants
14 and 28 days after transplantation, in which the main components were neural tissues, smooth and skeletal muscle tissues, and endodermal ducts/cysts positive for endo A cytokeratin but negative for Pax-2 (Fig. 2, A and B). Immunoreactivity
F57
F58
RENAL PRIMORDIA-LIKE DUCTS OF ES CELL ORIGIN
Eya-1, GDNF, and Wnt-4 was detected (Fig. 5G), confirming
that those structures actually possessed the renal primordia-like
features. Expression of HNF3␤, an endodermal epithelial
marker not involved in kidney development, was undetectable.
DISCUSSION
This study shows that branching ducts with morphological
and histochemical features similar to those of mesonephric
ducts or ureteric buds were induced in the in vivo outgrowths
of the mouse ES cell-derived EBs. They had Ksp-cadherin in
the cell-cell junctions, a specific epithelial marker for developing kidney and genitourinary tract (11, 38). Some of the
ducts were accompanied by mesonephric nephron-like structures. Notably, expression of kidney development-related
genes was detectable in these ducts and mesonephric nephronlike structures. These data suggest that ES cells are capable of
differentiating into the duct system of the kidney. The incidence of renal primordial structures in the teratomas was low
in all ES cell lines examined. The long-term survival (28 days)
did not increase the incidence compared with that in 14-day
survival, suggesting that the commitment into the renal cell
lineages occurred in EB outgrowths and/or in early stage after
transplantation. Judging from the disappearance of epithelial
Pax-2-immunoreactivity, the long-term survival appeared to
contribute to the differentiation of renal primordial structures.
A decrease in Pax-2-immunoreactivity occurs in mesonephric
tubules during development (34) and in cortical collecting
ducts in the adult kidney (12). Some mesonephric nephron-like
structures had a rudimentary glomerulus in contrast to previous
studies of human ES cells that reported the presence of
nephron-like structures with discernible glomeruli and tubules
in ES cell-derived teratomas (1, 43). This discrepancy seems to
depend principally on species differences, i.e., the human fetus
has a well-developed mesonephros with distinct glomeruli
(27), whereas the mouse fetus does not (48). In fact, no
Fig. 5. Expression of kidney development-related genes in the microdissected ducts and tubules. A: Ksp-cadherin-positive ducts in the teratoma tissues
originating from R1 cell line. Some of them have weak immunoreactivity for Pax-2. (B–E). Shown are the same structures in A during the laser microdissection
procedure, the section before (B) and after (C and D) microdissection, and the captured ducts on the lid of a reaction tube (E). Bars ⫽ 20 ␮m. F: part of the
microdissected structures. The collected samples include the both ducts and tubules because those structures are unable to be distinguished exactly. G: RT-PCR
analysis of the microdissected samples. Gene expressions essential for kidney development are evident. As a control, expression of HNF3␤ is undetectable.
AJP-Renal Physiol • VOL
290 • JANUARY 2006 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on June 14, 2017
diameter were observed in a small area, confirming the branching morphology similar to the ureteric tree (Fig. 3E). Analysis
of serial sections revealed that the ducts extended in a straight
manner rather than convoluted, and ended blind (Fig. 3F).
Cells surrounding the ducts were completely negative for
Pax-2, showing that the induced mesenchymal cells were
absent around them (Fig. 3, E and F). Convoluted tubules
doubly positive for Pax-2 and endo A cytokeratin were also
observed (Fig. 3G). Those tubules had no discernible glomerulus and resembled mesonephric tubules rather than metanephric nephrons, because nuclear staining for Pax-2 disappears in
the metanephric nephrons when they develop further than the
S-shaped body stage (12, 32, 33). Control staining of E12
mouse embryos showed the validity of the histochemistry, in
which doubly positive staining for Pax-2 and endo A cytokeratin, Ksp-cadherin, or DBA was confined to the mesonephric
duct and nephrons and to the derivatives of the ureteric bud
(Fig. 3, H–N). Omitting the primary antibody/lectin significantly reduced the staining intensity in those structures of E12
embryos (Fig. 3O).
