RESPONSES OF JELLYFISH TO ENVIRONMENTAL CHANGE
Shannon Klein
BSc (Hons)
Griffith School of Environment
Griffith Sciences
Griffith University, Gold Coast Campus, Queensland, Australia
Submitted in fulfilment of the requirements
of the degree of
Doctor of Philosophy
September 2016
ABSTRACT
Worldwide, marine ecosystems are being impacted by a suite of anthropogenic
stressors. Jellyfish are distributed worldwide and often proliferate rapidly to form
conspicuous and problematic blooms. Jellyfish are considered robust to a range of
environmental stressors and, as a consequence, there is concern among researchers that
changing environmental conditions could facilitate jellyfish populations. There is,
however, a paucity of robust evidence to support these claims because few manipulative
experiments have been done to establish causative mechanisms that may allow jellyfish
to proliferate under environmental stress. The overall aim of this thesis was to use
manipulative experiments to test hypotheses about the influence of local, regional and
global scale stressors on jellyfish.
To assess the potential interactive effects of environmental stressors that occur
episodically and on a local scale, I investigated the potential interactive effects of
reduced salinity and a photosystem II herbicide (atrazine) on symbiotic medusae of
Cassiopea sp. during a simulated rainfall event (Chapter 2). Medusae exposed to
reduced salinity and high concentrations of atrazine individually exhibited negative
effects. Medusae survived and recovered from conditions that mimicked mild and
moderate rainfall events, but exposure to conditions that mimicked a heavy rainfall
event (i.e. reduced salinity and high concentrations of atrazine in combination) caused
medusae to die. These findings suggest that although symbiotic medusae can tolerate
mild and moderate rainfall events, medusae may not survive heavy rainfall events that
typically expose biota to high levels of herbicide runoff and reduced salinity.
Global scale stressors occur concomitantly and have the potential to influence jellyfish
populations. I, therefore, examined the potential interactive effects of ocean warming
and future UV-B scenarios (both increasing and decreasing) on symbiotic jellyfish
ii
polyps of Cassiopea sp. (Chapter 3). Warming enhanced rates of asexual reproduction
of polyps and had no effect on the photochemical efficiency of symbionts under low
UV-B conditions. Under current and high UV-B conditions, however, warming reduced
polyp reproduction and photochemical efficiency of symbionts. If warming and reduced
UV-B conditions occur concomitantly in the future then Cassiopea sp. polyps may
continue to proliferate. If, however, warming coincides with elevated UV-B conditions
then polyp populations may decline in the future.
Jellyfish that harbour symbionts may have an ecological advantage over other nonsymbiotic jellyfish under environmental stress because symbionts take up and fix CO2,
produce oxygen during photosynthesis, and translocate carbon to the host. Chapter 4
assessed the role of symbionts (Symbiodinium) in potentially mitigating the concomitant
effects of hypoxia and acidification on polyps of Cassiopea sp. that occur during
microbial-driven coastal hypoxic events Although aposymbiotic polyps exposed to
hypoxia and acidification survived, the stressors in combination exacerbated the
negative effects on polyps relative to those exposed to the stressors individually.
Symbiotic polyps exposed to the dual stressors, however, responded similarly to those
raised under ambient conditions. Importantly, these findings demonstrate that
Symbiodinium mitigated the negative effects of hypoxia and acidification in
combination on Cassiopea sp. polyps and suggest that symbiotic polyps may continue
to proliferate in response to the dual stressors. Aposymbiotic polyps, however, may
decline when hypoxia and acidification co-occur.
Marine organisms may become more resistant to environmental change over time
through acclimation (or acclimatization) processes. Chapter 5 examined the potential
role of acclimation in mitigating the effects of future warming and acidification
conditions. I pre-exposed polyps of the Irukandji jellyfish Alatina nr mordens to
iii
elevated temperature and low pH, separately and in combination. Polyps were then
subsequently exposed to either current or future conditions (warming and acidification)
during a secondary exposure. Pre-exposure to warming and acidification in isolation
mitigated the negative effects of future conditions on polyps. Polyps pre-exposed to
warming and acidification in combination, however, exhibited negative effects,
suggesting that pre-exposure to the dual stressors did not mitigate the negative effects of
future conditions. Although pre-exposure to warming and acidification individually
could facilitate the proliferation of polyps, ocean warming and acidification are likely to
occur concomitantly and thus, polyps of A. nr mordens are unlikely to thrive in response
to the dual stressors.
In the studies conducted in this thesis, jellyfish (in most cases) survived the various
environmental stressors tested, but most failed to proliferate. Importantly, these findings
do not support claims that all jellyfish are robust to environmental stress. These
observations highlight the need to investigate the potential interactive effects of cooccurring stressors and suggest that conclusions based on studies that investigate the
effects of individual stressors should be interpreted cautiously when predicting how
jellyfish may respond to changing environmental conditions. Symbionts and
acclimation may play an important role in the proliferation of jellyfish under
environmental stress.
iv
STATEMENT OF ORIGINALITY
This work has not previously been submitted for a degree or diploma in any university.
To the best of my knowledge and belief, the thesis contains no material previously
published or written by another person except where due reference is made in the thesis
itself.
________________________________ Date: 09-09-2016
Shannon Klein
v
ACKNOWLEGEMENTS
I would like to express my sincerest gratitude to my principal supervisor Associate
Professor Kylie Pitt and my associate supervisor Professor Anthony Carroll for their
enduring support, patience, guidance and continuous enthusiasm throughout out my
candidature. In particular, I have been fortunate to have their thoughtful input and
editorial advice, which greatly improved the quality of this thesis and published papers
within. I thank the staff and fellow postgraduates at the Griffith School of Environment
and Australian Rivers Institute (Coast and Estuaries), particularly David Welsh, Fred
Leusch, Will Bennett, Peter Teasdale, Michael Arthur, Erin Wallace, David Spencer,
Ariella Chelsky, Chris Henderson, Anusuya Willis, Tyson Martin, Ben Gilby, Sarah
Engelhard and Mariel Familiar-Lopez for discussion, feedback and advice during the
course of my project.
Thank you to David Suggett, Matthew Nitschke and Sam Goyen for the opportunity to
collaborate, your advice and molecular analyses. I am tremendously grateful to Michael
Arthur and Jason Hay for their invaluable help and guidance with statistical analyses. I
am extremely grateful to Jamie Seymour and, Amanda Reno and Kate Wilson from
Underwater World, Sunshine Coast, for cultures of jellyfish and advice on husbandry. I
would also like to thank Dan Tonzing for his advice, laboratory assistance and extensive
technical support during my candidature. I am particularly grateful to Dusty McLean,
Erin Wallace, Tyson Martin, David Spencer, Chris Henderson, Lana Shaw, Novodha
Dissanayake, Asier Olalde, Nic Dorean, Deya Angulo Chinas, Catherine Pickering, Rod
Connolly, Jan Warnken, Steve Melvin, Jason van de Merwe, Tony Farrell and James
Furse for their amazing friendship and support.
I express my deepest appreciation to my Mum, Dad and grandparents for their
unconditional support and encouragement.
This work was funded by Griffith University and an Australian Postgraduate Award.
vi
ACKNOWLEDGEMENT OF CO-AUTHORED PAPERS
Included in this thesis are two published papers (Chapters 2 and 3), and two manuscript
submitted for publication (Chapters 4 and 5), which are co-authored by other
researchers. My contribution to each research chapter is outlined at the beginning of the
relevant chapters. The bibliographic details and status of these papers are:
Klein SG, Pitt KA, Carroll AR (2016) Reduced salinity increases susceptibility of
zooxanthellate jellyfish to herbicide toxicity during a simulated rainfall event.
Environmental Pollution 209:79-86 10.
Klein SG, Pitt KA, Carroll AR (2016) Surviving but not thriving: inconsistent
responses of zooxanthellate jellyfish polyps to ocean warming and future UV-B
scenarios. Scientific Reports 6: 28859.
Klein SG, Pitt KA, Nitschke MR, Goyen S, Welsh DT, Suggett DJ, Carroll AR
(submitted for publication) Symbiodinium mitigate the combined effects of hypoxia and
acidification on a non-calcifying cnidarian.
Klein SG, Pitt KA, Carroll AR (submitted for publication) Pre-exposure to individual,
but not simultaneous, climate change stressors allow Irukandji jellyfish polyps to cope
under future conditions.
Appropriate acknowledgements of those who contributed to the research but did not
qualify as authors are included at the end of each chapter.
_________________________ Date: 09-09-2016
Shannon Klein
_________________________ Date: 09-09-2016
Supervisor: Kylie Pitt
vii
RELATED PUBLICATIONS AND PRESENTATIONS
Peer reviewed publications
Klein SG, Pitt KA, Carroll AR (2016) Reduced salinity increases susceptibility of
zooxanthellate jellyfish to herbicide toxicity during a simulated rainfall event.
Environmental Pollution 209:79-86 10.
Klein SG, Pitt KA, Carroll AR (2016) Surviving but not thriving: inconsistent
responses of zooxanthellate jellyfish polyps to ocean warming and future UV-B
scenarios. Scientific Reports 6: 28859.
Conference presentations based on this thesis:
Klein SG, Pitt KA, Nitschke M, Goyen S, Welsh D, Suggett D, Carroll AR. The role of
zooxanthellae in mitigating the effects of hypoxia and acidification on jellyfish polyps.
Fifth International Jellyfish Blooms Symposium, Drivers of jellyfish blooms section,
June, 2016. Barcelona, Spain.
Klein SG, Pitt KA, Carroll AR. Freshwater input increases the vulnerability of
Cassiopea sp. jellyfish to herbicide exposure. Australian Marine Sciences Association
(AMSA) annual national conference. August, 2014. Canberra, ACT, Australia.
Klein SG, Pitt KA, Carroll AR. Interactive effects of herbicide toxicity and reduced
salinity on the zooxanthellate jellyfish, Cassiopea sp. Australian Coral Reefs Society
conference. General Session, August 2014. Brisbane City, QLD, Australia.
Klein SG, Pitt KA, Carroll AR. Investigating the effects of environmental stressors on
the early life history stages of jellyfish. Australian Rivers Institute annual higher degree
research symposium. July, 2014. Nathan, QLD, Australia.
viii
TABLE OF CONTENTS
Abstract ........................................................................................................................... ii
Statement of originality ...................................................................................................v
Acknowlegements .......................................................................................................... vi
Acknowledgement of co-authored papers .................................................................. vii
Related publications and presentations ..................................................................... viii
Chapter 1 An introduction to the influence of environmental change on jellyfish ..........1
Objectives and overview of thesis ........................................................................16
Chapter 2 Reduced salinity increases the susceptibility of zooxanthellate jellyfish to
herbicide toxicity during a simulated rainfall event ........................................................28
Chapter 3 Surviving but not thriving: inconsistent responses of zooxanthellate jellyfish
polyps to ocean warming and future UV-B scenarios .....................................................56
Chapter 4 Symbiodinium mitigate the combined effects of hypoxia and acidification on
a non-calcifying cnidarian ...............................................................................................66
Chapter 5 Pre-exposure to individual, but not simultaneous, climate change stressors
allow Irukandji jellyfish polyps to cope under future conditions ..................................106
Chapter 6 General discussion.......................................................................................143
Appendix ......................................................................................................................156
ix
CHAPTER 1 – INTRODUCTION
An introduction to the influence of environmental change on jellyfish
1
Human influences on the ocean
The human population has recently exceeded 7 billion (Keinan & Clark, 2012). The
growing human population has caused an increase in anthropogenic activities along
coastlines that have widespread effects on marine ecosystems (Crain et al., 2008, Best
et al., 2015, Pörtner & Gutt, 2016). Historically, the major anthropogenic stressors that
affected marine ecosystems were habitat loss and over-exploitation of key species (Sala
et al., 2000, Jackson et al., 2001, Dulvy et al., 2003). In the past century, however, the
list of anthropogenic stressors has expanded to include the effects of pollutants, the
input of excess nutrients, UV-B radiation and anthropogenic climate change caused by
greenhouse emissions. These stressors have caused rapid changes to marine ecosystems
on a local, regional and global scale (Hoegh-Guldberg, 2010) and are predicted to
adversely affect animal physiology (Doney et al., 2012), ecological interactions
(Hoegh-Guldberg et al., 2007) and alter ecosystem functioning (Best et al., 2015,
Albright et al., 2016).
Environmental stressors that occur on a global scale are a major threat to marine
ecosystems (Brown et al., 2013). Rising atmospheric greenhouse gas concentrations
(CO2, N2O4, CH4 and chlorofluorocarbons) have caused ocean surface temperatures to
increase by 0.6-0.7°C over the past century (IPCC, 2007, Solomon, 2007). In addition to
acting as a heat sink, the oceans have concurrently absorbed ~25-30% of the total
anthropogenic carbon dioxide (CO2) emissions since the 1800s (Feely et al., 2004,
Sabine et al., 2004). As a consequence, the mean surface pH of the ocean has decreased
by ~0.1 pH units relative to pre-industrial times (Caldeira et al., 2003, Doney, 2010). As
more anthropogenic CO2 enters the Earth’s atmosphere the ocean is expected to
simultaneously warm and become more acidic (IPCC, 2014). Ocean warming and
acidification are likely to have varying effects on marine organisms. For example, ocean
warming can stimulate physiological processes, but when temperature conditions
exceed the upper thermal threshold of marine organisms physiological processes can be
2
suppressed (Byrne, 2011). Ocean acidification reduces the concentration of carbonate
ions available for skeleton formation for calcifying organisms and can suppress
important physiological processes (Portner, 2008, Widdicombe, 2008).
Ocean warming and acidification are occurring concomitantly with changes to
ultraviolet B (UV-B) radiation. Between the 1960s and 1990s elevated levels of ozone
depleting substances (ODSs) in the atmosphere partially eroded the ozone layer and
elevated levels of UV-B radiation at the Earth’s surface (Weatherhead & Andersen,
2006). Since the yr. 2000 the area of total ozone has increased by ~1% (Chehade et al.,
2014, WMO, 2015) because the levels of ODSs in the Earth’s atmosphere have slowly
reduced (Stolarski et al., 2012). Climate system factors such as ozone chemistry and
climate change, however, may halt ozone recovery and potentially increase levels of
UV-B radiation at the Earth’s surface (Williamson et al., 2014, Bais et al., 2015).
Elevated UV-B radiation can reduce fecundity (Siebeck et al., 1994), slow development
(Przeslawski et al., 2004) and reduce survival of several life history stage of marine
organisms (De Lange & Van Reeuwijk, 2003).
Regional-scale and seasonal stressors (such as eutrophication and hypoxia) can affect
the physiology of marine organisms (Joyce et al., 2016), the persistence of populations
(Chu & Tunnicliffe, 2015) and affect ecosystem function (Baird et al., 2004, Diaz &
Rosenberg, 2008). Of these stressors, the anthropogenic input of excess nutrients is of
particular concern in some coastal areas that support dense human populations (Smith et
al., 1999). The excess input of nutrients (such as nitrogen and phosphorus) into coastal
waters can stimulate the excessive production of organic matter (OM) and lead to
eutrophication (Diaz & Rosenberg, 2008). The subsequent microbial consumption of
excess OM can deplete oxygen (O2) concentrations and can cause hypoxia (<2mg O2 L1
), cases of which have been reported with increasing frequency worldwide (Diaz &
3
Rosenberg, 2008). Hypoxia can reduce growth (Rabalais et al., 2002), reproduction
(Wang et al., 2016) and induce physiological stress in marine organisms (Spicer, 2014).
In some cases, hypoxic events can trigger mass mortality of metazoans and reduce
biodiversity (e.g.Rabalais et al., 2002).
Multiple anthropogenic stressors that occur on a local scale impact marine ecosystems
(Carilli et al., 2009). Terrestrial runoff and shipping activities contribute various
pollutants such as pesticides, heavy metals, anti-fouling chemicals and petroleum
hydrocarbons into coastal ecosystems (van Dam et al., 2011). These chemical pollutants
are often delivered into marine systems at high concentrations during episodic rainfall
events. Freshwater inflow during heavy rainfall exposes marine organisms to initially
high concentrations of pollutants and reduced salinity (Solomon et al., 1996, McMahon
et al., 2005, Davis et al., 2012). Chemical pollutants can be assimilated and
concentrated into biological tissue of marine organisms and cause severe physiological
stress (Depledge & Billinghurst, 1999, Islam & Tanaka, 2004). Despite the observation
that marine biota are exposed to initially high concentrations of chemical pollutants and
reduced salinity during rainfall events, few studies have quantified the combined effects
of the dual stressors on marine organisms (but see, Jones et al., 2003).
The importance of studying interactions between stressors
Changing ocean conditions expose marine organisms to multiple stressors that may
impart effects that differ from those when biota are exposed to the stressors
individually. The effects of multiple stressors on marine organisms is often assumed to
be an additive accumulation of the individual stressors (e.g. Halpern et al., 2007, Ban &
Alder, 2008). Numerous empirical studies, however, demonstrate that stressors in
combination can exacerbate the negative impacts on marine organisms (termed
synergism) (e.g. Lischka & Riebesell, 2012, Gobler et al., 2014). For example, growth
4
rates of the hard clam Mercenaria mercenaria were unaffected by low DO and low pH
individually, but growth rates of M. mercenaria were reduced by 40% when exposed to
the stressors in combination, suggesting a negative synergistic interaction (Gobler et al.,
2014). Conversely, other studies have observed that the effects of multiple stressors in
combination can be less than those of the individual stressors added together (Wulff et
al., 2000). For example, exposure to elevated UV-B radiation had negative effects on
microalgal assemblages of Haslea ostreana and Nitzschia spp., however, when the
microalgal assemblages were exposed to elevated UV-B radiation in nutrient rich
conditions (N, P, Si) the negative effects of UV-B were partly mitigated, suggesting an
antagonistic interaction (Wulff et al., 2000). Given the complexity of responses of
marine biota to co-occurring stressors, experiments need to consider the potential
interactive effects of co-occurring stressors to accurately predict how marine biota may
respond to environmental change.
