Molecular Human Reproduction, Vol.15, No.12 pp. 779–788, 2009
Advanced Access publication on August 3, 2009 doi:10.1093/molehr/gap062
ORIGINAL RESEARCH
Stable expression and characterization
of N-terminal tagged recombinant
human bone morphogenetic protein 15
1
Department of Pathology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 2Department of Molecular and Cellular
Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 3Department of Molecular and Human Genetics, Baylor
College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 4Department of Biochemistry and Cell Biology, Rice University, Houston,
TX, USA
5
Correspondence address. Tel: þ1-713-798-6451; Fax: þ1-713-798-5833; E-mail: [email protected]
abstract: Oocyte-derived growth factors are critically involved in multiple ovarian processes via paracrine actions. Although recombinant proteins have been applied to dissect the physiological functions of these factors, variation of activities among different protein preparations remains an issue. To further elucidate the roles of one of these growth factors, bone morphogenetic protein 15 (BMP15), in
mediating oocyte-regulated molecular and cellular events and to explore its potential clinical application, we engineered the human
BMP15 sequence to efficiently produce bioactive recombinant human BMP15 (rhBMP15). The proteolytic cleavage site of the hBMP15 precursor was optimized to facilitate the production of the mature protein, and a FLAG-tag was placed at the N-terminus of the mature region
to ease purification and avoid potential interference of the tag with the cystine knot structure. The rhBMP15 protein was purified using antiFLAG M2 affinity gel. Our results demonstrated that the N-terminal tagged rhBMP15 was efficiently processed in HEK-293 cells. Furthermore, the purified rhBMP15 could activate SMAD1/5/8 and induce the transcription of genes encoding cumulus expansion-related transcripts (Ptx3, Has2, Tnfaip6 and Ptgs2), inhibitory SMADs (Smad6 and Smad7), BMP antagonists (Grem1 and Fst), activin/inhibin bA
(Inhba) and bB (Inhbb) subunits, etc. Thus, our rhBMP15 containing a genetically modified cleavage sequence and an N-terminal FLAGtag can be efficiently produced, processed and secreted in a mammalian expression system. The purified rhBMP15 is also biologically
active and very stable, and can induce the expression of a variety of mouse granulosa cell genes.
Key words: BMP15 / recombinant protein / oocyte / granulosa cell
Introduction
The oocyte, the female germ cell, has attracted tremendous interest
owing to its unique role during follicular development (Eppig et al.,
1997, 2002; Eppig, 2001; Matzuk et al., 2002; Gilchrist et al., 2008;
Li et al., 2008a). It has been established that oocytes control folliculogenesis, and oocyte-derived growth factors play pivotal roles in regulating the functions of surrounding somatic cells via paracrine pathways
(Eppig et al., 1997; Eppig, 2001; Su et al., 2004; Hussein et al., 2005;
Gilchrist et al., 2008). The factors secreted by oocytes, especially
growth differentiation factor 9 (GDF9), bone morphogenetic protein
15 (BMP15) and fibroblast growth factor 8 (FGF8), are crucial regulators of follicular development and female fertility (Dong et al., 1996;
Galloway et al., 2000; Yan et al., 2001; Moore et al., 2004; Shimasaki
et al., 2004; Su et al., 2004; Juengel and McNatty, 2005; Sugiura et al.,
2007; Matzuk and Lamb, 2008). Both GDF9 and BMP15 are
TGFb superfamily members which are synthesized as prepropeptide
precursors containing a signal peptide, a prodomain and a mature
domain (Chang et al., 2002). Seven conserved cysteines are normally
present in these ligands, and six of them are involved in the formation
of intramolecular disulfide bonds, resulting in a ‘cystine knot’ structure
that is important for the function and stability of the proteins (Vitt
et al., 2001; Berry et al., 2002). However, both GDF9 and BMP15
lack the fourth conserved cysteine which is required for the formation
of a covalently linked intermolecular dimer (McPherron and Lee, 1993;
Dube et al., 1998; Laitinen et al., 1998).
The Bmp15 gene is mapped to the X chromosome (Dube et al.,
1998), and mutations in human BMP15 gene have been reported in
patients with ovarian failure (Di Pasquale et al., 2004; Dixit et al.,
2006). Although BMP15 and GDF9 share the highest homology to
each other within the TGFb family (Wu and Matzuk, 2002), Bmp15
null mice demonstrate cumulus cell dysfunction (Yan et al., 2001)
& The Author 2009. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved.
For Permissions, please email: [email protected]
Downloaded from http://molehr.oxfordjournals.org/ at Pennsylvania State University on February 27, 2014
Qinglei Li1, Saneal Rajanahally 1,4, Mark A. Edson 1,2,
and Martin M. Matzuk 1,2,3,5
780
Materials and Methods
Animals, cell lines and reagents
Mice were maintained on a mixed C57BL/6/129S6/SvEv genetic background and handled in accordance with the NIH Guide for the Care and
Use of Laboratory Animals. HEK-293 cells and 293T cells (HEK-293 cells
containing the T-antigen from SV40) were obtained from the Tissue
Culture Core at Baylor College of Medicine and maintained at 378C with
5% CO2. Fetal bovine serum (FBS), bovine serum albumin (BSA), anti-FLAG
M2 affinity gel, 3 FLAG peptide, FLAG-BAP(bacterial alkaline phosphatase) protein standard, mouse anti-FLAG M2 antibody and chromatography
column were purchased from Sigma. DMEM, geneticin (G418), HEPES,
penicillin – streptomycin, NuPAGE 4 – 12% or 12% Bis-Tris gel, Superscript
III reverse transcriptase, deoxyribonucleotide triphosphate, oligo (dT)12 – 18
primers, PureLink PCR purification kit and SilverQuest staining kit were
obtained from Invitrogen. Pregnant mare serum gonadotrophin (PMSG)
was from Calbiochem. Recombinant human BMP4 (rhBMP4), untagged
human BMP15 and soluble BMPR2 ectodomain (BMPR2 ECD) were
obtained from R&D. All restriction enzymes were from New England
Biolabs. FuGENE6, phosphatase inhibitors and proteinase inhibitors were
from Roche. Phospho-SMAD1/5/8 antibody was from Cell Signaling.
Phusion Hot Start High-Fidelity DNA polymerase was purchased from
Finnzymes. TURBO DNA-free DNase was the product of Ambion.
Peroxidase-conjugated goat anti-mouse/rabbit antibody was from Jackson
ImmunoResearch. RNeasy Micro Kit containing RLT buffer was obtained
from Qiagen. Zymoclean gel DNA recovery kit was purchased from
ZYMO Research. SuperSignal West Pico kit and BCA protein assay kit
were obtained from Pierce. Taqman Universal PCR master Mix and
Taqman gene expression probes were purchased from Applied Biosystems.
