NEWS AND VIEWS
© 2003 Nature Publishing Group http://www.nature.com/naturebiotechnology
itself going to be quite rare, we can say that
under any practical circumstances, the IL10
strain will face extinction after passage from
treated IBD patients into the environment.
This approach holds promise for the safe
application of GM bacteria as a therapeutic
tool. The next step is to see whether the
technology works as an efficient drug delivery vehicle in humans suffering from IBD
and thus could also be applied to other
intestinal disorders.
1. Torres, B., Jaenecke, S., Timmis, K.N., Garcia, J.L. &
Diaz, E. Environ. Microbiol. 2, 555–563 (2000).
2. Syvanen, M. Nat. Biotechnol. 17, 833 (1999).
3. Steidler, L. et al. Nat. Biotechnol. 21, 785–789 (2003).
4. Steidler, L. et al. Science 289, 1352–1355 (2000).
5. Schotte, L., Steidler, L., Vandekerckhove, J. & Remaut,
E. Enzyme Microb. Technol. 27, 761–765 (2000).
6. Steidler, L. et al. Infect. Immun. 66, 3183–3189
(1998).
Pointing fingers at the limiting
step in gene targeting
John H Wilson
Two groups combine zinc fingers with a nuclease to dramatically stimulate
homologous recombination and gene targeting in human and insect cells.
Modifying genes by homologous recombination—so-called gene targeting—is a standard tool of reverse genetics that has proven
enormously powerful for dissecting gene
function. But gene targeting has not been
achieved in all organisms—for example,
nematodes, zebrafish and most mammals—
and even where it has, it is inefficient, typically giving one event per 105–107 treated
cells. Low targeting efficiency is not a serious barrier for genome manipulation in cultured cells when the rare, modified cell can
be isolated and amplified. It becomes more
critical, however, in gene therapy, where the
precise, efficient correction of genetic
defects holds the promise of a cure. Two
recent articles in Science1,2 show that artificial zinc-finger nucleases can be used to
stimulate gene targeting in Drosophila and
in human cells. These studies bode well for
facile targeting and raise a glimmer of hope
for targeted gene therapy.
The full potential of gene targeting has
been realized only for mice, where embryonic stem (ES) cells can be cultured, modified by gene targeting, and introduced into
early embryos, ultimately giving rise to
mice fully derived from the modified ES
cells. Isolation of similar stem cells from
other mammalian species has failed.
However, the cloning of animals such as the
sheep Dolly by transfer of a somatic cell
The author is in the Verna and Marrs McLean
Department of Biochemistry and Molecular
Biology, Baylor College of Medicine, One Baylor
Plaza, Houston, Texas 77030, USA.
e-mail: [email protected]
nucleus into an enucleated oocyte opens up
an alternative route for germline modification. Cultured somatic cells can be modified by gene targeting and then used to
reconstitute a new animal by nuclear transfer. In this venue a low efficiency of gene
targeting translates into a large number of
cell doublings, which may compromise
nuclear totipotency.
Gene targeting engages the cell’s own
machinery for homologous recombination,
which has been honed by evolution to provide accurate repair when both strands of
DNA are compromised, as they are by crosslinks and double-strand breaks. In cells, the
most common breaks arise at stalled or collapsed replication forks3. Broken forks are
frequent enough that in the absence of the
principal recombinase, RecA, about half the
cells in a culture of Escherichia coli are dead,
and mammalian cells that are missing the
RecA homolog, Rad51, are not viable. In retrospect then, it is not surprising that artificial double-strand breaks introduced into
specific chromosomal sites by rare-cutting
endonucleases such as I-SceI dramatically
stimulate homologous recombination and
gene targeting4,5.
Although revealing of cellular mechanisms of double-strand break repair, I-SceI
cleavage does not offer a general way to
stimulate gene targeting because prior
modification of the chromosome is
required to introduce its 18-base pair
recognition site. What is needed is an extensive catalog of nucleases that will uniquely
cleave virtually any gene of interest. Zincfinger nucleases offer just that potential;
they combine precise zinc-finger mediated
NATURE BIOTECHNOLOGY VOLUME 21 NUMBER 7 JULY 2003
DNA recognition with the nonspecific DNA
cleavage domain from the restriction
enzyme FokI (see Fig. 1).