The need to incorporate environmental realism into experiments
To obtain a realistic understanding of how marine species are likely to respond to
environmental stress manipulative experiments need to accurately mimic conditions that
biota experience in the natural environment. For example, in coastal ecosystems,
hypoxia is linked to acidification because carbon dioxide (CO2) is produced during
microbial respiration, which subsequently reduces pH through the formation and
dissociation of carbonic acid (Gobler & Baumann, 2016). However, most experiments
that examine the effects of hypoxia on marine species do not consider the effects of
acidification. Many studies of the effects of hypoxia simulate low O2 concentrations by
bubbling nitrogen (N2) gas in seawater to displace O2 (e.g. Wang & Widdows, 1991,
Gracey et al., 2001, Eerkes-Medrano et al., 2013). Indeed, sparging N2 gas lowers O2
concentrations but simultaneously displaces CO2 and increases pH, which creates a low
O2, high pH environment that is contrary to observations of hypoxic systems in the
natural environment (Gobler et al., 2014). Consequently, results of experiments that
5
simulate hypoxic conditions with N2 gas may not accurately represent the response of
biota in the field.
Most studies of the effects of environmental stressors on marine biota investigate the
effects of exposure to constant levels of stressors (e.g. UV-B; Fischer & Phillips, 2014;
pollutants Vallotton et al., 2008; pH, Klein et al., 2014) In marine ecosystems, however,
biota are often subject to fluctuations in environmental conditions. For example, low
tides that occur in the middle of the day, when UV-B irradiance is most intense,
simultaneously expose shallow marine biota to high UV radiation and mid-day
temperature extremes (Helmuth et al., 2002). Furthermore, biota are often exposed to
multiple environmental stressors during ‘pulse’ events. Indeed, freshwater inflow from
rainfall events simultaneously expose biota to initially high concentrations of pesticides
but dilution due to tidal movements causes herbicide concentrations to subside over
several days. Despite these observations, most studies of the effects of pollutants
delivered in rainfall events investigate the effects of continuous exposure in short term
experiments (over several hours) (but see, Macinnis-Ng & Ralph, 2004; Vallotton et al.,
2008). To accurately assess how marine biota may respond to environmental stress,
manipulative experiments need to include environmentally relevant levels of the
stressors, ensure that the duration of exposure to the stressors is realistic and examine
potential interactive effects of co-occurring stressors.
Coping with environmental stress
The degree to which short term manipulative experiments can be used to accurately
predict how marine species may respond to environmental stress, ultimately depends on
whether organisms can adapt or acclimate to environmental change. Marine species may
become robust to environmental stressors through non-genetic changes such as
acclimation and genetic adaptation. Genetic adaptation involves the natural selection of
6
genetic variation that ultimately shifts the average phenotype to improve fitness (Bell,
2013, Logan et al., 2014). Although genetic adaptation is hypothesised to facilitate the
persistence of many marine species under future conditions, genetic adaptation typically
occurs over many sexual generations and thus is difficult to experimentally test.
Acclimation, however, can occur within a single generation and over short time-scales
such as weeks (e.g. Bellantuono et al., 2011) and months (e.g. Form & Riebesell,
2012). Acclimation is considered to be a major determinant for the persistence of
marine species in the face of climate change (Somero, 2005). Thus, manipulative
experiments need to consider whether marine species may acclimate or adapt to
changing conditions when predicting how biota may persist under future conditions.
Emerging evidence suggests that organisms that harbour endosymbiotic dinoflagellates
(zooxanthellae), may respond differently to non-symbiotic organisms under
environmental stress (Gibbin et al., 2014, Laurent et al., 2014). Zooxanthellae live
within the cells of the host, and in exchange, zooxanthellae take up and fix CO2 during
photosynthesis and translocate carbon to the host. Thus, living in symbiosis is likely to
benefit both partners. Zooxanthellae may be of particular benefit under hypoxic
conditions because zooxanthellae provide photosynthetic O2 to the host during
photosynthesis, potentially alleviating the host’s oxygen debt (Malcolm & Brown,
1977). The presence of zooxanthellae may partially mitigate the effects of acidification
because the CO2 utilised during photosynthesis can reduce the pCO2 within the host’s
tissues, thereby regulating the pH of the tissues (Laurent et al., 2013, Gibbin et al.,
2014, Laurent et al., 2014). These processes, however, only occur when zooxanthellae
photosynthesise during the day and, therefore, symbiotic biota may be limited in their
ability to cope during the night.
7
Jellyfish blooms
Jellyfish (defined here as cnidarian medusae) often proliferate rapidly and form
conspicuous blooms. Jellyfish blooms can directly interfere with human health or
enterprise and have severe socio-economic effects (Richardson et al., 2009, Lucas et al.,
2014). Some species of jellyfish from the class Scyphozoa can form problematic blooms
(Arai, 2012). For example, frequent blooms of the ‘giant jellyfish’ Nemopilema
nomurai in the Sea of Japan pose a significant threat to fisheries (Uye, 2008). Outbreaks
of the venomous jellyfish Pelagia noctiluca in the northeast Atlantic and Mediterranean
have detrimental effects on fisheries and tourism because envenomations prevent
swimmers from entering the water (Licandro et al., 2010). Cubozoan jellyfish are also
of major concern because of their powerful venom and potential to have severe
socioeconomic impacts on coastal communities (Madin et al., 2012).
Whether jellyfish populations are increasing globally is a contentious issue. Some
evidence suggests that jellyfish populations are increasing (Brotz, 2011), however, these
results contrast with one other global jellyfish analysis which concluded that there is no
robust evidence for a global increase in jellyfish (Condon et al., 2013). Although some
regions have exhibited increases in jellyfish populations, no change or decreases in
populations have been observed in other regions (Condon et al., 2013). Condon et al.
(2013) suggests that jellyfish populations undergo long term ( ̴ 20-yr) oscillations on a
global scale. That study, however, revealed that some coastal regions such as the Sea of
Japan, the Barents Sea and parts of the Mediterranean have experienced greater blooms
of medusae (Condon et al., 2013). Although dense aggregations of medusae are a
normal feature of healthy ecosystems, there is speculation that jellyfish blooms may be
further enhanced by anthropogenic impacts such as ocean warming (Purcell, 2012),
overfishing (Daskalov et al., 2007), eutrophication (Purcell, 2012) and the proliferation
of artificial structures (Duarte et al., 2012).
8
Claims that environmental drivers cause jellyfish blooms
Most conclusions made about possible drivers of jellyfish blooms have been based on
correlative data. However, direct empirical data are limited for most of these
environmental stressors because few manipulative experiments have been done to
establish causative mechanisms. Natural drivers including large-scale climate drivers
are hypothesised to promote jellyfish blooms (Lynam et al., 2005). For example, a rise
in jellyfish abundance in the 1990s in the Bering Sea was initially interpreted as a
consequence of climate change but a subsequent decline after the yr. 2000 coincided
with transitions between climatic regimes of the North Atlantic Oscillation (Brodeur et
al., 2008). Furthermore, El Niño oscillations between 1991-92 and 1997-98 in Monterey
Bay, California were linked to high abundances of some seldom-seen species of
cnidarian medusae, however, other historically common species were not abundant
(Raskoff, 2001). In addition to these natural oscillations, some researchers hypothesise
that warming ocean temperatures could further enhance jellyfish populations because
warming generally increases rates of growth and asexual reproduction of polyps
(Widmer, 2005, Wilcox et al., 2007, Purcell et al., 2009).
Overfishing of competitors and predators of jellyfish is hypothesised to cause a trophic
cascade that could facilitate the proliferation of jellyfish. For example, an outbreak of
the pelagic ctenophore Mnemiopsis leidyi (Phylum: Ctenophora) in the Black Sea was
attributed to regime shifts triggered by intense anthropogenic impacts, which included
eutrophication and heavy fishing (Daskalov et al., 2007). Eutrophication of coastal
waters may benefit jellyfish by increasing the availability of planktonic food for
jellyfish (Parsons & Lalli, 2002). Eutrophication is linked to the spread of hypoxia
because the excess nutrients can sink to the benthos and bacterial decomposition can
reduce oxygen concentrations (Diaz & Rosenberg, 2008). Jellyfish polyps and medusae
are considered to be more tolerant of hypoxia (<2mg O2l-1) than other metazoans
(Purcell et al., 2001, Shoji et al., 2005). Fish avoid and die in environments of <2-3mg
9
O2 per litre (Breitburg et al., 2001), but jellyfish tolerate ≤1mg O2 per litre (Condon et
al., 2001). Indeed, if jellyfish are more tolerant of hypoxic conditions than other
metazoans, jellyfish may proliferate because they may access food sources otherwise
unavailable to competitors. Furthermore, hypoxic conditions may provide a refuge from
other less tolerant predators such as fish (Shoji et al., 2005, Shoji et al., 2010).
Deleterious effects of environmental stressors on jellyfish
Jellyfish polyps and medusae are considered robust to a range of anthropogenic
stressors (Richardson et al., 2009, Templeman & Kingsford, 2010, Brotz, 2011,
Gershwin, 2013). For example, Stoner et al. (2011) examined the population density
and body size of Cassiopea sp. medusae at 5 highly urbanised sites and 5 undisturbed
sites and reported that Cassiopea sp. medusae were larger and more abundant in
urbanised sites. Although no manipulative experiments were done by Stoner et al.
(2011), the study was cited as evidence for the conclusion that eutrophication increased
population density and body size of Cassiopea sp. (Purcell, 2012, Gershwin, 2013).
Although jellyfish are frequently cited to benefit from climate change (Richardson et
al., 2009, Lynam et al., 2011, Purcell, 2012), few studies have experimentally examined
the effects of climate stressors on jellyfish. However, the effects of warmer
temperatures have been studied in scyphozoan polyps and are likely to benefit jellyfish
populations by enhancing rates of growth and reproduction (Widmer, 2005, Purcell,
2007, Wilcox et al., 2007, Purcell et al., 2009). Despite the co-occurrence of warming
and acidification in marine ecosystems, only one study (Klein et al., 2014) has
investigated the interactive effects of warming and acidification on jellyfish. That study
investigated the interactive effects of warming and acidification on a cubozoan jellyfish,
Alatina nr mordens, and reported that although warming enhanced rates of asexual
reproduction, acidification reduced the number of asexual buds and reduced the width
10
of statoliths by 24% in lowest pH treatment (pH 7.6) (Klein et al., 2014). These results
suggest that jellyfish may not be immune to the combined effects of ocean warming and
acidification.
Climate-induced changes to ultraviolet (UV) radiation may adversely affect jellyfish
populations. The only study to investigate the effects of UV light on medusa survival
reported that the freshwater jellyfish Limnocnida tanganyicae (Cnidaria: Hydrozoa)
actively avoided water layers with high illumination (Salonen et al., 2012). Light
incubation experiments revealed that jellyfish exposed to conditions where UV
wavelengths were filtered out were not significantly affected, however medusae
exposed to natural light died after only 1h of incubation (Salonen et al., 2012). Indeed,
while some jellyfish species may escape high levels of UV radiation through vertical
migration other benthic species that occur in shallow lagoon ecosystems may have a
limited ability to move. Despite the paucity of robust evidence researchers appear to
take, almost for granted now, that jellyfish are robust to environmental stressors.
The life histories of jellyfish
Medusae are gonochoristic and produce planula larvae via sexual reproduction (Arai,
2012). Scyphozoans and cubozoans have bipartite life histories, where embryos develop
into planula larvae (Arai, 2012) (Figure 1.1). The free-swimming larvae then settle on a
hard substrate and develop into sessile polyps that asexually reproduce. Asexual
budding of polyps is likely to be an important process that may ultimately determine the
size of medusa populations (Kingsford & Mooney, 2014). Blooms of scyphozoan
jellyfish occur when juvenile medusa bud asexually from the benthic polyps (a process
termed strobilation) (Figure 1.1a). Medusa production in cubozoan jellyfish, however,
can vary from complete metamorphosis of the polyp into a juvenile medusa to monodisc
strobilation which, after medusa production, allows the polyp to remain attached the
11
benthos and reproduce more polyps (Figure 1.1b) (Courtney et al., 2016). Medusa
production typically coincides with spring or summer when planktonic food is abundant
(Mills, 2001).
Many scyphozoan species grow and reproduce rapidly (Dawson & Hamner, 2009).
Jellyfish polyps are often perennial and can produce new polyps and medusae for many
years (Arai, 2012). Furthermore, during unfavourable conditions some scyphozoan and
cubozoan polyps are capable of encystment (Werner, 1975, Hartwick, 1991, Schiariti et
al., 2014). During this process polyps form podocysts with stored reserves of organic
compounds. Encystment is hypothesised to allow for short-term survival during
unfavourable conditions and provide protection against predators (Arai, 2009). These
podocysts are capable of further podocyst production and formation of medusae by
strobilation (Arai, 2009). When conditions are favourable podocysts excyst to form
active polyps and are capable of asexual reproduction and strobilation (Thein et al.,
2012). The rapid asexual reproduction of polyps and the ability of some species to form
podocysts during unfavourable conditions are hypothesised to be key drivers of the
rapid proliferation of medusae blooms.
12
(a)
(b)
Figure 1.1 (a) Schematic diagram of the life history of the scyphozoan jellyfish, Catostylus mosaicus (Pitt, 2000) (b) Schematic diagram of
the life history of the cubozoan jellyfish, Tripedalia cystophora (Carybdeidae) (Werner, 1973)
13
Zooxanthellate jellyfish
Like corals, some species of scyphozoan and cubozoan jellyfish form symbioses with
zooxanthellae (Straehler-Pohl & Jarms, 2011). Zooxanthellae commonly occur in the
genera Cassiopea, Mastigias, Phyllorhiza and Linuche (McCloskey et al., 1994, Trench
& Thinh, 1995, Verde & McCloskey, 1998, Pitt et al., 2005). Zooxanthellae in
scyphozoan jellyfish are typically from the Symbiodinium genus (Thornhill et al., 2006).
The most important benefit of this symbiosis is the translocation of photosynthetic
products from zooxanthellae to the host. Zooxanthellae take up and fix CO2, and then
translocate carbon to host tissues (Balderston & Claus, 1969). Similarly, inorganic
excretory products can be translocated from the host jellyfish to the zooxanthellae (Pitt
et al., 2009). Zooxanthellate medusae may assimilate dissolved inorganic carbon from
the water column (Pitt et al., 2009) and those that live on the benthos (such Cassiopea
sp.) extract and take up nutrients from the sediment (Jantzen et al., 2010). Thus, it is
likely that the tight cycling of nutrients between jellyfish and zooxanthellae is a major
benefit to zooxanthellate medusae that is otherwise not available to other
morphologically similar species that do not contain zooxanthellae.
Zooxanthellate jellyfish may respond differently to non-zooxanthellate jellyfish under
environmental stress. Photosynthesis of zooxanthellae may supply the host jellyfish
with photosynthetic oxygen, which may eliminate oxygen debt and be advantageous
under hypoxic conditions. Although cnidarians have only two cellular layers, and
therefore diffusion distance may be short, a substantial boundary layer can develop in
stagnant waters (Shick, 1990). Despite these observations no studies have investigated
the potential role of zooxanthellae in mitigating the negative effects of hypoxia on
jellyfish. Two studies, however, have examined how the presence of zooxanthellae may
allow cnidarians to cope when exposed to low oxygen conditions. (Malcolm & Brown,
1977, Rands et al., 1992). Malcolm & Brown (1977) exposed the symbiotic sea
anemone Anthopleura elegantissima to hypoxic conditions and reported that the
14
intracellular production of O2 enabled aerobic metabolism to continue under hypoxic
conditions. Zooxanthellae may also help zooxanthellate jellyfish to cope under
acidification conditions. Zooxanthellae take up and fix CO2 during photosynthesis,
which may reduce pCO2 in the host’s tissues. Indeed, under low pH conditions,
zooxanthellae cells can exert significant control over the pH of coral host tissues
(Gibbin et al., 2014). Observations that zooxanthellae contribute nutrients, take up and
fix CO2, and supply algal-derived O2 to the host suggest that jellyfish that harbour
zooxanthellae may have an ecological advantage under hypoxic and more acidic
conditions.
Overnight zooxanthellae are unable to photosynthesise and therefore, zooxanthellae
may be limited in their ability to mitigate the potential negative effects of hypoxia and
acidification on the host during the night-time. For example, under hypoxic conditions
the sea anemone Anemonia viridis, remained normoxic when exposed to light
conditions but A. viridis did not maintain normal ATP levels and intracellular pH
declined under dark conditions (Rands et al., 1992). These results suggest that the
survival of zooxanthellate jellyfish under hypoxic and more acidic conditions may
depend on whether the host can survive overnight when, coincidentally acidification and
hypoxia are generally the most extreme in coastal ecosystems (Summers & Engle,
1993).
15
OBJECTIVES AND OVERVIEW OF THESIS
The main objective of this thesis was to use manipulative experiments to test hypotheses
about the influence of environmental stressors on the proliferation of jellyfish.
Specifically, research chapters within this thesis aim to:
Chapter 2: Assess the interactive effects of reduced salinity and the herbicide atrazine
on the zooxanthellate jellyfish Cassiopea sp. during a simulated rainfall event.
Chapter 3: Investigate the potential interactive effects of future UV-B radiation
scenarios (both increasing and decreasing) and ocean warming projections on
zooxanthellate polyps of Cassiopea sp.
Chapter 4: Examine the role of Symbiodinium in mitigating the potential interactive
effects of long-term hypoxia and acidification on the ‘upside-down’ jellyfish, Cassiopea
sp.
Chapter 5: Assess the role of acclimation to elevated temperature and low pH
separately and in combination, in potentially mitigating the effects of future ocean
conditions on Irukandji jellyfish polyps of Alatina nr mordens.
16
REFERENCE LIST
Albright R, Caldeira L, Hosfelt J et al. (2016) Reversal of ocean acidification enhances
net coral reef calcification. Nature, 531, 362-365.
Arai M (2009) The potential importance of podocysts to the formation of scyphozoan
blooms: a review. Hydrobiologia, 616, 241-246.
Arai MN (2012) A Functional Biology of Scyphozoa. pp 137-171. Springer Science &
Business Media. London, Chapman and Hall.
Baird D, Christian RR, Peterson CH, Johnson GA (2004) Consequences of hypoxia on
estuarine ecosystem function: Energy diversion from consumers to microbes.
Ecological Applications, 14, 805-822.
Bais A, Mckenzie R, Bernhard G, Aucamp P, Ilyas M, Madronich S, Tourpali K (2015)
Ozone depletion and climate change: Impacts on UV radiation. Photochemical
& Photobiological Sciences, 14, 19-52.