Engineering of rhBMP15 cDNA
and expression construct
All mutations and restriction sites were introduced by PCR using Phusion
Hot Start High-Fidelity DNA polymerase. Overlap extension PCR was
performed to obtain the sequence encoding the optimized cleavage site
and FLAG-tag followed by the mature domain of hBMP15. Briefly,
plasmid containing the native hBMP15 coding sequence was used as a template, and amplified with primers PB1 (50 -gagaaagcttgccgccaccatggtcctcctca
g-30 ) and PB2 (50 -gagctcaagaccaccactatc-30 ). The resultant amplicon,
designated as fragment a (Fa), was inserted into the HindIII and BamHI
sites of pcDNA3 (designated as construct ABH). The mutation of cleava
ge site and incorporation of the FLAG-tag were conducted as follows.
First, primers PB3 (50 -gcaaaggttctggaataacaag-30 ) and PB4 (50 -gccgccgctca
ggctccgcttgctccggtgaagag-30 ) were used to generate Fb, which was utilized
as a template for primers PB3 and PBf5 (50 -cttgtcgtcatcgtccttgta
gtcgccgccgctcagg-30 ) to produce Fc. Then, Fd, which encodes the
FLAG-tag and the mature domain, was derived using primers PBf6
(50 -gactacaaggacgatgacgacaagcaagcagatgg-30 ) and PB7 (50 -gagtctcgagtca
tctgcatgtac-30 ). Lastly, Fd and Fc were combined and subjected to overla
p extension PCR using primers PB3 and PB7, and the amplicon (Fe) was
cloned into ABH at BamHI and XhoI sites (designated as pQL-rhBMP15).
All PCR fragments were purified by using the PureLink PCR purification kit
or Zymoclean gel DNA recovery kit. The identities of all cloned sequences
were verified by DNA sequencing (Child Health Research Center Molecular Core Laboratory, Baylor College of Medicine).
Transient transfection and selection of stable
cell clones
The hBMP15 expression construct (pQL-rhBMP15) was transiently transfected into HEK-293T cells using FuGENE6 transfection reagent according
Downloaded from http://molehr.oxfordjournals.org/ at Pennsylvania State University on February 27, 2014
whereas Gdf9 null mice have defects at the primary follicle stage (Dong
et al., 1996; Elvin et al., 1999b). These genetic studies provide compelling evidence that both BMP15 and GDF9 are important oocyteproduced factors that can regulate the ovarian somatic cell functions
in the mouse ovary. Moreover, the synergistic roles of the two
growth factors in the ovary have been suggested and/or demonstrated
by several reports (Yan et al., 2001; Hanrahan et al., 2004; Su et al.,
2004, 2008; McNatty et al., 2005; McIntosh et al., 2008). The novel
functions and regulations of these factors as well as the complex interactions among them are beginning to be unraveled (Hussein et al.,
2006; Gilchrist et al., 2008; McIntosh et al., 2008; Yeo et al., 2008),
and notably, the utilization of biologically active recombinant proteins
is key to these studies.
Epitope tagging is a powerful recombinant DNA approach (Jarvik
and Telmer, 1998) and has been applied to understand the functions
and signaling cascades of oocyte-secreted factors in the ovary
(Hashimoto et al., 2005; Mottershead et al., 2008). A C-terminal
FLAG-tagged recombinant human BMP15 (rhBMP15) was previously
produced and characterized (Otsuka Fumio et al., 2000). However,
the C-terminus of hBMP15 contains two cysteines (CTCR) that are
involved in the formation of ‘cystine knot structure’ characteristic of
the cystine knot family members (Sun and Davies, 1995). The
establishment of a functional cystine knot motif in the tertiary structure of a protein may facilitate its interaction with other factors
through the appropriate arrangement of a unique hydrophobic
surface of the molecule (Vitt et al., 2001), which is of particular importance in the context of ligand–receptor interactions for BMP15/GDF9
signaling. It is unclear if a C-terminal epitope tag will potentially
alter the conformation and activity/stability of the recombinant
protein because of its proximity to these cysteine residues. To our
knowledge, production of the N-terminal tagged rhBMP15 has not
been reported.
It has been documented that activation of TGFb superfamily ligands
is a complex and fine-tuned process where the ligands are synthesized
as inactive precursor/preproproteins (signal –proregion–mature
region) which are post-translationally modified by proprotein convertases that enzymatically cleave the propeptide to produce active
mature proteins (Massague, 1998; Massague and Chen, 2000; Chang
et al., 2002). In our previous study, we used a subtilisin-like serine convertase PACE (paired basic amino acid cleaving enzyme)/furin to
obtain efficient processing of BMP15 in CHO cells (unpublished
data) similar to that of mouse GDF9 production (Elvin et al.,
1999a). However, the presence of overexpressed PACE/furin in the
system may potentially affect the activity of the target proteins
produced.
By taking advantage of the endogenously produced proprotein
convertases through genetic engineering of an optimized cleavage
site into the hBMP15 precursor sequence, we efficiently produced
stable and mature rhBMP15 protein with an N-terminal FLAG-tag
in mammalian cells. Since granulosa cells are known target cells of
BMP15 and their functions as well as gene transcriptions are
subject to BMP15 regulation (Otsuka et al., 2000, 2001; Otsuka
and Shimasaki, 2002; Moore et al., 2003), we demonstrated the
bioactivity of the N-terminal tagged rhBMP15 using mouse
granulosa cells (mGCs) as an initial step toward exploring the functions, molecular underpinnings and potential clinical applications of
BMP15.
Li et al.
781
Production of bioactive human BMP15
to the manufacturer’s instructions. The conditioned medium was assayed
for the production of rhBMP15 72 h after transfection. To create the
stable cell lines, pQL-rhBMP15 was transfected into HEK-293 cells, and
the cells were re-plated at a low density 2 days after transfection in the
presence of 800 mg/ml G418. G418-resistant cell colonies were selected
after 10 –14 days. The colonies were then cultured and analyzed for the
expression and secretion of rhBMP15 protein using western blot. The
selected stable cell lines were maintained in culture medium containing
200 mg/ml G418.
Protein purification and quantification
Generation of human BMP15 polyclonal
antibody
A cDNA fragment encoding the mature hBMP15 protein (GenBank accession NM_005448) was subcloned into pET23b containing a His-tag
(Novagen), and the His-tagged hBMP15 protein was produced in BL21
cells (Novagen) according to the manufacture’s manual. The hBMP15
fusion protein was used to immunize mice null for Bmp15 (Bmp15 2/2 )
(Yan et al., 2001) to produce the polyclonal antibody according to a protocol consisting of a primary injection and three following boosts. The antisera from the mouse were collected and tested by western blot analyses
using medium containing rhBMP15 produced from mammalian cells.
The specificity of the anti-hBMP15 antibody was confirmed by a preabsorption experiment. Briefly, the anti-hBMP15 serum (1 : 2000) was preincubated with rhBMP15 (5 mg/ml) or control buffer overnight at 48C.
