GENERAL
ENDOCRINOLOGY
Peripheral Androgen Receptors Sustain the
Acrobatics and Fine Motor Skill of Elaborate Male
Courtship
Matthew J. Fuxjager, Kristy M. Longpre, Jennifer G. Chew, Leonida Fusani, and
Barney A. Schlinger
Department of Integrative Biology and Physiology (M.J.F., K.M.L., J.G.C., B.A.S.), University of California,
Los Angeles, Laboratory of Neuroendocrinology (M.J.F., B.A.S.), Brain Research Institute, University of
California, Los Angeles, and Department of Ecology and Evolutionary Biology (B.A.S.), University of
California, Los Angeles, Los Angeles, California 90095; and Department of Life Sciences and
Biotechnology (L.F.), University of Ferrara, 44121 Ferrara, Italy
Androgenic hormones regulate many aspects of animal social behavior, including the elaborate
display routines on which many species rely for advertisement and competition. One way that this
might occur is through peripheral effects of androgens, particularly on skeletal muscles that control
complex movements and postures of the body and its limbs. However, the specific contribution of
peripheral androgen-muscle interactions to the performance of elaborate behavioral displays in
the natural world has never been examined. We study this issue in one of the only natural physiological models of animal acrobatics: the golden-collared manakin (Manacus vitellinus). In this
tropical bird, males compete with each other and court females by producing firecracker-like wingsnaps and by rapidly dancing among saplings over the forest floor. To test how activation of peripheral
androgen receptors (AR) influences this display, we treat reproductively active adult male birds with the
peripherally selective antiandrogen bicalutamide (BICAL) and observe the effects of this manipulation
on male display performance. We not only validate the peripheral specificity of BICAL in this species,
but we also show that BICAL treatment reduces the frequency with which adult male birds perform
their acrobatic display maneuvers and disrupts the overall structure and fine-scale patterning of these
birds’ main complex wing-snap sonation. In addition, this manipulation has no effect on the behavioral
metrics associated with male motivation to display. Together, our findings help differentiate the various effects of peripheral and central AR on the performance of a complex sociosexual behavioral
phenotype by indicating that peripheral AR can optimize the motor skills necessary for the production
of an elaborate animal display. (Endocrinology 154: 3168 –3177, 2013)
I
n many species throughout the animal kingdom, individuals perform elaborate social displays to attract
mates and defend territories (1– 6). These phenotypes
more than likely rely on robust muscular systems that provide not only great strength but also superior motor agility
for sustained and highly coordinated physical activity.
The mechanisms through which these muscle systems are
maintained for such remarkable display behavior are virtually unknown. Here we explore this issue by testing how
androgenic signaling systems specifically within the periphery help maintain acrobatic display behavior.
Androgenic hormones act via intracellular androgen
receptors (AR) to modulate animal social behavior. A
principal target of androgens is the central nervous system
(CNS), which controls how and when individuals interact
with each other in a top-down manner (7). In many vertebrates, however, AR are also expressed peripherally, and
specifically in the skeletal muscles (8 –10). Prior studies
presume that androgens influence simplistic sexual reflexes and movements in part by acting on discrete muscular targets that have strong sex-specific functions (11–
ISSN Print 0013-7227 ISSN Online 1945-7170
Printed in U.S.A.
Copyright © 2013 by The Endocrine Society
Received April 2, 2013. Accepted June 12, 2013.
First Published Online June 19, 2013
Abbreviations: AR, androgen receptor; BICAL, bicalutamide; CNS, central nervous system;
qPCR, quantitative PCR; STRI, Smithsonian Tropical Research Institute.
3168
endo.endojournals.org
Endocrinology, September 2013, 154(9):3168 –3177
doi: 10.1210/en.2013-1302
doi: 10.1210/en.2013-1302
15). Thus, it seems that androgens may also act via AR
more broadly throughout the periphery, particularly on
skeletal muscles, to facilitate complex movements associated with elaborate, whole-body social signaling behavior. Whether this occurs is not known because no studies
have measured the effect of experimentally manipulated
peripheral or muscular AR on behavioral output, let alone
elaborate behavioral output necessary for physically complex social displays.
Songbirds have emerged as one of the most widely used
groups of vertebrates to study how androgenic steroids
affect social signals. Much of the work in this area focuses
on the brain, and thus explores how androgens guide the
sensorimotor and premotor programs of song learning
and production (16 –19). At the same time, androgens can
also act on the avian vocal organ, the syrinx, to presumably influence song (15). This, in turn, implies that androgens act on multiple levels of the motor systems that
underlie the acoustic signaling abilities of songbirds.
However, not all birds are capable of singing complex
vocalizations, and instead many avian species communicate and/or advertise by performing intricate and strenuous flying, jumping, and dancing routines (4 – 6). To optimize the movement and balance of the wings, legs, and
tail that are required for such behavior, peripheral muscular systems throughout the entire body must be fully
engaged and coordinated (5). Thus, given the important
roles of androgens in modulating birdsong, it is possible
that androgenic hormones also help facilitate musculoskeletal systems that guide the physicality behind the signaling traits of nonsinging birds.
Currently one of the only animal models used to study
the mechanisms of natural animal acrobatics and fine motor skill is the golden-collared manakin (Manacus vitellinus). In this tropical bird, males compete and attract mates
by producing loud wing-snap sonations and by performing elaborate, high-speed dances among saplings near the
forest floor (20, 21). Their display is both visual and
acoustic, and its extraordinary physicality and complexity
requires remarkable strength and neuromuscular control
(20). Moreover, male golden-collared manakins express
abundant AR in their skeletal muscles compared to other
birds that do not exhibit complex courtship displays (22),
and nearly all components of the males’ display repertoire
depend on activation of AR (23). Based on this work, we
hypothesize that peripheral AR in the musculoskeletal system facilitates the complex, acrobatic elements of the male
display repertoire.