Balderston WL, Claus G (1969) Study of the symbiotic relationship between
Symbiodinium microadriaticum Freudenthal, a Zooxanthella and the upside
down jellyfish, Cassiopea sp. Nova Hedwigia.
Ban N, Alder J (2008) How wild is the ocean? Assessing the intensity of anthropogenic
marine activities in British Columbia, Canada. Aquatic Conservation: Marine
and Freshwater Ecosystems, 18, 55-85.
Bell G (2013) Evolutionary rescue and the limits of adaptation. Philosophical
Transactions of the Royal Society of London B: Biological Sciences, 368,
20120080.
Bellantuono AJ, Hoegh-Guldberg O, Rodriguez-Lanetty M (2011) Resistance to
thermal stress in corals without changes in symbiont composition. Proceedings
of the Royal Society of London B: Biological Sciences, rspb20111780.
Best RJ, Stone MN, Stachowicz JJ (2015) Predicting consequences of climate change
for ecosystem functioning: variation across trophic levels, species and
individuals. Diversity and Distributions, 21, 1364-1374.
Breitburg DL, Pihl L, Kolesar SE (2001) Effects of low dissolved oxygen on the
behavior, ecology and harvest of fishes: a comparison of the Chesapeake Bay
and Baltic-Kattegat systems. Coastal and Estuarine Studies, 58, 241-267.
17
Brodeur RD, Decker MB, Ciannelli L et al. (2008) Rise and fall of jellyfish in the
eastern Bering Sea in relation to climate regime shifts. Progress in
Oceanography, 77, 103-111.
Brotz L (2011) Changing jellyfish populations: trends in large marine ecosystems.
University of British Columbia.
Brown CJ, Saunders MI, Possingham HP, Richardson AJ (2013) Managing for
interactions between local and global stressors of ecosystems. PLOS one, 8,
e65765.
Byrne M (2011) Impact of ocean warming and ocean acidification on marine
invertebrate life history stages: vulnerabilities and potential for peristence in a
changing ocean. Oceanography and Marine Biology: An Annual Review, 49, 142.
Caldeira K, Jain AK, Hoffert MI (2003) Climate sensitivity uncertainty and the need for
energy without CO2 emission. Science, 299, 2052-2054.
Carilli JE, Norris RD, Black BA, Walsh SM, Mcfield M (2009) Local stressors reduce
coral resilience to bleaching. PLOS one, 4, e6324.
Chehade W, Weber M, Burrows J (2014) Total ozone trends and variability during
1979–2012 from merged data sets of various satellites. Atmospheric Chemistry
and Physics, 14, 7059-7074.
Chu JW, Tunnicliffe V (2015) Oxygen limitations on marine animal distributions and
the collapse of epibenthic community structure during shoaling hypoxia. Global
Change Biology, 21, 2989-3004.
Condon RH, Decker MB, Purcell JE (2001) Effects of low dissolved oxygen on survival
and asexual reproduction of scyphozoan polyps (Chrysaora quinquecirrha)
Hydrobiologia, 451, 89-95.
Condon RH, Duarte CM, Pitt KA et al. (2013) Recurrent jellyfish blooms are a
consequence of global oscillations. Proceedings of the National Academy of
Sciences, 110, 1000-1005.
Courtney R, Browning S, Seymour J (2016) Early Life History of the
‘Irukandji’Jellyfish Carukia barnesi. PLOS one, 11, e0151197.
Crain CM, Kroeker K, Halpern BS (2008) Interactive and cumulative effects of multiple
human stressors in marine systems. Ecology Letters, 11, 1304-1315.
18
Daskalov GM, Grishin AN, Rodionov S, Mihneva V (2007) Trophic cascades triggered
by overfishing reveal possible mechanisms of ecosystem regime shifts.
Proceedings of the National Academy of Sciences, 104, 10518-10523.
Davis AM, Lewis SE, Bainbridge ZT, Glendenning L, Turner RDR, Brodie JE (2012)
Dynamics of herbicide transport and partitioning under event flow conditions in
the lower Burdekin region, Australia. Marine Pollution Bulletin, 65, 182-193.
Dawson MN, Hamner WM (2009) A character-based analysis of the evolution of
jellyfish blooms: adaptation and exaptation. In: Jellyfish Blooms: Causes,
Consequences, and Recent Advances. pp 193-215. Springer.
De Lange HJ, Van Reeuwijk PL (2003) Negative effects of UV-B-irradiated
phytoplankton on life history traits and fitness of Daphnia magna. Freshwater
Biology, 48, 678-686.
Depledge MH, Billinghurst Z (1999) Ecological Significance of Endocrine Disruption
in Marine Invertebrates. Marine Pollution Bulletin, 39, 32-38.
Diaz RJ, Rosenberg R (2008) Spreading dead zones and consequences for marine
ecosystems. Science, 321, 926-929.
Doney SC (2010) The Growing Human Footprint on Coastal and Open-Ocean
Biogeochemistry. Science, 328, 1512-1516.
Doney SC, Ruckelshaus M, Duffy JE et al. (2012) Climate change impacts on marine
ecosystems. Marine Science, 4.
Duarte CM, Pitt KA, Lucas CH et al. (2012) Is global ocean sprawl a cause of jellyfish
blooms? Frontiers in Ecology and the Environment, 11, 91-97.
Dulvy NK, Sadovy Y, Reynolds JD (2003) Extinction vulnerability in marine
populations. Fish and fisheries, 4, 25-64.
Eerkes-Medrano D, Menge BA, Sislak C, Langdon CJ (2013) Contrasting effects of
hypoxic conditions on survivorship of planktonic larvae of rocky intertidal
invertebrates. Marine Ecology Progress Series, 478: 139.
Feely RA, Sabine CL, Lee K, Berelson W, Kleypas J, Fabry VJ, Millero FJ (2004)
Impact of anthropogenic CO2 on the CaCO3 system in the oceans. Science, 305,
362-366.
Fischer J, Phillips NE (2014) Carry‐over effects of multiple stressors on benthic
embryos are mediated by larval exposure to elevated UVB and temperature.
Global Change Biology, 20, 2108-2116.
19
Form AU, Riebesell U (2012) Acclimation to ocean acidification during long‐term CO2
exposure in the cold‐water coral Lophelia pertusa. Global Change Biology, 18,
843-853.
Gershwin L-A (2013) Stung!: On Jellyfish Blooms and the Future of the Ocean,
University of Chicago Press.
Gibbin EM, Putnam HM, Davy SK, Gates RD (2014) Intracellular pH and its response
to CO2-driven seawater acidification in symbiotic versus non-symbiotic coral
cells. Journal of Experimental Biology, 217, 1963-1969.
Gobler CJ, Baumann H (2016) Hypoxia and acidification in ocean ecosystems: coupled
dynamics and effects on marine life. Biology Letters, 12, 20150976.
Gobler CJ, DePasquale EL, Griffith AW, Baumann H (2014) Hypoxia and acidification
have additive and synergistic negative effects on the growth, survival, and
metamorphosis of early life stage bivalves PLoS ONE 9 (1): e83648. doi:
10.1371/journal.pone.0083648
Gracey AY, Troll JV, Somero GN (2001) Hypoxia-induced gene expression profiling in
the euryoxic fish Gillichthys mirabilis. Proceedings of the National Academy of
Sciences, 98, 1993-1998.
Halpern BS, Selkoe KA, Micheli F, Kappel CV (2007) Evaluating and ranking the
vulnerability of global marine ecosystems to anthropogenic threats.
Conservation Biology, 21, 1301-1315.
Hartwick R (1991) Observations on the anatomy, behaviour, reproduction and life cycle
of the cubozoan Carybdea sivickisi. In: Coelenterate Biology: Recent Research
on Cnidaria and Ctenophora. pp 171-179. Springer.
Helmuth B, Harley CD, Halpin PM, O'donnell M, Hofmann GE, Blanchette CA (2002)
Climate change and latitudinal patterns of intertidal thermal stress. Science, 298,
1015-1017.
Hoegh-Guldberg O (2010) Dangerous shifts in ocean ecosystem function? ISME
Journal, 4, 1090-1092.
Hoegh-Guldberg O, Mumby PJ, Hooten AJ et al. (2007) Coral reefs under rapid climate
change and ocean acidification. Science, 318, 1737-1742.
IPCC (2007) Climate Change 2007. In: The Physical Science Basis: Summary of Policy
Makers. pp 21 pp, Geneva, Switzerland.
20
IPCC (2014) Climate Change 2014: Synthesis Report. Contribution of Working Groups
I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on
Climate Change.
Islam S, Tanaka M (2004) Impacts of pollution on coastal and marine ecosystems
including coastal and marine fisheries and approach for management: a review
and synthesis. Marine Pollution Bulletin, 48, 624-649.
Jackson JBC, Kirby MX, Berger WH et al. (2001) Historical Overfishing and the
Recent Collapse of Coastal Ecosystems. Science, 293, 629-637.
Jantzen C, Wild C, Rasheed M, El-Zibdah M, Richter C (2010) Enhanced pore-water
nutrient fluxes by the upside-down jellyfish Cassiopea sp. in a Red Sea coral
reef. Marine Ecology Progress Series, 411, 117-125.
Jones RJ, Muller J, Haynes D, Schreiber U (2003) Effects of herbicides diuron and
atrazine on corals of the Great Barrier Reef, Australia. Marine Ecology Progress
Series, 251, 153-167.
Joyce W, Ozolina K, Mauduit F, Ollivier H, Claireaux G, Shiels HA (2016) Individual
variation in whole-animal hypoxia tolerance is associated with cardiac hypoxia
tolerance in a marine teleost. Biology Letters, 12, 20150708.
Keinan A, Clark AG (2012) Recent explosive human population growth has resulted in
an excess of rare genetic variants. Science, 336, 740-743.
Kingsford MJ, Mooney CJ (2014) The ecology of box jellyfishes (Cubozoa). In:
Jellyfish Blooms. pp 267-302. Springer.
Klein SG, Pitt KA, Rathjen KA, Seymour JE (2014) Irukandji jellyfish polyps exhibit
tolerance to interacting climate change stressors. Global Change Biology, 20,
28-37.
Laurent J, Tambutté S, Tambutté É, Allemand D, Venn A (2013) The influence of
photosynthesis on host intracellular pH in scleractinian corals. Journal of
Experimental Biology, 216, 1398-1404.
Laurent J, Venn A, Tambutté É, Ganot P, Allemand D, Tambutté S (2014) Regulation
of intracellular pH in cnidarians: response to acidosis in Anemonia viridis. Febs
Journal, 281, 683-695.
Licandro P, Conway D, Yahia MD et al. (2010) A blooming jellyfish in the northeast
Atlantic and Mediterranean. Biology Letters, 6, 688-691.
Lischka S, Riebesell U (2012) Synergistic effects of ocean acidification and warming on
overwintering pteropods in the Arctic. Global Change Biology, 18, 3517-3528.
21
Logan CA, Dunne JP, Eakin CM, Donner SD (2014) Incorporating adaptive responses
into future projections of coral bleaching. Global Change Biology, 20, 125-139.
Lucas CH, Gelcich S, Uye S-I (2014) Living with Jellyfish: Management and
Adaptation Strategies. In: Jellyfish Blooms. pp 129-150. Springer.
Lynam C, Lilley M, Bastian T, Doyle T, Beggs S, Hays G (2011) Have jellyfish in the
Irish Sea benefited from climate change and overfishing? Global Change
Biology, 17, 767-782.
Lynam CP, Hay SJ, Brierley AS (2005) Jellyfish abundance and climatic variation:
contrasting responses in oceanographically distinct regions of the North Sea, and
possible implications for fisheries. Journal of the Marine Biological Association
of the United Kingdom, 85, 435-450.
Macinnis-Ng CM, Ralph PJ (2004) In situ impact of multiple pulses of metal and
herbicide on the seagrass, Zostera capricorni. Aquatic Toxicology, 67, 227-237.
Madin EM, Ban NC, Doubleday ZA, Holmes TH, Pecl GT, Smith F (2012) Socioeconomic and management implications of range-shifting species in marine
systems. Global Environmental Change, 22, 137-146.
Malcolm JM, Brown WI (1977) Zooxanthellae‐produced O2 promotes sea anemone
expansion and eliminates oxygen debt under environmental hypoxia. Journal of
Experimental Zoology, 201, 149-155.
McCloskey L, Muscatine L, Wilkerson F (1994) Daily photosynthesis, respiration, and
carbon budgets in a tropical marine jellyfish (Mastigias sp.). Marine Biology,
119, 13-22.
McMahon K, Bengtson Nash S, Eaglesham G, Müller JF, Duke NC, Winderlich S
(2005) Herbicide contamination and the potential impact to seagrass meadows in
Hervey Bay, Queensland, Australia. Marine Pollution Bulletin, 51, 325-334.
Mills CE (2001) Jellyfish blooms: are populations increasing globally in response to
changing ocean conditions? In: Jellyfish Blooms: Ecological and Societal
Importance. pp 55-68. Springer.
Parsons T, Lalli C (2002) Jellyfish population explosions: revisiting a hypothesis of
possible causes. La Mer, 40, 111-121.
Pitt K (2000) Life history and settlement preferences of the edible jellyfish Catostylus
mosaicus (Scyphozoa: Rhizostomeae). Marine Biology, 136, 269-279.
Pitt KA, Koop K, Rissik D (2005) Contrasting contributions to inorganic nutrient
recycling by the co-occurring jellyfishes, Catostylus mosaicus and Phyllorhiza
22
punctata (Scyphozoa, Rhizostomeae). Journal of Experimental Marine Biology
and Ecology, 315, 71-86.
Pitt KA, Welsh DT, Condon RH (2009) Influence of jellyfish blooms on carbon,
nitrogen and phosphorus cycling and plankton production. In: Jellyfish Blooms:
Causes, Consequences, and Recent Advances. pp 133-149. Springer.
Portner H (2008) Ecosystem effects of ocean acidification in times of ocean warming: a
physiologist's view. Marine Ecology Progress Series, 373, 203-217.
Pörtner HO, Gutt J (2016) Impacts of climate variability and change on (marine)
animals: physiological underpinnings and evolutionary consequences.
Integrative and Comparative Biology, 56, 31-44.
Przeslawski R, Davis AR, Benkendorff K (2004) Effects of ultraviolet radiation and
visible light on the development of encapsulated molluscan embryos. Marine
Ecology Progress Series, 268, 151-160.
Purcell JE (2007) Environmental effects on asexual reproduction rates of the
scyphozoan Aurelia labiata. Marine Ecology Progress Series, 348, 183-196.
Purcell JE (2012) Jellyfish and Ctenophore Blooms Coincide with Human Proliferations
and Environmental Perturbations. Annual Review of Marine Science, 4, 209-235.
Purcell JE, Breitburg DL, Decker MB, Graham WM, Youngbluth MJ, Raskoff KA
(2001) Pelagic cnidarians and ctenophores in low dissolved oxygen
environments: a review. Coastal Hypoxia: Consequences for Living Resources
and Ecosystems, 77-100.
Purcell JE, Hoover RA, Schwarck NT (2009) Interannual variation of strobilation by the
scyphozoan Aurelia labiata in relation to polyp density, temperature, salinity,
and light conditions in situ. Marine Ecology Progress Series, 375, 139-149.
Rabalais NN, Turner RE, Wiseman Jr WJ (2002) Gulf of Mexico hypoxia, aka" The
dead zone". Annual Review of Ecology and Systematics, 235-263.
Rands ML, Douglas AE, Loughman BC, Ratcliffe RG (1992) Avoidance of Hypoxia in
a Cnidarian Symbiosis by Algal Photosynthetic Oxygen. Biological Bulletin,
182, 159-162.
Raskoff KA (2001) The impact of El Niño events on populations of mesopelagic
hydromedusae. Hydrobiologia, 451, 121-129.
Richardson AJ, Bakun A, Hays GC, Gibbons MJ (2009) The jellyfish joyride: causes,
consequences and management responses to a more gelatinous future. Trends in
ecology & evolution, 24, 312-322.
23
Sabine CL, Feely RA, Gruber N et al. (2004) The oceanic sink for anthropogenic CO2.
Science, 305, 367-371.
Sala OE, Stuart Chapin F, Iii et al. (2000) Global Biodiversity Scenarios for the Year
2100. Science, 287, 1770-1774.
Salonen K, Högmander P, Langenberg V, Mölsä H, Sarvala J, Tarvainen A, Tiirola M
(2012) Limnocnida tanganyicae medusae (Cnidaria: Hydrozoa): a
semiautonomous microcosm in the food web of Lake Tanganyika.
Hydrobiologia, 690, 97-112.
Schiariti A, Morandini AC, Jarms G, Von Glehn Paes R, Franke S, Mianzan H (2014)
Asexual reproduction strategies and blooming potential in Scyphozoa. Marine
Ecology Progress Series, 510, 241-253.
Shick JM (1990) Diffusion limitation and hyperoxic enhancement of oxygen
consumption in zooxanthellate sea anemones, zoanthids, and corals. The
Biological Bulletin, 179, 148-158.
Shoji J, Kudoh T, Takatsuji H, Kawaguchi O, Kasai A (2010) Distribution of moon
jellyfish Aurelia aurita in relation to summer hypoxia in Hiroshima Bay, Seto
Inland Sea. Estuarine, Coastal and Shelf Science, 86, 485-490.
Shoji J, Masuda R, Yamashita Y, Tanaka M (2005) Effect of low dissolved oxygen
concentrations on behavior and predation rates on red sea bream Pagrus major
larvae by the jellyfish Aurelia aurita and by juvenile Spanish mackerel
Scomberomorus niphonius. Marine Biology, 147, 863-868.
Siebeck O, Vail T, Williamson C et al. (1994) Impact of UV-B radiation on
zooplankton and fish in pelagic freshwater ecosystems. Advances in limnology,
43, 101-114.
Smith VH, Tilman GD, Nekola JC (1999) Eutrophication: impacts of excess nutrient
inputs on freshwater, marine, and terrestrial ecosystems. Environmental
Pollution, 100, 179-196.
Solomon KR, Baker DB, Richards RP et al. (1996) Ecological risk assessment of
atrazine in North American surface waters. Environmental Toxicology and
Chemistry, 15, 31-76.