Then, the absorbed anti-sera were used to detect 50 ng of rhBMP15
using western blot analysis described below.
Western blot
Western blots were carried out as previously described (Li et al., 2008b).
In brief, conditioned medium from the transfected/untransfected
HEK-293 cells, protein lysates of HEK-293/granulosa cells or purified
rhBMP15 were subjected to electrophoresis under reducing or nonreducing conditions on NuPAGE 4 – 12% or 12% Bis-Tris gel. The separated proteins were then transferred onto nitrocellulose membranes
(30 V for 70 min). Membranes were blocked with 3% non-fat milk and
incubated with mouse anti-FLAG M2 antibody (1 : 1000 in 3% milk) or
rabbit anti-phospho-SMAD1/5/8 antibody (1 : 500 in 1% BSA) overnight
at 48C. Membranes were subsequently probed with peroxidase-
Granulosa cell culture and treatment
Isolation and culture of mGCs were performed as described elsewhere
(Pangas et al., 2006; Li et al., 2008b). Briefly, immature female mice
(21– 23 days) were primed with 5 IU PMSG (i.p.), and 44 – 46 h later,
large antral follicles were punctured for GC collection. The collection
medium was DMEM-F12 containing 0.3% BSA, 100 U/ml penicillin –
streptomycin and 10 mM HEPES. To exclude the oocytes, the GC
suspension was filtered through a 40 mm nylon mesh and washed twice
with collection medium. The mGCs were utilized for the following experiments. (i) SMAD activation analysis: to examine the activation of the
SMAD1/5/8 pathway by rhBMP15, mGCs were treated with control
buffer, rhBMP15 (100 ng/ml) or untagged hBMP15 (R&D) preincubated
with/without the BMPR2 ECD (1 mg/ml), or rhBMP4 (50 ng/ml; positive
control for SMAD1/5/8 phosphorylation). Cells were collected after 1 h
of treatment. The mGCs were lysed on ice in radio immunoprecipitation
assay buffer [50 mM Tris– HCl (pH 7.5), 250 mM NaCl, 0.5% NP-40 and
50 mM NaF] in the presence of proteinase and phosphatase inhibitors.
The cell suspensions were then sonicated and cellular proteins collected
after centrifugation. Quantification of protein was conducted using BCA
protein assay kit. Thirty micrograms of total protein/well were loaded
on the gel for western blot analysis. The western blot experiments were
repeated twice. (ii) Gene induction assay: the mGCs were treated with
rhBMP15 at 0 (control buffer), 30, 50, 100 and 200 ng/ml for a dose –
response experiment. For the bioactivity assays, mGCs were treated
with rhBMP15 (100 ng/ml), untagged hBMP15 (R&D) or control buffer
(control treatment). The control buffer was prepared from the untransfected HEK-293 cell culture medium and contains the same buffer as
that in the purified protein. The cells were collected and subjected to
RNA isolation after 5 h of treatment.
Reverse-transcription, PCR, and real-time
PCR
Total RNAs from HEK-293 cells and primary mGCs (5 h of treatment)
were isolated using Qiagen RNeasy Mini Kit and Micro Kit, respectively.
On-column DNase digestion was performed to eliminate potential
genomic DNA contamination according to the protocol of the manufacturer. Additionally, RNA from HEK-293 cells was further treated with
TURBO DNA-free DNase prior to reverse transcription (RT). RT was
performed using 200 ng (mGCs) or 1 mg (HEK-293 cells) of total RNA
and Superscript III reverse transcriptase in a 20 ml volume. One microlitre
of RT product was used for PCR amplification (20 ml reaction volume),
which was performed using a DNA Engine PTC-200 Peltier Thermal
Cycler. PCR primers were designed using Primer Express (Applied Biosystems, Foster City, CA, USA) and listed in Table I. Ten microlitres of the
resultant PCR products were separated and visualized on 1% agarose
gel containing ethidium bromide. In a parallel experiment, the PCR products (20 ml) were purified and sequenced to confirm their identities
(Agencourt Bioscience Corp.). The PCR was repeated twice and DNA
sequencing was performed using purified PCR products from one
experiment.
Real-time PCR was conducted using the ABI Prism 7500 Sequence
Detection System (Applied Biosystems) (Li et al., 2007). The reaction
was performed in a 20 ml volume using Taqman Universal PCR Master
Mix and Taqman gene expression probes (Ptx3, Mm00477267_g1;
Has2,
Mm00515089_m1;
Tnfaip6,
Mm00493736_m1;
Ptgs2
Mm00478374_m1; Fst, Mm00514982_m1; Inha, Mm03024204_s1; Inhba,
Downloaded from http://molehr.oxfordjournals.org/ at Pennsylvania State University on February 27, 2014
Stable cells expressing rhBMP15 were plated in DMEM containing 10%
FBS, 100 U/ml penicillin – streptomycin and 200 mg/ml G418. When the
cells reached confluency, DMEM containing 2% FBS and 100 U/ml
penicillin – streptomycin was used for the production of rhBMP15, and
the medium was collected every 2 days from culture dishes for up to
12 days. Purification of rhBMP15 was conducted using anti-FLAG M2
affinity gel according to the manufacturer’s protocol. Briefly, the conditioned medium containing rhBMP15 and proteinase inhibitors was incubated overnight at 48C with the appropriate amount of anti-FLAG M2
affinity gel based on the estimated quantity of recombinant protein in
the conditioned medium. After incubation, the resin was collected by centrifugation or filtration through a chromatography column and washed.
The rhBMP15 proteins were then eluted with 3 FLAG peptide or
0.1 M glycine HCl (pH 3.5) in TBS (pH 7.5). BSA (1 mg/ml) was added
to the protein before being stored at 2208C. The purified proteins
were quantified by western blot using FLAG-bacterial alkaline phosphatase
(BAP) standards. The control buffer was prepared from the untransfected
HEK-293 cell culture using the same protocol. The purity of the purified
rhBMP15 was examined by silver staining using a commercially available
SilverQuest staining kit.
conjugated goat anti-mouse or rabbit secondary antibody (1 : 10 000) for
70 min at room temperature. SuperSignal West Pico kit was used to
detect the chemiluminescence signal. Quantification of protein signals
was performed using NIH Image J software.
782
Li et al.
Table I Primers for amplification of proprotein
convertases
Primer name
Forward
Reverse
........................................................................................
Pcsk1
atcttcgtctgggcttcgg
gatttgggtttgcttccagg
Pcsk2
tgctcacctccaaacggaac
ttgaccgtgatgacagcctg
Furin
aggccacatgactactccgc
ggactctcggctgctctgg
Pcsk4
catcctgccgctgatctaca
cgtgttgaaatagtagcccttgttct
Pcsk5
tccctgccagtctgacatga
cattcgcactcctccgatct
Pcsk6
gcaggctttcgagtatggca
ggcagagactgaggtcccag
Pcsk7
atccaggacattgcacccaa
catcgtcatctggtccccag
Gapdh
ggtctcctctgacttcaaca
agccaaattcgttgtcatac
Statistical analyses
Differences among groups were assessed by ANOVA and the means
between individual groups were further compared using Tukey’s honest
significant difference test. Comparison of means between two groups
was made by student’s t-test. Data are reported as mean + standard
error of the mean (SEM), and P , 0.05 was considered to be statistically
significant.
