Journal of Neurochemistry, 2007
doi:10.1111/j.1471-4159.2007.04605.x
NeuroD1: developmental expression and regulated genes in the
rodent pineal gland
Estela M. Muñoz,*,1,2 Michael J. Bailey,*,1,3 Martin F. Rath,*, Qiong Shi,* Fabrice Morin,*,4
Steven L. Coon,* Morten Møller and David C. Klein*
*Section on Neuroendocrinology, Office of the Scientific Director, National Institute of Child Health and Human Development,
National Institutes of Health, Bethesda, Maryland, USA
Department of Neuroscience and Pharmacology, University of Copenhagen, Panum Institute, Blegdamsvej, Copenhagen N,
Denmark
Abstract
NeuroD1/BETA2, a member of the bHLH transcription factor
family, is known to influence the fate of specific neuronal,
endocrine and retinal cells. We report here that NeuroD1
mRNA is highly abundant in the developing and adult rat
pineal gland. Pineal expression begins in the 17-day embryo
at which time it is also detectable in other brain regions.
Expression in the pineal gland increases during the embryonic
period and is maintained thereafter at levels equivalent to
those found in the cerebellum and retina. In contrast, NeuroD1
mRNA decreases markedly in non-cerebellar brain regions
during development. Pineal NeuroD1 levels are similar during
the day and night, and do not appear to be influenced by
sympathetic neural input. Gene expression analysis of the
The pinealocyte is a conserved component of the vertebrate
circadian timing system that functions by converting daily
information into a corresponding rhythm in the production of
the hormone melatonin (Coon et al. 1995; Roseboom and
Klein 1995; Roseboom et al. 1996; Ganguly et al. 2002).
Mammalian retinal photoreceptors also have the capacity to
synthesize melatonin, albeit to a significantly lower and more
variable degree, consistent with a local role (Iuvone et al.
2005).
Melatonin synthesis is one of many features which
indicate that the pineal gland and retina evolved from a
common chordate photodetector (Klein 2004). First, pinealocytes of many non-mammalian vertebrates are photosensitive and express pineal-specific forms of opsins (Collin
1971; Okano et al. 1994; Max et al. 1995; Mano et al.
1999). Secondly, photoreceptor features are evident during
early ontogenetic developmental stages in certain mammalian species (Zimmerman and Tso 1965; Møller 1986).
Thirdly, developing mammalian pinealocytes have the
pineal glands from neonatal NeuroD1 knockout mice identifies
127 transcripts that are down-regulated (>twofold, p < 0.05)
and 16 that are up-regulated (>twofold, p < 0.05). According
to quantitative RT-PCR, the most dramatically down-regulated
gene is kinesin family member 5C (100-fold) and the most
dramatically up-regulated gene is glutamic acid decarboxylase
1 (fourfold). Other impacted transcripts encode proteins involved in differentiation, development, signal transduction and
trafficking. These findings represent the first step toward elucidating the role of NeuroD1 in the rodent pinealocyte.
Keywords: BETA2, development, microarray, NeuroD1,
pineal gland.
J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
Received January 31, 2007; revised manuscript received February 22,
2007; accepted February 23, 2007.
Address correspondence and reprint request to David C. Klein, NIH
49/6A82, Bethesda, MD 20892-4480, USA.
E-mail: [email protected]
1
Both authors contributed equally to this manuscript.
2
The present address of Estela M. Muñoz is the Institute of Histology
and Embryology, School of Medicine, National University of Cuyo,
National Council of Research, Science and Technology (CONICET),
Mendoza, Argentina.
3
The present address of Michael J. Bailey is the Department of Poultry
Science, Texas A & M University, College Station, TX 77843-2472,
USA.
4
The present address of Fabrice Morin is the INSERM, Laboratory of
Cellular and Molecular Neuroendocrinology, European Institute for
Peptide Research, University of Rouen, Mont-Saint-Aignan, France.
Abbreviations used: BETA2, b-cell E-box transactivator 2; bHLH,
basic helix-loop-helix; CaMKII, calcium/calmodulin-dependent protein
kinase II; GABA, gamma-aminobutyric acid; Id, inhibitor of differentiation/DNA binding-1; KO, knockout; LD, light:dark; NE, norepinephrine; NeuroD1, neurogenic differentiation factor 1; SSC, sodium
chloride/sodium citrate buffer; WT, wild-type; ZT, zeitgeber time.
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
2 E. M. Muñoz et al.
potential of photoreceptor differentiation (Araki et al. 1988,
1993; Tosini et al. 2000; Araki 2001). Fourthly, a sensory
nerve homologous to the pineal tract in lower vertebrates
connects the pineal gland with the rostral mesencephalon
(Møller 1978, 1979). Finally, genetic evidence of a common
origin is provided by expression in both tissues of a set of
signal transduction proteins associated with phototransduction. These include S-antigen, interphotoreceptor retinoidbinding protein, phosducin/MEKA, recoverin and transducin
beta (Donoso et al. 1985; Korf et al. 1985, 1992; Rodrigues
et al. 1986; Reig et al. 1990; Schaad et al. 1991; Babila
et al. 1992).
Expression of members of the phototransduction/melatonin synthesis set of genes in the pinealocyte and retinal
photoreceptor appears to be explained by a common
mechanism involving orthodenticle homeobox (Otx) family-related and cone-rod homeobox (Crx) transcription
factors, which bind to photoreceptor conserved elements in
the regulatory regions of these genes (Chen et al. 1997;
Furukawa et al. 1999; Bernard et al. 2001; Gamse et al.
2002; Nishida et al. 2003; Appelbaum et al. 2004, 2005;
Rath et al. 2006). Basic helix-loop-helix (bHLH) transcription factors, including the neurogenic differentiation factor 1
(NeuroD1 also referred to as BETA2) (Lee et al. 1995; Naya
et al. 1995), have been identified as key regulators of retinal/
pineal development and function (Morrow et al. 1999; Cau
and Wilson 2003; Pennesi et al. 2003; Akagi et al. 2004;
Cho and Tsai 2004; Hyung Chae et al. 2004; Ochocinska
and Hitchcock 2007). The presence of NeuroD1 in the pineal
gland, first reported in studies on zebrafish pineal gland (Cau
and Wilson 2003), has been recently supported by preliminary microarray studies on the rat pineal gland (Coon SL,
Carter D, Baler R, Klein DC, unpublished).
As a basic helix-loop-helix protein, NeuroD1 interacts
with ubiquitously expressed E-proteins, such as E12/E47,
regulating gene expression via binding to a consensus E-boxlike element. The NeuroD1/E-protein binding site elements
reside within the regulatory region of genes expressed in a
tissue-specific manner, including insulin, secretin and proopiomelanocortin (Naya et al. 1995; Mutoh et al. 1997;
Poulin et al. 1997).
In the context of circadian clock function, the link between
NeuroD1 and E-box-mediated gene expression is of special
interest because E-boxes play a crucial role in circadian
regulation of gene expression and have the potential of
influencing gene expression in the pineal gland (Hastings
2000; Muñoz et al. 2002; Muñoz and Baler 2003; Okamura
2004; Simonneaux et al. 2004). Additionally, a role for the
NeuroD1 gene is also indicated by the finding that the
negative regulatory helix-loop-helix (HLH) Id proteins,
which act by disrupting the NeuroD1/E-protein-E-box complex in other tissues (Benezra et al. 1990; Ghil et al. 2002),
are also expressed in the pineal gland (Humphries et al.
2002).
Results of the study presented indicate that NeuroD1 is
expressed in the rodent pineal gland starting late in fetal
development and that it selectively influences the expression
of specific genes in this tissue.
Materials and methods
Animals
Sprague–Dawley rats were obtained from Taconic Farms (Germantown, NY, USA) and Charles River Laboratories (Sulzfeld,
Germany) and housed for at least 2 weeks in LD 14 : 10 lighting
cycles (lights on at 7 A.M.), with water and food ad libitum.
Surgical removal of the superior cervical ganglia (SCGX) was
performed by Taconic Farms. Control animals underwent sham
surgery. Animals were killed by decapitation after CO2 asphyxiation. Day tissues, including pineal gland, retina, cerebellum and
cortex, were collected 7 h after the lights were turned on
[zeitgeber time (ZT) 7], while night tissues were obtained at the
middle of the night period (ZT19) under dim red light.