Solomon S (2007) Climate change 2007-the physical science basis: Working group I
contribution to the fourth assessment report of the IPCC, Cambridge University
Press.
24
Somero GN (2005) Linking biogeography to physiology: evolutionary and acclimatory
adjustments of thermal limits. Frontiers in Zoology, 2, 1-1.
Spicer JI (2014) What can an ecophysiological approach tell us about the physiological
responses of marine invertebrates to hypoxia? Journal of Experimental Biology,
217, 46-56.
Stolarski RS, Douglass AR, Remsberg EE, Livesey NJ, Gille JC (2012) Ozone
temperature correlations in the upper stratosphere as a measure of chlorine
content. Journal of Geophysical Research: Atmospheres (1984–2012), 117.
Stoner EW, Layman CA, Yeager LA, Hassett HM (2011) Effects of anthropogenic
disturbance on the abundance and size of epibenthic jellyfish Cassiopea spp.
Marine pollution bulletin, 62, 1109-1114.
Straehler-Pohl I, Jarms G (2011) Morphology and life cycle of Carybdea morandinii,
sp. nov.(Cnidaria), a cubozoan with zooxanthellae and peculiar polyp anatomy.
Zootaxa, 2755, 36-56.
Summers JK, Engle VD (1993) Evaluation of sampling strategies to characterize
dissolved oxygen conditions in northern Gulf of Mexico estuaries.
Environmental monitoring and assessment, 24, 219-229.
Templeman MA, Kingsford MJ (2010) Trace element accumulation in Cassiopea
sp.(Scyphozoa) from urban marine environments in Australia. Marine
Environmental Research, 69, 63-72.
Thein H, Ikeda H, Uye S-I (2012) The potential role of podocysts in perpetuation of the
common jellyfish Aurelia aurita (Cnidaria: Scyphozoa) in anthropogenically
perturbed coastal waters. Hydrobiologia, 690, 157-167.
Thornhill DJ, Daniel MW, LaJeunesse TC, Schmidt GW, Fitt WK (2006) Natural
infections of aposymbiotic Cassiopea xamachana scyphistomae from
environmental pools of Symbiodinium. Journal of Experimental Marine Biology
and Ecology, 338, 50-56.
Trench R, Thinh L-V (1995) Gymnodinium linucheae sp. nov.: the dinoflagellate
symbiont of the jellyfish Linuche unguiculata. European Journal of Phycology,
30, 149-154.
Uye S-I (2008) Blooms of the giant jellyfish Nemopilema nomurai: a threat to the
fisheries sustainability of the East Asian Marginal Seas. Plankton and Benthos
Research, 3, 125-131.
25
Vallotton N, Eggen RIL, Escher BI, Krayenbühl J, Chèvre N (2008) Effect of pulse
herbicidal exposure on Scenedesmus vacuolatus: a comparison of two
photosystem II inhibitors. Environmental Toxicology and Chemistry, 27, 13991407.
Van Dam JW, Negri AP, Uthicke S, Mueller JF (2011) Chemical pollution on coral
reefs: exposure and ecological effects. Ecological impact of toxic chemicals
Bentham Science Publishers Ltd, 187-211.
Verde EA, McCloskey L (1998) Production, respiration, and photophysiology of the
mangrove jellyfish Cassiopea xamachana symbiotic with zooxanthellae: effect
of jellyfish size and season. Marine Ecology Progress Series, 168, 147-162.
Wang SY, Lau K, Lai K-P et al. (2016) Hypoxia causes transgenerational impairments
in reproduction of fish. Nature Communications, 7, 12114.
Wang W, Widdows J (1991) Physiological responses of mussel larvae Mytilus edulis to
environmental hypoxia and anoxia. Marine Ecology Progress Series, 70, 223236.
Weatherhead EC, Andersen SB (2006) The search for signs of recovery of the ozone
layer. Nature, 441, 39-45.
Werner B (1973) Life cycle of Tripedalia cystophora Conant (cubomedusae). Nature,
232, 582-583.
Werner B (1975) Bau und Lebensgeschichte des Polypen von Tripedalia cystophora
(Cubozoa, class. nov., Carybdeidae) und seine Bedeutung für die Evolution der
Cnidaria. Helgoländer Wissenschaftliche Meeresuntersuchungen, 27, 461.
Widdicombe SS (2008) Predicting the impact of ocean acidification on benthic
biodiversity: what can animal physiology tell us? Journal of Experimental
Marine Biology and Ecology, 366, 187-197.
Widmer CL (2005) Effects of temperature on growth of north-east Pacific moon
jellyfish ephyrae, Aurelia labiata (Cnidaria: Scyphozoa). Journal of the Marine
Biological Association of the United Kingdom, 85, 569-573.
Wilcox ST, Moltschaniwskyj NA, Crawford CM (2007) Asexual reproduction in
scyphistomae of Aurelia sp.: Effects of temperature and salinity in an
experimental study. Journal of Experimental Marine Biology and Ecology, 353,
107-114.
26
Williamson CE, Zepp RG, Lucas RM et al. (2014) Solar ultraviolet radiation in a
changing climate. Nature Climate Change, 4, 434-441.
WMO (2015) Scientific Assessment of Ozone Depletion: 2014, Global Ozone Research
Monitoring Project. Geneva, Switzerland.
Wulff A, Sundbäck K, Nilsson C, Underwood GJ (2000) Effects of UV-B radiation on a
marine microphytobenthic community growing on a sand‐substratum under
different nutrient conditions. Limnology and Oceanography, 45, 1144-1152.
27
CHAPTER 2
Reduced salinity increases susceptibility of zooxanthellate jellyfish to
herbicide toxicity during a simulated rainfall event
This chapter includes a published paper. My contribution involved: designing the study,
conducting the experiments, data analysis, interpretation of results and writing the
manuscript. The bibliographical details of the co-authored published paper, including all
authors are:
Klein SG, Pitt KA, Carroll AR (2016) Reduced salinity increases susceptibility of
zooxanthellate jellyfish to herbicide toxicity during a simulated rainfall event. Environmental
Pollution 209:79-86 10. http://dx.doi.org/10.1016/j.envpol.2015.11.012
(Signed) _____________________
Corresponding (1st) author: Shannon Klein
(Countersigned) _____________________
Supervisor (and co-author): Kylie Pitt
28
Abstract
Accurately predicting how marine biota are likely to respond to changing ocean conditions
requires accurate simulation of interacting stressors, exposure regimes and recovery periods.
Jellyfish populations have increased in some parts of the world and, despite few direct
empirical tests, are hypothesised to be increasing because they are robust to a range of
environmental stressors. Here, we investigated the effects of contaminated runoff on a
zooxanthellate jellyfish by exposing juvenile Cassiopea sp. medusae to a photosystem II
(PSII) herbicide, atrazine and reduced salinity conditions that occur following rainfall. Four
levels of atrazine (0 ngL-1, 10ngL-1, 2µgL-1, 20µgL-1) and three levels of salinity (35ppt,
25ppt, 17ppt) were varied, mimicking the timeline of light, moderate and heavy rainfall
events. Normal conditions were then slowly re-established over four days to mimic the
recovery of the ecosystem post-rain and the experiment continued for a further 7 days to
observe potential recovery of the medusae. Pulse-amplitude modulated (PAM) chlorophyll
fluorescence, growth and bell contraction rates of medusae were measured. Medusae exposed
to the combination of high atrazine and lowest salinity died. After 3 days of exposure, bell
contraction rates were reduced by 88% and medusae were 16% smaller in the lowest salinity
treatments. By Day 5 of the experiment, all medusae that survived the initial pulse event
began to recover quickly. Although atrazine decreased YII under normal salinity conditions,
YII was further reduced when medusae were exposed to both low salinity and atrazine
simultaneously. Atrazine breakdown products were more concentrated in jellyfish tissues
than Atrazine at the end of the experiment, suggesting that although bioaccumulation
occurred, atrazine was metabolised. Our results suggest that reduced salinity may increase the
susceptibility of medusae to herbicide exposure during heavy rainfall events.
29
Introduction
Marine biota are under increasing pressure from a suite of anthropogenic activities and
climate change (Crain et al., 2008, Dawson et al., 2011). To accurately assess how marine
biota respond to environmental stress, however, experiments need to mimic the conditions
biota experience in the field. These conditions include using environmentally relevant levels
of the stressors, ensuring that the duration of exposure to the stressor is realistic and (Hughes
& Connell, 1999, Macinnis-Ng & Ralph, 2004), if appropriate, examining the effects of
simultaneous exposure to multiple stressors that may impart effects that differ from those
when biota are exposed to each stressor individually (Folt et al., 1999).
Jellyfish populations have increased in some regions of the world (but decreases or no
changes have been reported in others) (Condon et al., 2013), and in some cases have caused
severe socio-economic impacts on tourism, fisheries and power industries (Purcell et al.,
2007). Some researchers have suggested that jellyfish populations have increased because
jellyfish can tolerate many environmental stressors, including pollutants (Lucas, 2001,
Templeman & Kingsford, 2010, Gershwin, 2013). The few studies of the effects of pollutants
on jellyfish, however, demonstrate that chemical pollutants can exert deleterious effects on
jellyfish. For example, exposure to crude oil extract caused 100% mortality of Pelagia
noctiluca at concentrations ≥20µgL-1 after 16 h exposure, and survival of ephyrae and larvae
decreased with increasing concentrations and exposure time (Almeda et al., 2013). Pollutants
such as heavy metals can also bioaccumulate within jellyfish tissues (Templeman &
Kingsford, 2010, Almeda et al., 2013, Templeman & Kingsford, 2015), but the sub-lethal
effects of these metals have not been tested. Observations that toxic pollutants can negatively
affect several life history stages suggest that jellyfish may not be immune to the effects of
pollutants in coastal waters.
30
Like corals, jellyfish from the genus Cassiopea harbor zooxanthellae. Zooxanthellae, the
microalgal symbionts of corals, jellyfish and other marine invertebrates contribute
carbohydrates and other photosynthetic products to their host animals. Obstruction of electron
transport through photosystem II (PSII), which occurs as a result of exposure to herbicides,
can, therefore, reduce rates of growth and reproduction of the host. In some cases
zooxanthellae may be expelled from the host (Jones & Kerswell, 2003, Negri et al., 2005,
Cantin et al., 2007). Consequently animals, as well as plants, can be affected by exposure to
PSII herbicides. PSII herbicides include, amongst others, atrazine, simazine, ametryn,
hexazinone, diuron and tebuthiuron.
Worldwide, herbicides are usually detected in coastal waters in the ngL-1 range (Okamura et
al., 2003, Shaw et al., 2010) but during heavy rainfall and floods, herbicides may occur in the
µgL-1 range (McMahon et al., 2005, Davis et al., 2012, Smith et al., 2012), which greatly
exceed ecological guideline trigger values that are known to have deleterious effects on
marine organisms (ANZECC and ARMCANZ, 2000). Floods, however, are episodic events
and elevated concentrations of herbicides generally persist for only a few days (Solomon et
al., 1996). Organisms that are adversely affected by the initial exposure to herbicides may
begin to recover once concentrations of herbicides decline and the organism begins to
metabolise the toxins into other forms. These metabolic breakdown products can occur in
high concentrations in coastal environments and, because they are structurally similar to their
parent compound, they can also exert deleterious effects on marine organisms (Stratton,
1984, Topp et al., 2000). Despite their persistence in coastal environments, most studies of
herbicide exposure have focused only on the effects of the parent compound.
Most studies of the effects of pollutants delivered in heavy rainfall events investigate the
effects of continuous exposure over several hours (but see, Macinnis-Ng & Ralph, 2004,
Vallotton et al., 2008). Freshwater inflow from heavy rainfall events exposes biota to initially
31
high concentrations of herbicides, but dilution (due to tidal movements) causes herbicide
concentrations to decline over several days. Furthermore, several studies have highlighted the
importance of investigating the recovery of marine organisms after pulsed exposures to
determine the effects of repeated exposures (Solomon et al., 1996, Macinnis-Ng & Ralph,
2004). Macinnis-Ng & Ralph (2004) investigated the effect of two 10 h pulse exposures to
copper and the herbicide, Irgarol 1051 on the seagrass Zostera capricorni and reported that
although a 4-day recovery period between exposures allowed for the recovery of
photosynthetic efficiency and chlorophyll concentrations, seagrasses were more vulnerable to
the second exposure period. Studies that mimic the variation in herbicide concentrations that
occur during rainfall events, and also allow organisms a period of recovery following the
return to ambient conditions, may give a more realistic understanding of the long-term effects
of herbicides.et al., 2008)
During floods, coastal organisms are exposed to multiple stressors simultaneously, including
sudden changes in salinity, exposure to pollutants and increased turbidity. Only one study,
however, has examined the interactive effects of herbicides and other flood stressors on a
cnidarian. That study, which was done on coral and tested a mild 8ppt reduction in salinity,
reported that photosynthetic efficiency was reduced when exposed to Diuron (at 1 and 3μgL1
) after 10h incubations, but no significant interaction was detected with reduced salinity
(Jones et al., 2003). The salinity reduction tested was small (probably reflecting changes in
salinity that occur on coastal coral reefs after heavy rain), and it is likely that larger
fluctuations in salinity occur within estuarine ecosystems, which could further exacerbate the
effects of herbicides. Studies that consider the effects of multiple stressors and exposure
regimes specific to the area of interest, are more likely to provide a realistic understanding of
how biota are likely to respond to changing environmental conditions.
32
Jellyfish from the genus Cassiopea inhabit shallow areas and so are periodically subjected to
heavy rainfall events in which they are exposed to multiple stressors simultaneously.
Cassiopea sp. rest upside down on the benthos with their oral arms facing upwards to expose
their zooxanthellae to light (Hofmann et al., 1996). Cassiopea sp. occur in tropical and subtropical coastal waters worldwide and can form conspicuous blooms, which are sometimes
problematic (Arai, 2001, Mills, 2001).
The objective of this study was to mimic mild to heavy rainfall events by exposing Cassiopea
sp. medusae to a pulse exposure of reduced salinity and increased concentrations of the
herbicide atrazine, followed by a period where salinity and atrazine concentrations returned
to ambient conditions. Atrazine was chosen as a model PSII herbicide because it is
considered to be one of the five priority photosystem II inhibitor herbicides by the
Queensland Government, Australia (Smith et al., 2012). Since the ban of diuron in Australia
(in late 2011) (APVMA, 2011), atrazine is the most frequently detected herbicide along the
Queensland coastline. We, therefore, selected atrazine as a herbicide of concern for our
chosen study ecosystem. We hypothesised that Cassiopea sp. medusae exposed to low
salinity and atrazine separately would exhibit negative effects on rates of growth, bell
contractions and photosynthetic efficiency, but when exposed to both low salinity and
atrazine simultaneously the effects would be compounded. At the end of the experiment,
concentrations of atrazine and its breakdown products in the tissues of the jellyfish were
analysed to determine whether they accumulated and persisted within the tissues.
33
Materials and methods
Experimental approach
Juvenile Cassiopea sp. medusae (size: 19.6mm ±0.42 (mean ±1SE)) were sampled from an
enclosed shallow lagoon in Crab Island, Moreton Bay (27.34°S; 153.40°E), Queensland, in
March 2014. Atrazine was not detected in water sampled adjacent to the mainland in western
Moreton Bay and because Crab Island is on the eastern side of Moreton Bay and distant from
any source of agriculture or human settlement, atrazine concentrations at Crab Island were
also considered to be negligible. Consequently, the medusae used in the experiment had no
prior exposure to atrazine or its breakdown products. Medusae were acclimated to laboratory
conditions for 4 weeks and fed newly hatched Artemia sp. nauplii daily. Medusae were
exposed to 14 hours of light per day to accurately mimic diurnal patterns. Aquarium lights
were used to imitate the natural solar spectrum, with the wave crest located in the blue
spectrum (400-500nm) to optimise photosynthesis of zooxanthellae.
The full factorial design consisted of two orthogonal factors: salinity (three levels: high
salinity (35ppt, ambient), moderate salinity (25ppt), low salinity (17ppt)) and the herbicide
atrazine (four nominal levels: no atrazine (0µL-1), background atrazine (0.01µL-1), low
atrazine (2µgL-1), high atrazine (20µgL-1)). Salinity conditions and exposure times were
based on changes in salinity that have been recorded during mild, moderate and heavy
rainfall events in Saltwater Creek, Gold Coast Australia (27.54ºS, 153.22ºE) (Benfer et al.,
2007, EHMP, 2014), where Cassiopea sp. occurs. Atrazine levels and concentrations were
based on actual concentrations recorded in coastal waters year-round (background atrazine),
after moderate rainfall events (low atrazine) and heavy rainfall events (high atrazine) along
the Queensland coast. These data were taken from studies spanning a wide geographical area,
from Hervey Bay (25.16ºS, 152.53ºE) (e.g. McMahon et al. 2005) to North Queensland (e.g.
Davis et al. 2012, Smith et al., 2012).
34
The experiment was done in a laboratory with the temperature controlled at 24°C, which was
the ambient temperature at the location from which the jellyfish were collected. Four
replicate 1L glass aquaria, each containing one medusa (bell diameter 14-26mm), were
randomly allocated to each salinity and herbicide combination. Each aquarium was gently
aerated to maintain >80% oxygen saturation and to circulate water. Lids were placed loosely
over each aquarium with a header space of ~15mm to minimise evaporation and subsequent
changes in salinity. Temperature was recorded daily in each aquarium using a thermometer
and salinity was measured using a conductivity-salinity meter (TPS salinity-conductivity
meter, MC-84). Each aquarium was replenished daily with fresh seawater of the appropriate
salinity and atrazine concentrations. Fresh 10µm filtered seawater was used in the
experiment, and sourced from The Gold Coast Seaway, Queensland (27.56ºS, 153.25ºE).
Salinity was manipulated by adding reverse osmosis water. Atrazine stock solutions were
prepared using 10µm filtered seawater and atrazine, 2-Chloro-4-ethylamino-6isopropylamino-1,3,5-triazine (sourced from Sigma-Aldrich, CAS number: 1912-24-9). Each
day, three stock solutions and one control solution (filtered seawater) were made and
sonicated for 30 minutes to ensure the solutions were homogenous.