Results and discussion
Genetic engineering of the hBMP15
precursor
Usage of abundantly overexpressed exogenous PACE/Furin as cleavage enzymes has the potential to reduce the efficiency of active
rhBMP15 production; hence, we sought to take advantage of
endogenously produced proprotein convertases. Using RT –PCR
analysis, we found that HEK-293 cells express mRNA transcripts for
furin and a number of other proprotein convertases such as proprotein convertase subtilisin/kexin type 2 (Pcsk2), Pcsk5, Pcsk6 and
Pcsk7 (Fig. 1).
The von Willebrand factor (vWF) is a secreted glycoprotein that
can be efficiently processed by PACE/furin. Notably, the -2 Lys (K)
and -4 Arg (R) amino acids upstream of the cleavage site are of functional importance for the efficient propeptide cleavage (Wise et al.,
1991; Casonato et al., 2003). We predicted that replacement of the
cleavage site of hBMP15 by the consensus cleavage sequence of
vWF would enhance the processing of hBMP15 by endogenous
PACE/furin and other related proteinases, which may eliminate the
necessity of using exogenous PACE for the efficient production of
Figure 1 Expression of mRNA transcripts for proprotein convertases in HEK-293 cells.
Total RNA was isolated from HEK-293 cells and RT –PCR was performed to
examine the steady-state mRNA transcripts encoding the proprotein convertases in these cells. Note that furin, Pcsk2, Pcsk5, Pcsk6 and Pcsk7 mRNA
are readily detectable in HEK-293 cells. Gapdh was used as an internal
control for PCR. Ten microlitres of the PCR products from a 20 ml reaction
volume were separated and visualized on 1% agarose gel containing ethidium
bromide. The identities of the amplicons were verified by DNA sequencing.
The PCR experiment was repeated twice. Pcsk, proprotein convertase subtilisin/kexin; þ or 2, RT with or without reverse transcriptase.
rhBMP15. Therefore, we genetically modified the hBMP15 cleavage
sequence (RRTR) based on the consensus cleavage sequence
(HRSKR/SLS) of vWF (Casonato et al., 2003) (Fig. 2A). Concomitantly, two glycines (GG) were placed downstream of the cleavage
site to minimize potential effects of the FLAG-tag (DYKDDDDK)
on the cleavage event (Fig. 2A). The FLAG tag was placed at the Nterminus of the mature BMP15 peptide instead of the C-terminus to
preclude its potential influence on the cystine knot structure, which
is composed of conserved cysteines among TGFb family members
(Fig. 2B). A perfect Kozak sequence (gccgccaccatgg) was also engineered to ensure the correct and efficient initiation of translation
(Kozak, 1986, 1987). The hBMP15 precursor was constructed by
overlap extension PCR as depicted in Fig. 2C.
Efficient production of rhBMP15
in mammalian cells
The pQL-rhBMP15 expression construct was transiently transfected
into HEK-293T cells, and the conditioned medium was analyzed for
secretion of rhBMP15 by western blot. Two immunoreactive bands
of rhBMP15 were detected (Fig. 3A, lane 1) using anti-FLAG M2 antibody that can recognize the FLAG-tag at the N-terminus, C-terminus
or in the middle of a protein. The predicted molecular weights (MWs)
of the mature form and precursor of the N-terminal FLAG-tagged
rhBMP15 are 15.3 and 46.4 kDa, respectively. The sizes of the
mature forms of N-terminal tagged rhBMP15 under reducing conditions resemble those of the C-terminal FLAG-tagged rhBMP15
Downloaded from http://molehr.oxfordjournals.org/ at Pennsylvania State University on February 27, 2014
Mm00434339_m1; Inhbb, Mm01286587_m1; Smad6, Mm00484738_m1;
Smad7,
Mm00484741_m1;
Grem1,
Mm03024240_s1;
Kitl,
Mm00442972_m1). Gapdh was used as the internal control and amplified
using a Taqman probe (Part no. 4352339E). All real-time PCR analyses
were performed in duplicates, and the results were from at least three
independent culture experiments. The abundance of mRNA for target
genes was normalized relative to that of Gapdh, and DCT was produced
by subtracting the mean CT of controls from the CT of each target
genes. Fold changes in mRNA expression were calculated using the
formula 22DDCT (Livak and Schmittgen, 2001).
Production of bioactive human BMP15
783
(A) The precursor cleavage sites of vWF (RSKR) and hBMP15 (RRTR) are shown in red. The cleavage site of hBMP15 was changed to that of vWF, and the surrounding
sequence was optimized based on that of vWF (dark blue). The FLAG-tag (DYKDDDDK; dark blue) was added immediately preceding the mature domain of hBMP15.
Mutations, restriction enzyme sites and a Kozak sequence were introduced by PCR, and FLAG-tag and additional sequence were introduced by PCR with overlap extension. (B) Comparison of conserved cysteines between TGFb ligands and the oocyte-derived factors BMP15 and GDF9. Similar to TGFb ligands, most of the known TGFb
family members have seven conserved cysteines (C1 – C7) in their protein sequences, among which six (indicated by blue arrows) are involved in the formation of intramolecular disulfide bonds and the cysteine ‘ring-knot’ structure. However, both BMP15 and GDF9 lack the fourth conserved cysteine (red asterisk) that is involved in the
formation of covalently linked intermolecular dimers. Note that the positions of the cysteines are not proportionally represented. The question marks represent variable
amino acids. (C) Genetic engineering of hBMP15 cDNA. Overlap extension PCR was performed to obtain the sequence encoding the optimized cleavage site and an
N-terminal FLAG-tag. See the Materials and Methods section for details. The red vertical line marks the cleavage site, whereas the solid blue bar indicates the position
of the FLAG-tag. The blue line indicates the mature domain of hBMP15 on the cDNA fragment Fe, and the green line corresponds with the proregion of hBMP15, which
spans part of Fa (cloned into ABH) and Fe. Subcloning of Fe into the ABH construct results in the final rhBMP15 expression construct, pQL-rhBMP15, which contains a
signal, a proregion, an optimized cleavage site, a FLAG-tag and a mature domain. Note that the hBMP15 cDNA and the sizes of the PCR fragments are not drawn
proportionally.