In the current study, we examine this idea by developing
a method for manipulating AR exclusively in the periphery
and measuring how this manipulation impacts the goldencollared manakin’s display. We achieved the first goal by
endo.endojournals.org
3169
administering bicalutamide (BICAL) to a group of captive
manakins. BICAL is a potent antiandrogen that is thought
to block AR in a peripherally selective manner (24, 25);
thus, we validated that this drug indeed inhibits the functional effects of avian AR in this manner. We achieved the
second goal by treating wild breeding males with BICAL
and recording how this drug impacts their display. Prior
work shows that antiandrogens, like BICAL, are ideal for
testing how AR influences avian behavior, because estrogen receptors, not AR, provide negative feedback of androgen secretion in birds (26, 27); as such, antiandrogens
[ie, BICAL (28)] inhibit avian AR without changing circulating levels of testosterone (29). Together, these studies
allow us to evaluate and measure the role of peripheral
androgens in modulating the performance and fine motor
skills of the golden-collared manakin’s elaborate signaling
repertoire.
Materials and Methods
Animals
This work was conducted at the Smithsonian Tropical Research Institute (STRI) in Gamboa, Panama. All experiments
were performed during the breeding season from February to
April. Golden-collared manakins were collected using passive
mist netting from active leks in the nearby forest. The Animal
Care and Use Committees at the University of California, Los
Angeles, and STRI approved the methods described herein.
Experiment 1: validation studies
We validated the efficacy and peripheral selectivity of BICAL
using juvenile male and female golden-collared manakins captured at or near active leks. Juvenile males and females (ie, green
birds) have dull green plumage and are distinguishable from
adult males, but not each other. These birds maintain low testosterone levels (30, 31), although AR levels in their skeletal
muscles are as high as breeding adult males (22). Moreover,
testosterone administration to both male and female green birds
induces wing-snap behavior similar to that of adult males (30,
31). These features make green birds ideal for testing whether
BICAL is peripherally selective on AR in this species.
Upon capture, all green birds were quickly returned to our
STRI facility. Individuals were housed singly in small cages (29 ⫻
32 cm) in one room, giving them constant visual and acoustic
contact. Birds received fresh papaya ad libitum. After 2-3 days of
captivity, each bird was implanted at the base of the neck with a
12-mm SILASTIC brand tube (0.76 mm inner diameter, 1.65
mm outer diameter; Dow Corning Inc, Midland, Michigan) that
contained crystalline testosterone. An ice chip was gently pressed
against the implantation site to numb the skin before implantation. Details of this procedure have been described previously
(23, 32). Prior work verifies that such implants not only increase
testosterone to levels typical of breeding males (32), but also
induces physiological and behavioral states typical of breeding
males (30, 31). At this same time, birds were randomly assigned
to receive either an additional time-release BICAL implant (see
3170
Fuxjager et al
Peripheral Androgen Receptors and Animal Acrobatics
below for BICAL details; n ⫽ 3 males) or an additional control
implant (n ⫽ 3 males, n ⫽ 1 female). The second implant was
administered in the same manner as the first implant (23, 32). No
bird responded adversely to either the implantation surgeries or
the testosterone/BICAL treatments.
Because testosterone induces maximal behavioral and physiological effects in female and juvenile male manakins after 8 –18
days of implantation (30, 31), we recorded behavior in this experiment during the same time window. Birds were videotaped
with a Sony camcorder (New York, New York) for approximately 8 h/d (between 6:30 AM and 4:00 PM). An observer randomly selected a subset of these videos and recorded the rate at
which birds fed on papaya and the total number of times birds
hopped on or between perches within their cage. On postimplantation day 19, each bird was weighed and killed by rapid
decapitation. Three wing muscles (pectoralis, supracoracoideus,
and scapulohumeralis caudalis) and 2 areas of the brain (telencephalon and hypothalamus) were quickly dissected from the
birds, flash frozen on dry ice, and stored at ⫺80°C for mRNA
analysis (see below).
Experiment 2: peripheral AR manipulation in wild
adult male birds
We used reproductively active adult male golden-collared
manakins to test the effects of peripheral AR on display performance and motor skills. Each bird in this study was captured at
its own courtship arena between 6:30 and 9:00 AM. Once taken
from the mist net, birds were weighed, color banded, and randomly assigned to receive either a time-release BICAL implant
(see below for BICAL details; n ⫽ 5) or a blank control implant
(n ⫽ 6). Implants were administered sc on the bird’s back and at
the base of its neck. Implantation took approximately 2 minutes,
and the details of this procedure are described elsewhere (23). No
bird was adversely affected by either the implantation or treatment of BICAL, and some birds were observed displaying within
minutes or hours after their release.
Birds in this experiment were taken from 7 different leks in
geographically distinct locations; each lek contained between 2
and 10 actively breeding adult males. Five of these 7 leks contained at least 4 displaying males, and we included 2 birds from
each of these leks in this experiment (one of these birds was
assigned to the control group, whereas the other was assigned to
the BICAL group). The other 2 leks contained 3 or fewer displaying males; only one bird from each of these leks was used in
this experiment, with one individual assigned to the BICAL
group and the other individual assigned to the control group.
We recorded the behavior of treated and untreated birds during multiple 30-minute observation sessions. Upon arriving at a
male’s display site for one of these observation sessions, we recorded whether the male was present as an index of his ability to
hold his own arena in the face of likely male-male competition
(33). After a 15-minute habituation period, we then recorded the
frequency of 5 unambiguous behaviors: 1) chee-poos, 2) wingsnaps, 3) roll-snaps, 4) jump-snap displays, and 5) the number of
snaps per jump-snap display (see full descriptions in Results). A
total of 4 –5 sessions was recorded for each bird during both
postimplantation days 1–5 and postimplantation days 6-10. Observation sessions occurred between 7:00 and 9:00 AM and between 12:00 and 4:30 PM, which correspond to peak display
activity in this species (23). Observation times were balanced,
Endocrinology, September 2013, 154(9):3168 –3177
such that each individual was watched an equal number of times
throughout the morning and afternoon observation windows.
The observers sat approximately 10 m from the arena so that
they were close enough to watch the bird without disturbing him.
Data were recorded in a notebook.