To accurately mimic the pulsed nature of a rainfall event, salinity was reduced by 1.5ppt h-1
in the low salinity treatments and reduced by 1.5ppt every 2 hours in the moderate salinity
treatments until desired salinity levels were achieved. Atrazine concentrations were increased
by 15% of the desired concentration for each treatment every 2 hours until desired
concentrations were reached. Conditions were held constant for two days and then gradually
returned to ambient (pre-flood) levels over four days by raising salinity by 5ppt d-1 (in the
low salinity treatments) and 2.5ppt d-1 (in the moderate salinity treatments). Atrazine
concentrations were reduced by 25% d-1. By Day 6, experimental conditions in all treatments
had returned to ambient levels and the experiment was continued for a further seven days to
measure potential recovery (i.e. the experiment ran for 13 days).
35
Data collection
Four response variables were measured: survival, sizes of medusae, the rate of bell
contractions (as a measure of behaviour) and photosynthetic efficiency of inhospite
zooxanthellae. Each day, the number of bell contractions were measured for two minutes for
each medusa and recorded as contractions min-1. Medusae were then removed from each
replicate aquarium and immersed in seawater in a petri dish where the diameter of each
medusa (at full extension) was recorded to the nearest mm using callipers. All medusae were
then adapted to dark conditions for 20 minutes prior to Pulse Amplitude Modulated (PAM)
measurements. Chlorophyll fluorescence measurements were made in a small plastic
container with a Phyto-PAM (Walz, GmbH, Effeltrich, Germany). Measurements of
chlorophyll fluorescence yielded a measure of the minimum (F) and maximum fluorescence
yield (FmV) from which the effective quantum yield (YII) was calculated (∆F/Fm′) (Genty et
al., 1989). All medusae were then returned to their appropriate aquaria and fed by introducing
ca. 100 newly hatched Artemia sp. nauplii.
Analysis of herbicide concentrations
A pilot study was done to test target concentrations of atrazine and concentrations were
measured analytically using liquid chromatography/ mass spectrometry (LC/MS Q-TOF).
The pilot study verified that concentrations of atrazine in each salinity treatment remained
stable over the 24 hour and confirmed that the natural seawater used during the experiment
did not already contain atrazine or derivatives of atrazine. The pilot study also confirmed the
use of 0.01µgL-1, 2.0µgL-1 and 20µgL-1 as nominal spiked concentrations for the experiment.
100mL samples were taken in 100mL HCl-washed glass bottles. Separation was achieved
using a 1 × 100mm Agilent Zorbax eclipse plus C18 column with a 1.8µm particle size.
Samples were analysed at 35ºC, with a flow rate of 0.8mL min-1 with isocratic elution of 1%
B isocratic (0-3 mins), followed by a linear gradient 1%-100% B (3-8 mins), isocratic elution
with 100% B (8-9mins), and finally column reconditioning using a gradient from 100%-1% B
36
(9-11 mins) and isocratic elution of 1%B (11-14 mins) (A/water with 0.1% formic acid,
B/Acetonitrile with 0.1% formic acid).
At the end of the experiment all medusae that survived were collected, weighed and frozen.
All samples were freeze dried using a benchtop VirTis Freeze Dryer (benchtop K) and the dry
weight was recorded. A liquid-liquid phase extraction (milli-Q water, and dichloromethane)
was used to extract atrazine from each medusa. Samples were dried and re-dissolved in a
final volume of 1mL of MeOH and analysed on a Waters triple Quad LC/MS with an Aquity
UPLC (ultrahigh performance) inlet. Separation was achieved using a 2.1mm × 100mm
Cortecs UPLC C18 column with a particle size of 1.6µm. Samples were analysed at 40ºC,
with a flow rate of 0.6mL min-1 with a linear gradient starting at 1% A (0.1% formic in
acetonitrile) (0-5 mins), 62.5% A -37.5% B ( water with 0.1% formic acid) (5mins5.50mins), 100% A (5.50mins- 9 mins) and held at 100% A – 99% B (9 mins-10mins). The
LC/ MS analysis targeted atrazine and its breakdown products, des-isopropyl atrazine and
des-ethyl atrazine.
Statistical analyses
Two separate statistical analyses were used to analyse each dependent variable because all
medusae in the high atrazine, low salinity (20µgL-1, 17ppt) treatment died on Day 3 of the
experiment. The dependent variables (change in medusa size (%), bell contraction rates (min1
) and YII) in all treatments on days 1-3 were analysed using separate repeated measures
linear mixed models (LMMs) in SPSS (SPSS, Released 2013). The three fixed factors for
each analysis were identical, and were herbicide concentration (0µL-1, 0.01µL-1, 2µgL-1,
20µgL-1), salinity (35ppt, 25ppt, 17ppt) and time (days 1-3), which was the repeated measure.
For all treatments that survived the experiment, all dependent variables at Day 13 were
analysed using separate LMMs in SPSS. The two fixed factors were herbicide concentration
and salinity. A range of models (e.g. AR(1), AR(1): heterogeneous, Compound Symmetry
37
(CS)) were investigated and the best model was obtained by comparing various goodness-offit statistics (-2 log likelihood, AIC, and BIC). If required, data were ln(x+1) transformed. For
all analyses, data were checked for normality using standardised residual and Q-Q plots.
When significant differences were found estimated marginal means were used to identify
which means differed. Atrazine data could not be transformed to satisfy normality or
homogeneity of variance assumptions for an ANOVA, therefore a permutational approach
was used. Final atrazine concentrations in medusae at the end of the experiment were
analysed using a two-way permutational multivariate analysis of variance (PERMANOVA)
using PRIMER. The two fixed factors were herbicide concentration and salinity. Data were
ln(x+1) transformed. When significant differences were found, PERMANOVA pairwise tests
were used to test which means differed. Total atrazine concentrations were calculated by
adding atrazine, des-isopropyl atrazine and des-ethyl atrazine.
38
Results
Survival and Effective Quantum Yield
All medusae in the high atrazine (20µgL-1), low salinity (17ppt) treatment died by Day 3 of
the experiment but medusae in all other treatments survived throughout the experiment.
During Days 1-3, the temporal variation of YII values among atrazine treatments was not
consistent across the three salinity treatments (Fig. 1) (Table 1). The interaction was caused
by inconsistencies in the way the medusae responded to herbicide within each level of
salinity. Specifically, in the highest salinity level, only medusae in the high atrazine treatment
had significantly lower YII values by Day 3 of the experiment (Fig. 1a). Medusae in the
moderate salinity level responded faster than medusae in the high salinity level, with
significantly lower YII values in the background, low and high atrazine treatments detected at
Day 2. All medusae in the lowest salinity treatments experienced reduced YII values at Day 2
of the experiment. At Day 2, there was no significant difference between the no atrazine and
background atrazine treatments but there were significantly lower YII values in both the low
atrazine and high atrazine treatments, with the most pronounced effect seen in the high
atrazine treatment. After Day 3, all low salinity treatments except for the high atrazine
treatment, in which all individuals had died, began to slowly recover (Fig. 1c). From Day 4
onwards, YII values increased in all treatments, but rates of increase were not consistent
among atrazine treatments. At the end of the experiment there was no significant difference
between YII values among salinity and atrazine treatments (Fig. 1) (Table 2).
39
Fig. 1 Effective quantum yield (mean±1 SE) during the 13 day experiment at high (a),
moderate (b) and low salinity (c) levels. Linear mixed model analysis was done only for days
1-3 because all medusae in the low salinity, high atrazine treatment died on Day 3 (Days 1-3
(n=48) and Days 4-13 (n=44)). Letters above data points indicate similarities (e.g. AA) and
differences (e.g. AB) between atrazine treatments within each day, as determined by
estimated marginal means. Note y-axis scales vary among figures.
40
Table 1 Summary of results for three linear mixed models comparing effective quantum
yield, bell contractions (min-1) and medusae size (% change) between treatments during the
first 3 days of the experiment (Day 1-3). Df=degrees of freedom. BIC= Bayesian Information
Criterion.
Variable
YII
Bell contractions
Medusae size
Transformation
Ln(x+1)
Ln(x+1)
Ln(x+1)
Model-of-best-fit
CS BIC=77
AR1(H) BIC=969
AR1(H) BIC=637
P
P
Source of variation
Df
P
Salinity
2
<0.001
<0.001
F=25.163
Herb
3
F=8.900
6
0.005
Time
2
<0.001
Time × Salinity
4
0.012
Time × Herb
6
<0.001
0.159
F=0.835
F=1.830
0.977
F=3.752
0.544
F=0.193
F=0.745
<0.001
F=20.471
>0.001
F=90.273
F=15.377
<0.001
F=3.592
>0.001
F=14.310
F=16.372
0.250
F=8.386
Time × Salinity × Herb 12
F=34.668
0.484
<0.001
Salinity × Herb
>0.001
F=23.296
0.208
F=1.360
F=1.464
0.938
0.028
F=2.151
0.505
F=0.442
F=0.946
Table 2 Summary of results for three linear mixed models comparing effective quantum
yield, bell contractions (min-1) and medusae size (% change) between treatments at Day 13 of
the experiment. Df= degrees of freedom. BIC= Bayesian Information Criterion.
Variable
YII
Bell contractions
Medusae size
Transformation
Ln(x+1)
Ln(x+1)
Ln(x+1)
Model-of-best-fit
AR1 BIC=151
AR1(H) BIC=252
AR1(H) BIC=245
Source of variation
Df
P
P
P
Salinity
2
0.156
0.951
>0.001
F=1.971
F=0.050
F=25.753
0.429
0.118
0.086
F=0.949
F=2.109
F=2.395
0.428
0.126
0.943
F=1.009
F=1.874
F=0.237
Herb
Salinity × Herb
3
5
41
Behaviour
Salinity, but not exposure to atrazine, reduced the rate of bell contractions (Table 1) although
the pattern of variation among salinity treatments varied through time (Table 1) (Fig. 2). At
Day 2 of the experiment, bell contraction rates were reduced by 18% in the high salinity
treatment, 62% in the moderate salinity treatment and 94% in the lowest salinity treatment.
Bell contraction rates began to recover in all treatments from Day 3 onwards. From Days 813 bell contraction rates were consistent across all levels of salinity and at the end of the
experiment there was no significant difference between salinity treatments (Table 2) (Fig. 2).
Fig. 2 Bell contractions (number min-1) (mean±1 SE) during the 13 day experiment. Letters
above data points indicates no significant difference (e.g. AA) and significant differences
(e.g. AB) between salinity treatments, as determined by estimated marginal means. Note
sample size varies among days (Days 1-3 (n=48) and Days 4-13 (n=44)).
42
Change in size of medusae
Atrazine did not affect the size of medusae but significant differences were detected among
salinity treatments and patterns were not consistent through time (Days 1-3) (Table 1) (Fig.
3). At Day 3 of the experiment, medusae in the high salinity treatment had increased in size
by 8% but medusae in the moderate salinity treatment had decreased by 7% and medusae in
the lowest salinity treatment had decreased by 16%. At the end of the experiment, medusae in
the high salinity treatments had increased in size by 8%. Although medusae in the moderate
and low salinity treatments began to increase in size after 5 days, medusae did not return to
their initial size, with significant differences remaining between salinity treatments at Day 13
(Fig. 3) (Table 2).
Fig. 3 Percentage change in size of medusae (mean ±1 SE) during the 13 day experiment.
Letters above data points indicates no significant difference (e.g. AA) and significant
differences (e.g. AB) between salinity treatments, as determined by estimated marginal
means. Note sample size varies among days (Days 1-3 (n=48) and Days 4-13 (n=44)).
43
Concentrations of atrazine and its breakdown products in medusae tissues
LC/MS analysis of medusae tissue collected at the end of the experiment revealed
concentrations of atrazine and its two breakdown products, des-isopropyl atrazine and desethyl atrazine in medusae in all treatments except for the no atrazine treatment (Table 3).
Salinity had no effect on concentrations of atrazine, des-isopropyl atrazine, des-ethyl atrazine
or total atrazine. However, concentrations of atrazine (P=0.001, F=9.646), des-ethyl atrazine
(P=0.006, F=5.428), des-isopropyl atrazine (P=0.001, F= 9.562) and total atrazine (P=0.001,
F=6.89) in medusae varied among atrazine treatments. Medusae in the background atrazine
treatment had significantly lower mean atrazine and des-isopropyl concentrations in their
tissues than medusae from the low and high atrazine treatments. However, there was no
significant difference between the mean atrazine and des-isopropyl concentrations in
medusae tissues from the low and high atrazine treatments (Table 3). The mean des-ethyl
atrazine and total atrazine concentrations within medusae tissues increased consistently
across the background, low and high atrazine treatments (Table 3).
44
Table 3 Mean (±1SE) concentrations (µgL-1) of atrazine, des-isopropyl atrazine and des-ethyl atrazine and total atrazine (i.e. the sum of atrazine
and its derivatives) within jellyfish at Day 13 of the experiment. Medusae were exposed to four atrazine treatments NA (no atrazine, 0µgL-1), BA
(background atrazine, 0.01µgL-1), LA (low atrazine, 2µgL-1), HA (high atrazine, 20µgL-1). Concentrations of atrazine and atrazine derivatives
were averaged across all salinity levels tested. Letters in parentheses next to results indicate similarities (A,A) and differences (A,B) between
atrazine treatments, as determined by post-hoc tests. ND= Not detected.
Atrazine
treatments
Atrazine
Mean ± 1SE
(µgL-1)
Des-isopropyl
Mean ± 1SE
( µgL-1)
Des-ethyl
Mean ± 1SE
( µgL-1)
Total Atrazine
Mean ± 1SE
(µg L-1)
NA
ND (A)
ND(A)
ND(A)
ND(A)
BA
1.8×10-3 (±0.001)(B)
9.4×10-3 (±0.003)(B)
8.3×10-3 (±0.003)(B)
1.9×10-2 (± 0.004)(B)
LA
5.1×10-2 (±0.023)(C)
4.7×10-1(±0.144)(C)
9.8×10-1(±0.285)(C)
1.49 (±0.388)(C)
HA
6.2×10-2 (±0.031)(C)
7.2×10-1 (±0.277)(C)
2.28 (±0.299)(D)
3.14 (±0.624)(D)
45
Discussion
Cassiopea sp. medusae survived most herbicide and salinity conditions tested, except
for medusae exposed to the highest atrazine and lowest salinity conditions
simultaneously. These results support our hypothesis that when exposed to low salinity
and atrazine separately, medusae would exhibit negative effects, but when exposed to
low salinity and atrazine simultaneously the effects would be compounded. Indeed, if
we had only investigated the effects of herbicide and salinity as single stressors we
would have concluded that Cassiopea sp. survived all salinity and herbicide levels
tested. Overall, our observations suggest Cassiopea sp. jellyfish may survive during
mild to moderate rainfall events but that exposure to heavy rainfall may cause
populations to decline.
Atrazine affected photosynthetic efficiency but not the behaviour (i.e. bell contraction
rates) or growth of the animals whereas exposure to low salinities negatively affected all
three response variables. Medusae died, however, only when exposed to the most
extreme combination of both treatments. Taken together, these observations suggest that
the impaired photosynthetic functioning caused by exposure to Atrazine may have been
the ultimate cause of mortality in medusae. Photosynthetic efficiency and bell
contraction rates rapidly returned to normal after the treatments were returned to
ambient conditions. Medusae that shrank during the experiment, however, did not
recover to their original size. Mortality of animals is usually closely coupled with size
(Kimura et al., 2010) and exposure to even mild and moderate rainfall events may,
therefore, increase mortality rates within the population.
The effects of chemical pollutants on marine biota can vary depending on exposure
time. In this study, Cassiopea sp. were exposed to atrazine and reduced salinity over a
6-day period, and negative effects on YII were observed after only one day of exposure.
46
The only other study to investigate the effects of a herbicide and reduced salinity on
cnidarians used a considerably shorter exposure time of 10h (Jones et al., 2003). Jones
et al. (2003) observed reduced effective quantum yield in corals exposed to Diuron (at 1
and 3µgL-1), but there was no significant effect of salinity on the photosynthetic
efficiency of the two coral species tested. Differences in results may be due to a longer
exposure time in the current study and may explain why atrazine and reduced salinity
had negative effects on medusae of Cassiopea sp., but no interactive effects were seen
on A. formosa and M. digitata. Furthermore, Jones et al. (2003) reduced salinity by just
8ppt whereas the current study reduced salinity by 18ppt. The moderate salinity level
(25ppt) chosen in this study, however, was similar to that of the low salinity conditions
(27ppt) tested in Jones et al. (2003), in which no negative effects of salinity were
observed. Our observations that the low atrazine treatment reduced photosynthetic
efficiency under moderate salinity conditions over 2 days suggest that longer exposure
times may yield more toxic effects than shorter exposure periods. Experimental
conditions, as well as exposure times, may vary according to the type of ecosystem
being tested. For example, Jones et al (2003) tested a shorter exposure time, probably to
mimic a rainfall event on a coastal coral reef, whereas the current study investigated the
effects of a longer exposure time in an intertidal creek, yielding different results. Basing
experimental conditions on measurements in the field may provide a more realistic
understanding of how marine biota are likely to react to pollutant exposure during heavy
rainfall events.
Salinity and herbicide concentrations in the field, as well as exposure times, may differ
from those tested in this study and are likely to influence whether organisms such as
Cassiopea sp. can tolerate more extreme rainfall events. The lowest salinity conditions
tested in this study were based on heavy rainfall events that typically occur 3 or 4 times
per year within the region. However, rarer and more extreme flood events may reduce
salinity even further and consequently reduce concentrations of atrazine via dilution.
47
Indeed, if Cassiopea sp. were exposed to lower salinity conditions in combination with
the atrazine concentrations tested here, Cassiopea sp. may be more vulnerable to heavy
rainfall events. Furthermore, differences in flushing rates and tidal regimes between
different coastal ecosystems (e.g. open coasts vs coastal lagoons) is likely to influence
the time it takes ecosystems to recover following heavy rainfall events. The same level
of rainfall, therefore, may be more detrimental for populations in poorly-flushed coastal
lagoons than in coastal embayments. Accurately predicting how Cassiopea sp. will
respond in other coastal ecosystems and during more extreme flooding events thus
requires investigating a wider range of salinity and herbicide concentrations than tested
here, as well as investigation into the effects of herbicides other than atrazine.