The Cys2-His2 zinc-finger domain, first
observed in the crystal structure of the
transcription factor Zif268, is the most
common DNA-binding motif in eukaryotes
and is encoded in about 2% of our genes.
This 30-amino acid domain folds into a
ββα structure that is stabilized by coordination of a zinc ion (see Fig. 1). Zinc fingers
recognize a three-nucleotide sequence in
the major groove, making contacts primarily with bases in one strand. In current
designs, each monomer of a dimeric zincfinger nuclease comprises three zinc fingers
linked to the FokI cleavage domain, allowing recognition of a nine-nucleotide segment. Because efficient DNA cleavage
requires dimerization through the FokI
domain6, the effective recognition site is 18
nucleotides in length, long enough to be
unique in mammalian genomes.
Motivated by the possibility of developing
artificial transcription activators and
repressors, several groups have combined
phage display and rational design to select
zinc-finger domains with new specificities.
Of the 64 triplets in DNA, zinc-fingers with
good affinity and specificity have been identified for most 5′-GNN (where N is any
nucleotide) and many 5′-ANN triplets7–9.
This leads to a reasonable expectation of
finding appropriate six-finger (18 bp) targets roughly every 0.5–1.0 kb—that is, in
virtually any gene.
It is this enormous potential versatility
that Bibikova et al.1 and Porteus and
Baltimore2 have tapped into to demonstrate
the utility of zinc-finger nucleases for
genome
modification.
Porteus
and
Baltimore deposited into the genome of
human cells versions of the green fluorescent
protein (GFP) gene disabled by insertion of
sites for I-SceI and two defined zinc-finger
nucleases. Cotransfection of a correcting
fragment of GFP and an expression vector
for I-SceI or either zinc-finger nuclease
increased the number of GFP-positive cells
by more than 1000-fold. Optimization
experiments suggest that 3–5% of treated
cells can be targeted in this way.
Bibikova et al.1 have taken this approach a
step further by designing a zinc-finger
nuclease to cleave the easily scorable yellow
(y) gene of Drosophila (Fig. 1). They showed
previously that induction of nuclease
expression by heat shock during larval
development generates mutations by cleavage and nonhomologous end joining
(NHEJ)10. In the present study, they use the
759
Figure 1 Cut to order.
The middle finger from
the Zif268 transcription
factor illustrates the
structure of a zincfinger domain and
identifies the amino
acid residues important
for DNA binding. The
two component zincfinger nuclease shown
below is the one used by
Bibikova et al.1 to
cleave the Drosophila
yellow locus. Carats
indicate the sites of
cleavage. The zinc
finger is modified from
Figure 1 in ref. 12. The
zinc-finger nuclease is
modified from Figure 1
in Bibikova et al.10.
N
C
DNA
binding
Zinc-finger domains
F3
F2
F1
N
5'–ACTGCCTACCGCATTAAAGTGGATGAGTGT–3'
3'–TGACGGATGGCGTAATTTCACCTACTCACA–5'
N
F1
F2
same larval heat shock to liberate from the
chromosome a mutant segment of y DNA.
The liberated fragment serves as an efficient
template for homologous repair of the normal locus after cleavage with the zinc-finger
nuclease. Some 15–20% of surviving adults
yielded mutant offspring, about two-thirds
of which arose by homologous recombination with the donor segment, whereas the
remainder occurred by NHEJ.
Together, these studies show that zinc-finger nucleases are as effective as I-SceI—the
gold standard—at enhancing gene targeting
and that they can be designed from scratch
to stimulate gene targeting at a specific
genomic site. At this point, you may be asking “Where do I get one for my gene?”
Unfortunately, some assembly is required.
There are no kits. But there is a recipe: find
potential sites for cleavage in your gene,
assemble the appropriate zinc-finger and
nuclease domains by PCR, and identify
nucleases that bind in the low nanomolar
range11. This final step is critical because
zinc-finger domains are not autonomous;
their affinity and specificity can be influenced by their neighbors9,11. This is why it is
prudent to design nucleases for several sites
at once. It is also likely to be the basis for the
cautionary notes in both studies that
expression of some nucleases can be toxic,
presumably due to cleavage at other sites in
the genomes.