(Hashimoto et al., 2005) [i.e. double bands with the apparent MW of
16 and 17 kDa (Fig. 3A, lane 1)]. Recently, it has been shown that the
17 kDa rhBMP15 expressed with a C-terminal tag is O-glycosylated
(Saito et al., 2008). Interestingly, when the rhBMP15 protein was analyzed under non-reducing condition, the sizes were 20 kDa (Fig. 3A,
lane 2). The MW difference of rhBMP15 under non-reducing (Fig. 3A,
lane 2) and reducing (Fig. 3A, lanes 1 and 3) conditions may reflect the
existence of intramolecular disulfide bonds. The purity of rhBMP15
protein was then examined by silver staining (Fig. 3B). Silver staining
demonstrated major doublet bands 15 kDa corresponding to the
mature hBMP15 observed by western blot (Fig. 3A, lanes 1 and 3)
and a 34 kDa band corresponding to the size of the proregion,
which was not detectable by western blot using the anti-FLAG antibody due to the absence of the FLAG-tag. Some minor bands with
high MWs were also observed. Indeed, the C-terminal tagged
hBMP15 was also a pro-mature complex as previously reported
when purified using a similar approach (Saito et al., 2008). Furthermore, the immunoreactive bands of rhBMP15 can be detected using
an anti-hBMP15 antibody (Fig. 3C, lane 2). The specificity of the
anti-hBMP15 antibody was confirmed in an independent absorption
Downloaded from http://molehr.oxfordjournals.org/ at Pennsylvania State University on February 27, 2014
Figure 2 Construction of N-terminal FLAG-tagged rhBMP15.
784
Li et al.
mGCs were freshly prepared and treated with purified rhBMP15 at 0, 30, 50,
100 and 200 ng/ml. Cells were harvested after 5 h treatment, and total RNA
was isolated. Real-time PCR was performed using a Taqman probe to quantify
Ptx3 mRNA abundance. Gapdh was used as an internal control. Fold changes of
the treated group relative to the control (0 ng/ml of rhBMP15) were calculated
using DDCT method. All PCR experiments were performed in duplicates. Data
are mean + SEM from four independent culture experiments. Bars without a
common letter are significantly different at P , 0.05.
Figure 3 Expression and purification of N-terminal FLAG-tagged
rhBMP15.
(A) Expression of rhBMP15 in mammalian cells under reducing or non-reducing
conditions. Lane 1, The rhBMP15 was detected by anti-FLAG M2 antibody
under reducing conditions as two bands of 16 and 17 kDa in the conditioned
medium (20 ml) of HEK-293T cells transfected with rhBMP15 expression vector,
but was absent in medium from untransfected cells (data not shown). Lane 2,
Detection of purified rhBMP15 (20 ng) using anti-FLAG M2 antibody under nonreducing conditions. Lane 3, Detection of purified rhBMP15 (20 ng) using antiFLAG M2 antibody under reducing conditions. The purified rhBMP15 was
obtained from conditioned medium produced by HEK-293 cells stably expressing rhBMP15. (B) Silver staining of purified rhBMP15. Lane 1, Conditioned
medium (CM; 20 ml); lane 2, Purified rhBMP15 (100 ng). Note the major
doublet bands around 15 kDa relative to the mature hBMP15 observed in
western blot and a 34 kDa band corresponding to the size of the proregion.
(C) Detection of rhBMP15 by anti-hBMP15 antibody. Recombinant hBMP15
was absent in medium (20 ml) from untransfected HEK-293T cells (lane 1),
but present in the medium (20 ml) from pQL-rhBMP15 transfected cells (lane
2). Note the presence of non-specific high MW bands in both transfected and
untransfected media. (D) Confirmation of the specificity of anti-hBMP15 body.
Fifty nanograms of rhBMP15 were loaded per lane. Although the anti-hBMP15
antibody absorbed with control buffer readily detected the rhBMP15, absorption of the antibody (1 : 2000) with rhBMP15 (5 mg/ml) blocks its detection of
the rhBMP15 signal. Re-probing of both blots with anti-FLAG antibody demonstrated the equal loading of rhBMP15. (E) Quantification of purified rhBMP15 by
western blot. One microlitre of purified rhBMP15 (lane 4; arrow head) was analyzed under reducing conditions by western blot and quantified using FLAG-BAP
standards (arrow) at 5 ng (lane 1), 10 ng (lane 2) and 20 ng (lane 3). All western
blots/silver staining in A–D were repeated at least twice, and the image in E represents one quantification experiment of purified rhBMP15.
experiment (Fig. 3D). Pre-absorption of the antibody with rhBMP15
abolished its detection of the specific rhBMP15 signal in the western
blot (Fig. 3D).
In support of the enhanced cleavage of the hBMP15 precursor by
endogenous proprotein convertases, we found that the rhBMP15 precursor in the conditioned medium was below the limit of detection
(Fig. 3A, lane 1); however, it is readily detectable in studies where
the native hBMP15 cleavage site was used for recombinant protein
production (Hashimoto et al., 2005). The lack of detectable
rhBMP15 precursor in the media indicated the efficient cleavage of
the precursor, most likely by endogenous PACE/furin. Thus, optimization of the cleavage site facilitated production of the mature and
active form of hBMP15.
HEK-293 cell lines stably expressing rhBMP15 were created and
used as a convenient source to produce rhBMP15. Conditioned
medium containing 2 mg/ml of rhBMP15 could be routinely produced. The purified rhBMP15 was quantified by immunoblot using
FLAG-BAP standards (Fig. 3E).
N-terminal tagged recombinant hBMP15
activates the SMAD1/5/8 signaling pathway
and induces gene expression in mouse
granulosa cells
Selection of rhBMP15 dosage for the in vitro studies was based on a
dose–response experiment in which 100 ng/ml of rhBMP15 demonstrated robust and consistent induction of mGC genes (Fig. 4). To
verify that the rhBMP15 can activate the BMP-responsive SMADs,
SMAD1/5/8, mGCs were treated with control buffer (control), purified rhBMP15 (100 ng/ml) or untagged hBMP15 (100 ng/ml) from
R&D systems. Recombinant hBMP4 (50 ng/ml) was used as a positive
control for SMAD1/5/8 activation. Western blot revealed elevated
Downloaded from http://molehr.oxfordjournals.org/ at Pennsylvania State University on February 27, 2014
Figure 4 Dose-dependent induction of Ptx3 mRNA by rhBMP15.
Production of bioactive human BMP15
Figure 5 Activation of SMAD1/5/8 by N-terminal tagged
rhBMP15.
phospho-SMAD1/5/8 in mGCs treated with rhBMP15, untagged
rhBMP15 or rhBMP4 (positive control) (Fig. 5). To determine if
these effects were specific to the rhBMP15 stimulation, we also preincubated the rhBMP15 or R&D hBMP15 with BMPR2 ECD (1 mg/ml)
before adding the mixture to the cell culture. As expected, BMPR2
ECD attenuated the levels of phosphorylated SMAD1/5/8 stimulated
by the rhBMP15 or R&D hBMP15 (Fig. 5).