For northern blot analysis of pineal NeuroD1 mRNA during
development, pineal glands were removed during daytime from rats
at the indicated ages, placed on dry ice and stored at )80C until
used. Pools of pineal glands were prepared (E18–E21, 20 glands;
P3–P19, 10 glands; adults, three or four glands per pool); three pools
were analyzed per developmental stage and time point. Two
different pools of three or four pineal glands from SCGX and
control animals killed in the middle of day and night periods were
also assayed.
For developmental in situ hybridization studies, two or three
intact brains with the pineal gland were collected during daytime
from rats at the indicated ages. For in situ hybridization studies on
adults, animals were killed at ZT7 and ZT19 and the brains were
removed immediately (five per time point).
For microarray analysis and quantitative real-time PCR studies
(qRT-PCR), a colony of mice was established using a male
NeuroD)/+ mouse provided by Ming-Jer Tsai (Baylor University,
Houston, TX, USA) (Naya et al. 1997; Liu et al. 2000). This
animal was bred with a 129/Sv female (Taconic Farms) and the
heterozygotes resulting from this mating were used to generate a
colony. Most offspring died within a few days of birth (Naya et al.
1997); this high rate of death in the 129/Sv background contrasts
with a report of a higher survival rate in the same background (Liu
et al. 2000). On post-natal day 0 (P0), pineal glands from wildtype (+/+) and NeuroD1 knockout (–/–) mice were removed during
the daytime and placed on solid CO2; differences in pineal size
were not observed among genotypes. In addition, samples of tail
tissue were obtained for genotyping confirmation. Total RNA was
isolated from pools of three pineal glands; three pools per
genotype were analyzed. For the in situ studies presented in Fig. 7;
three intact brains with the pineal gland per genotype were also
collected; heterozygote (+/–) animals were only included in this
study.
All animal experiments were done in accordance with the
guidelines of EU Directive 86/609/EEC (approved by the Danish
Council for Animal Experiments) and the National Institutes of
Health Guide for Care and Use of Laboratory Animals.
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
NeuroD1 in the pineal gland 3
Northern blot analysis
Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad,
CA, USA) and resolved on a 1.5% agarose/formaldehyde gel (5–
8 lg/lane). Overnight passive capillary transfer was performed to
transfer RNA onto a charged nylon membrane (Nytran, Schleicher
and Schuell, Dassell, Germany). The resolved RNA was crosslinked using ultraviolet light. The 28S and 18S bands were used as
loading control.
A 422 bp probe targeting the 3¢-end of the rat NeuroD1 open
reading frame (nucleotides 740-1161, GenBank accession number
NM_019218) was generated by PCR using the Pfu Turbo DNA
Polymerase and cloned into a pCR-Blunt II-TOPO vector
(Invitrogen). Probe identity was confirmed by sequencing. The
arylalkylamine N-acetyltransferase (Aanat) probe was previously
described (Roseboom et al. 1996). Hybridization of RNA was
performed using 32P-labeled probes in QuikHyb buffer (Stratagene,
La Jolla, CA, USA) for 2 h at 68C. Probes were labeled by random
priming using a DNA labeling kit (Amersham Biosciences,
Piscataway, NJ, USA). Approximately 1 · 106 dpm/mL hybridization buffer and 100 lg/mL final concentration of sheared salmon
sperm DNA were used. Hybridization was followed by two washes
with 2 · SSC (300 mmol/L NaCl, 30 mmol/L sodium citrate, pH
7.0)/0.1% sodium dodecyl sulfate at 25C for 15 min and a final
wash with 0.1 · SSC/0.1% sodium dodecyl sulfate at 60C for
30 min.
Blots were analyzed using a PhosphorImager and ImageQuant
software (Molecular Dynamics, Sunnyvale, CA, USA). Signal
intensity from at least three independent blots was measured. For the
developmental study, the percent of maximum value was calculated
using the highest intensity from each blot as 100%.
In situ hybridization of brain sections
The brains of adult rats were removed and frozen in crushed solid
CO2. Fetal rat brains and brains of NeuroD1 KO mice were fixed by
immersion in cold 4% paraformaldehyde in 0.05 mol/L phosphate
buffer for 2 days. This was followed by cryosubstitution in 25%
sucrose overnight and freezing of the brains. Sagittal cryostat
sections of the brains, 14 lm (rat developmental series and
NeuroD1 KO mice) or 12 lm (adult rats) in thickness, were used
for in situ hybridization as previously described (Møller et al.
1997).
Two 35S-labeled antisense probes were used to identify rat
NeuroD1 mRNA (GenBank accession number NM_019218),
5¢-CAAATTGGTAGTGGGCTGGGACAAACCTTTGCAGAGTG-3¢
(nucleotides 636-599) and 5¢-CGGGAATGGTGAAACTGACGTGCCTCTAATCGTGAAAG-3¢ (nucleotides 1186-1149). The levels
of mouse tryptophan hydroxylase (NM_009414) transcripts were
characterized using two specific antisense DNA probes, 5¢-TCTGCAAAATACTTTCGTCTTCTACGATAGACATTGTC-3¢ (nucleotides 891-854) and 5¢-CATTTTCAGAGAGAGTGAGTGATTGAATATGGAGA-3¢ (nucleotides 1937–1903). Mouse S-antigen
(NM_009118) transcripts were identified with the following
antisense probe: 5¢-CTATCTGTTCCACTGATACTTTAATCTTCTT-3¢ (nucleotides 1108–1078). The probes were suspended in
sterile diethylpyrocarbonate-water to a concentration of 5 pmol/lL.
Five microliters of the probe solution was then labeled with [35S]dATP to a specific activity of 1 · 1018 dpm/mol by using terminal
transferase (Roche Diagnostics, Penzberg, Germany).
Frozen sections were fixed after thawing for 5 min in 4%
paraformaldehyde in phosphate-buffered saline, washed twice in
phosphate-buffered saline and acetylated for 10 min in 0.25% acetic
anhydride in 0.9% NaCl containing 0.1 mol/L triethanolamine.
Sections were then dehydrated in ethanol, delipidated in chloroform,
rehydrated partially and allowed to dry. For hybridization of the
cryostat sections, the labeled probe was diluted in hybridization
buffer (10 lL labeled probe/mL hybridization buffer) consisting of
50% (v/v) formamide, 4 · SSC, 1 · Denhardt solution (0.02%
bovine serum albumin, 0.02% polyvinylpyrrolidone, 0.02% Ficoll),
10% (w/v) dextran sulfate, 10 mmol/L dithiothreitol, 0.5 mg/mL
salmon sperm DNA and 0.5 mg/mL yeast tRNA. An aliquot of
200 lL of labeled probe diluted in hybridization buffer was pipetted
onto each section. The sections were then covered with Parafilm
and incubated in a humid chamber overnight at 37C. Slides were
washed in 1 · SSC at 55C and then 25C, and finally rinsed in
distilled water.
Sections were exposed to an X-ray film for 1–2 weeks. The X-ray
film was developed by using a commercial developing machine. Both
NeuroD1 probes detailed above yielded similar images on sections of
adult rat brain; for the developmental study only the NeuroD1 probe
corresponding to nucleotides 1186–1149 was used. Similar images
were also obtained with both probes for detection of tryptophan
hydroxylase detailed above in the NeuroD1 KO mice. The X-ray
images were digitized and quantitated (Image 1.42 software, Wayne
Rasband, NIH). Optical densities were converted to dpm/mg tissue by
using simultaneously exposed 14C-standards calibrated by comparison with 35S-brain-paste standards. The NeuroD1 signal in the pineal
gland, and cerebellar external and internal granular layers, EGL and
IGL, respectively, was quantitated on 2–6 sections per brain from two
to three animals at the indicated ages. The habenular area was not
present in all images because it was out of the plane of section; the
signal was quantitated on 2–6 brain sections from one to three
animals. Data are presented as the mean ± SD.