Twenty-eight days after transplantation, both mesonephric
duct-like and mesonephric nephron-like structures were also
detectable in the teratoma tissues, but still in small numbers
(Fig. 4). Their reactivity for the above antibodies (Fig. 4, A–C)
and lectin was basically the same as that of the renal primordialike structures 14 days after transplantation. In some ducts and
tubules, however, Pax-2-immunoreactivity decreased or disappeared (Fig. 4, D–G), indicating their differentiation. Some
tubules had a rudimentary renal corpuscle-like portion with an
avascular glomerulus (Fig. 4F), which supported that they
resembled mesonephric nephrons.
Laser microdissection analysis of renal primordia-like
structures. Laser microdissection of Ksp-cadherin-positive
ducts/tubules was performed 28 days after transplantation (Fig.
5, A–F), and the extracted RNA samples were subjected to
RT-PCR analysis of kidney development-related genes. As a
result, expression of Pax-2, Lim-1, c-Ret, Emx2, Sall1, WT-1,
RENAL PRIMORDIA-LIKE DUCTS OF ES CELL ORIGIN
AJP-Renal Physiol • VOL
essential for metanephros development, providing a basis for
investigating ES cells as a potential source for kidney regeneration.
ACKNOWLEDGMENTS
The mouse ES cell line R1 was a kind gift from Dr. Andras Nagy (Mount
Sinai Hospital, Toronto, Canada). We thank Kayo Suzuki, Masako Seki, and
Dr. Kiyokazu Kametani, Research Center for Instrumental Analysis, Shinshu
University, for outstanding technical assistance.
GRANTS
This work was supported by Grants-in-Aid for Scientific Research
14780633 (to K. Johkura) and 13558107 (to K. Sasaki) and by a Grant-in-Aid
for the 21st Century COE Program (to K. Sasaki) from the Ministry of
Education, Culture, Sports, Science, and Technology of Japan.
REFERENCES
1. Amit M, Carpenter MK, Inokuma MS, Chiu CP, Harris CP, Waknitz
MA, Itskovitz-Eldor J, and Thomson JA. Clonally derived human
embryonic stem cell lines maintain pluripotency and proliferative potential
for prolonged periods of culture. Dev Biol 227: 271–278, 2000.
2. Brophy PD, Ostrom L, Lang KM, and Dressler GR. Regulation of
ureteric bud outgrowth by Pax2-dependent activation of the glial derived
neurotrophic factor gene. Development 128: 4747– 4756, 2001.
3. Couse JF, Dixon D, Yates M, Moore AB, Ma L, Maas R, and Korach
KS. Estrogen receptor-␣ knockout mice exhibit resistance to the developmental effects of neonatal diethylstilbestrol exposure on the female reproductive tract. Dev Biol 238: 224 –238, 2001.
4. Cui L, Johkura K, Yue F, Ogiwara N, Okouchi Y, Asanuma K, and
Sasaki K. Spatial distribution and initial changes of SSEA-1 and other cell
adhesion-related molecules on mouse embryonic stem cells before and
during differentiation. J Histochem Cytochem 52: 1447–1457, 2004.
5. Doetschman TC, Eistetter H, Katz M, Schmidt W, and Kemler R. The
in vitro development of blastocyst-derived embryonic stem cell lines:
formation of visceral yolk sac, blood islands and myocardium. J Embryol
Exp Morphol 87: 27– 45, 1985.
6. Durbec P, Marcos-Gutierrez CV, Kilkenny C, Grigoriou M, Wartiowaara K, Suvanto P, Smith D, Ponder B, Costantini F, Saarma M,
Sariola H, and Pachnis V. GDNF signaling through the Ret receptor
tyrosine kinase. Nature 381: 789 –793, 1996.
7. Evans MJ and Kaufman MH. Establishment in culture of pluripotential
cells from mouse embryos. Nature 292: 154 –156, 1981.
8. Favor J, Sandulache R, Neuhäuser-Klaus A, Pretsch W, Chatterjee B,
Senft E, Wurst W, Blanquet V, Grimes P, Spörle R, and Schughart K.
The mouse Pax21Neu mutation is identical to a human PAX2 mutation in
a family with renal-coloboma syndrome and results in developmental
defects of the blain, ear, eye, and kidney. Proc Natl Acad Sci USA 93:
13870 –13875, 1996.
9. Fujii T, Pichel JG, Taira M, Toyama R, Dawid IB, and Westphal H.
Expression patterns of the murine LIM class homeobox gene lim1 in the
developing brain and excretory system. Dev Dyn 199: 73– 83, 1994.