As an initial step toward examining the activity of the N-terminal
tagged rhBMP15, we analyzed its ability to induce gene expression
in the mGC culture since GCs are targets of BMP15 action (Otsuka
et al., 2000). BMPs can bind to the type 2 and type 1 receptors and
activate SMAD signaling proteins, preferably SMAD1/5/8, to regulate
gene transcription (Chang et al., 2002; Shimasaki et al., 2004). To
ensure the maximal probability of responsive target identification,
the gene candidates selected for the initial analysis of rhBMP15 bioactivity were ideally known targets of both BMPs and oocyte-derived
factors such as GDF9. Thus, as the priority candidates for the gene
induction assay, we selected several BMP4-induced genes (such as
Ptx3, Has2, Ptgs2, Tnfaip6, Smad6, Smad7 and Grem1) from our previous microarray analysis (unpublished data), since all of these genes
except Smad6 and Smad7 are also regulated by GDF9 in mGCs
(Elvin et al., 1999a; Pangas et al., 2004; Li et al., 2008b). Additionally,
a number of granulosa cell expressed genes of potential interest
(Inhba, Inhbb, Inha, Fst and Kitl) were tested. mGCs are an abundant
source that can be obtained from hormone-primed ovaries and
have been used in the literature to examine the bioactivity and function of oocyte-produced factors (Elvin et al., 1999a; Otsuka et al.,
2000; Pangas et al., 2004; McNatty et al., 2005). Moreover, GDF9
can induce cumulus expansion-related transcripts in mGCs (Elvin
et al., 1999a; Li et al., 2008b), indicating that mGCs are capable of
expressing cumulus-related transcripts upon stimulation with
oocyte/oocyte-derived factor.
For the above reasons, we conducted the initial rhBMP15 bioactivity
analysis using primary mGC culture. Interestingly, treatment of mGCs
with purified rhBMP15 (100 ng/ml) induced the expression of genes
encoding cumulus expansion-related transcripts (Has2, Ptx3, Tnfaip6
and Ptgs2) (Fig. 6A –D), BMP antagonists (Fst and Grem1) (Fig. 6I
and J), inhibitory SMADs (Smad6 and Smad7) (Fig. 6K and L) and
activin/inhibin b subunits (Inhba and Inhbb) (Fig. 6F and G) within
5 h of treatment. Strikingly, robust stimulation of Has2 and Ptx3
(90 –100-fold) by rhBMP15 was observed (Fig. 6A and B). Remarkable effects of purified mouse GDF9 on these cumulus transcripts
were also observed in mGCs (unpublished data), suggesting the competent responsiveness of granulosa cells to these oocyte-derived
factors and their involvement in cumulus cell function. To determine
if these dramatic effects of gene stimulation were caused by potential
alterations of rhBMP15 activity due to the N-terminal FLAG-tag, we
examined the ability of the untagged hBMP15 from R&D Systems to
induce these transcripts in the mGC culture. Consistently, the
untagged hBMP15 was also a potent stimulator of the cumulus
expansion-related transcripts, especially Has2 and Ptx3 (Fig. 6M and
N), suggesting that the robust induction of gene transcripts by the
rhBMP15 is not caused by the incorporation of an N-terminal
FLAG-tag.
In contrast to the dramatic effect of rhBMP15 on inducing the aforementioned gene transcripts, the mRNA abundance for Inha and Kitl
was not significantly affected by the N-terminal tagged rhBMP15 in
mGCs treated for 5 h (Fig. 6E and H). This finding is in contrast to
a previous report that Kitl was up-regulated by the C-terminal
tagged rhBMP15 in rat GCs (Otsuka and Shimasaki, 2002). It is
unknown if this inconsistency results from the differences of the
origins of granulosa cells or the construction/preparation of recombinant proteins. In support of the former, it was noted that the cellular
localization pattern of Kitl mRNA transcript in the ovary is distinct
between mouse and rat (mural GCs in mouse versus cumulus cells
in rat) (Shimasaki et al., 2004). Although the significance of rhBMP15
regulation of the aforementioned genes in mGCs remains unclear, it
may have functional implications in critical physiological events associated with follicular development. The activity of this N-terminal tagged
rhBMP15 in promoting the expression of glycolytic enzymes [platelet
phosphofructokinase (Pfkp) and lactate dehydrogenase A (Ldha)] in
cumulus cells (Sugiura et al., 2007) was verified in the presence of
FGF8B [Dr K. Sugiura (personal communication)], indicating the functional involvement of BMP15 in glycolysis carried out by cumulus cells.
Of note, the N-terminal tagged rhBMP15 was stable, as repeated
freezing and thawing (two times) or storage at 48C for up to 4
weeks did not have detectable effects on its activity in the mGC
gene induction assays (data not shown).
Thus, in the current study, we efficiently produced biologically active
and stable rhBMP15, which has potential applications in assisted
reproductive technology to improve infertility treatment (Gilchrist
et al., 2008; Li et al., 2008a). Further studies are necessary to
achieve a more comprehensive profile of genes induced by the
N-terminal tagged rhBMP15 in mGCs. Moreover, the activity of the
N-terminal tagged rhBMP15 in modulating BMP-associated biological
events/functions in the ovary and/or other systems needs to be
examined.
Downloaded from http://molehr.oxfordjournals.org/ at Pennsylvania State University on February 27, 2014
The purified rhBMP15 (100 ng/ml) or untagged hBMP15 (R&D; 100 ng/ml)
was preincubated with/without BMPR2 ECD (1 mg/ml) before adding to the
mGC culture. mGCs treated with control buffer (control) were used as a negative control, whereas recombinant hBMP4 (50 ng/ml) was included as a positive control for SMAD1/5/8 activation. The cells were collected and proteins
immediately prepared after 1 h of treatment. The proteins were quantified by
BCA method, and 30 mg of total proteins was resolved by SDS – PAGE.
Western blot demonstrated a single band of 58 kDa, corresponding to
the phospho-SMAD1/5/8 (p-SMAD1/5/8). The levels of p-SMAD1/5/8 in
mGCs treated with rhBMP15, untagged hBMP15 (R&D) or rhBMP4 were elevated. Pre-incubation with BMPR2 ECD (1 mg/ml) attenuated the p-SMAD1/
5/8 levels induced by the rhBMP15 or the untagged hBMP15 (R&D). All
western blot experiments were performed at least twice and representative
images from one experiment are presented.
785
786
Li et al.