Microarray hybridization
Total mouse pineal RNA was isolated using a RiboPure total RNA
isolation kit (Ambion, Austin, TX, USA). The amount and quality of
RNA were assessed using a BioRad spectrophotometer (BioRad,
Hercules, CA, USA) and an Agilent 2100 Bioanalyzer (Agilent
Technologies, Palo Alto, CA, USA). Total RNA (1 lg) was subjected
to a single round of amplification using a MessageAmp II aRNA
Amplification Kit (Ambion) according to the manufacturer’s instructions. Briefly, total RNA was reverse transcribed with reverse
transcriptase and an Oligo(dT) primer containing a T7 RNA
polymerase promoter. Single-stranded cDNA was converted into
double stranded (ds) cDNA and purified. cRNA was generated from
the ds cDNA by in vitro transcription. Purified cRNA (4 lg) was used
as starting material for the GeneChip One-Cycle Target Labeling kit
(Affymetrix, Santa Clara, CA, USA) to produce biotinylated cDNA.
The cDNA, 20 lg, was then fragmented and hybridized to the
GeneChip Mouse Genome Array 430 2.0 (Affymetrix) containing
over 39 000 probe sets, for 18 h at 45C. The arrays were stained and
washed using the appropriate Affymetrix protocols.
Analysis of microarray data
Affymetrix arrays were scanned using a GeneChip Scanner 3000
(Affymetrix). For each array, the raw signal intensity (.CEL) files
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
4 E. M. Muñoz et al.
were generated and analyzed with ArrayAssist software (Stratagene)
using Robust Multi-Array analysis with GC content normalization
(GC RMA). Statistical comparisons between the wild-type (+/+,
n = 3) and NeuroD1 knockout (–/–, n = 3) groups were made using
a Student’s t-test. Further analysis of the most dramatically affected
genes (p < 0.05) was done by qRT-PCR. The microarray data are
available at the Gene Expression Omnibus (www.ncbi.nlm.nih.gov/
projects/geo/), Series #GSE6030.
Quantitative real-time PCR
Total RNA was isolated using a RiboPure RNA isolation kit. The
amount and quality of RNA were assessed using a BioRad
spectrophotometer and an Agilent 2100 Bioanalyzer. Total RNA
was then subjected to deoxyribonuclease (DNase) treatment using
TURBO DNA-free (Ambion) to remove contaminating genomic
DNA. cDNA production was carried out using the Superscript II
protocol (Invitrogen) and 1 lg of DNase-treated total RNA as
starting material.
Real-time PCR experiments were performed using the LightCycler 2.0 rapid thermal cycler system (Roche). PCR reactions were
carried out in a 25 lL volume consisting of 0.5 lmol/L primers
(Table 1), the reaction mixture provided in the RT2 Real-Time
SYBR Green master mix (SuperArray Bioscience, Frederick, MD,
USA) and cDNA as per the manufacturer’s instructions. Assays
included an initial denaturation step at 95C for 10 min, followed by
40 cycles of denaturation at 95C for 15 s, annealing at 63C for
30 s, then extension at 72C for 30 s. Product specificity was
confirmed in initial PCR experiments by agarose gel electrophoresis
of the amplified products and thereafter, during every qRT-PCR run,
by melting curve analysis (Tm).
Quantitation was performed using internal standards of known
copy numbers specific for each target gene. Standards were prepared
by cloning the target PCR products into pGEM-T Easy vector
(Promega, Madison, WI, USA). Clones were confirmed by
sequencing and also by plasmid DNA digestion with EcoRI
followed by 2.0% agarose gel electrophoresis for visualization of
the correct product sizes. Serial 100-fold dilutions of each PCR
target (101–107 copies/lL) were prepared and used to generate
standard curves for quantitation during each run. Gene expression
was determined using a 2-lL sample of a 10-fold dilution of pineal
Table 1
cDNA from either wild-type or NeuroD1 knockout animals for each
reaction. A Student’s t-test was used to determine statistical
significance.
Results
NeuroD1 mRNA is expressed in the developing and adult
rat pineal gland
Northern blot analysis using total RNA isolated from pineal
pools collected from E18 to adulthood revealed the presence
of two NeuroD1 transcripts (2.2 and 3.6 kb) in the pineal
gland beginning at E18 (Fig. 1). NeuroD1 mRNA expression
increases progressively during pineal development and
remains high in the adult. A relatively weaker third transcript
(1.6 kb) is present in samples in which total NeuroD1
mRNA is abundant. At all stages, the 2.2 kb transcript is
the most prominent.
The developmental pattern of pineal NeuroD1 mRNA
revealed by in situ hybridization was in agreement with the
above results. The in situ approach also provided additional
information, both on NeuroD1 expression in the embryonic
pineal gland at stages at which dissection is not possible, and
also on expression in the brain early in embryogenesis
(Figs 2a, 2b, 3). At E16, NeuroD1 mRNA is not present in
the pineal anlagen, seen as an evagination of the roof of the
diencephalon (Quay 1974). In contrast, at this time NeuroD1
expression is prominent in the neocortical neuroepithelium,
the thalamus, the tectum of the mesencephalon and in the
floor of the rhomboid fossa. At E17, pineal NeuroD1 mRNA
is weakly detectable while at E18, expression is prominent.
During the E18 to E21 period, pineal NeuroD1 mRNA levels
increase; in contrast, during this time NeuroD1 mRNA levels
decrease in the neocortical neuroepithelium and tectum.
Thalamic expression, on the other hand, remains limited to
the habenular area. From E18 to E21, NeuroD1 mRNA also
becomes evident in cerebellum and hippocampus as previ-
Primers for quantitative real-time PCR analysis
Target
Sense-primer
Antisense-Primer
Size (bp)
Accession number
Beta actin
Neurogenic differentiation 1, Nd1
Engrailed 2, En2
S-antigen, Sag
Tryptophan hydroxylase 1, Tph1
Hydroxyindole O-methyltransferase, Hiomt
Kinesin family member 5C, Kif5c
Glutamic acid decarboxylase 1, Gad1
Arylalkylamine N-acetyltransferase, Aanat
Paired box gene 6, Pax6
EST-1459253, unknown
Rho family GTPase 3, Rnd3
aaggccaaccgtgaaaagat
cgcagaaggcaaggtgtc
gaccggccttcttcaggt
gggaagatcaagcatgaggac
cacagttcagatcccctctaca
tctcgcctttcagggtcat
gccagggaggacctcaag
tgggatttgaaaaccagatca
tgcagtcaggagtctcagctt
gttccctgtcctgtggactc
gtacatcctagggagacgttaattg
cagcacattagtggaactctcaa
gtggtacgaccagaggcatac
tttggtcatgtttccacttcc
tggtctgaaactcagccttg
tcgatgccctccttgatg
gaacgtggcctaggagttca
gtctcgaacacggtgacctc
gcaggttatgaagggtctgg
tcttggcgtagaggtaatcagc
aagtgctccctgagcaacag
accgcccttggttaaagtct
ttggcttcgccttcatattt
tctgcttggccatatttgc
110
90
127
62
64
103
67
60
102
61
61
77
M12481
NM_010894
NM_010134
NM_009118
NM_009414
XM_909110
NM_008449
NM_008077
NM_009591
BC011272
N/A
NM_028810
Primers sequences are given from 5¢ to 3¢. N/A: not available.
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
NeuroD1 in the pineal gland 5
E18 E19
E20 E21
P3
P12 P19
P6
P30
P60
~3.6 kb
~2.2 kb
~1.6 kb
~5 kb
18S
~2 kb
120
100
Signal Intensity
(% of Maximum)
Fig. 1 NeuroD1 mRNA levels in the
developing and adult rat pineal gland. Northern blot analysis reveals that the NeuroD1
gene is differentially expressed throughout
the development of the pineal gland (upper
image). 28S/18S: ribosomal RNA bands
(middle image). After hybridization with a
specific 32P-labeled NeuroD1 probe, three
blots from three different pineal pools
collected at the indicated developmental
stages were analyzed using a PhosphorImager and ImageQuant software. The percent of maximum value was calculated
using the highest intensity from each blot
as 100%. Data in the graph are the
mean ± SD from three independent blots.
28S
80
60
40
20
0
E18
E19
E20
E21
E, embryonic ages
ously reported (Cho and Tsai 2004; Hyung Chae et al. 2004).