Our observations that medusae contained atrazine, des-ethyl atrazine and des-isopropyl
atrazine concentrations at Day 13 of the experiment suggests that atrazine was retained
and metabolised during the recovery period. Total atrazine concentrations at the end of
the experiment, however, were small relative to the total atrazine they were exposed
over the course of the experiment. At Day 13 of the experiment medusae had
significantly higher concentrations of des-ethyl atrazine than atrazine (in its original
form) and des-isopropyl atrazine. These results are probably due to des-ethyl atrazine
being considerably less hydrophilic (with a cLogP value of 1.31) than des-isopropyl
(cLogP value of 0.99) and, therefore, less likely to be excreted by Cassiopea sp.
medusae during the recovery period (see Janicka et al., 2006). Although atrazine
degradation products remained in medusae at the end of the experiment, medusae began
to recover quickly from Day 4 onwards and no negative effects on photosynthetic
efficiency or behaviour were observed after Day 10 of the experiment. These
observations suggest that concentrations of atrazine, des-ethyl atrazine and desisopropyl at Day 13 of the experiment had limited effects on photosynthetic efficiency
and behaviour.
48
Knowledge of the direct effects of des-isopropyl atrazine and des-ethyl atrazine on
photosystem II and other physiological processes in the marine environment is limited
(but see, Tchounwou et al., 2000, Magnusson et al., 2010). Magnusson et al. (2010)
investigated the effects of atrazine and des-ethyl atrazine on benthic microalage and
reported that des-ethyl atrazine inhibited YII but was less toxic than its original atrazine
form. To more accurately assess the effects of atrazine on photosystem II and other
biological processes we must now investigate the pathway by which atrazine is
absorbed, metabolised and excreted. While medusae may tolerate some pollutants in
their tissues, pollutants may exert sub-lethal effects that could make medusae more
susceptible to other environmental stressors and so the interactive effects of pollutants
and their degradation products with other environmental stressors should be considered.
Magnusson et al., 2010)
Our results demonstrate that Cassiopea sp. medusae can tolerate the salinity and
herbicide conditions that typically occur in mild to moderate rainfall events but that they
may not survive heavy rainfall events with high levels of atrazine runoff. Rainfall events
that reduce salinity and increase exposure to pollutants such as atrazine, therefore, may
be a major driver of the population dynamics of Cassiopea sp. Our study, however,
examined the response of medusae to simulated rainfall events and other stages of the
life history may respond differently. Indeed if the polyps can persist during heavy
rainfall events then they could restock populations of medusae following extreme
rainfall events. Importantly our results do not support previous claims that jellyfish are
robust to environmental stressors and they highlight the need to examine the interactive
effects of co-occurring stressors under environmentally relevant scenarios as a means of
assessing the response of marine biota to changing ocean conditions.
49
Acknowledgements
This work was funded by Griffith University and an Australian Post-graduate Award to
SK. We thank F. Leusch, A. White, B. Matthews for technical support, B. Blair for
laboratory assistance and JM Arthur for statistical advice.
50
References
Almeda R, Wambaugh Z, Chai C, Wang Z, Liu Z, Buskey EJ (2013) Effects of Crude
Oil Exposure on Bioaccumulation of Polycyclic Aromatic Hydrocarbons and
Survival of Adult and Larval Stages of Gelatinous Zooplankton. PLOS one, 8,
e74476.
ANZECC and ARMCANZ (2000) Australian and New Zealand guidelines for fresh and
marine water quality. Australian and New Zealand Environment and
Conservation Council and Agriculture and Resource Management Council of
Australia and New Zealand, Canberra, 1-103.
APVMA (2011) Diuron – Environment Assessment. Australian Pesticides and
Veterinary Medicines Authority, Canberra, 1-247.
Arai MN (2001) Pelagic coelenterates and eutrophication: a review. In: Jellyfish
Blooms: Ecological and Societal Importance. pp 69-87. Springer.
Benfer NP, King B, Lemckert CJ (2007) Salinity observations in a subtropical estuarine
system on the Gold Coast, Australia. Journal of Coastal Research, 50, e651.
Brotz L, Cheung WW, Kleisner K, Pakhomov E, Pauly D (2012) Increasing jellyfish
populations: trends in Large Marine Ecosystems. Hydrobiologia, 690, 3-20.
Cantin NE, Negri AP, Willis BL (2007) Photoinhibition from chronic herbicide
exposure reduces reproductive output of reef-building corals. Marine Ecology
Progress Series, 344, 81-93.
Condon RH, Duarte CM, Pitt KA et al. (2013) Recurrent jellyfish blooms are a
consequence of global oscillations. Proceedings of the National Academy of
Sciences, 110, 1000-1005.
Crain CM, Kroeker K, Halpern BS (2008) Interactive and cumulative effects of multiple
human stressors in marine systems. Ecology Letters, 11, 1304-1315.
Davis AM, Lewis SE, Bainbridge ZT, Glendenning L, Turner RDR, Brodie JE (2012)
Dynamics of herbicide transport and partitioning under event flow conditions in
the lower Burdekin region, Australia. Marine Pollution Bulletin, 65, 182-193.
51
Dawson TP, Jackson ST, House JI, Prentice IC, Mace GM (2011) Beyond predictions:
biodiversity conservation in a changing climate. Science, 332, 53-58.
EHMP (2014) Ecosystem Health Monitoring Program. (ed
http://www.healthywaterways.org/ehmphome.aspx).
Fabricius KE (2005) Effects of terrestrial runoff on the ecology of corals and coral
reefs: review and synthesis. Marine Pollution Bulletin, 50, 125-146.
Folt C, Chen C, Moore M, Burnaford J (1999) Synergism and antagonism among
multiple stressors. Limnology and Oceanography, 44, 864-877.
Genty B, Briantais J-M, Baker NR (1989) The relationship between the quantum yield
of photosynthetic electron transport and quenching of chlorophyll fluorescence.
Biochimica et Biophysica Acta (BBA)-General Subjects, 990, 87-92.
Gershwin L-A (2013) Stung!: On Jellyfish Blooms and the Future of the Ocean,
University of Chicago Press.
Hofmann DK, Fitt W, Fleck J (1996) Checkpoints in the life-cycle of Cassiopea spp.:
control of metagenesis and metamorphosis in a tropical jellyfish. International
Journal of Developmental Biology, 40, 331-338.
Hughes T, Connell J (1999) Multiple stressors on coral reefs: A long‐term perspective.
Limnology and Oceanography, 44, 932-940.
Janicka M, Kwietniewski L, Perišić-Janjić N (2006) Determination of retention factors
of s-triazines homologous series in water using a numerical method basing on
Ościk's equation. Chromatographia, 63, S87-S93.
Jones RJ, Kerswell AP (2003) Phytotoxicity of Photosystem II(PSII) herbicides to coral.
Marine Ecology Progress Series, 261, 149-159.
Jones RJ, Muller J, Haynes D, Schreiber U (2003) Effects of herbicides diuron and
atrazine on corals of the Great Barrier Reef, Australia. Marine Ecology Progress
Series, 251, 153-167.
Kimura S, Kato Y, Kitagawa T, Yamaoka N (2010) Impacts of environmental
variability and global warming scenario on Pacific bluefin tuna (Thunnus
52
orientalis) spawning grounds and recruitment habitat. Progress in
Oceanography, 86, 39-44.
Lucas CH (2001) Reproduction and life history strategies of the common jellyfish,
Aurelia aurita, in relation to its ambient environment Hydrobiologia, 45, 229246.
Macinnis-Ng CMO, Ralph PJ (2004) In situ impact of multiple pulses of metal and
herbicide on the seagrass, Zostera capricorni. Aquatic Toxicology, 67, 227-237.
Magnusson M, Heimann K, Quayle P, Negri AP (2010) Additive toxicity of herbicide
mixtures and comparative sensitivity of tropical benthic microalgae. Marine
Pollution Bulletin, 60, 1978-1987.
McMahon K, Bengtson Nash S, Eaglesham G, Müller JF, Duke NC, Winderlich S
(2005) Herbicide contamination and the potential impact to seagrass meadows in
Hervey Bay, Queensland, Australia. Marine Pollution Bulletin, 51, 325-334.
Mills CE (2001) Jellyfish blooms: are populations increasing globally in response to
changing ocean conditions? In: Jellyfish Blooms: Ecological and Societal
Importance. pp 55-68. Springer.
Negri A, Vollhardt C, Humphrey C, Heyward A, Jones R, Eaglesham G, Fabricius K
(2005) Effects of the herbicide diuron on the early life history stages of coral.
Marine Pollution Bulletin, 51, 370-383.
Negri AP, Flores F, Röthig T, Uthicke S (2011) Herbicides increase the vulnerability of
corals to rising sea surface temperature. Limnology and Oceanography, 56, 471485.
Owen R, Knap A, Ostrander N, Carbery K (2003) Comparative acute toxicity of
herbicides to photosynthesis of coral zooxanthellae. Bulletin of Environmental
Contamination and Toxicology, 70, 0541-0548.
Purcell JE, Uye S, Lo W (2007) Anthropogenic causes of jellyfish blooms and their
direct consequences for humans: a review. Marine Ecology Progress Series,
350, 153-174.
53
Richardson AJ, Bakun A, Hays GC, Gibbons MJ (2009) The jellyfish joyride: causes,
consequences and management responses to a more gelatinous future. Trends in
Ecology & Evolution, 24, 312-322.
Shaw M, Furnas MJ, Fabricius K, Haynes D, Carter S, Eaglesham G, Mueller JF (2010)
Monitoring pesticides in the Great Barrier Reef. Marine Pollution Bulletin, 60,
113-122.
Smith R, Middlebrook R, Turner R, Huggins R, Vardy S, Warne M (2012) Large-scale
pesticide monitoring across Great Barrier Reef catchments – Paddock to Reef
Integrated Monitoring, Modelling and Reporting Program. Marine Pollution
Bulletin, 65, 117-127.
Solomon KR, Baker DB, Richards RP et al. (1996) Ecological risk assessment of
atrazine in North American surface waters. Environmental Toxicology and
Chemistry, 15, 31-76.
SPSS (Released 2013) IBM SPSS Statistics for Windows. Version 22.0, Armonk, NY:
IBM Corp.
Stratton GW (1984) Effects of the herbicide atrazine and its degradation products, alone
and in combination, on phototrophic microorganisms. Archives of
Environmental Contamination and Toxicology, 13, 35-42.
Tchounwou P, Wilson B, Ishaque A, Ransome R, Huang M-J, Leszczynski J (2000)
Toxicity assessment of atrazine and related triazine compounds in the microtox
assay, and computational modeling for their structure-activity relationship.
International Journal of Molecular Sciences, 1, 63-74.
Templeman MA, Kingsford MJ (2010) Trace element accumulation in Cassiopea
sp.(Scyphozoa) from urban marine environments in Australia. Marine
Environmental Research, 69, 63-72.
Templeman MA, Kingsford MJ (2015) Predicting aqueous copper and zinc
accumulation in the upside-down jellyfish Cassiopea maremetens through the
use of biokinetic models. Environmental monitoring and assessment, 187, 1-8.
54
Topp E, Mulbry WM, Zhu H, Nour SM, Cuppels D (2000) Characterization of striazine herbicide metabolism by a Nocardioides sp. isolated from agricultural
soils. Applied and Environmental Microbiology, 66, 3134-3141.
Vallotton N, Eggen RIL, Escher BI, Krayenbühl J, Chèvre N (2008) Effect of pulse
herbicidal exposure on Scenedesmus vacuolatus: a comparison of two
photosystem II inhibitors. Environmental Toxicology and Chemistry, 27, 13991407.
55
CHAPTER 3
Surviving but not thriving: inconsistent responses of zooxanthellate
jellyfish polyps to ocean warming and future UV-B scenarios
This chapter includes a published paper. My contribution involved: designing the study,
conducting the experiments, data analysis, interpretation of results and writing the
manuscript. The bibliographical details of the co-authored published paper, including all
authors are:
Klein SG, Pitt KA, Carroll AR (2016) Surviving but not thriving: inconsistent
responses of zooxanthellate jellyfish polyps to ocean warming and future UV-B
scenarios. Scientific Reports 6: 28859.
(Signed) _____________________
Corresponding (1st) author: Shannon Klein
(Countersigned) _____________________
Supervisor (and co-author): Kylie Pitt
Please note: Supplementary material for this paper (Fig. S1) is included as an appendix.
56
57
58
59
60
61
62
63
64
65
CHAPTER 4
Symbiodinium mitigate the combined effects of hypoxia and acidification
on a non-calcifying cnidarian
This chapter includes an unpublished paper. My contribution involved: designing the
study, conducting the experiments, data analysis, interpretation of results and writing
the manuscript. The bibliographical details of the co-authored paper, including all
authors are:
Klein SG, Pitt KA, Nitschke MR, Goyen S, Welsh DT, Suggett DJ, Carroll AR
(submitted) Symbiodinium mitigate the combined effects of hypoxia and acidification
on a non-calcifying cnidarian.
(Signed) _____________________
Corresponding (1st) author: Shannon Klein
(Countersigned) _____________________
Supervisor (and co-author): Kylie Pitt
66
Abstract
Hypoxia is a major anthropogenic stressor in many coastal regions. Hypoxic waters are
depleted in O2 but simultaneously experience enhanced CO2 (and thus decreased pH)
due to microbial respiration. Most studies of hypoxia, however, do not consider the
potential interactive effects of low O2 and pH. During photosynthesis, Symbiodinium
cells, the microalgal symbionts of cnidarians and other marine invertebrates, take up
CO2 and produce O2 and thus potentially mitigate the negative effects of hypoxia and
acidification. To test this hypothesis we therefore investigated the role of Symbiodinium
in mitigating the potential interactive effects of hypoxia and acidification on a noncalcifying cnidarian by comparing asexual reproduction rates and the buffering capacity
of symbiotic and aposymbiotic polyps of Cassiopea sp. jellyfish. We also measured the
photosynthetic efficiency, Chl a content and Symbiodinium density of symbiotic polyps.
Symbiotic and aposymbiotic polyps were exposed to two levels of dissolved oxygen
(ambient, 6.0mgL-1, and hypoxic, 2.0mgL-1) and two levels of pH (ambient, pH 8.0, and
low pH, pH 7.6) in a full factorial design. Acidification alone resulted in 58% more
symbiotic polyps than aposymbiotic polyps suggesting that elevated CO2 stimulated
Symbiodinium spp. and enhanced the fitness of Cassiopea sp. Symbiotic polyps exposed
to combined hypoxia and acidification produced similar numbers of polyps to those
exposed to ambient conditions, further suggesting that the presence of Symbiodinium
mitigated the combined effects of hypoxia and acidification on asexual reproduction.
The internal pH of aposymbiotic polyps reflected the pH of water they were exposed to,
as did that of symbiotic polyps during the night, however, during the day, internal pH
measurements of symbiotic polyps exposed to low pH conditions recovered to control
levels. Similar to the results for asexual reproduction, Symbiodinium cell densities
responded positively to acidification, but Chl a content per polyp and Symbiodinium Chl
a per cell increased in response to the dual stressors. Symbiodinium clearly plays an
important role in mitigating the combined effects of hypoxia and acidification on
Cassiopea sp. polyps. Symbiodinium may also enhance the fitness of other cnidarian
67
hosts under hypoxic and more acidic conditions. Non-calcifying cnidarians, such as
jellyfish and anemones, may therefore have a greater competitive advantage during
hypoxic events. These findings have important implications for benthic ecosystems
under changing environmental conditions.
68
Introduction
Marine ecosystems are under increasing pressure from climate change and a suite of
anthropogenic perturbations (Crain et al., 2008). Hypoxia (oxygen depletion) is one of
these threats and hypoxic zones have been reported with increasing frequency in coastal
ecosystems (Diaz & Rosenberg, 2008). Hypoxic zones are predicted to expand with
growing human activities (Vaquer-Sunyer & Duarte, 2008, Altieri & Gedan, 2015) and
hypoxia now represents one of the most severe threats to coastal marine ecosystems
(Vaquer-Sunyer & Duarte, 2008, Chu & Tunnicliffe, 2015).
Anthropogenic nutrient loads to coastal waters stimulates excessive production of
organic matter (OM). The subsequent microbial remineralisation of OM depletes
oxygen (O2) from the water column and can result in hypoxia (<2mg O2 L-1) (Cai et al.,
2011). However, hypoxic waters are also more acidic because the carbon dioxide (CO2)
produced during microbial respiration reduces pH through the formation and
dissociation of carbonic acid (Gobler & Baumann, 2016). During these processes, CO2
and O2 levels are closely coupled in coastal waters and thus, hypoxia is concomitantly
linked to a reduction in pH (Gobler et al., 2014).
Despite hypoxia and acidification being tightly coupled in coastal waters, most
experiments that investigate the potential impacts of hypoxia do not consider the effects
of lowered pH. Instead, these experiments commonly sparge seawater with N2 gas to
displace O2 (e.g. Wang & Widdows, 1991, Baker & Mann, 1994, Gracey et al., 2001,
Eerkes-Medrano et al., 2013). Sparging with N2 gas, however, simultaneously displaces
CO2 from the system which elevates pH, thereby forcing pH in a direction that is
contrary to that observed in field scenarios (Gobler et al., 2014). To accurately assess
the response of marine biota to hypoxia, we must closely mimic chemical changes that
occur in the natural environment.
69
Our understanding of the effects of hypoxic conditions on biological responses is
hindered by limited data on the potential interactive effects of hypoxia and acidification
on marine biota (but see, Gobler & Baumann, 2016). Of the few studies that have
examined the combined effects of hypoxia and acidification on marine organisms, most
studies have focused on calcifying taxa and demonstrate variable responses to the dual
stressors (e.g. Kim et al., 2013, Gobler et al., 2014, DePasquale et al., 2015,
Jakubowska & Normant, 2015, Jansson et al., 2015). In one study, two species of
bivalves, Argopecten irradians and Mercenaria mercenaria, were exposed to low DO
(~36.5µM) and low pH (~7.53). Exposure to low DO alone inhibited the growth and
metamorphosis of A. irradians, but not M. mercenaria. Exposure to hypoxia and
acidification in combination, however, imposed more severe effects on A. irradians and
reduced growth rates in M. mercenaria (Gobler et al., 2014). Another study found that
intermittent exposure to lowered DO (5mgL-1) over 15 days did not reduce growth rates
of juvenile abalone, Haliotis rufescens, but intermittent exposure to low DO and low pH
(pH 7.65) in combination reduced growth rates (Kim et al., 2013). However, taken
together, these studies generally suggest that the combined effects of hypoxia and
acidification may be more severe than those of the individual stressors.