In a randomly selected subset of observation sessions, male
roll-snap sonations were tape-recorded (Sony TC-D5M professional tape recorder). Audio files from these recordings were
digitized (sample rate ⫽ 48 KHz; 16 bit dynamic range) and
Audacity Audio Editor (version 1.3.14) was used to produce
spectrograms of each male’s roll snaps [average 4.7 (⫾0.7 SEM)
roll snaps per bird]. Time intervals between the independent
snaps within a given roll snap were measured on spectrograms,
and these measurements were verified using waveform diagrams
of the same roll snap generated with Praat Phonetics Software
(see Figure 4, A and B). Accuracy between measurement techniques was greater than 95%.
BICAL treatment
BICAL (also known as Casodex) is a potent antiandrogen that
blocks AR in a peripherally selective manner, and it has been used
with success to antagonize AR in both small mammals and birds
(24, 25, 28). Custom-made BICAL implants (1.6 ⫻ 5 mm diameter pellets) were purchased from Innovative Research of
America (Sarasota, Florida), and they were designed to release
BICAL at a rate of 0.25 mg/d for up to 21 days. Given the average
weight of an adult male manakin during the breeding season, this
daily amount of BICAL equates to a dose of 12.5 mg/kg䡠d. In
birds, prior results suggest that this dose is sufficient to induce
nontoxic, antiandrogenic effects (28). The manufacturer provided control (blank) implants of the same size as BICAL implants and made from the same materials.
Quantitative PCR (qPCR)
Expression of mRNA in muscle and brain tissues was conducted using qPCR. Procedures for Trizol RNA extractions (Invitrogen, Carlsbad, California), Superscript II reverse transcriptase (Promega, Madison, Wisconsin) reactions, and qPCR
analysis are outlined in great detail elsewhere (22, 32, 34).
Briefly, reactions were performed in an ABI 7300 sequence detection system (Applied Biosystems Inc, Foster City, California)
using 5 ng of template. Primers for parvalbumin (forward, 5⬘TTGTCCTGAAGGGCTTTACC; reverse, 5⬘-TACCATCACCGTCCTTATCTCC), IGF-I (forward, 5⬘-AACCAGTTCTGTTGCTGCTG; reverse, 5⬘-AAAGCCTCTGTCTCCACACAC),
aromatase (forward, 5⬘-GGATGAGCACATGGATTTTGC; reverse, 5⬘-GCAGTCAGATCCCCTCTGTTC), AR (forward, 5⬘ATGAGTACCGCATGCACAAA; reverse, 5⬘-AACTCCTGGGGTGTGATCTG), sorting nexin 2 (forward, 5⬘-GCAGTAAAAGGTGTGTTTGACCAT; reverse-5⬘-CTTGCCACTTCTGCCAGCAT), and the housekeeping control gene GAPDH
(forward, 5⬘-TGACCTGCCGTCTGGAAAA; reverse, 5⬘-CCATCAGCAGCAGCCTTCA) were designed from the zebra finch
genome. Many of these primers have been used successfully on
avian tissues, including those of manakins (22, 32, 34, 35).
Primer concentrations were determined by primer optimization.
Reactions were run at 50°C for 2 minutes, 95°C for 10 minutes,
and then 40 cycles of 95°C for 15 seconds and 60°C for 1 minute.
A final dissociation stage was added to the end of the reaction,
which ran at 95°C for 15 seconds, 60°C for 30 seconds, and 95°C
doi: 10.1210/en.2013-1302
for 15 seconds. Reaction efficiencies were near 100%, and dissociation curves verified the absence of contamination. Samples
were run in duplicate. The standard curve method was used to
measure relative expression of each gene of interest (ie, quantity
gene of interest/quantity GAPDH).
Statistical analyses
In the validation experiments, we used 2-tailed t tests to compare weights, feeding behavior, and activity (hop rate) between
treatment groups. We used 2-way ANOVAs to compare mRNA
levels in wing muscles, with treatment group as one factor and
muscle as the other factor. We used t tests to compare mRNA
levels in the brain.
In analyses of adult behavior, we used a generalized linear
mixed model with a binomial distribution and a logit link function to determine whether BICAL treatment and observation
number influenced the probability of detecting males at their
respective display arenas. Bird identity was included in this
model as a random variable.
Next, we used 2-way mixed-design ANOVAS to assess effects
of BICAL on the different behaviors (each behavior was run in its
own model). In these models, BICAL treatment was the betweensubjects factor, and postimplantation time (days 1–5 or days
6 –10) was the within-subjects factor. Significant interactions
endo.endojournals.org
3171
were followed with post hoc pair-wise contrasts, with applied
least significant difference corrections. However, because jumpsnap display behavior in the BICAL birds was infrequent, the
sample sizes for the snaps/jump-snap display in the BICAL birds
were also relatively low. We therefore pooled the snaps/jumpsnap display across the postimplantation time, and we used a
2-tailed t test to measure the effect of BICAL on this variable.
For a detailed assessment of the roll-snap motor program, we
used a general linear mixed model, with BICAL treatment and
the between-snap intervals as the fixed factors and the number of
roll snaps nested within bird identity as the random variable.
Significant interactions were followed with post hoc ANOVA
and pair-wise comparison tests, with applied least significant
difference corrections.
All continuous data were log transformed [log(1⫹X)] to meet
the conditions of normality.
Results
Efficacy and validation of peripheral AR
manipulation
We first examined whether BICAL influenced the
health and activity of captive golden-collared manakins.
Figure 1. Functional effects of BICAL on mRNA expression of known androgen-dependent genes in the periphery and brain. Relative mRNA levels
of parvalbumin (A) and IGF-I (B) in 3 skeletal muscles that control wing movement (pectoralis, supracoricoideus, scapulohumeralis caudalis).
Relative mRNA levels of aromatase in the hypothalamus (C) as well as AR (D) and sorting nexin 2 (E) in the telencephalon are shown. In A and B,
asterisks within a graph’s legend depict significant overall effects of BICAL treatment on gene expression. Although some muscles appear to vary
in transcriptional responsiveness to BICAL, the actual cause of this variation is unclear considering that AR is robustly expressed in all 3 muscles
(22), and prior studies show that these same muscles produce parvalbumin and IGF-I in response to androgenic stimulation (34). In C–E, the
abbreviation N.S. denotes no significant difference (P ⬎ .05) in gene expression between control and BICAL birds. In all graphs, bars represent
means ⫾ 1 SEM. In all graphs, black bars represent controls, whereas hatched bars represent BICAL treated birds.