In post-natal ages (P2–P30), NeuroD1 mRNA is abundant in
the pineal gland, cerebellum and hippocampus (both cornu
ammonis and the dentate gyrus); habenular expression is
confined to the medial habenular area.
The spatial distribution of NeuroD1 mRNA in the
cerebellum accompanies the cerebellar development
(Figs. 2a, 2b and 3). A stronger NeuroD1 signal is observed
in the external granular layer of the cerebellum from E19 to
P6. At this time, a less intense signal is seen in the
developing internal granular layer. From P12 to P18,
NeuroD1 mRNA is higher in the internal granular layer
consistent with neuronal migration from the external granular
layer; at P30, the cerebellar NeuroD1 is confined to the
internal granular layer, while expression in the external
granular layer has disappeared.
Examination of the in situ hybridization labeling pattern of
the pineal gland revealed that NeuroD1 mRNA is uniformly
distributed, consistent with expression in the pinealocyte,
which comprises over 90% of the cells in the rodent gland.
Pineal NeuroD1 mRNA levels do not exhibit a night/day
difference and are not influenced by the sympathetic
neural input
Many highly expressed transcripts in the pineal gland exhibit
marked day/night differences. Here we examined whether
this was also true for NeuroD1. We found that NeuroD1
mRNA is present at equivalent levels during the day and
P3
P6
P12
P19
P30
P60
P, postnatal ages
night in the pineal gland, retina and cerebellum (Figs. 4, 5).
The 2.2 kb NeuroD1 transcript is dominant in the adult
cerebellum and retina, as in the pineal gland (Fig. 5). The
minor 3.6 and 1.6 kb transcripts are also present in the
cerebellum and retina. NeuroD1 transcripts are not detectable
in the adult cortex by the northern blot or in situ hybridization methods used here.
The daily rhythms in melatonin synthesis and other
elements of pineal function are regulated by neural stimulation via post-ganglionic projections from the SCG. In some
cases, neuronal stimulation generates day/night changes and
in other cases, effects are seen following a week after
stimulus deprivation (Klein et al. 1981; Sugden and Klein
1983). To determine whether neural input controls NeuroD1
mRNA levels, we examined pineal glands from animals in
which neural stimulation was interrupted by SCGX. This
procedure does not appear to influence NeuroD1 mRNA
levels (Fig. 6).
NeuroD1-controlled gene regulation
The role of NeuroD1 in the pineal gland was assessed by
Affymetrix microarray analysis of P0 wild-type (WT) and
NeuroD1 knockout (KO) mouse pineal glands. Comparison
of the WT and NeuroD1 KO datasets revealed that of the
39 000 transcripts present on the array, 143 are influenced
by NeuroD1. Of these, 127 were suppressed in the KO
animals by a ‡ twofold, statistically significant change
(p < 0.05) (Supplementary Table 1). In addition, the abun-
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
6 E. M. Muñoz et al.
(a)
(b)
Fig. 2 NeuroD1 expression in the developing and adult rat brain. Left
column: X-Ray images from sagittal sections of rat brains collected
during embryonic ages E16–E21 (a) and post-natal ages P2–P30 (b)
reveal the pattern of NeuroD1 expression throughout brain development. Right column: counter-stained sections corresponding to the Xray images. Two to three brains were sectioned at the indicated
developmental stages. Images shown here are representative of 2–6
serial sagittal sections obtained per brain. For further details see the
Materials and methods section. Aq, cerebral aqueduct; Ce, cerebellum; 3V, third ventricle; 4V, fourth ventricle; Ha, habenular area; Hi,
hippocampus; Na, nasal mucosa; NC, neocortex; Pi, pineal gland; SC,
superior colliculus; Te, mesencephalic tectum; Th, thalamus. Scale
bar = 1 mm.
dance of 16 transcripts increased by more than twofold
(p < 0.05) (Supplementary Table 2).
Examination of the array results indicated that many of the
phototransduction/melatonin synthesis subset of genes,
which define the pineal phenotype, are expressed at P0 in
KO and WT pineal glands at similar levels. These include
phosducin, phosphodiesterase 6, S-antigen, GTP cyclohydrolase, aromatic amino acid decarboxylase, paired box
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
NeuroD1 in the pineal gland 7
(100-fold vs. sixfold), which may reflect technical
differences. A statistically significant small decrease in
Aanat mRNA levels was observed using qRT-PCR (Table 2);
differences in Sag and Tph1 mRNA levels were not detected
by in situ analysis or by qRT-PCR (Fig. 7, Table 2).
Discussion
Fig. 3 Densitometric quantitation of NeuroD1 expression in the
developing and adult rat pineal gland. The X-ray images of in situ
hybridization analysis throughout pineal development were digitized
and quantitated. Data are presented as the mean ± SD from two to six
brain sections per brain from two to three animals at the indicated
ages. NeuroD1 mRNA levels in both the external and internal granular
layers of the cerebellum, EGL and IGL, respectively, were also
quantitated on these sections and shown here. In the habenular area,
which due to its size was not present in all images, the signal was
quantified on two to six sections per brain from one to three animals.
For further details see the Materials and methods section.
gene 6 (Pax 6), Crx and the b1-adrenergic receptor. Other
members of this subset were either not represented on the
microarray chip or not expressed at this age. As indicated
above, studies on older animals were not possible because
nearly all NeuroD1–/– mice generated in these studies died
within the first 2 days of birth.
Subsequent qRT-PCR analysis was done on the two most
dramatically regulated transcripts and also on representatives
of the phototransduction /melatonin synthesis gene subset (Santigen, Sag; tryptophan hydroxylase, Tph1; arylalkylamine
N-acetyltransferase, Aanat; hydroxyindole O-methyltransferase, Hiomt). This confirmed results of gene profiling
(Table 2) regarding expression of kinesin family member 5C
(Kif5c) and glutamic acid decarboxylase 1 (Gad1). The
difference in Kif5c mRNA based on qRT-PCR was larger
The results reported here reveal that NeuroD1 is expressed in
the embryonic and adult rodent pineal gland with levels
equivalent to or greater than those found in the retina and
cerebellum. Based on the uniform dense distribution revealed
by the in situ hybridization studies, it is highly probable that
NeuroD1 mRNA is expressed in the dominant cell of the
pineal gland, the pinealocyte. NeuroD1 expression in interstitial cells, perivascular macrophages and blood vessels,
however, can not be ruled out. In zebrafish, pineal cell
populations can be defined according to their requirements
for specific combinations of bHLH proteins, including
NeuroD1 (Cau and Wilson 2003).
In the rat pineal gland, NeuroD1 mRNA was not detected
at the very earliest time examined (E16); rather expression
begins to increase at E17, approximately 2 days after the
evagination of the roof of the diencephalon and at least 1 day
after the appearance of Otx2 in the gland (Rath et al. 2006).
The increase observed from E17 to E21 suggests that
NeuroD1 is expressed in dividing cells, because it is
abundant at a time when pinealocytes are proliferating (Quay
1974; Calvo et al. 2004). In fact, bromodeoxyuridine
incorporation studies at the developing rat pineal gland level
revealed that 60% of the pineal cells underwent the last
division(s) between E18 and E21, while the rest of the pineal
cells originated after birth, particularly in the first five postnatal days (Calvo et al. 2004). This is also consistent with
reports that NeuroD1 mRNA occurs in proliferating cells in
other brain areas, including the hippocampus and cerebellum
(Lee et al. 2000; Liu et al. 2000). Our in situ hybridization
studies are in agreement because NeuroD1 expression in
these brain areas was observed to increase during the late
embryonic phases and first post-natal ages, when mitotic rate
peaks (Lee et al. 2000). NeuroD1 expression in mitotically
active cells was also reported during retinogenesis in
zebrafish; these dividing cells might give rise to specific cell
lineages within the zebrafish retina such as rod and cone
photoreceptors (Ochocinska and Hitchcock 2007). NeuroD1
appears, therefore, to link cell cycle regulation, cell fate
specification and cell survival.