Due to the competing influences of respiration and photosynthesis, hypoxic zones
experience considerable diel fluctuations of DO and pH and these conditions may
persist for weeks to months (Gobler & Baumann, 2016). Most manipulative
experiments that investigate the effects of hypoxia, however, expose biota to constant
levels of dissolved oxygen (DO) over days (e.g. Regnault & Aldrich, 1988) or weeks
(e.g. Landry et al., 2007). Thus, knowledge of how marine biota may respond to diel
fluctuations of pH and DO is limited. One study, however, investigated the effects of
semi-diurnal fluctuations in DO and pH on two species of mytilid mussels and reported
that although there was no effect of low DO, constant exposure to low pH (<7.6) over 8
70
days slowed development. Exposure to variable low pH (mean ± range: 7.51 ± 0.15),
however, induced no negative effects (Frieder et al., 2014). In contrast, exposure to
more extreme diel fluctuations (pH 7.2-7.9, DO 2.0-7.0 mgL-1) over 15 and 18 days
resulted in higher larval mortality of the juvenile bivalves Argopecten irradians and
Mercenaria mercenaria respectively, than exposure to constant levels of DO and pH
(Clark, 2015). These results suggest that the duration and magnitude of changes to DO
and pH influences the response of biota to hypoxic events and highlights the need to
incorporate relevant diel shifts into manipulative experiments.
Although marine animals may be negatively affected by elevated pCO2, non-calcifying
marine plants may benefit. CO2 and bicarbonate ions (HCO3-) increase in concentration
as waters become more acidic. These conditions may benefit marine plants because CO2
is essential for photosynthesis (Kroeker et al., 2010). Marine autotrophs can have
effective carbon concentrating mechanisms (CCMs) that actively accumulate and
concentrate inorganic carbon, either as CO2 or bicarbonate ions (HCO3-) or both (Raven
& Beardall, 2003). Despite these mechanisms, marine algae can become carbon-limited
and depend upon ambient CO2 and HCO3- in seawater (Raven & Beardall, 2003).
Studies of a diverse range of marine plants, including benthic algae (Diaz-Pulido et al.,
2007), phytoplankton (Tortell et al., 2008) and seagrass (Beer & Koch, 1996)
consistently show that elevated pCO2 enhances rates of photosynthesis and growth.
The observation that many animals are harmed by elevated pCO2 whilst plants benefit,
poses an interesting notion for how invertebrates, including reef-building corals, hosting
symbiotic dinoflagellates (e.g. Symbiodinium sp.) may respond to microbial-driven
coastal hypoxia. Specifically, the presence of symbiotic microalgae may partially
mitigate the effects of acidification because the CO2 utilised during photosynthesis may
reduce the pCO2 within the host’s tissues, thereby regulating the pH of the tissues.
71
Photosynthetic symbionts also provide O2 to their animal host during photosynthesis
and thus potentially ameliorate oxygen debt during hypoxic events (Malcolm & Brown,
1977). Indeed, Symbiodinium cells are intracellular symbionts and can exert significant
control over pH (Laurent et al., 2013, Laurent et al., 2014) and DO within host tissues
(Malcolm & Brown, 1977). However, Symbiodinium can only photosynthesise during
the day and, therefore, their ability to mitigate the effects of hypoxia during the night
may be limited.
Of the studies that empirically examined the effects of low DO and high CO2, only one
study has considered the effects on symbioses involving Symbiodinium. That study
exposed two species of anemones (Anemonia alicemartinae and Phymactis papillosa) to
constant levels of low DO (<3.1mgL-1) and a mild low pH (7.7-7.8) over 6 days and
reported that while pH increased the metabolism of both species, low pH and low DO in
combination depressed metabolism (Steckbauer et al., 2015). Although the effects of
hypoxia and acidification on symbiotic associations have been studied, no studies have
investigated the response of symbiotic and aposymbiotic (i.e. symbiont-free) individuals
of the same species, to fully evaluate the role of Symbiodinium. To more accurately
predict how marine biota may respond to hypoxic events we must discern the role(s) the
host and/ or symbionts play in coping with the dual effects of hypoxia and acidification.
The ability of symbiotic cnidarians to survive environmental stress will largely depend
on their ability to adapt or acclimate to changing ocean conditions. Cnidarian hosts can
harbour multiple clades with different physiological tolerances (Mieog et al., 2007,
Jones et al., 2008). For example, hosts that form symbioses with physiologically
tolerant clades such as Symbiodinium sp. of Clade D are more robust to thermal stress
(Berkelmans & Van Oppen, 2006). Changes in the relative abundance of different
clades is referred to as symbiont ‘shuffling’ (Jones et al., 2008). For example, the
72
dominant symbiont clade of Acropora millepora shifted from the thermally sensitive
Symbiodinium C2 to D after transplantation into a warmer environment and resulted in a
higher thermal tolerance of the association (Berkelmans & Van Oppen, 2006). Only by
understanding the conditions in which physiologically tolerant symbiont genotypes may
be selected for, is it possible to assess the potential for symbiotic cnidarians to acclimate
to changing environmental conditions.
The objective of this study was to investigate the role of Symbiodinium in mitigating the
potential interactive effects of long-term hypoxia and acidification on a non-calcifying
cnidarian. We compared the asexual reproduction and internal pH measurements of
symbiotic and aposymbiotic polyps of a model host jellyfish (Cassiopea sp.) in a full
factorial experimental design that consisted of lowered oxygen and pH. Specifically, we
hypothesised that Cassiopea sp. polyps exposed to hypoxia and acidification
individually and simultaneously would exhibit negative physiological effects but the
negative effects of hypoxia and acidification would be, at least partially, mitigated by
the presence of Symbiodinium. We also investigated the effects of hypoxia and
acidification on the photosynthetic efficiency, Chl a concentration and Symbiodinium
density of symbiotic Cassiopea sp. polyps. We hypothesised that in hospite
Symbiodinium exposed to acidification would exhibit positive effects but when exposed
to hypoxia Symbiodinium would exhibit negative effects. When exposed to the dual
stressors, however, the negative effects of hypoxia would be mitigated by the positive
effects of acidification on Symbiodinium. We also assessed the presence of
Symbiodinium clade(s) in symbiotic polyps and whether they differed between
treatments. We hypothesised that the composition of Symbiodinium communities within
polyps would differ in response to hypoxia and acidification, individually and in
combination.
73
Materials and methods
Species studied
Symbiotic and aposymbiotic polyps of the upside down jellyfish, Cassiopea sp. were
used to test the hypotheses. Cassiopea sp. inhabit shallow waters in tropical and
subtropical waters worldwide (Hofmann et al., 1996) and so are probably exposed to
considerable fluctuations in DO and pH. Cassiopea sp. larvae that had settled on a rock
in a jellyfish display tank at Underwater World, Sunshine Coast, Australia were
collected in September 2013. Symbiotic polyps were sampled from the upper surface of
the rock and aposymbiotic polyps that occurred in low light conditions were collected
from the underside. Larvae of Cassiopea spp. are aposymbiotic and metamorphose into
aposymbiotic polyps (Sachs & Wilcox, 2006). Aposymbiotic polyps can acquire
Symbiodinium from the external environment, a process termed ‘horizontal
transmission’ (Sachs & Wilcox, 2006, Thornhill et al., 2006). Aposymbiotic and
symbiotic Cassiopea sp. polyps thus serve as ideal study organisms to examine the role
of Symbiodinium (and hence host-Symbiodinium symbioses) in moderating the potential
negative effects of stressors such as hypoxia and acidification on cnidarians.
Experimental Approach
All polyps were checked for the presence or absence of symbionts, using pulse
amplitude modulated (PAM) fluorometry (as used by: Steindler et al., 2002, Lemloh et
al., 2009) and fluorescence microscopy with UV Illumination, prior to the start of the
experiment and every second day during the experiment. Polyps were acclimated to
laboratory conditions by culturing them in seawater at 25ºC for 4 weeks prior to the
commencement of the experiment. Fresh 10 µm filtered seawater was used to exchange
seawater in the polyp cultures was sourced from The Gold Coast Seaway, Queensland
(27.56ºS, 153.25ºE). The seawater was stored in darkness for at least 10 weeks prior to
acclimation to ensure that polyps were not exposed to free-living Symbiodinium during
74
the experiment. During acclimation, all polyps were exposed to 12 hours of
photosynthetic active radiation (PAR) using aquarium lights that mimicked the natural
solar spectrum in coastal ecosystems, with the wave crest located in the blue spectrum
(400-500nm). All polyps were fed newly hatched Artemia sp. nauplii every third day.
The experimental design consisted of three orthogonal factors: pH (two levels: ambient
(mean ±1SE, pH 7.97 ± 0.01) and low pH (pH 7.66± 0.01)), oxygen concentration (two
levels: ambient (6.27mgL-1 ± 0.05) and hypoxic (2.46mgL-1 ± 0.06)) and polyp type
(two levels: symbiotic and aposymbiotic). Four replicate aquaria were randomly
allocated to each combination of pH, oxygen and polyp type (i.e. N=32). Levels and
diel fluctuations of pH (~7.9- 8.15) and DO (~6.0 -6.7mgL-1) of control treatments were
based on 24h field measurements taken in October, 2014 in Moreton Bay, Australia
(27.13ºS, 153.07ºE). In hypoxic systems, the magnitude of diel fluctuations of pH and
DO can vary specific to the ecosystem being tested. We, therefore, selected moderate
levels of DO and diel variation (~1.5mgL-1- 3.0mgL-1) from a range of hypoxic
scenarios in coastal ecosystems worldwide (e.g. Park et al., 2007, Tyler et al., 2009).
Levels of DO and pH are stoichiometrically linked in marine ecosystems (Cai et al.,
2011) and pH can vary between pH 6.9- 7.9 during hypoxic events (Gobler et al., 2014,
Gobler & Baumann, 2016). We, therefore, selected moderate pH levels (~ 7.5-7.75) for
the low pH treatments from a range of pH data collected from coastal hypoxic systems
(e.g. Cai et al., 2011, Melzner et al., 2012, Gobler et al., 2014) (Fig. A4.1).
The experiment was done in a controlled temperature laboratory with the ambient
temperature set at 25ºC. Six polyps were transferred using a toothpick into small plastic
petri dishes weighted with stainless steel weights that were immersed in 1L glass
aquaria. Three petri-dishes were placed into each replicate aquarium (i.e. 18 polyps per
aquarium); one petri dish was allocated for asexual reproduction measurements and the
75
other two were used for pH microelectrode and chlorophyll fluorescence measurements.
One petri dish was allocated to each dependent variable (measured throughout the
experiment) to prevent overcrowding of polyps and for ease of cleaning excess algal
growth.
Manipulation of water chemistry
To achieve the desired water chemistry of each treatment, a series of gas mass
controllers were used to deliver defined mixtures of CO2, N2 and O2 gas to seawater
(sensu Bockmon et al., 2013). The desired gas compositions (CO2, N2, O2) were mixed
from individual gas cylinders using four sets of three Omega® mass flow controllers
(FMA-5400s, 0-20 mL/min (CO2), 0-5 L/min (N2), 0-2 L/min (O2)), which allowed for
four independent treatments. The mass flow controllers were operated and functions
monitored by a desktop PC running NI LabVIEW™ software (32-bit version) with
communication using a voltage generating Omega Expandable Modular Data
Acquisition System® (iNET-400) connected with three Omega® wiring boxes with
screw terminals (iNET-510). The desired proportions of CO2, N2 and O2 were mixed in
a stainless steel manifold and the subsequent gas line was split to provide identical gas
mixtures to the replicate aquaria. Gas flow rates to replicate aquaria were manually
adjusted using secondary stainless steel manifolds with control valves. For each
treatment, two gas compositions (day and night) were used to closely mimic diel
fluctuations in water chemistry in the field. NI LabVIEW™ was used to linearly
transition between day and night gas mixtures but gas compositions were held constant
at night and from 10am-2pm (Fig. A.4.1).
The desired gas compositions for each treatment were continuously delivered to each
aquarium using plastic air stones. Lids were placed loosely over each replicate aquarium
with a header space of ~10mm to minimise evaporation and subsequent changes in
76
water chemistry. 25% of the water in each aquarium was replaced every day using water
of the same chemistry. All aquaria were exposed to a 12 hours of light per day to
accurately mimic diel patterns during summer.
Analysis of carbonate chemistry
Levels of pCO2 were calculated based on measured levels of total alkalinity (TA), pH,
DO, temperature and salinity using the program CO2SYS (Lewis et al., 1998) (Table
4.1). Every third day, a 100mL water sample was collected for analysis of TA from one
randomly selected replicate from each of the treatments. Samples were collected in
clean glass amber bottles using a drawing tube, bottles were filled from the bottom and
water allowed to overflow for 10-15 seconds to minimise gas exchange with the
atmosphere. All samples were fixed with 20µL of mercuric chloride to prevent
biological activity and stored at 4 C until analysed. All samples were analysed within
24 hours of collection. TA samples were analysed using an automatic 848 Titrino Plus
Total Alkalinity Titrator (Metrohm©) calibrated every 3 days on the total scale using
TRIS/HCl buffers in synthetic seawater. TA measurements on 50mL samples of
certified reference material (provided by A. G. Dickson, batch #T27) were used to
verify TA values. Every third day, temperature, salinity, pH and DO were measured at
10am (Table 4.1). Temperature was recorded in each aquarium using a thermometer and
salinity was measured using a conductivity-salinity metre (TPS salinity-conductivity
metre, MC-84). The DO concentration in each aquarium was recorded using an optic
DO sensor (Mettler Toledo OptiOPx, Mettler Toledo Ltd). The pH of each aquarium
was measured using a FiveGo pH meter (Mettler Toledo Ltd) equipped with a TRIScompatible electrode (Inlab Expert Pro Electrode, Mettler Toledo Ltd). Every 2-3 days,
pH electrodes were calibrated using TRIS/HCl buffers in synthetic seawater. To
accurately measure diel patterns of O2 and CO2 during the experiment, pH and DO
measurements were taken hourly (between 6am-6pm) from one randomly selected
replicate from each of the treatments once per week.
77
Data collection
Asexual reproduction and internal pH of both symbiotic and aposymbiotic polyps were
measured to investigate the role of Symbiodinium in moderating the effects of hypoxia
and pH. We measured four response variables: photochemical efficiency (YII), Chl a
content and Symbiodinium density on symbiotic polyps to further investigate the effects
of hypoxia and acidification on symbiotic Cassiopea sp. polyps. Every third day, all
reproduction dishes were removed from aquaria and the number of individual polyps
were recorded using a dissecting microscope. Only when asexual buds had
metamorphosed into individual polyps from the planuloid stage, were they counted and
used as the dependent variable.
78
Table 4.1 Mean ± 1SE water chemistry measurements taken during the 22 day experiment. Temperature, salinity and pH measurements
were taken at 10am every 3 days and TA and pCO2 measurements were taken weekly (Weeks 1, 2, 3, and 4).
Treatment
Temp (ºC)
Salinity (ppt)
Alkalinity (µeq kg -1)
pH
Oxygen
(mg O2 L-1)
Calculated pCO2
(µatm)
Symbiotic
Control
25.1±0.02
36.3±0.09
2299.06± 9.3
8.00±0.02
6.3±0.14
421.07±27.7
Hypoxic
25.1±0.03
36.2±0.07
2276.20±19.3
8.01±0.03
2.0±0.13
405.32±25.1
Low pH
25.1±0.02
36.2±0.07
2281.67±20.9
7.62±0.01
6.3±0.13
1151.36±48.3
Hypoxic & low pH
25.0±0.05
36.1±0.08
2267.18±30.6
7.63±0.02
2.3±0.20
1173.34±32.3
Control
25.1±0.02
36.3±0.08
2336.06± 7.3
8.01±0.03
6.2±0.19
410.01±28.6
Hypoxic
25.1±0.04
36.2±0.07
2249.87±22.6
8.02±0.02
2.2±0.26
402.03±32.3
Low pH
25.2±0.03
36.4±0.08
2303.82±10.6
7.61±0.01
6.5±0.18
1189.02±43.9
Hypoxic & low pH
25.0±0.06
36.3±0.08
2260.85±32.5
7.63±0.01
2.1±0.18
1186.25±41.9
Aposymbiotic
79
Internal pH measurements
Every third day, one polyp was selected randomly from each replicate aquarium to
measure internal pH. All polyps were collected with ~30mL of their respective
treatment water and placed on a 30mm plastic petri dish under a dissecting microscope.
The pH microelectrode (pH-25 Unisense, Denmark; 20-30µm tip diameter) was
mounted on and controlled by a micromanipulator. The pH microelectrode was
introduced into the treatment water and external pH measurements were taken ~5mm
from the polyp. All microelectrode measurements were performed horizontally when
polyps were upright (i.e. perpendicular to the microelectrode), halfway between the base
of the polyp and the beginning of the oral arms, to ensure consistency of microelectrode
profiles among all polyps. The epidermis formed a seal around the entrance point of the
electrode and prevented fluid exchange between the external seawater and the polyp
tissue. Polyps varied slightly in shape and size and so to ensure consistency, pH was
recorded at four increments through one side of the polyp until the gastrovascular cavity
was reached, yielding 6 measurements per polyp (i.e. external pH, increments 1-4, and
gastrovascular cavity). Increments through the polyp were determined relative to the
thickness of the body wall. Prior to pH measurements, the pH micro-electrodes were
calibrated with pH 7 and 10 buffer solutions.
The fluorescent pH sensitive dye, 5(6)-Carboxynaphthofluorescein (sourced from
Sigma-Aldrich, CAS no: 128724-35-6), was used to validate pH microelectrode profiles
using a fluorescent microscope. Polyps were incubated at 25ºC in their aquarium water
supplemented with the fluorescent pH sensitive dye to a final concentration of 50 µmol
L-1 5(6)-Carboxynaphthofluorescein for 30 minutes to allow sufficient uptake. Polyps
were placed in 3mL vials and the pH-sensitive dye solution was allowed to overflow the
vials into water baths at a rate of ~2mL min-1 to ensure gently mixing. Following
staining, polyps were observed and photographed using a Nikon Eclipse 80i
fluorescence microscope and UV Illumination.