3172
Fuxjager et al
Peripheral Androgen Receptors and Animal Acrobatics
Endocrinology, September 2013, 154(9):3168 –3177
en-collared manakins in their natural habitat. We began this analysis by
assessing whether BICAL influences
the motivation of male birds to socially engage with conspecifics and
display (Figure 2). Within a group of
breeding males (ie, a lek), individuals
usually signal to each other in various social contexts by producing
simple chee-poo vocalizations (39).
Breeding males also exhibit extreme
fidelity for their own display arenas
on the forest floor and consequently
Figure 2. Effects of peripheral AR antagonism on behavior associated with male social arousal
compete with each other to maintain
and motivation. A, Estimated probability that the individual observing adult male behavior
located the target male at its respective display arena. Values at 1.0 represent 100% estimated
these sites (33). Indeed, blocking peprobability of relocation, whereas values at 0.0 represent 0% estimated probability of relocation.
ripheral AR with BICAL had no imEach bar represents the estimate probability as calculated by our statistical model (see Materials
pact on either of these behaviors, beand Methods), and there was no difference in the probability of relocating BICAL-treated birds
during the experiment compared with controls (P ⬎ .05). B, Average number of chee-poo calls
cause treated and untreated birds
adult male birds broadcast at or near their arena. The N.S. notation within the legend denotes no
showed no difference in the number
effect of BICAL treatment (P ⬎ .05). Chee-poo data represent means ⫾ 1 SEM. In both graphs,
of chee-poos they broadcast (F1,9 ⫽
black bars and solid lines represent controls, whereas hatched columns and dashed lines
0.27, P ⫽ .62) or the probability that
represent BICAL treated birds.
they were found around their arenas
(F1,74 ⫽ 0.10, P ⫽ .76). Neither of
Compared with controls, birds treated with BICAL
showed no difference in body weight (t5 ⫽ ⫺1.02, P ⫽ these variables changed over the course of the study (chee.36), feeding time (t5 ⫽ 1.10, P ⫽ .32), or number of perch poo: F1,9 ⫽ 0.04, P ⫽ .84; arena maintenance: F10,74 ⫽
hops (t5 ⫽ 1.08, P ⫽ .33). Thus, BICAL treatment itself did 0.75, P ⫽ .68), and both of these variables were unaffected
not induce toxic-like effects that might otherwise suppress by treatment ⫻ time-course interactions (chee-poo: F1,9 ⫽
0.10; P ⫽ .77; arena maintenance: F9,74 ⫽ 0.25, P ⫽ .97).
physical condition, alertness, and levels of activity.
In these same individuals, we validated that BICAL These data are therefore consistent with the notion that
blocks AR in a peripherally selective manner by assessing BICAL administration did not disrupt social motivation,
this drug’s effect on mRNA expression of known andro- since treated individuals exhibited a similar ability and
gen-dependent genes in both the periphery and the brain willingness to interact with others and maintain their dis(Figure 1). BICAL treatment down-regulated the expres- play arena.
To determine whether peripheral AR influenced the
sion of parvalbumin (F1,15 ⫽ 4.71, P ⫽ .046) and IGF-I
(F1,15 ⫽ 4.62, P ⫽ .048) in the wing musculature. Past acrobatic elements of the wild birds’ display, we analyzed
work shows that both of these genes are under strong the effects of BICAL treatment on 4 unambiguous display
AR-dependent regulation in manakin skeletal muscles maneuvers that demand exquisite agility and motor per(34). In contrast, BICAL treatment had no effect on ex- formance (Figure 3, A and B): 1) wing-snaps, 2) roll-snaps,
pression of hypothalamic aromatase (t5 ⫽ 0.43, P ⫽ .68) 3) jump-snap displays, and 4) the number of wing-snaps
or telencephalic AR (t5 ⫽ 1.57, P ⫽ .18) and sorting nexin per jump-snap display (20, 21, 40). Wing-snaps are loud
2 (t5 ⫽ ⫺0.25, P ⫽ .82). Past work in birds and mammals mechanical sonations produced when males powerfully
shows that such neuronal expression of these 3 genes de- hit their wings together above their head. Similarly, rollpends on androgen action (36 –38). These results collec- snaps are produced when males successively snap their
tively show that BICAL blunts the functional effects of AR wings together at a rate of approximately 50 – 60 snaps/sec
outside the CNS, like in skeletal muscles, but not inside the (Hz). Jump-snap displays are the birds’ main courtship
CNS itself. Our findings therefore provide some of the first dance; they are performed when males leap among sapvalidation that BICAL blocks avian AR in a peripherally lings over a small arena on the forest floor at speeds of
approximately 2.5 m/sec, and during each of these leaps,
specific way.
males can produce a single wing-snap in midair. All of
Peripheral AR and male acrobatic performance
these behaviors, including the number of snaps incorpoWe next explored the effects of peripheral AR on the rated into jump-snap routines, are greatly reduced in redisplay repertoire of wild, reproductively active male gold- sponse to BICAL treatment (Figure 3, C–F; wing-snaps:
doi: 10.1210/en.2013-1302
endo.endojournals.org
3173
Figure 3. Impact of peripheral AR antagonism on wild, adult male golden-collared manakin display behavior. A, Schematic of a reproductively
active male hitting his wings together above his head to produce either a wing-snap sonation (single hit) or a roll-snap sonation (multiple, rapid
hits). B, Schematic of a reproductively active bird performing his jump-snap display, in which he rapidly leaps from sapling to sapling around an
arena that he has cleared for himself on the forest floor. During each of these leaps, the male snaps his wings together in midair. Average number
of wing-snaps (C), roll-snaps (D), jump-snap displays (E), and average number of snaps per jump-snap display (F) is shown. Due to infrequent jumpsnap displaying in BICAL birds (see panel E), sample sizes for snaps per jump-snap display in BICAL birds (F) were low; thus, snaps per jump-snap
display data were pooled across postimplantation time. Data represent means ⫾ 1 SEM. In all line graphs, asterisks within the legend denote a
significant effect of BICAL treatment (P ⬍ .05). Asterisks above specific lines denote significant changes in behavior within individuals of the same
treatment group (P ⬍ .05). Solid lines and black bars represent controls, whereas dashed lines and hatched lines represent BICAL treated birds.