The finding that NeuroD1 mRNA is present in the pineal
gland during the post-natal and adult periods contrasts with
the decrease in NeuroD1 in non-cerebellar brain areas,
including the neocortical neuroepithelium and tectum. The
precise function of NeuroD1 during the early post-natal
period does not appear to be a requirement for the expression
of many phototransduction/melatonin synthesis-related genes
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
8 E. M. Muñoz et al.
DAY
Ce
NIGHT
Ce
Pi
Pi
Hi
Ha
Ha
Fig. 4 NeuroD1 mRNA in the daytime and nighttime adult rat brain.
X-Ray images of sagittal sections of adult rat brains show a strong
NeuroD1 signal in pineal gland (Pi) and cerebellum (Ce). Night/day
differences are not evident. A signal is also observed in the medial
habenular area (Ha) and the hippocampus (Hi). Five adult brains were
Pineal
D
N
Cortex
D
N
Cerebellum
D
N
Retina
D
N
~3.6 kb
~2.2 kb
~1.6 kb
28S
~5 kb
18S
~2 kb
D, mid-day;
N, mid-night.
Fig. 5 NeuroD1 mRNA in adult rat tissues. Northern blot analysis
reveals that NeuroD1 transcripts are present in adult rat pineal,
cerebellum and retina. Night/day differences are not evident (upper
image). 28S/18S: ribosomal RNA bands (lower image). After hybridization with a specific 32P-labeled NeuroD1 probe, blots were analyzed
using a PhosphorImager. The blot shown here is representative of
three independent northern blots.
that define pineal phenotype because their expression is not
suppressed in the pineal gland of P0 NeuroD1 KO mice. The
importance and functional significance of the small decrease
in Aanat mRNA that was observed are difficult to assess
because of the limited sample size, which did not include
night adult glands, in which Aanat expression is strongly
increased; KO mice died within the first days after birth
(Naya et al. 1997).
It is possible that NeuroD1 may function to modulate
aspects of signal transduction and melatonin synthesis that
were not examined here. For example, NeuroD1 might
modulate the rhythmic production of melatonin by modulating the dynamics of rhythmic expression of Aanat through
interactions with E-boxes in the Aanat gene (Chen and Baler
2000).
sectioned per time-point. Images shown here are representative of at
least four serial sagittal sections analyzed per brain. Similar results
were obtained with both NeuroD1 probes. For further details see the
Materials and methods section. Scale bar = 1 mm.
Although our data show that pineal NeuroD1 mRNA
levels do not vary on a daily basis nor are they directly driven
by SCG-mediated neural input, post-translational regulation
of NeuroD1 protein is not unlikely, based on studies in other
systems (Khoo et al. 2003; Gaudilliere et al. 2004; Hyung
Chae et al. 2004; Dufton et al. 2005). For example, it has
been demonstrated that phosphorylation mediates specific
temporal and spatial NeuroD1-dependent responses, including dendritic morphogenesis in the cerebellar granule
neurons; the mechanism involved reflects neural control of
CaMKII-dependent phosphorylation of NeuroD1 (Gaudilliere et al. 2004). In this light, it is of interest to note that
phosphorylation of NeuroD1 protein might occur in the
pinealocytes because norepinephrine (NE) could activate
CaMKII through a1-adrenergic elevation of intracellular
Ca2+ (Sugden et al. 1987), which in turn could alter gene
expression through effects on NeuroD1. This rapid mode of
transcriptional control is known to occur in the pineal gland
in the case of cyclic AMP which regulates a set of genes by
directing phosphorylation of cyclic AMP response element
binding protein (Roseboom and Klein 1995; Roseboom et al.
1996; Baler et al. 1997, 1999; Maronde et al. 1999; Gaildrat
et al. 2005; Kim et al. 2005).
Gene profiling analysis together with qRT-PCR established that the expression of Kif5c and Gad1 genes is
strongly influenced by NeuroD1. Kinesin superfamily
proteins (KIFs) function as molecular motors in vesicular
and non-vesicular microtubule-dependent transport; their
role is, therefore, essential for morphogenesis and functioning of the cell (Miki et al. 2001). The Kif5c gene is a
neuronal type KIF with high expression in lower motor
neurons from 2-week-old or older mice, suggesting an
important role in the maintenance of motor neurons,
including axonal elongation. Kif5c KO mice exhibit a
reduction in overall brain mass and a relative loss of motor
neurons to sensory neurons; homozygote animals are,
however, viable with no gross defects (Kanai et al. 2000).
The severe reduction of Kif5c mRNA levels seen here in
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
NeuroD1 in the pineal gland 9
Table 2
Confirmation of microarray results using quantitative real-time PCR
Gene, gene symbol
mRNA level
WT
mRNA level
KO
Fold change
qRT-PCR
Fold change
array
Kinesin family member 5C, Kif5c
Neurogenic differentiation1, Nd1
EST-1459253, unknown
Engrailed 2, En2
Paired box gene 6, Pax6
Arylalkylamine N-acetyltransferase, Aanat
Hydroxyindole O-methyltransferase, Hiomt
Tryptophan hydroxylase 1,Tph1
Rho family GTPase 3, Rnd3
S-antigen, Sag
Glutamic acid decarboxylase 1, Gad1
16.00
3.49
4.52
7.31
0.52
1.80
15.04
1296.56
20.21
1855.91
4.30
0.17
0.08
0.79
2.26
0.19
0.68
6.43
702.60
15.04
1629.54
15.79
)95.95*
)42.37*
)5.73
)3.23
)2.75
)2.64*
)2.34
)1.85
)1.34
)1.14
3.67*
)6.19
)78.65
)3.88
)5.43
)1.50
)1.40
N/A
)1.60
)5.42
)1.60
4.10
mRNA levels are given as copies of specific mRNA per 1000 copies of actin. ‘Fold Change’ columns show the decrease or increase in mRNA in KO
animals relative to WT animals. Fold change values marked with an asterisk indicate statistically significant differences (p < 0.05). Primers for PCR
are given in Table 1. Fold Changes for microarray data in the last column are shown for comparison; all changes over twofold are statistically
significant. N/A, not available.
SHAM
SCGX
Day
Night
Day
Night
NeuroD1
Aanat
28S
18S
Fig. 6 NeuroD1 mRNA levels in the rat pineal gland are not influenced by neural input from the SCG. NeuroD1 mRNA levels do not
change after surgical removal of the superior cervical ganglia (SCGX)
in comparison with controls (upper image), whereas the Aanat mRNA
rhythm is abolished (middle image). Pineal total RNA was obtained
from control and SCGX rats killed at ZT7 (day) and ZT19 (night).
Each lane contains 4 lg total RNA isolated from a pool of three or four
pineal glands; two different pools per time point were analyzed from
both groups killed on the same day. After hybridization with the 32Plabeled NeuroD1 probe, the blot was stripped and re-probed for Aanat.
Blots were analyzed using a PhosphorImager. 28S/18S: ribosomal
RNA bands (lower image).
the NeuroD1 KO mouse pineal gland provides reason to
suspect that one mechanism through which NeuroD1 may
influence pineal physiology is through Kif5c-dependent
processes, perhaps by contributing to the formation of
pineal processes.
The most highly up-regulated gene in the KO was Gad1,
which encodes the enzyme that catalyzes the conversion of
glutamic acid to gamma-aminobutyric acid (GABA), the
major inhibitory neurotransmitter in the vertebrate central
nervous system (Westmoreland et al. 2001). In the pineal
gland, GABA has been claimed to serve a paracrine role as a
modulator of secretion of melatonin (Rosenstein et al. 1990;
Echigo and Moriyama 2004). The fourfold increase of
Gad1 mRNA in the pineal gland of NeuroD1 KO animals
suggests that NeuroD1 functions as a repressor of the Gad1
gene, thereby regulating GABAergic signaling. Accordingly,
NeuroD1 might indirectly modulate melatonin biosynthesis
and secretion by controlling GABA synthesis. This also
suggests a possible broader role of NeuroD1 in circadian
biology because GABA is thought to impact clock function
(Hamasaka et al. 2005; Piggins and Loudon 2005).
In view of the evidence that NeuroD1 plays a role in the
development of the retina (Morrow et al. 1999; Yan and
Wang 2000a,b; Pennesi et al. 2003; Akagi et al. 2004; Ma
et al. 2004; Ochocinska and Hitchcock 2007), it is of interest
to consider the nature of common NeuroD1-dependent
molecular mechanisms that are involved in both the retinal
photoreceptor and pinealocyte. It seems reasonable to suspect
that these mechanisms involve NeuroD1 binding to consensus NeuroD1/E-protein DNA binding elements (E-box-like).