10. Gaiger A, Reese V, Disis ML, and Cheever MA. Immunity to WT1 in
the animal model and in patients with acute myeloid leukemia. Blood 96:
1480 –1489, 2000.
11. Igarashi P, Shashikant CS, Thomson RB, Whyte DA, Liu-Chen S,
Ruddle FH, and Aronson PS. Ksp-cadherin gene promoter. II. Kidneyspecific activity in transgenic mice. Am J Physiol Renal Physiol 277:
F599 –F610, 1999.
12. Imgrund M, Grone E, Grone HJ, Kretzler M, Holzman L, Schlondorff D, and Rothenpieler UW. Re-expression of the developmental
gene Pax-2 during experimental acute tubular necrosis in mice 1. Kidney
Int 56: 1423–1431, 1999.
13. Johkura K, Cui L, Suzuki A, Teng R, Kamiyoshi A, Okamura S,
Kubota S, Zhao X, Asanuma K, Okouchi Y, Ogiwara N, Tagawa Y,
and Sasaki K. Survival and function of mouse embryonic stem cellderived cardiomyocytes in ectopic transplants. Cardiovasc Res 58: 435–
443, 2003.
14. Johkura K, Liang Y, Teng R, Ogiwara N, and Sasaki K. Nephrogenesis
accompanied by vascularisation in the mouse embryonic metanephros
transplanted into the adult kidney for the creation of additional nephrons.
Nephrology 7: 92–100, 2002.
290 • JANUARY 2006 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on June 14, 2017
discernible vascularized glomeruli were observed in the mesonephros of mouse embryos used as controls.
Although gene expression essential for kidney development
was detected in the EB outgrowths, the pattern of expression
did not correlate with that found in mouse knockout experiments (23, 29, 35, 37, 41). For example, expression of GDNF
and Wnt-4 preceded Pax-2 expression, the earliest event in
kidney development along with the expression of Lim-1. This
altered gene expression pattern may be due to the fact that the
EB outgrowths contain a wide variety of cell lineages, some of
which express the same genes as the developing kidney. Taken
together, gene expression in metanephric development is
shared with mesonephric development. These facts may be
responsible for the absence of discernible metanephric nephron
structures in teratomas in contrast to both the in vitro and in
vivo PCR data. Thus the present study indicates that simultaneous induction of a duct system and the metanephric mesenchyme might not occur in the EB outgrowths. However, the
possibility cannot be excluded that metanephric cells appeared
in the EB outgrowths but failed to survive in the teratomas.
Metanephric mesenchymal cells, the epithelial progenitor cells
of the metanephric nephron, can differentiate into myofibroblasts, smooth muscle, and, likely, endothelial cells in vitro,
suggesting that they are pluripotent stem cells of the nephron
(26). Further research will be necessary to evaluate the potential of ES cells to differentiate into the metanephric nephron.
The nephron is organized from many cell types, e.g., podocytes, mesangial cells, juxtaglomerular cells, and uriniferous
tubule epithelial cells. If these cells are individually induced
from stem cells, they may be useful for cell therapy in kidney
diseases, or for the development of bioartificial organs in
combination with tissue engineering. However, because of the
intricate structure of the nephron, employing these differentiated cell types as cellular sources in vitro or in vivo is unlikely
to result in the formation of functional structures. Induction of
nephrons is crucial to the regeneration of kidney tissues. Given
that nephrons develop in conjunction with the collecting duct
system, and the connection between them is essential for
acquiring the proper function of the nephron, the induction of
collecting ducts will be a requirement for this purpose. Previous studies, by both other investigators and ourselves, demonstrated that when renal primordia of experimental animals,
including metanephric mesenchyme and ureteric bud, were
implanted into adult host kidneys or ectopic sites, they produced a number of functional nephrons with vascularized
glomeruli and collecting duct systems (14, 31). Furthermore,
metanephric tissue transplanted from rat embryos to adult rats
after 3 days of preservation in vitro developed into functional
kidneys (30). From these results, one can raise the hypothesis
that once renal primordial cells, ureteric bud epithelial cells,
and metanephric mesenchymal cells can be produced from ES
cells and selectively amplified, coculturing them will induce
nephrogenesis accompanied by collecting duct formation via
reciprocal inductive interactions. Transplantation of developing nephrons of ES cell origin into an impaired kidney or to
ectopic sites is considered to be a possible strategy for regeneration of kidney function in the future. Although more work is
necessary to establish in vitro induction and selection (38)
techniques for renal primordial cells, the present study demonstrated histochemically the potency of ES cells to differentiate into cells of the mesonephric duct/ureteric bud lineage
F59
F60
RENAL PRIMORDIA-LIKE DUCTS OF ES CELL ORIGIN
AJP-Renal Physiol • VOL
32. Rothenpieler UW and Dressler GR. Pax-2 is required for mesenchymeto-epithelium conversion during kidney development. Development 119:
711–720, 1993.