F1,9 ⫽ 37.77, P ⬍ .001; roll-snaps: F1,9 ⫽ 107.95, P ⬍
.001; jump-snap displays: F1,9 ⫽ 32.74, P ⬍ .001; snaps/
jump snap display: t9 ⫽ 2.33, P ⫽ .045). Overall, the
frequency with which most of these behaviors were produced did not change over time (wing snap: F1,9 ⫽ 2.42;
P ⫽ .15; roll snap: F1,9 ⫽ 0.31; P ⫽ .59; jump snap display:
F1,9 ⫽ 0.05; P ⫽ .83), and only wing-snap behavior was
affected by a significant treatment ⫻ time-course interaction (wing-snap: F1,9 ⫽ 6.26; P ⫽ .034; roll-snap: F1,9 ⫽
0.17; P ⫽ .69; jump-snap display: F1,9 ⫽ 2.51; P ⫽ .15).
Analysis of this interaction showed that BICAL’s suppressive effect on wing-snap behavior increased as the study
progressed (Figure 3C; P ⬍ .05).
A remarkable feature of wing-snap and jump-snap maneuvers is that they are performed at speeds faster than the
human eye can detect. The roll-snap, for example, requires
rapid and precise wing elevation and retraction, because
the sonation is the product of approximately 6 –20 independent wing-snap events that are repeated within a time
span of about 100 –350 milliseconds (Figure 4, A and B;
see also Supplemental Movie 1, published on The Endocrine Society’s Journals Online web site at http://endo.en-
dojournals.org). The average interval between snap events
is roughly 19 milliseconds, and during this time, the wings
are lifted above the head from a half-raised position, hit
together above the head, and then retracted back to the
half-raised position. As such, we investigated whether peripheral AR influenced these fine motor skills by assessing
the impact of BICAL on the acoustic patterning of the
roll-snap sonation (Figure 4C). Treatment with BICAL
not only shortened the number of snaps included in a given
roll and thus the overall duration of the roll-snap itself
(F22,385 ⫽ 2.50, P ⬍ .001), but also increased the average
time interval between independent snap events by around
2 milliseconds (⬃10%–15%) (F1,86 ⫽ 14.49, P ⬍ .001).
Furthermore, measures of the between-snap interval were
affected by a significant treatment ⫻ snap-interval number
interaction (F7,386 ⫽ 3.98, P ⬍ .001). This, in effect, means
that BICAL caused birds to snap their wings together more
slowly at the onset of a roll-snap but then speed up the rate
of snapping as the roll-snap progressed (F7,132 ⫽ 3.71, P ⫽
.001; post hoc tests, P ⬍ .05). In contrast, the control birds
snapped their wings together at a relatively constant rate
throughout an entire roll-snap (F22,311 ⫽ 1.28, P ⫽ .181).
3174
Fuxjager et al
Peripheral Androgen Receptors and Animal Acrobatics
Endocrinology, September 2013, 154(9):3168 –3177
treated males were found on their
display areas with equal probability
to controls and readily produced
chee-poo vocalizations that are
strongly associated with social arousal
and engagement (39). Thus, our results collectively suggest that peripheral AR maintains the capacity for
acrobatic performance by acting in a
bottom-up manner. This may ultimately occur through some form of
AR-induced gating of the processes
through which instruction from the
brain and spinal cord is communicated to and/or translated into intricate muscular contraction patterns
throughout the body.
Androgenic control of elaborate
display behavior
We hypothesize that the effects of
peripheral AR on display output
originate in part from androgenic action on skeletal muscles. Golden-collared manakins express high levels of
muscular AR compared with other
passerine species that do not exhibit
Figure 4. Effects of peripheral AR on the fine motor pattern of the male’s roll-snap signal. A,
elaborate social displays, and
Spectrogram of a control bird’s roll snap. Each black broadband line represents an independent
manakin wing muscles have a
snap event within the series of snaps, which ultimately makes up the roll-snap sonation. The
space between independent snap events represents the duration between snaps within a roll
greater capacity to convert androsnap. B, Waveform diagram of the same roll snap on which between-snap interval measurements
gens to their more potent androgenic
were confirmed. Each spike represents a single snap event, within the entire roll-snap signal. The
metabolites (22). Moreover, gene exspace between spikes represents the time interval between snap events. C, Average time intervals
between snap events within a roll-snap for BICAL and control birds. Asterisk in the legend denotes a
pression data from previous studies
significant effect of treatment (P ⬍ .05). Asterisks below the lower error bars of the BICAL bird data
show that the androgen testosterone
points represent significant differences in the time interval at the specific snap interval compared to
increases muscular mRNA exprescontrols (post hoc contrasts, P ⬍ .05). Differences in letters above error bars represent significant
sion of parvalbumin and IGF-I (34),
differences between snap interval durations within BICAL birds (post hoc ANOVA with between
group comparisons, P ⬍ .05). All data represent means ⫾ 1 SEM. Solid line represents controls,
and work presented here confirms
whereas dashed line represents BICAL treated birds.
that this action occurs via AR. The
products of these two genes play imDiscussion
portant roles in regulating neuromuscular function. For
Here, we show that the AR in the periphery supports the example, parvalbumin enhances calcium buffering in
performance and fine motor coordination of the golden- muscle cells, which in turn increases the speed of muscle
collared manakin’s acrobatic social display. This occurs in contraction cycling (41, 42). IGF-I, on the other hand, not
a manner that is independent of central AR activation, only increases the size and strength of muscle fibers (43,
because blocking AR outside the CNS changes both the 44) but also travels from the muscle to the spinal cord in
frequency with which male birds perform elaborate com- a retrograde fashion in which it then acts to maintain spiponents of their display repertoire and certain components nal circuitry (45, 46). In light of these findings, it appears
of the display moves themselves. Our validation studies as though muscular AR influences how male birds proconfirm that BICAL antagonizes AR in a peripherally se- duce complex display behavior by modulating either the
lective manner and does not impede an individuals’ health functional abilities of the muscle tissue itself and/or the
or activity. Moreover, BICAL does not appear to impact spinal circuits (or spinal central pattern generators) that
behavior associated with the motivation to display, since underlie the motor programs of rapid wing and leg move-
doi: 10.1210/en.2013-1302
ment. Notably, any of these changes to the muscle and
spinal cord may also adjust somatosensory processing and
integration, which in theory may also affect display
performance.