Downloaded from http://molehr.oxfordjournals.org/ at Pennsylvania State University on February 27, 2014
Figure 6 Induction of gene expression by rhBMP15 in mGCs.
mGCs were freshly prepared and treated with control buffer (Con), purified N-terminal tagged rhBMP15 (100 ng/ml) or untagged hBMP15 (R&D; 100 ng/ml). Cells were
harvested after 5 h treatment and total RNA was isolated. Real-time PCR analyses of Has2 (A), Ptx3 (B), Tnfaip6 (C), Ptgs2 (D), Inha (E), Inhba (F), Inhbb (G), Kitl (H), Fst
(I), Grem1 (J), Smad6 (K) and Smad7 (L) mRNA abundance using the control buffer-treated or rhBMP15-treated cells and Taqman probes. Real-time PCR analyses of
Has2 (M), Ptx3 (N), Tnfaip6 (O), Ptgs2 (P) mRNA abundance using buffer-treated or the untagged hBMP15 (R&D)-treated cells and Taqman probes. Abundance of
mRNA for each gene was normalized against that of Gapdh. Fold changes of the treated group relative to controls were calculated using DDCT method. All PCR experiments were performed in duplicates. Data are mean + SEM from three independent culture experiments. Bars without a common letter are significantly different at
P , 0.05.
Production of bioactive human BMP15
Acknowledgements
The authors thank Ms Lang Ma for help with the hBMP15 antibody
production. We are grateful to Dr Koji Sugiura for verifying the activity
of our rhBMP15 in the regulation of glycolytic enzyme expression in
mouse cumulus cells. Dr Naoki Iwamori kindly gave us the pcDNA3
vector. Mr Julio Agno helped to maintain all of the mice used for
the granulosa cell culture experiments. Dr Ankur Nagaraja provided
some primers for the PCR experiment.
Funding
References
Berry C, Thomas M, Langley B, Sharma M, Kambadur R. Single cysteine to
tyrosine transition inactivates the growth inhibitory function of
Piedmontese myostatin. Am J Physiol Cell Physiol 2002;283:C135– C141.
Casonato A, Sartorello F, Cattini MG, Pontara E, Soldera C, Bertomoro A,
Girolami A. An Arg760Cys mutation in the consensus sequence of the
von Willebrand factor propeptide cleavage site is responsible for a new
von Willebrand disease variant. Blood 2003;101:151 – 156.
Chang H, Brown CW, Matzuk MM. Genetic analysis of the mammalian
transforming growth factor-beta superfamily. Endocr Rev 2002;
23:787– 823.
Di Pasquale E, Beck-Peccoz P, Persani L. Hypergonadotropic ovarian
failure associated with an inherited mutation of human bone
morphogenetic protein-15 (BMP15) gene. Am J Hum Genet 2004;
75:106– 111.
Dixit H, Rao LK, Padmalatha VV, Kanakavalli M, Deenadayal M, Gupta N,
Chakrabarty B, Singh L. Missense mutations in the BMP15 gene are
associated with ovarian failure. Hum Genet 2006;119:408 – 415.
Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk MM. Growth
differentiation factor-9 is required during early ovarian folliculogenesis.
Nature 1996;383:531– 535.
Dube JL, Wang P, Elvin J, Lyons KM, Celeste AJ, Matzuk MM. The bone
morphogenetic protein 15 gene is X-linked and expressed in oocytes.
Mol Endocrinol 1998;12:1809 – 1817.
Elvin JA, Clark AT, Wang P, Wolfman NM, Matzuk MM. Paracrine actions
of growth differentiation factor-9 in the mammalian ovary. Mol
Endocrinol 1999a;13:1035– 1048.
Elvin JA, Yan C, Wang P, Nishimori K, Matzuk MM. Molecular
characterization of the follicle defects in the growth differentiation
factor 9-deficient ovary. Mol Endocrinol 1999b;13:1018 – 1034.
Eppig JJ. Oocyte control of ovarian follicular development and function in
mammals. Reproduction 2001;122:829 –838.
Eppig JJ, Chesnel F, Hirao Y, O’Brien MJ, Pendola FL, Watanabe S,
Wigglesworth K. Oocyte control of granulosa cell development: how
and why. Hum Reprod 1997;12:127 – 132.
Eppig JJ, Wigglesworth K, Pendola FL. The mammalian oocyte orchestrates
the rate of ovarian follicular development. Proc Natl Acad Sci USA 2002;
99:2890– 2894.
Galloway SM, McNatty KP, Cambridge LM, Laitinen MPE, Juengel JL,
Jokiranta TS, McLaren RJ, Luiro K, Dodds KG, Montgomery GW et
al. Mutations in an oocyte-derived growth factor gene (BMP15) cause
increased ovulation rate and infertility in a dosage-sensitive manner.
Nat Genet 2000;25:279– 283.
Gilchrist RB, Lane M, Thompson JG. Oocyte-secreted factors: regulators
of cumulus cell function and oocyte quality. Hum Reprod Update 2008;
14:159– 177.
Hanrahan JP, Gregan SM, Mulsant P, Mullen M, Davis GH, Powell R,
Galloway SM. Mutations in the genes for oocyte-derived growth
factors GDF9 and BMP15 are associated with both increased
ovulation rate and sterility in Cambridge and Belclare sheep (Ovis
aries). Biol Reprod 2004;70:900 – 909.
Hashimoto O, Moore RK, Shimasaki S. Posttranslational processing of
mouse and human BMP-15: potential implication in the determination
of ovulation quota. Proc Natl Acad Sci USA 2005;102:5426 – 5431.
Hussein TS, Froiland DA, Amato F, Thompson JG, Gilchrist RB. Oocytes
prevent cumulus cell apoptosis by maintaining a morphogenic paracrine
gradient of bone morphogenetic proteins. J Cell Sci 2005;
118:5257– 5268.
Hussein TS, Thompson JG, Gilchrist RB. Oocyte-secreted factors
enhance oocyte developmental competence. Dev Biol 2006;296:
514 – 521.
Jarvik JW, Telmer CA. Epitope tagging. Annu Rev Genet 1998;32:601– 618.
Juengel JL, McNatty KP. The role of proteins of the transforming growth
factor-fbetag superfamily in the intraovarian regulation of follicular
development. Hum Reprod Update 2005;11:144 – 161.
Kozak M. Point mutations define a sequence flanking the AUG initiator
codon that modulates translation by eukaryotic ribosomes. Cell 1986;
44:283– 292.
Kozak M. An analysis of 50 -noncoding sequences from 699 vertebrate
messenger RNAs. Nucleic Acids Res 1987;15:8125 – 8148.
Laitinen M, Vuojolainen K, Jaatinen R, Ketola I, Aaltonen J, Lehtonen E,
Heikinheimo M, Ritvos O. A novel growth differentiation factor-9
(GDF-9) related factor is co-expressed with GDF-9 in mouse oocytes
during folliculogenesis. Mech Dev 1998;78:135– 140.
Li Q, Graff JM, O’Connor AE, Loveland KL, Matzuk MM. SMAD3 regulates
gonadal tumorigenesis. Mol Endocrinol 2007;21:2472– 2486.
Li Q, McKenzie LJ, Matzuk MM. Revisiting oocyte – somatic cell
interactions: in search of novel intrafollicular predictors and regulators
of oocyte developmental competence. Mol Hum Reprod 2008a;
14:673– 678.