As indicated above, NeuroD1 is of special interest as E-boxes
and bHLH transcription factors are critical elements in
circadian clock transcriptional regulation (Hastings 2000;
Muñoz et al. 2002; Muñoz and Baler 2003; Okamura 2004).
Elements of the molecular clock mechanism that bind to Eboxes are also expressed in the pineal gland and some are
induced by NE treatment (Simonneaux et al. 2004). Accordingly, it is possible that NeuroD1 and clock components
might interact in the temporal control of gene expression in
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
10 E. M. Muñoz et al.
Fig. 7 In situ analysis of the pineal gland in the NeuroD1 knockout
mouse. X-ray images of sagittal sections of P2 mouse brains show
strong and specific signals in the pineal gland (Pi) for tryptophan hydroxylase and S-antigen transcripts. Differences in the intensity of the
signals among genotypes were not detected. Three brains were sectioned per genotype. Images shown here are representative of at least
four serial sagittal sections analyzed per brain. Scale bar = 1 mm. For
further details see the Materials and methods section.
the pineal gland through competitive binding for E-boxes or
in concert with other transcription factors and their binding
sites.
The potential mechanisms regulating NeuroD1 expression
were examined in silico (Genomatix Software GmbH,
Munich, Germany) by focusing on a 3 kb 5¢-region encompassing the proposed transcriptional start site of the rat
NeuroD1 gene. This region contains two photoreceptor
conserved element sites, which bind Crx/Otx and three
E4BP4 transcription factor binding sites grouped within
close proximity of each other. Likewise, the mouse NeuroD1
gene was found to have a similar cluster (two Crx/Otx sites
and four E4BP4 binding sites). This is consistent with a role
of Crx/Otx in the expression of NeuroD1 in the pineal gland
and retina.
Bioinformatics analysis of the 3 kb 5¢-flanking regions of
mouse Gad1 and Kif5c revealed that in both genes, these
regions have a single NeuroD1/E-protein binding site.
Further studies are required to establish the involvement of
these DNA elements in gene expression regulation; other
mechanisms including compensatory effects might be also
responsible for the changes observed in our microarray
analysis. In addition, four Crx/Otx and four E4BP4 transcription factor binding sites occur in the potential regulatory
region of Kif5c. This suggests that NeuroD1 acts in concert
with Otx2 and Crx in the pineal gland to control expression
of these genes (Chen et al. 1997; Furukawa et al. 1999;
Bernard et al. 2001; Gamse et al. 2002; Nishida et al. 2003;
Appelbaum et al. 2004, 2005; Rath et al. 2006). E4BP4 is a
basic leucine zipper transcription factor implicated in multiple biological processes including circadian clock function
in the chicken pineal gland (Doi et al. 2001). The E4BP4
binding sites in Kif5c may serve to link expression of it with
E4BP4 and related bHLH factors, including those involved
in circadian clock mechanisms.
Against this background of potential regulation by
elements of the molecular clock and by NE, NeuroD1
emerges as a potential integrative link between pineal cell
fate determination, circadian function and NE-dependent
signal transduction. Similar homeobox-clock protein interactions were reported in the zebrafish pineal gland (Appelbaum et al. 2004, 2005). The potential role of NeuroD1 in
circadian transcription might be direct via binding to E-boxes
or indirect via protein-protein interactions with other transacting factors, including negative regulatory proteins (Id and
E4BP4). The future direction of this research involves testing
these hypothetical considerations.
Conclusion
The expression of NeuroD1 in the developing and adult rat
pineal gland, together with altered gene expression profiles in
the pineal gland of the NeuroD1 KO mouse indicate that this
transcription factor may play multiple physiological roles in
the rodent pinealocyte.
Acknowledgements
This research was supported by funds from the Intramural Research
Program of the National Institute of Child Health and Human
Development, National Institutes of Health and from the Danish
Medical Research Council (Grant 22-02-0288), the Lundbeck
Foundation, the Novo Nordisk Foundation and the Carlsberg
Foundation. The NeuroD1 heterozygote mouse was kindly provided
by Dr. MJ Tsai (Baylor College of Medicine, Houston, Texas). We
also wish to express our appreciation to Daniel T. Abebe for his
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
NeuroD1 in the pineal gland 11
veterinary support and Mrs. Ursula Rentzmann for her histological
assistance.
Supplementary material
The following supplementary material is available for this article
online:
Table S1 Transcripts down-regulated in NeuroD1 KO animals as
determined by microarray analysis. Data show the fold decrease in
mRNA in KO animals relative to WT animals. The fold change
values shown are an average of three WT and three KO arrays. In
the KO animals, 127 transcripts exhibit decreases in mRNA
abundance with at least a twofold, statistically significant change
(p < 0.05). The full microarray dataset is available at the Gene
Expression Omnibus (www.ncbi.nlm.nih.gov/projects/geo/), Series
# GSE6030.
Table S2 Transcripts up-regulated in NeuroD1 KO animals as
determined by microarray analysis. Data show the fold increase in
mRNA in KO animals relative to WT animals. The fold change
values shown are an average of three WT and three KO arrays. In
the KO animals, 16 transcripts exhibit increases in mRNA
abundance with at least a twofold, statistically significant change
(p < 0.05). The full microarray dataset is available at the Gene
Expression Omnibus (www.ncbi.nlm.nih.gov/projects/geo/), Series
# GSE6030.
This material is available as part of the online article from http://
www.blackwell-synergy.com
References
Akagi T., Inoue T., Miyoshi G., Bessho Y., Takahashi M., Lee J. E,
Guillemot F. and Kageyama R. (2004) Requirement of multiple
basic helix-loop-helix genes for retinal neuronal subtype specification. J. Biol. Chem. 279, 28492–28498.
Appelbaum L., Toyama R., Dawid I. D., Klein D. C., Baler R. and
Gothilf Y. (2004) Zebrafish serotonin N-acetyltransferase-2 gene
regulation: pineal-restrictive downstream module contains a functional E-box and three photoreceptor conserved elements. Mol.
Endocrinol. 5, 1210–1221.
Appelbaum L., Anzulovich A., Baler R. and Gothilf Y. (2005) Homeobox-clock protein interaction in zebrafish. A shared mechanism
for pineal-specific and circadian gene expression. J. Biol. Chem.
280, 11544–11551.
Araki M. (2001) Developmental potency of cultured pineal cells: an
approach to pineal developmental biology. Microsc. Res. Tech. 53,
33–42.
Araki M., Watanabe K., Tokunaga F. and Nonaka T. (1988) Phenotypic
expression of photoreceptor and endocrine cell properties by
cultured pineal cells of the newborn rat. Cell Differ. Dev. 25,
155–163.
Araki M., Kodama R., Eguchi G., Yasujima M., Orii H. and Watanabe K.
(1993) Retinal differentiation from multipotential pineal cells of
the embryonic quail. Neurosci. Res. 18, 63–72.
Babila T., Schaad N. C., Simonds W. F., Shinohara T. and Klein D. C.
(1992) Development of MEKA (phosducin), G beta, G gamma, and
S-antigen in the rat pineal gland and retina. Brain Res. 585, 141–148.
Baler R., Covington S. and Klein D. C. (1997) The rat arylalkylamine
N-acetyltransferase gene promoter. cAMP activation via cAMPresponsive element-CCAAT complex. J. Biol. Chem. 272, 6979–
6985.
Baler R., Covington S. and Klein D. C. (1999) Rat arylalkylamine
N-acetyltransferase gene. Upstream and intronic components of a
bipartite promoter. Biol. Cell 91, 699–705.
Benezra R., Davis R. L., Lockshon D., Turner D. L. and Weintraub H.
(1990) The protein Id: a negative regulator of helix-loop-helix
DNA binding proteins. Cell 61, 49–59.
Bernard M., Dinet V. and Voisin P. (2001) Transcriptional regulation
of the chicken hydroxyindole-O-methyltransferase gene by the
cone-rod homeobox containing protein. J. Neurochem. 79, 248–
257.
Calvo J. L., Boya J., Carbonell A. L. and Garcia-Maurino J. E.