The effects of BICAL on display output occurred relatively rapidly, with males showing significant decreases in
acrobatic display behavior within the first five days of
treatment. This implies that AR inhibition influences display output by affecting muscle contractility, rather than
overall muscle size. For example, a precipitous decrease in
the production of parvalbumin might quickly increases the
speed of muscle contraction cycling by reducing muscle
relaxation time (42). On the other hand, the immediate
impact of IGF-I on muscles may be more subtle (44), because changes in IGF-I production can precede corresponding modifications to muscle growth and hypertrophy (47). We can only speculate about these ideas, given
that the time frame in which we assessed how BICAL influences muscular gene expression did not directly overlap
with the time frame in which we assessed how BICAL
influences adult male behavior. Future studies are needed
to examine how variation in AR-dependent genes in muscle tissues is related to different aspects of breeding male
display routines and motor skills.
Even as our results underscore the significance of peripheral AR on display output, they obviously do not exclude the central effects of AR action on normal display
exhibition. For example, prior work in golden-collared
manakins shows that the antiandrogen flutamide, which
blocks AR both peripherally and centrally, influences all
aspects of male display performance, including the number of times males produce chee-poo vocalizations (23).
Given that our peripherally selective manipulation of AR
did not impact the rates of chee-poo production and that
flutamide blocks AR in the CNS, it appears likely that
centralized populations of AR govern how frequently
male birds broadcast these calls while they maintain their
display sites. In addition, neuroanatomical studies of AR
expression patterns within the golden-collared manakin
CNS suggest that the spinal cord is an especially critical
site at which androgens act to influence motor control of
the wings and legs (32, 48). Thus, in the context of these
past experiments, our current work suggests that androgens tightly modulate motor control of manakin social
behavior at multiple levels of the neuromuscular system.
Building further on this idea, it is also possible that
peripheral androgenic action influences other organ systems that either directly or indirectly impact male display
behavior. Cardiovascular activity, respiration, and digestion are just a few of these processes that obviously contribute to the males’ acrobatic routines, and thus preventing androgenic modulation of these systems might in
endo.endojournals.org
3175
theory alter display output. How androgens potentially
integrate these discrete organs simultaneously for elaborate reproductive behavior is not understood and is a current interest of our laboratory.
Functional significance
Prior studies show that individual adult male goldencollared manakins vary not only in the number of times
they normally produce different display moves around
their arenas, but also in the speed with which they actually
perform these maneuvers (30, 40, 49). This latter finding
is revealed by high-speed videography of males performing their main jump-snap display routines, and it turns out
that individual differences in display speeds occur on the
order of milliseconds (40). Studies that focus on malefemale interactions indicate that females prefer to mate
with males that perform acrobatic maneuvers more frequently and fractions of a second faster than other conspecifics in the population (49). Although this past work
suggests that female golden-collared manakins are able to
perceive minuscule differences in male performance speed,
it also implies that females can detect the changes to male
behavior we induced through BICAL treatment, including
the subtle millisecond-scale changes to the temporal patterning of the roll snap. Thus, peripheral AR action may
enhance male motor performance in a way that affects the
courtship skills and mating success of breeding males.
Evolutionary considerations
In the context of studies on animal vocal communication, our current work implies a degree of convergence in
the androgenic mechanisms that modulate adaptive
acoustic signal repetition. The roll snap is a repetitive,
broad-frequency acoustic signal (Figure 4, A and B) and is
used by females to assess male motor skills when making
mate choice decisions (49). In this way, roll snaps are reminiscent of trills, or rapidly repeated notes, that are part of
many avian (50, 51) and mammalian vocal displays (52,
53). In these species, performance limits constrain the production of trills (54), and thus trill rate can signal an individual’s competitive ability and attractiveness (55, 56).
The few studies that investigate the effects of androgens on
trill production suggest that the activation of AR influences the length and temporal patterning of trill bouts
within a song (53); however, this work does not tease apart
peripheral and central effects of androgens on trill performance. This past work and our current study imply that
AR plays a role in modulating mechanisms that control
signal repetition, regardless of whether the signal is vocal,
and thus originates from vocal organs (ie, syrinx or larynx), or whether the signal is mechanical, and thus originates from specialized body and limb movement. Our
3176
Fuxjager et al
Peripheral Androgen Receptors and Animal Acrobatics
results therefore also provide broader insight into the evolution of elaborate and unusual display routines, such as
roll snaps and trills.
Finally, it is notable that androgens likely act within the
golden-collared manakins’ wing musculature to refine
complex reproductive display behavior, because these
muscles also are crucial for day-to-day nonreproductive
activities (57). As indicated above, in most other research
examining androgen-muscle interactions, the muscles under examination serve predominantly sex-specific functions (11–15), such that androgenic effects on these tissues
most likely have little influence on the ability to perform
basic locomotory activities. In golden-collared manakins,
however, the tissues on which AR acts regulate the lifting
and retraction of the bird’s wings (57), and thus modifications to the basic anatomy and/or physiology of these
tissues for reproductive behavior may uniquely impose a
cost on the level of optimal flight performance that is otherwise necessary for daily living. Further research is
needed to explore these possible trade-offs between different muscular needs for sociosexual behavior and
survival.
Conclusions
In summary, we show that activation of peripheral AR
sustains the acrobatic abilities and fine motor skills that
are necessary for male golden-collared manakins to perform their elaborate sociosexual displays. Given that these
effects are coupled with motor control and coordination
and that this species expresses high levels of AR in its
muscle tissues (22), we conclude that peripheral AR modulates the output of complex behavior by acting within the
musculoskeletal system itself.