33. Ryan G, Steele-Perkins V, Morris JF, Rauscher FJ III, and Dressler
GR. Repression of Pax-2 by WT1 during normal kidney development.
Development 121: 867– 875, 1995.
34. Sainio K, Hellstedt P, Kreidberg JA, Saxen L, and Sariola H. Differential regulation of two sets of mesonephric tubules by WT-1. Development 124: 1293–1299, 1997.
35. Sánchez MP, Silos-Santiago I, Frisén J, He B, Lira SA, and Barbacid
M. Renal agenesis and the absence of enteric neurons in mice lacking
GDNF. Nature 382: 70 –73, 1996.
36. Saxén L. Organogenesis of the kidney. In: Developmental and Cell
Biology Series, edited by Barlow PW, Green PB, and White CC. Cambridge UK: Cambridge Univ. Press, 1987, vol. 19.
37. Schuchardt A, D’Agati V, Larsson-Blomberg L, Costantini F, and
Pachnis V. Defects in the kidney and enteric nervous system of mice
lacking the tyrosine kinase receptor Ret. Nature 367: 380 –383, 1994.
38. Shao X, Johnson JE, Richardson JA, Hiesberger T, and Igarashi P. A
minimal Ksp-cadherin promoter linked to a green fluorescent protein
reporter gene exhibits tissue-specific expression in the developing kidney
and genitourinary tract. J Am Soc Nephrol 13: 1824 –1836, 2002.
39. Shawlot W and Behringer RR. Requirement for Lim1 in head-organizer
function. Nature 374: 425– 430, 1995.
40. Srinivas S, Wu Z, Chen CM, D’Agati V, and Costantini F. Dominant effects of RET receptor misexpression and ligand-independent
RET signaling on ureteric bud dependent. Development 126: 1375–1386,
1999.
41. Stark K, Vainio S, Vassileva G, and McMahon AP. Epithelial transformation of metanephric mesenchyme in the developing kidney regulated
by Wnt-4. Nature 372: 679 – 683, 1994.
42. Suvanto P, Hiltunen JO, Arumae U, Moshnyakov M, Sariola H,
Sainio K, and Saarma M. Localization of glial cell line-derived neurotrophic factor (GDNF) mRNA in embryonic rat by in situ hybridization.
Eur J Neurosci 8: 816 – 822, 1996.
43. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel
JJ, Marshall VS, and Jones JM. Embryonic stem cell lines derived from
human blastocysts. Science 282: 1145–1147, 1998.
44. Torres M, Gómez-Pardo E, Dressler GR, and Gruss P. Pax-2 controls
multiple steps of urogenital development. Development 121: 4057– 4065,
1995.
45. Van Adelsberg J, Sehgal S, Kukes A, Brady C, Barasch J, Yang J, and
Huan Y. Activation of hepatocyte growth factor (HGF) by endogenous
HGF activator is required for metanephric kidney morphogenesis in vitro.
J Biol Chem 276: 15099 –15106, 2001.
46. Xu PX, Adams J, Peters H, Brown MC, Heaney S, and Maas R.
Eya1-deficient mice lack ears and kidneys and show abnormal apoptosis of
organ primordia. Nat Genet 23: 113–117, 1999.
47. Yoshida M, Suda Y, Matsuo I, Miyamoto N, Takeda N, Kuratani S,
and Aizawa S. Emx1 and Emx2 functions in development of dorsal
telencephalon. Development 124: 101–111, 1997.
48. Zamboni L and Upadhyay S. Ephemeral, rudimentary glomerular structures in the mesonephros of the mouse. Anat Rec 201: 641– 644, 1981.