If a broad range of safe and effective zincfinger nucleases were available, how would
they affect genome manipulation? For
tractable systems, such as mouse embryonic
stem cells, it may not be worth the initial
effort to develop a nuclease just to avoid the
tedious, but manageable screening that
760
may be especially valuable in systems where
gene targeting has proven difficult or
impossible.
Of course, ultimately, these zinc-finger
nucleases also raise the tantalizing possibility of gene correction as a realistic therapy
for human disease. Successful modification
of several percent of treated cells is definitely intriguing. But make no mistake—
plenty of obstacles remain before zinc
fingers can guide the hand of an aspiring
genetic surgeon.
F3
Nuclease
domain
©Bob Crimi
© 2003 Nature Publishing Group http://www.nature.com/naturebiotechnology
NEWS AND VIEWS
must now be done. For primary cells and
established cell lines, which are notoriously
more difficult to target, for gene targeting in
preparation for nuclear transfer, and for
model organisms such as nematodes and
zebrafish the up-front investment may pay
handsome dividends. By matching the targeting strategy to the natural role of homologous recombination, zinc-finger nucleases
1. Bibikova, M., Beumer, K., Trautman, J.K. & Carroll,
D. Science 300, 764 (2003).
2. Porteus, M.H. & Baltimore, D. Science 300, 763
(2003).
3. Cox, M.M. et al. Nature 404, 37–41 (2000).
4. Rouet, P., Smih, F., & Jasin, M. Mol. Cell. Biol. 14,
8096–8106 (1994).
5. Brenneman, M., Gimble, F.S. & Wilson, J.H. Proc.
Natl. Acad. Sci. USA 93, 3608–3612 (1996).
6. Smith, J. et al. Nucl. Acids Res. 28, 3361–3369
(2000).
7. Segal, D.J., Dreier, B., Beerli, R.R. & Barbas III,
C.F. Proc. Natl. Acad. Sci. USA 96, 2758–2763
(1999).
8. Dreier, B., Beerli, R.R., Segal, D.J., Flippin, J.D. &
Barbas III, C.F. J. Biol. Chem. 276, 29466–29478
(2001).
9. Liu, Q., Xia, Z. & Case, C.C. J. Biol. Chem. 277,
3850–3856 (2002).
10. Bibikova, M., Golic, M., Golic, K.G. & Carroll, D.
Genetics 161, 1169–1175 (2002).
11. Segal, D.J. Methods 26, 76–83 (2002).
12. Pabo, C.O., Peisach, E. & Grant, R.A. Annu. Rev.
Biochem. 70, 313–340 (2001).
ES cells prove egg-straordinary
George Q Daley
The observation that embryonic stem cells can not only differentiate into
oocytes, but also form blastocyst-like structures has provocative implications
for basic research and beyond.
Embryonic stem (ES) cells are the gate-crashers of embryo development, commingling
with the differentiating inner cell mass after
injection into the blastocyst and chimerizing
every tissue in the adult mouse. That they can
contribute to the germ line is demonstrated by
the fact that breeding chimeric mice will—
with variable but low efficiency—generate offspring that derive from the input ES cells.
Until recently, however, no laboratory had
The author is in the Department of Biological
Chemistry and Molecular Pharmacology,
Harvard Medical School, Division of Pediatric
Hematology/Oncology, Children’s Hospital and
Dana Farber Cancer Institute, Whitehead
Institute, 9 Cambridge Center, Cambridge, MA
02142, USA. e-mail: [email protected]
succeeded in generating germ cells from ES
cells in vitro. In a remarkable paper published
in Science, the group of Hans Scholer1 has
done just that: they have coaxed ES cells to differentiate into oocytes, and even more surprisingly, found that some of the oocytes appear
to undergo parthenogenetic activation to
form blastocyst-like structures. The implications of this observation push the boundaries
of scientific research into fascinating and ethically provocative new directions.
Since the first report of in vitro differentiation of ES cells almost two decades ago2,
numerous groups have exploited murine, and
lately human, ES cells to study the development of blood cells, cardiac and skeletal muscle, hepatocytes, neurons and endothelium,
among others. While the cytokine leukocyte
inhibitory factor (LIF) maintains murine ES
VOLUME 21 NUMBER 7 JULY 2003 NATURE BIOTECHNOLOGY