Acknowledgments
We thank Andy Bass for helpful conversations about this manuscript and data. We also thank Michelle Rensel, Kyla Davidoff,
Joy Eaton, and Mital Shah for assistance collecting and analyzing
data. We also thank STRI and its administrative staff for their
assistance with this project as well as Autoridad Nacional del
Ambiente and the Autoridad del Canal de Panama for permission to conduct these studies. M.J.F. was supported in part by
National Institutes of Health Training Grant T32 HD007228
awarded to the Laboratory of Neuroendocrinology at the University of California, Los Angeles.
Address all correspondence and requests for reprints to:
Matthew Fuxjager PhD, University of California, Los Angeles, Integrative Biology and Physiology, 610 Charles E. Young Drive, Los
Angeles, California 90095. E-mail: [email protected].
Endocrinology, September 2013, 154(9):3168 –3177
This work was supported by National Science Foundation
Grant IOS-0646459 (to B.A.S.).
Disclosure Summary: The authors have nothing to declare.
References
1. Hogg JT, Forbes SH. Mating in bighorn sheep: frequent male reproduction via a high-risk “unconventional” tactic. Behav Ecol Sociobiol. 1997;41:33– 48.
2. Thorbjarnarson JB, Hernandez G. Reproductive ecology of the Orinoco crocodile (Crocodylus intermedius) in Venezuela. II. Reproductive and social behavior. J Herpetol. 1993;27:371–379.
3. Masonjones HD, Lewis SM. Courtship behavior in the dwarf seahorse, Hippocampus zosterae. Copeia. 1996;634 – 640.
4. Nuechterlein GL, Storer RW. The pair formation displays of the
western grebe. Condor. 1982;84:350 –369.
5. Bostwick KS, Prum RO. High-speed video analysis of wing-snapping in two manakin clades (Pipridae: Aves). J Exp Biol. 2003;206:
3693–3706.
6. Frith CB, Cooper WT. Courtship display and mating of Victoria’s
riflebird, Ptiloris victoriae, with notes on the courtship displays of
congeneric species. Emu. 1996;96:102–113.
7. Adkins-Regan E. Hormones and Animal Social Behavior. Princeton,
NJ: Princeton University Press; 2005.
8. Regnier M, Herrera AA. Differential sensitivity to androgens within
a sexually dimorphic muscle of male frogs (Xenopus laevis). J Neurobiol. 1993;24:1215–1228.
9. Michel G, Baulieu EE. Androgen receptor in rat skeletal muscle:
characterization and physiological variations. Endocrinology.
1980;107:2088 –2098.
10. Kadi F, Bonnerud P, Eriksson A, Thornell LE. The expression of
androgen receptors in human neck and limb muscles: effects of training and self-administration of androgenic-anabolic steroids. Histochem Cell Biol. 2000;113:25–29.
11. Rand MN, Breedlove SM. Androgen locally regulates rat bulbocavernosus and levator ani size. J Neurobiol. 1992;23:17–30.
12. Regnier M, Herrera AA. Changes in the contractile properties by
androgen hormones in sexually dimorphic muscles of male frogs
(Xenopus laevis). J Physiol (Camb). 1993;461:565–581.
13. Brantley RK, Marchaterre MA, Bass AH. Androgen effects on vocal
muscle structure in a teleost fish with intersexual and intrasexual
dimorphism. J Morphol. 1993;216:305–318.
14. Fischer L, Catz D, Kelley D. An androgen receptor messenger-RNA
isoform associated with hormone induced cell proliferation. Proc
Nat Acad Sci USA. 1993;90:8254 – 8258.
15. Veney SL, Wade J. Steroid receptors in the adult zebra finch syrinx:
a sex difference in androgen receptor mRNA, minimal expression of
estrogen receptor alpha and aromatase. Gen Comp Endocrinol.
2004;136:192–199.
16. Brenowitz EA, Lent K. Act locally and think globally: Intracerebral
testosterone implants induce seasonal-like growth of adult avian
song control circuits. Proc Nat Acad Sci USA. 2002;99:12421–
12426.
17. Remage-Healey L, Joshi NR. Changing neuroestrogens within the
auditory forebrain rapidly transform stimulus selectivity in a downstream sensorimotor nucleus. J Neurosci. 2012;32:8231– 8241.
18. Barclay SR, Harding CF. Differential modulation of monoamine
levels and turnover rates by estrogen and/or androgen in hypothalamic and vocal control nuclei of male zebra finches. Brain Res.
1990;523:251–262.
19. Soma KK, Wissman AM, Brenowitz EA, Wingfield JC. Dehydroepiandrosterone (DHEA) increases territorial song and the size of an
associated brain region in a male songbird. Horm Behav. 2002;41:
203–212.
doi: 10.1210/en.2013-1302
20. Schlinger BA, Day LB, Fusani L. Behavior, natural history and neuroendocrinology of a tropical bird. Gen Comp Endocrinol. 2008;
157:254 –258.
21. Chapman FM. The courtship of Gould’s manakin (Manacus vitellinus vitellinus) on Barro Colorado Island, Canal Zone. Bull Am Museum Nat Hist. 1935;68:472–521.
22. Feng NY, Katz A, Day LB, Barske J, Schlinger BA. Limb muscles are
androgen targets in an acrobatic tropical bird. Endocrinology.
2010;151:1042–1049.
23. Fusani L, Day LB, Canoine V, Reinemann D, Hernandez E,
Schlinger BA. Androgen and the elaborate courtship behavior of a
tropical lekking bird. Horm Behav. 2007;51:62– 68.
24. Freeman SN, Mainwaring WIP, Furr BJA. A possible explanation
for the peripheral selectivity of a novel non-steroidal pure antiandrogen, Casodex (ICI 176,334). Br J Cancer. 1989;60:664 – 668.
25. Furr BJA. Casodex (ICI-176,334)—a new, pure, peripherally selective anti-androgen: preclinical studies. Horm Res. 1989;32:69 –76.
26. Soma KK, Sullivan K, Tramontin AD, Saldanha CJ, Schlinger BA,
Wingfield JC. Acute and chronic effects of an aromatase inhibitor on
territorial aggression in breeding and nonbreeding male song sparrows. J Comp Physiol A. 2000;186:759 –769.