Li Q, Pangas SA, Jorgez CJ, Graff JM, Weinstein M, Matzuk MM. Redundant
roles of SMAD2 and SMAD3 in ovarian granulosa cells in vivo. Mol Cell
Biol 2008b;28:7001 – 7011.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(2Delta Delta C(T)) method.
Methods 2001;25:402 – 408.
Massague J. TGF-beta signal transduction. Annu Rev Biochem 1998;
67:753– 791.
Massague J, Chen YG. Controlling TGF-beta signaling. Genes Dev 2000;
14:627– 644.
Matzuk MM, Lamb DJ. The biology of infertility: research advances and
clinical challenges. Nat Med 2008;14:1197 – 1213.
Matzuk MM, Burns KH, Viveiros MM, Eppig JJ. Intercellular communication
in the mammalian ovary: oocytes carry the conversation. Science 2002;
296:2178– 2180.
McIntosh CJ, Lun S, Lawrence S, Western AH, McNatty KP, Juengel JL.
The proregion of mouse BMP15 regulates the cooperative
interactions of BMP15 and GDF9. Biol Reprod 2008;79:889 – 896.
McNatty KP, Juengel JL, Reader KL, Lun S, Myllymaa S, Lawrence SB,
Western A, Meerasahib MF, Mottershead DG, Groome NP et al.
Bone morphogenetic protein 15 and growth differentiation factor 9
co-operate to regulate granulosa cell function. Reproduction 2005;
129:473– 480.
Downloaded from http://molehr.oxfordjournals.org/ at Pennsylvania State University on February 27, 2014
This study was supported by National Institutes of Health Grants
HD33438 and HD32067 (to M.M.M.). M.A.E. was supported by a
scholarship from Baylor Research Advocates for Student Scientists
and training grants T32GM07730 and T32HD07165.
787
788
Su YQ, Wu X, O’Brien MJ, Pendola FL, Denegre JN, Matzuk MM, Eppig JJ.
Synergistic roles of BMP15 and GDF9 in the development and
function of the oocyte – cumulus cell complex in mice: genetic
evidence for an oocyte – granulosa cell regulatory loop. Dev Biol 2004;
276:64– 73.
Su YQ, Sugiura k, Wigglesworth k, O’Brien MJ, Affourtit JP, Pangas SA,
Matzuk MM, Eppig JJ. Oocyte regulation of metabolic cooperativity
between mouse cumulus cells and oocytes: BMP15 and GDF9 control
cholesterol biosynthesis in cumulus cells. Development 2008;
135:111– 121.
Sugiura K, Su Y-Q, Diaz FJ, Pangas SA, Sharma S, Wigglesworth K,
O’Brien MJ, Matzuk MM, Shimasaki S, Eppig JJ. Oocyte-derived
BMP15 and FGFs cooperate to promote glycolysis in cumulus cells.
Development 2007;134:2593 – 2603.
Sun PD, Davies DR. The cystine-knot growth-factor superfamily. Annu Rev
Biophys Biomol Struct 1995;24:269 – 292.
Vitt UA, Hsu SY, Hsueh AJW. Evolution and classification of cystine
Knot-containing hormones and related extracellular signaling
molecules. Mol Endocrinol 2001;15:681 – 694.
Wise RJ, Dorner AJ, Krane M, Pittman DD, Kaufman RJ. The role of von
Willebrand factor multimers and propeptide cleavage in binding and
stabilization of factor VIII. J Biol Chem 1991;266:21948– 21955.
Wu X, Matzuk MM. GDF-9 and BMP-15: oocyte organizers. Rev Endocr
Metab Disord 2002;3:27 – 32.
Yan C, Wang P, DeMayo J, DeMayo FJ, Elvin JA, Carino C, Prasad SV,
Skinner SS, Dunbar BS, Dube JL et al. Synergistic roles of bone
morphogenetic protein 15 and growth differentiation factor 9 in
ovarian function. Mol Endocrinol 2001;15:854– 866.
Yeo CX, Gilchrist RB, Thompson JG, Lane M. Exogenous growth
differentiation factor 9 in oocyte maturation media enhances
subsequent embryo development and fetal viability in mice. Hum
Reprod 2008;23:67 – 73.
Submitted on March 29, 2009; resubmitted on July 22, 2009; accepted on July 29,
2009
Downloaded from http://molehr.oxfordjournals.org/ at Pennsylvania State University on February 27, 2014
McPherron AC, Lee SJ. GDF-3 and GDF-9: two new members of the
transforming growth factor-beta superfamily containing a novel pattern
of cysteines. J Biol Chem 1993;268:3444 –3449.
Moore RK, Erickson GF, Shimasaki S. Are BMP-15 and GDF-9 primary
determinants of ovulation quota in mammals? Trends Endocrinol Metab
2004;15:356 – 361.
Moore RK, Otsuka F, Shimasaki S. Molecular basis of bone morphogenetic
protein-15 signaling in granulosa cells. J Biol Chem 2003;278:304 – 310.
Mottershead DG, Pulkki MM, Muggalla P, Pasternack A, Tolonen M,
Myllymaa S, Korchynskyi O, Nishi Y, Yanase T, Lun S et al.
Characterization of recombinant human growth differentiation factor-9
signaling in ovarian granulosa cells. Mol Cell Endocrinol 2008;283:
58 – 67.
Otsuka F, Shimasaki S. A negative feedback system between oocyte bone
morphogenetic protein 15 and granulosa cell kit ligand: its role in
regulating granulosa cell mitosis. Proc Natl Acad Sci USA 2002;
99:8060 – 8065.
Otsuka F, Yao Z, Lee T-h, Yamamoto S, Erickson GF, Shimasaki S. Bone
morphogenetic protein-15. Identification of target cells and biological
functions. J Biol Chem 2000;275:39523 –39528.
Otsuka F, Yamamoto S, Erickson GF, Shimasaki S. Bone morphogenetic
protein-15 inhibits follicle-stimulating hormone (FSH) action by
suppressing FSH receptor expression. J Biol Chem 2001;276:11387–11392.
Pangas SA, Jorgez CJ, Matzuk MM. Growth differentiation factor 9
regulates expression of the bone morphogenetic protein antagonist
gremlin. J Biol Chem 2004;279:32281 – 32286.
Pangas SA, Li X, Robertson EJ, Matzuk MM. Premature luteinization and
cumulus cell defects in ovarian-specific Smad4 knockout mice. Mol
Endocrinol 2006;20:1406 – 1422.
Saito S, Yano K, Sharma S, McMahon HE, Shimasaki S. Characterization of
the post-translational modification of recombinant human BMP-15
mature protein. Protein Sci 2008;17:362 – 370.
Shimasaki S, Moore RK, Otsuka F, Erickson GF. The bone morphogenetic
protein system in mammalian reproduction. Endocr Rev 2004;25:72–101.
Li et al.