290 • JANUARY 2006 •
www.ajprenal.org
Downloaded from http://ajprenal.physiology.org/ by 10.220.33.1 on June 14, 2017
15. Johnson KR, Cook SA, Erway LC, Matthews AN, Sanford LP,
Paradies NE, and Friedman RA. Inner ear and kidney anomalies caused
by IAP insertion in an intron of the Eya1 gene in a mouse model of BOR
syndrome. Hum Mol Genet 8: 645– 653, 1999.
16. Kalatzis V, Sahly I, El-Amraoui A, and Petit C. Eya1 expression in the
developing ear and kidney: towards the understanding of the pathogenesis
of Branchio-Oto-Renal (BOR) syndrome. Dev Dyn 213: 486 – 499, 1998.
17. Kemler R, Brulet P, Schnebelen MT, Gaillard J, and Jacob F.
Reactivity of monoclonal antibodies against intermediate filament proteins
during embryonic development. J Embryol Exp Morphol 64: 45– 60, 1981.
18. Kreidberg JA, Sariola H, Loring JM, Maeda M, Pelletier J, Housman
D, and Jaenisch R. WT-1 is required for early kidney development. Cell
74: 679 – 691, 1993.
19. Kuure S, Vuolteenaho R, and Vainio S. Kidney morphogenesis: cellular
and molecular regulation. Mech Dev 92: 31– 45, 2000.
20. Laitinen L, Virtanen I, and Saxén L. Changes in the glycosylation
pattern during embryonic development of mouse kidney as revealed with
lectin conjugates. J Histochem Cytochem 35: 55– 65, 1987.
21. Maltsev VA, Wobus AM, Rohwedel J, Bader M, and Hescheler J.
Cardiomyocytes differentiated in vitro from embryonic stem cells developmentally express cardiac-specific genes and ionic currents. Circ Res 75:
233–244, 1994.
22. Miyamoto N, Yoshida M, Kuratani S, Matsuo I, and Aizawa S. Defects
of urogenital development in mice lacking Emx2. Development 124:
1653–1664, 1997.
23. Moore MW, Klein RD, Fariñas I, Sauer H, Armanini M, Phillips H,
Reichardt LF, Ryan AM, Carver-Moore K, and Rosenthal A. Renal
and neuronal abnormalities in mice lacking GDNF. Nature 382: 76 –79,
1996.
24. Nagy A, Gocza E, Diaz EM, Prideaux VR, Ivanyi E, Markkula M, and
Rossant J. Embryonic stem cells alone are able to support fetal development in the mouse. Development 110: 815– 821, 1990.
25. Nishinakamura R, Matsumoto Y, Nakao K, Nakamura K, Sato A,
Copeland NG, Gilbert DJ, Jenkins NA, Scully S, Lacey DL, Katsuki
M, Asashima M, and Yokota T. Murine homolog of SALL1 is essential
for ureteric bud invasion in kidney development. Development 128:
3105–3115, 2001.
26. Oliver JA, Barasch J, Yang J, Herzlinger D, and Al-Awqati Q.
Metanephric mesenchyme contains embryonic renal stem cells. Am J
Physiol Renal Physiol 283: F799 –F809, 2002.
27. Oyer CE. Juxtagonadal mesonephric glomeruli in fetuses of 11 to 21
weeks of gestation. Pediatr Pathol 12: 683– 689, 1992.
28. Pellegrini M, Pantano S, Lucchini F, Fumi M, and Forabosco A. Emx2
developmental expression in the primordia of the reproductive and excretory systems. Anat Embryol 196: 427– 433, 1997.
29. Pichel JG, Shen L, Sheng HZ, Granholm AC, Drago J, Grinberg AC,
Lee EJ, Huang SP, Saarma M, Hoffer BJ, Sariola H, and Westphal H.
Defects in enteric innervation and kidney development in mice lacking
GDNF. Nature 382: 73–76, 1996.
30. Rogers SA and Hammerman MR. Transplantation of metanephroi after
preservation in vitro. Am J Physiol Regul Integr Comp Physiol 281:
R661–R665, 2001.
31. Rogers SA, Lowell JA, Hammerman NA, and Hammerman MR.
Transplantation of developing metanephroi into adult rats. Kidney Int 54:
27–37, 1998.