27. Fusani L, Gahr M, Hutchison JB. Aromatase inhibition reduces
specifically one display of the ring dove courtship behavior. Gen
Comp Endocrinol. 2001;122:23–30.
28. Fennell MJ, Radecki SJ, Proudman JA, Scanes CG. The suppressive
effects of testosterone on growth in young chickens appears to be
mediated via peripheral androgen receptor; studies of the anti-androgen ICI 176,334. Poult Sci. 1996;75:763–766.
29. Sperry TS, Wacker DW, Wingfield JC. The role of androgen receptors in regulating territorial aggression in male song sparrows. Horm
Behav. 2010;57:86 –95.
30. Day LB, Fusani L, Hernandez E, et al. Testosterone and its effects on
courtship in golden-collared manakins (Manacus vitellinus): seasonal, sex, and age differences. Horm Behav. 2007;51:69 –76.
31. Day LB, McBroom JT, Schlinger BA. Testosterone increases display
behaviors but does not stimulate growth of adult plumage in male
golden-collared manakins (Manacus vitellinus). Horm Behav. 2006;
49:223–232.
32. Fuxjager MJ, Schultz JD, Barske J, et al. Spinal motor and sensory
neurons are androgen targets in an acrobatic bird. Endocrinology.
2012;153:3780 –3791.
33. McDonald JB, Clay RP, Brumfield RT, Braun MJ. Sexual selection
on plumage and behavior in an avian hybrid zone: experimental tests
of male-male interactions. Evolution. 2001;55:1443–1451.
34. Fuxjager MJ, Barske J, Du S, Day L, Schlinger BA. Androgens regulate gene expression in avian skeletal muscles. PLoS One. 2012;
7:e51482.
35. Tomaszycki ML, Peabody C, Replogle K, Clayton DF, Tempelman
RJ, Wade J. Sexual differentiation of the zebra finch song system:
potential roles for sex chromosome genes. BMC Neurosci. 2009;
10:24.
36. Harada N, Abedohmae S, Loeffen R, Foidart A, Balthazart J. Synergism between androgens and estrogens in the induction of aromatase and its messenger RNA in the brain. Brain Res. 1993;622:
243–256.
37. Wu D, Tang YP, Wade J. Co-localization of Sorting Nexin 2 and
androgen receptor in the song system of juvenile zebra finches. Brain
Res. 2010;1343:104 –111.
38. Lu S, Simon NG, Wang Y, Hu S. Neural androgen receptor regu-
endo.endojournals.org
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
3177
lation: effects of androgen and antiandrogen. J Neurobiol. 1999;
41:505–512.
Schlinger BA, Schultz JD, Hertel F. Neuromuscular and endocrine
control of an avian courtship behavior. Horm Behav. 2001;40:276 –
280.
Fusani L, Giordano M, Day LB, Schlinger BA. High-speed video
analysis reveals individual variability in the courtship displays of
male golden-collared manakins. Ethology. 2007;113:964 –972.
Heizmann CW, Berchtold MW, Rowlerson AM. Correlation of
parvalbumin concentration with relaxation speed in mammalian
muscle. Proc Natl Acad Sci USA. 1982;79:7243–7247.
Muntener M, Kaser L, Weber J, Berchtold MW. Increase of skeletal
muscle relaxation speed by direct injection of parvalbumin cDNA.
Proc Natl Acad Sci USA. 1995;92:6504 – 6508.
Musaro A, McCullagh KJA, Naya FJ, Olson EN, Rosenthal N.
IGF-1 induces skeletal myocyte hypertrophy through calcineurin in
association with GATA-2 and NF-ATc1. Nature. 1999;400:581–
585.
Adams GR, McCue SA. Localized infusion of IGF-I results in skeletal muscle hypertrophy. J Appl Physiol. 1998;84:1716 –1722.
Kaspar BK, Llado J, Sherkat N, Rothstein JD, Gage FH. Retrograde
viral delivery of IGF-1 prolongs survival in a mouse ALS model.
Science. 2003;301:839 – 842.
Dobrowolny G, Giacinti C, Pelosi L, et al. Muscle expression of a
local Igf-1 isoform protects motor neurons in an ALS mouse model.
J Cell Biol. 2005;168:193–199.
Adams GR, Haddad F, Baldwin KM. Time course of changes in
markers of myogenesis in overloaded rat skeletal muscles. J Appl
Physiol. 1999;87:1705–1712.
Schultz JD, Schlinger BA. Widespread accumulation of [H-3]testosterone in the spinal cord of a wild bird with an elaborate courtship
display. Proc Natl Acad Sci USA. 1999;96:10428 –10432.
Barske J, Schlinger BA, Wikelski M, Fusani L. Female choice for
male motor skills. Proc R Soc Lond Ser B Biol Sci. 2011;278:3523–
3528.
de Kort SR, Eldermire ERB, Valderrama S, Botero CA, Vehrencamp
SL. Trill consistency is an age-related assessment signal in banded
wrens. Proc R Soc B Biol Sci. 2009;276:2315–2321.
Sockman KW. Annual variation in vocal performance and its relationship with bill morphology in Lincoln’s sparrows, Melospiza lincolnii. Anim Behav. 2009;77:663– 671.
Behr O, von Helversen O. Bat serenades— complex courtship songs
of the sac-winged bat (Saccopteryx bilineata). Behav Ecol Sociobiol.
2004;56:106 –115.
Pasch B, George AS, Hamlin HJ, Guillette LJ, Phelps SM. Androgens
modulate song effort and aggression in neotropical singing mice.
Horm Behav. 2011;59:90 –97.
Podos J. A performance constraint on the evolution of trilled vocalizations in a songbird family (Passeriformes: Emberizdae). Evolution. 1997;51:537–551.
Pasch B, George AS, Campbell P, Phelps SM. Androgen-dependent
male vocal performance influences female preference in neotropical
singing mice. Anim Behav. 2011;82:177–183.
Illes AE, Hall ML, Vehrencamp SL. Vocal performance influences
male receiver response in the banded wren. Proc R Soc B Biol Sci.
2006;273:1907–1912.
Dial KP. Activity patterns of the wing muscles of the pigeon (Columbia livia) during different modes of flight. J Exp Zool. 1992;
262:357–373.