(2004) Time of origin of the rat pineal gland cells. A bromodeoxyuridine immunohistochemical study. Histol. Histopathol. 19, 137–142.
Cau E. and Wilson S. W. (2003) Ash1a and Neurogenin1 function
downstream of Floating head to regulate epiphysial neurogenesis.
Development 130, 2455–2466.
Chen W. and Baler R. (2000) The rat arylalkylamine N-acetyltransferase
E-box: differential use in a master vs. a slave oscillator. Brain Res.
Mol. Brain Res. 81, 43–50.
Chen S., Wang Q. L., Nie Z., Sun H., Lennon G., Copeland N. G.,
Gilbert D. J., Jenkins N. A. and Zack D. J. (1997) Crx, a novel
Otx-like paired-homeodomain protein, binds to and transactivates
photoreceptor cell-specific genes. Neuron 19, 1017–1030.
Cho J. H. and Tsai M. J. (2004) The role of BETA2/NeuroD1 in the
development of the nervous system. Mol. Neurobiol. 30, 35–47.
Collin J. P. (1971) Differentiation and regression of the cells of the
sensory line in the epiphysis cerebri, in The Pineal Gland (Wolstenholme G. E. W. and Knight J., eds.), pp. 79–125. ChurchillLivingstone, Edinburgh.
Coon S. L., Roseboom P. H., Baler R., Weller J. L., Namboodiri M. A.,
Koonin E. V. and Klein D. C. (1995) Pineal serotonin N-acetyltransferase: expression cloning and molecular analysis. Science
270, 1681–1683.
Doi M., Nakajima Y., Okano T. and Fukada Y. (2001) Light-induced
phase-delay of the chicken pineal circadian clock is associated with
the induction of cE4bp4, a potential transcriptional repressor of
cPer2 gene. Proc. Natl Acad. Sci. USA 98, 8089–8094.
Donoso L. A., Merryman C. F., Edelberg K. E., Naids R. and Kalsow C.
(1985) S-antigen in the developing retina and pineal gland. Invest.
Ophthalmol. Vis. Sci. 26, 561–567.
Dufton C., Marcora E., Chae J. H., McCullough J., Eby J., Hausburg M.,
Stein G. H., Khoo S., Cobb M. H. and Lee J. E. (2005) Contextdependent regulation of NeuroD activity and protein accumulation.
Mol. Cell Neurosci. 28, 727–736.
Echigo N. and Moriyama Y. (2004) Vesicular inhibitory amino acid
transporter is expressed in gamma-aminobutyric acid (GABA)containing astrocytes in rat pineal glands. Neurosci. Lett. 367,
79–84.
Furukawa T., Morrow E. M., Li T., Davis F. C. and Cepko C. L. (1999)
Retinopathy and attenuated circadian entrainment in Crx-deficient
mice. Nat. Genet. 23, 466–470.
Gaildrat P., Møller M., Mukda S., Humphries A., Carter D. A.,
Ganapathy V. and Klein D. C. (2005) A novel pineal-specific
product of the oligopeptide transporter PepT1 gene: circadian
expression mediated by cAMP activation of an intronic promoter.
J. Biol. Chem. 280, 16851–16860.
Gamse J. T., Shen Y. C., Thisse C., Thisse B., Raymond P. A., Halpern
M. E. and Liang J. O. (2002) Otx5 regulates genes that show
circadian expression in the zebrafish pineal complex. Nat. Genet.
30, 117–121.
Ganguly S., Coon S. L. and Klein D. C. (2002) Control of melatonin
synthesis in the mammalian pineal gland: the critical role of
serotonin acetylation. Cell Tissue Res. 309, 127–137.
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
12 E. M. Muñoz et al.
Gaudilliere B., Konishi Y., de la Iglesia N., Yao G. and Bonni A. (2004)
A CaMKII-NeuroD signaling pathway specifies dendritic morphogenesis. Neuron 41, 229–241.
Ghil S. H., Jeon Y. J. and Suh-Kim H. (2002) Inhibition of BETA2/
NeuroD by Id2. Exp. Mol. Med. 34, 367–373.
Hamasaka Y., Wegener C. and Nässel D. R. (2005) GABA modulates
Drosophila circadian clock neurons via GABAB receptors and
decreases in calcium. Neurobiology 65, 225–240.
Hastings M. H. (2000) Circadian clockwork: two loops are better than
one. Nat. Rev. Neurosci. 1, 143–146.
Humphries A., Klein D. C., Baler R. and Carter D. A. (2002) cDNA
array analysis of pineal gene expression reveals circadian rhythmicity of the dominant negative helix-loop-helix protein-encoding
gene, Id-1. J. Neuroendocrinol. 14, 101–108.
Hyung Chae J., Stein G. H. and Lee J. E. (2004) NeuroD: the predicted
and the surprising. Mol. Cells 18, 271–288.
Iuvone P. M., Tosini G., Pozdeyev N., Haque R., Klein D. C. and
Chaurasia S. S. (2005) Circadian clocks, clock networks, arylalkylamine N-acetyltransferase, and melatonin in the retina. Prog.
Retin. Eye Res. 24, 433–456.
Kanai Y., Okada Y., Tanaka Y., Harada A., Terada S. and Hirokawa N.
(2000) KIF5C, a novel neuronal kinesin enriched in motor neurons.
J. Neurosci. 20, 6374–6384.
Khoo S., Griffen S. C., Xia Y., Baer R. J., German M. S. A. and Cobb
M. H. (2003) Regulation of insulin gene transcription by ERK1
and ERK2 in pancreatic beta cells. J. Biol. Chem. 278, 32969–
32977.
Kim J. S., Coon S. L., Blackshaw S., Cepko C. L., Møller M., Mukda S.,
Zhao W. Q., Charlton C. G. and Klein D. C. (2005) Methionine
adenosyltransferase: adrenergic-cAMP mechanism regulates a
daily rhythm in pineal expression. J. Biol. Chem. 280, 677–684.
Klein D. C. (2004) The 2004 Aschoff/Pittendrigh lecture: theory of the
origin of the pineal gland: a tale of conflict and resolution. J. Biol.
Rhythms 19, 264–279.
Klein D. C., Auerbach D. A. and Weller J. L. (1981) Seesaw signal
processing in pineal cells: homologous sensitization of adrenergic
stimulation of cyclic GMP accompanies homologous desensitization of beta-adrenergic stimulation of cyclic AMP. Proc. Natl Acad.
Sci. USA 78, 4625–4629.
Korf H. W., Møller M., Gery I., Zigler J. S. and Klein D. C. (1985)
Immunocytochemical demonstration of retinal S-antigen in the
pineal organ of four mammalian species. Cell Tissue Res. 239,
81–85.
Korf H. W., White B. H., Schaad N. C. and Klein D. C. (1992) Recoverin in pineal organs and retina of various vertebrate species
including man. Brain Res. 595, 57–66.
Lee J. E., Hollenberg S. M., Snider L., Turner D. L., Lipnick N. and
Weintraub H. (1995) Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein. Science 268,
836–844.
Lee J. K., Cho J. H., Hwang W. S., Lee Y. D., Reu D. S. and Suh-Kim H.
(2000) Expression of NeuroD/BETA2 in mitotic and postmitotic
neuronal cells during the development of nervous system. Dev.
Dyn. 217, 327–336.
Liu M., Pleasure S. J., Collins A. E., Noebels J. L., Naya F. J., Tsai M. J.
and Lowenstein D. H. (2000) Loss of BETA2/NeuroD leads to
malformation of the dentate gyrus and epilepsy. Proc. Natl Acad.
Sci. USA 97, 865–870.
Ma W., Yan R. T., Xie W. and Wang S. Z. (2004) A role of ath5 in
inducing NeuroD and the photoreceptor pathway. J. Neurosci. 24,
7150–7158.
Mano H., Kojima D. and Fukada Y. (1999) Exo-rhodopsin: a novel
rhodopsin expressed in the zebrafish pineal gland. Brain Res. Mol.
Brain Res. 73, 110–118.
Maronde E., Pfeffer M., Olcese J., Molina C. A, Schlotter F., Dehghani
F., Korf H. W. and Stehle J. H. (1999) Transcription factors in
neuroendocrine regulation: rhythmic changes in pCREB and ICER
levels frame melatonin synthesis. J. Neurosci. 19, 3326–3336.
Max M., McKinnon P. J., Seidenman K. J., Barrett R. K., Applebury
M. L., Takahashi J. S. and Margolskee R. F. (1995) Pineal opsin: a
nonvisual opsin expressed in chick pineal. Science 267, 1502–
1506.
Miki H., Setou M., Kaneshiro K. and Hirokawa N. (2001) All kinesin
superfamily protein, KIF, genes in mouse and human. Proc. Natl
Acad. Sci. USA 98, 7004–7011.
Møller M. (1978) Presence of a pineal nerve (nervus pinealis) in the
human fetus; a light and electron microscopical study of the
innervation of the pineal gland. Brain Res. 154, 1.
Møller M. (1979) Presence of a pineal nerve (nervus pinealis) in fetal
mammals. Progr. Brain Res. 52, 103.
Møller M. (1986) The human fetal pineal gland. in Morphological
indications of a photoreceptive capacity, in: The Pineal Gland
during Development (Gupta D. and Reiter R. J, eds.), pp. 80–88.
Croom-Helm Ltd, London, Sidney.
Møller M., Phansuwan-Pujito P., Morgan K. C. and Badiu C. (1997)
Localization and diurnal expression of mRNA encoding the beta1adrenoceptor in the rat pineal gland: an in situ hybridization study.
Cell Tissue Res. 288, 279–284.
Morrow E. M., Furukawa T., Lee J. E. and Cepko C. L. (1999) NeuroD
regulates multiple functions in the developing neural retina in
rodent. Development 126, 23–36.
Muñoz E. and Baler R. (2003) The circadian E-box: when perfect is not
good enough. Chronobiol. Internat. 20, 371–388.
Muñoz E., Brewer M. and Baler R. (2002) Circadian transcription:
thinking outside the E-box. J. Biol. Chem. 277, 36009–36017.
Mutoh H., Fung B. P., Naya F. J., Tsai M. J., Nishitani J. and Leiter A. B.
(1997) The basic helix-loop-helix transcription factor BETA2/
NeuroD is expressed in mammalian enteroendocrine cells and
activates secretin gene expression. Proc. Natl Acad. Sci. USA 94,
3560–3564.
Naya F. J., Stellrecht C. M. and Tsai M. J. (1995) Tissue-specific
regulation of the insulin gene by a novel basic helix-loop-helix
transcription factor. Genes Dev. 9, 1009–1019.
Naya F. J., Huang H. P., Qiu Y., Mutoh H., DeMayo F. J., Leiter A. B.
and Tsai M. J. (1997) Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/
neuroD-deficient mice. Genes Dev. 11, 2323–2334.
Nishida A., Furukawa A., Koike C., Tano Y., Aizawa S., Matsuo I. and
Furukawa T. (2003) Otx2 homeobox gene controls retinal photoreceptor cell fate and pineal gland development. Nat. Neurosci. 6,
1255–1263.
Ochocinska M. J. and Hitchcock P. F. (2007) Dynamic expression of the
basic helix-loop-helix transcription factor NeuroD in the rod and
cone photoreceptor lineages in the retina of the embryonic and
larval zebrafish. J. Comp. Neurol. 501, 1–12.
Okamura H. (2004) Clock genes in cell clocks: roles, actions, and
mysteries. J. Biol. Rhythms 19, 388–399.
Okano T., Yoshizawa T. and Fukada Y. (1994) Pinopsin is a chicken
pineal photoreceptive molecule. Nature 372, 94–97.
Pennesi M. E., Cho J. H., Yang Z., Wu S. H., Zhang J., Wu S. M. and
Tsai M. J. (2003) BETA2/NeuroD1 null mice: a new model for
transcription factor-dependant photoreceptor degeneration.
J. Neurosci. 23, 453–461.
Piggins H. D. and Loudon A. (2005) Circadian biology: clocks within
clocks. Curr. Biol. 15, R455–R457.
Poulin G., Turgeon B. and Drouin J. (1997) NeuroD1/BETA2 contributes to cell-specific transcription of the proopiomelanocortin
gene. Mol. Cell Biol. 17, 6673–6682.
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works
NeuroD1 in the pineal gland 13
Quay W.B. (1974) Pineal chemistry, in Cellular and Physiological
Mechanisms, (Thomas C. C, ed.), p. 5. Springfield, Illinois.
Rath M. F., Muñoz E., Ganguly S., Morin F., Shi Q., Klein D. C. and
Møller M. (2006) Expression of the Otx2 homeobox gene in the
developing mammalian brain: embryonic and adult expression in
the pineal gland. J. Neurochem. 97, 256–266.
Reig J. A., Yu L. and Klein D. C. (1990) Pineal transduction. Adrenergic fi cyclic AMP-dependent phosphorylation of cytoplasmic
33-kDa protein (MEKA) which binds beta gamma-complex of
transducin. J. Biol. Chem. 265, 5816–5824.
Rodrigues M. M., Hackett J., Gaskins R., Wiggert B., Lee L., Redmond
M. and Chader G. J. (1986) Interphotoreceptor retinoid-binding
protein in retinal rod cells and pineal gland. Invest. Ophthalmol.
Vis. Sci. 27, 844–850.
Roseboom P. H. and Klein D. C. (1995) Norepinephrine stimulation of
pineal cyclic AMP response element-binding protein phosphorylation: primary role of a beta-adrenergic receptor/cyclic AMP
mechanism. Mol. Pharmacol. 47, 439–449.
Roseboom P. H., Coon S. L., Baler R., McCune S. K., Weller J. L. and
Klein D. C. (1996) Melatonin synthesis: analysis of the more than
150-fold nocturnal increase in serotonin N-acetyltransferase messenger ribonucleic acid in the rat pineal gland. Endocrinology 137,
3033–3045.
Rosenstein R. E., Chuluyan H. E., Diaz M. C. and Cardinali D. P. (1990)
GABA as a presumptive paracrine signal in the pineal gland.
Evidence on an intrapineal GABAergic system. Brain Res. Bull.
25, 339–344.
Schaad N. C., Shinohara T., Abe T. and Klein D. C. (1991) Photoneural
control of the synthesis and phosphorylation of pineal MEKA
(phosducin). Endocrinology 129, 3289–3298.
Simonneaux V., Poirel V. J., Garidou M. L., Nguyen D., Diaz-Rodriguez
E. and Pevet P. (2004) Daily rhythm and regulation of clock gene
expression in the rat pineal gland. Brain Res. Mol. Brain Res. 120,
164–172.
Sugden D. and Klein D. C. (1983) Regulation of rat pineal hydroxyindole-O-methyltransferase in neonatal and adult rats. J. Neurochem.
40, 1647–1653.
Sugden L. A., Sugden D. and Klein D. C. (1987) Alpha 1-adrenoceptor
activation elevates cytosolic calcium in rat pinealocytes by
increasing net influx. J. Biol. Chem. 262, 741–745.
Tosini G., Doyle S., Geusz M. and Menaker M. (2000) Induction of
photosensitivity in neonatal rat pineal gland. Proc. Natl Acad. Sci.
USA 97, 11540–11544.
Westmoreland J. J., Hancock C. R. and Condie B. G. (2001) Neuronal
development of embryonic stem cells: a model of GABAergic
neuron differentiation. Biochem. Biophys. Res. Comm. 284, 674–
680.
Yan R. T. and Wang S. Z. (2000a) Differential induction of gene
expression by basic fibroblast growth factor and NeuroD in cultured retinal epithelial cells. Vis. Neurosci. 17, 157–164.
Yan R. T. and Wang S. Z. (2000b) Expression of an array of photoreceptor genes in chick embryonic retinal pigment epithelium cell
cultures under the induction of NeuroD. Neurosci. Lett. 280, 83–
86.
Zimmerman B. L. and Tso M. O. (1965) Morphologic evidence of
photoreceptor differentiation of pinealocytes in the neonatal rat.
J. Cell Biol. 66, 60–75.
2007 International Society for Neurochemistry, J. Neurochem. (2007) 10.1111/j.1471-4159.2007.04605.x
No claim to original US government works