80
Photochemical efficiency (YII) of Symbiodinium
Prior to the commencement of the experiment, and at weekly intervals throughout the
experiment, symbiotic polyps were sampled to measure photochemical efficiency of
Symbiodinium using a ToxY-Pulse amplitude modulator (ToxY-PAM). Prior to
fluorescence measurements, one polyp from each replicate aquarium was transferred
into an individual well of a black, non-binding 96-well plate (Greiner Bio-One GmbH,
cat no. 655090). All polyps were dark-adapted for 20 minutes prior to PAM
measurements. The ToxY-PAM repeatedly measured several photosynthetic parameters
of Symbiodinium under dark conditions. Repetitive measurements of the Chl a
fluorescence parameters yielded a measure of the minimum (F0) and maximum
fluorescence yield (Fm), from which the effective quantum yield (YII) was determined
(Genty et al., 1989).
Symbiodinium density and Chl a measurements
At the end of the experiment, four polyps were sampled from each replicate aquarium
containing symbiotic polyps and stored in 1mL of 0.22µm filtered seawater. Polyps
were macerated with a tissue homogeniser for 30s and a 100µL aliquot was taken from
each sample for Symbiodinium counts. 100µL of glycerol was added to each 100µL
aliquot and samples frozen at -80ºC until analysed. Defrosted samples were mixed and
ten 0.10µL drops from each sample were counted using a Neubauer haemacytometer.
The remaining 900µL samples were used for estimates of Chl a content. All Chl a
samples were centrifuged at 3000 × ɡ at 4ºC for 10 minutes and the supernatant
discarded. The pelleted Symbiodinium were resuspended in 95% ethanol and extracted
overnight in the dark at 4ºC overnight before being centrifuged. Absorption of the
supernatant was determined at 647nm and 664nm using a UV-1800 Shimadzu©
81
spectrophotometer. All samples were analysed in 1cm quartz cuvettes and the
instrument was calibrated using 95% ethanol blanks. Chl a content was determined
using coefficients from a spectrophotometric equation (-5.2007 × A647 + 13.5275 ×A664)
for chlorophytes in ethanol (see Ritchie, 2006).
Identification of Symbiodinium
At the end of the experiment, ten polyps from each replicate aquarium containing
Symbiodinium were sampled and stored in DMSO preservation buffer (Seutin et al.,
1991). The samples were washed twice with phosphate buffered saline (PBS) and the
total DNA was extracted using the MO BIO PowerPlant Pro DNA Isolation Kit (MO
BIO Laboratories, CA, USA, cat no. 13400-50) following the manufacturers beadbeating protocol with an extra phenolic separation step. The Symbiodinium partial 5.8S,
ITS2, and partial 28S region was amplified by PCR using the forward ITS-dino
(5′GTGAATTGCAGAACTCCGTG 3′) and reverse ITS2-rev2
(5′CCTCCGCTTACTTATATGCTT 3′) primers (Stat et al., 2011). ITS2 amplicons
were purified through gel electrophoresis, sequenced by the Australian Genome
Research Facility (AGRF), and compared to Symbiodinium entries in NCBI using the
Basic Local Alignment Search Tool (BLAST), yielding a % match. Sequences retrieved
by this study were deposited in NCBI under the accession numbers KX533944 through
KX533954 (Table A4.2).
Statistical analyses
The dependent variables of internal pH and YII, were analysed using repeated measures
linear mixed models (LMMs) in SPSS (SPSS, Released 2013). The number of fixed
factors for each dependent variable differed according to how the data were collected.
The fixed factors for internal pH were: pH (pH 8.0 and pH 7.6), oxygen (6.0mgL-1 and
82
2.0mgL-1), polyp type (symbiotic and aposymbiotic), day/ night (day and night), and
distance (through polyp) (increments: 0-6), which was the repeated measure. The fixed
factors for YII were: pH (pH 8.0 and pH 7.6), oxygen (6.0mgL-1 and 2.0mgL-1), and
time (days 0-22), which was the repeated measure. The dependent variables of number
of polyps, Chl a and Symbiodinium density, were analysed using LMMs. The fixed
factors for number of polyps were: pH (pH 8.0 and pH 7.6), oxygen (6.0mgL-1 and
2.0mgL-1), and polyp type (symbiotic and aposymbiotic). The fixed factors for Chl a
and Symbiodinium density were: pH (pH 8.0 and pH 7.6) and oxygen (6.0mgL-1 and
2.0mgL-1). In all repeated measures LMMs, various models (e.g. AR(1), AR(1)
heterogeneous, CS) were investigated to assess the model of best fit by comparing
several goodness-of-fit statistics (e.g. -2 Restricted Log Likelihood, Akaike’s
Information Criteria (AIC) and Bayesian Information Criterion (BIC)). All data were
checked for normality and homoscedasticity using standardised residual plots and Q-Q
plots and if required, data were either ln or ln(x+1) transformed. If significant
differences were found, estimated marginal means were used to determine which means
differed.
83
Results
Survival and asexual reproduction
All polyps of Cassiopea sp. survived throughout the experiment and numbers of polyps
increased in all treatments. At the end of the experiment, the number of polyps differed
among pH treatments but patterns were not consistent between symbiont treatments,
resulting in a significant pH × symbiont interaction (Table 4.2, Fig. 4.1). The greatest
number of polyps were produced by symbiotic polyps under low pH conditions with
symbiotic polyps producing 58% more polyps than aposymbiotic polyps. Under
ambient conditions, aposymbiotic polyps produced 17% fewer polyps than symbiotic
polyps (Fig. 4.1). The number of polyps also differed among oxygen treatments and
22% fewer polyps occurred in hypoxic treatments (mean ± 1SE: 9.63 ± 0.53) compared
to ambient treatments (12.25 ± 0.67), regardless of pH conditions or symbiont status
(Table 4.2). Symbiotic polyps exposed to low pH and low oxygen produced a similar
number of polyps (12.25 ± 0.41) to those exposed to ambient conditions (13.25 ± 0.54).
Strobilation was not observed during the experiment.
84
Table 4.2 Summary of results for a LMMs analysis comparing the number of polyps
between treatments at day 22 of the experiment. Df= Degrees of freedom. P values in
bold are statistically significant (P < 0.05). BIC (Bayesian Information Criterion)
=85.204, and AIC (Akaike’s Information Criterion) =84.026.
Source
Numerator df
Denominator df
F
Sig.
Symbiont
1
24
106.778
<0.001
Oxygen
1
24
49.00
<0.001
pH
1
24
0.111
0.742
Symbiont × Oxygen
1
24
1.000
0.327
Symbiont × pH
1
24
25.000
<0.001
Oxygen × pH
1
24
0.111
0.742
Symbiont × Oxygen × pH
1
24
0.111
0.742
Figure 4.1 Mean ±1SE number of polyps recorded at Day 22 of the experiment. Letters
above error bars indicate similarities (e.g. AA) or differences (e.g. AB) between
treatments, as determined by estimated marginal means.
85
Internal pH profiles
The pH profile through polyp walls differed among pH treatments, but patterns were not
consistent among symbiotic and aposymbiotic polyps and differed between day and
night, resulting in a significant day/ night × symbiont × pH × distance interaction (Table
4.3, Fig. 4.2). During the night, pH profiles of the polyps mimicked their experimental
conditions; were consistent across the external to internal body wall and did not differ
between symbiotic and aposymbiotic polyps (Fig. 4.2a). During the day, in the
symbiotic polyps, pH slowly increased from Increment 1 to Increment 4 through the
polyp tissues and then decreased in the gastrovascular cavity to levels similar to that of
the solution pH (Fig. 4.2b). Under ambient conditions, the internal pH of symbiotic
polyps was greater than aposymbiotic polyps and the internal pH of symbiotic polyps
increased by 0.19 units at Increment 4 relative to aposymbiotic polyps (Fig. 4.2b). This
pattern was consistent in the low pH treatments, but the magnitude of difference
between symbiotic and aposymbiotic polyps was greater. The internal pH of symbiotic
polyps in the low pH treatment was highest at Increment 4 and increased by 0.27 units
relative to aposymbiotic polyps (Fig. 4.2b). At Increment 4, the internal pH of symbiotic
polyps matched the internal pH of aposymbiotic polyps under ambient conditions (Fig.
4.2b). There was no significant difference between the pH of the gastrovascular cavities
of symbiotic and aposymbiotic polyps, but the pH levels of the gastrovascular cavity of
polyps exposed to low pH conditions were reduced (Fig. 4.2b).
86
Table 4.3 Summary of results for a LMMs analysis comparing day and night pH
microelectrode profiles between treatments at Day 22 of the experiment. The model-ofbest-fit was AR(1), BIC (Bayesian Information Criterion) = -1045.115, AIC (Akaike’s
Information Criterion) = -1056.104. Note, only significant terms are presented in Table
4.3, refer to Table A4.1 for results of the full-factorial analysis. Df= Degrees of
freedom. P values in bold are statistically significant (P < 0.05).
Source
Numerator
df
Denominator
df
F
Sig.
Day/ Night
1
47.916
192.545
<0.001
Symbiont
1
47.916
74.747
<0.001
pH
1
47.916
2366.626
<0.001
Day/ Night × Symbiont
1
47.916
61.419
<0.001
Day/ Night × pH
1
47.916
4.812
0.033
Symbiont × pH
1
47.916
10.856
0.002
Day/ Night × Symbiont × pH
1
47.916
6.528
0.014
Distance
5
145.035
70.592
<0.001
Day/ Night × Distance
5
145.035
29.885
<0.001
Symbiont × Distance
5
145.035
53.912
<0.001
pH × Distance
5
145.035
17.608
<0.001
Day/ Night × Symbiont × Distance
5
145.035
49.310
<0.001
Day/ Night × pH × Distance
5
145.035
19.436
<0.001
Symbiont × pH × Distance
5
145.035
8.137
<0.001
Day/ Night × Symbiont × pH × Distance
5
145.035
6.370
<0.001
87
Figure 4.2 Mean (±1SE) pH profiles through polyp walls taken during the night (a) and
day (b). Letters next to data points indicate similarities (e.g. AA) or differences (e.g.
AB) between treatments, as determined by estimated marginal means.
88
Photochemical efficiency
The temporal variation of YII values among pH treatments was not consistent among
oxygen treatments, resulting in a significant oxygen × pH × time interaction (Table 4.4,
Fig. 4.3). At Day 1, there was no difference in YII values among treatments. The
magnitude of difference between treatments was small and although significant
differences were detected, no consistent patterns were observed (Fig. 4.3).
Figure 4.3 Mean (±1SE) effective quantum yield during the 22 day experiment. Letters
next to data points indicate similarities (e.g. AA) or differences (e.g. AB) between
treatments, as determined by estimated marginal means.
89
Symbiodinium identification, Chl a content and cell density
Symbiodinium ITS2 sequences from all replicate aquaria, except for one replicate
sample in the control treatment that could not be sequenced, were confirmed to match
Symbiodinium ITS2 subtype C1 (NCBI Genbank accession KX533944- KX533954 for
ITS2 sequences generated in this study) (Table A4.2).
At the end of the experiment, the Chl a content of individual polyps varied among pH
treatments, but patterns were not consistent among oxygen treatments and resulted in a
significant pH × oxygen interaction (Fig. 4.4a, Table 4.5). Chl a content was highest in
polyps in the low pH, hypoxic treatment (32% higher than the ambient treatment).
Under low pH conditions polyp Chl a contents were similar in the ambient DO and
hypoxic treatments. (Fig. 4.4a). Under ambient pH conditions, however, polyps in the
hypoxic treatment had the lowest Chl a content of all the treatments and contained 48%
less Chl a than those in the ambient DO treatment (Fig. 4.4a).
The density of Symbiodinium cells within individual polyps varied between pH
treatments, but patterns were inconsistent across oxygen treatments, resulting in a
significant pH × oxygen interaction (Fig. 4.4b, Table 4.5). The Symbiodinium density in
polyps in the low pH ambient DO treatment was 39% higher than those under ambient
conditions and was higher than that of all other treatments (Fig. 4.4b).
Symbiodinium specific Chl a content per cell differed among pH treatments, but
inconsistent responses across oxygen treatments resulted in a significant pH × oxygen
interaction (Fig. 4.4c, Table 4.5). Symbiodinium Chl a per cell was highest in the low
pH and hypoxic treatment and exceeded that of all other treatments. Within the ambient
pH level, exposure to hypoxic conditions resulted in a 55% lower Chl a per cell
90
concentration relative to the control treatment (Fig. 4.4c). This pattern was reversed,
however, in the low pH treatments where the Chl a per cell was 53% higher under
hypoxic and low pH, than under low pH conditions (Fig. 4.4c).
91
Table 4.4 Summary of results for a LMMs analysis comparing YII values between
treatments during the 22 day experiment (Days 0, 1, 4, 7, 10, 13, 16, 19, 22). The
model-of-best-fit was CS, BIC (Bayesian Information Criterion) = -501.960, AIC
(Akaike’s Information Criterion) = -507.325. Df= Degrees of freedom. P values in bold
are statistically significant (P < 0.05).
Source
Numerator df
Denominator df
F
Sig.
Oxygen
1
45.197
1.251
0.269
pH
1
45.197
1.929
0.172
Time
8
60.422
1.311
0.255
Oxygen × pH
1
45.197
2.780
0.102
Oxygen × Time
8
60.422
3.655
0.002
pH × Time
8
60.422
0.911
0.514
Oxygen × pH × Time
8
60.422
2.392
0.026
Table 4.5 Summary of results for three LMMs comparing Chl a (µg polyp-1),
Symbiodinium density (cell polyp-1) and Chl a cell-1 (pg) between treatments of
symbiotic polyps at Day 22 of the experiment. Df = degrees of freedom. BIC= Bayesian
Information Criterion and AIC = Akaike’s Information Criterion. P values in bold are
statistically significant (P < 0.05).
Variable
Chl a polyp-1
Symbiodinium polyp-1
Chl a cell-1
Transformation
None
Ln
None
Information Criterion
BIC= -22.192
BIC= 10.359
BIC= 61.675
AIC= -22.676
AIC= 9.874
AIC= 61.190
Source of variation
Df
P
P
P
pH
1
<0.001
0.131
0.050
Oxygen
1
pH × Oxygen
1
F=23.008
F=2.633
F=4.727
0.418
0.124
0.499
F=0.705
F=2.730
F=0.485
0.007
0.047
0.002
F=10.516
F=5.095
F=16.385
92
Figure 4.4 Mean (±1SE) Chl a polyp-1 (a) Symbiodinium cells polyp-1 (b) Chl a cell-1 (c)
at Day 22 of the experiment. Letters above error bars indicate similarities (e.g. AA) or
differences (e.g. AB) between treatments, as determined by estimated marginal means.
93
Discussion
The pattern of asexual reproduction supported the hypothesis that the presence of
Symbiodinium would mitigate the effects of acidification on Cassiopea sp. polyps, but
not the hypothesis that the symbionts would mitigate the effects of hypoxia.
Interestingly, however, symbiotic polyps exposed simultaneously to both hypoxia and
acidification produced a similar number of polyps to those grown under ambient
conditions, suggesting that the presence of Symbiodinium mitigated the effects of the
dual stressors. This pattern appeared to occur because the benefits conferred by elevated
CO2 offset the negative effects of hypoxia. Indeed, if we had only investigated the effect
of low DO we would have concluded that hypoxia reduced the asexual reproduction of
both symbiotic and aposymbiotic polyps. Our observations suggest, however, that
symbiotic cnidarians that have similar physiological tolerances to Cassiopea sp. may
still thrive when hypoxia and acidification co-occur those that are non-symbiotic may
decline in response to the dual stressors. These results highlight the importance of
investigating the effects of co-occurring stressors and how symbiotic and non-symbiotic
biota may respond differently to environmental stressors.
The survival of marine organisms in hypoxic systems may partly depend on their ability
to regulate their internal pH under lowered pH conditions that result from elevated
dissolved inorganic carbon (DIC) concentrations. During the day, under low pH
conditions, the internal pH of symbiotic polyps matched the pH levels of aposymbiotic
polyps exposed to ambient conditions, and suggests that photosynthesis of
Symbiodinium may play an important role in regulating the internal pH of symbiotic
cnidarians during hypoxic events. Aposymbiotic polyps, however, conformed to the pH
of their respective treatments, and this suggests that Cassiopea sp. polyps, as hosts, may
be limited in their ability to regulate their internal pH under low pH conditions. Only
one study has compared the internal pH of isolated symbiotic and non-symbiotic coral
cells under elevated CO2 conditions. That study reported that short term exposure to
94
decreasing pH (from pH 7.8 to 6.8) (over ~2hrs) caused the internal pH of nonsymbiotic coral cells to decrease by 0.3-0.4 pH units but the internal pH of symbiotic
coral cells recovered to control levels (Gibbin et al., 2014). These results demonstrate
that Symbiodinium may exert significant control over the internal pH of host tissues and
suggest that symbiotic biota may be more robust to hypoxic environments than nonsymbiotic biota.
The survival of symbiotic organisms ultimately depends on the physiological limitations
of both the host and their symbionts. Photochemical efficiency of Symbiodinium
appeared to be unaffected by the various treatments tested. Despite lower YII values
than those reported in Chapter 3 and 2, our observations of Chla and Symbiodinium
densities suggest that Symbiodinium proliferated under experimental conditions.
Densities of Symbiodinium were highest in the low pH treatment, and, similar to the
result for asexual reproduction, suggests that low pH conditions (caused by elevated
DIC) may be favourable for Symbiodinium. The observation that Symbiodinium
densities increased under high CO2 conditions relative to ambient conditions, suggests
that Symbiodinium of Cassiopea sp. polyps may be limited by the availability of
inorganic carbon under these conditions. Exposure to low pH and low DO
simultaneously did not increase densities of Symbiodinium, however, Chl a content and
Chl a per cell increased in response to the dual stressors. Although studies that examine
the response of Symbiodinium to the combined effects of hypoxia and acidification are
limited, observations of other cnidarians exposed to high CO2 conditions demonstrate
inconsistent responses of Symbiodinium density and Chl a content (e.g. Reynaud et al.,
2003, Crawley et al., 2010, Towanda & Thuesen, 2012, Gabay et al., 2013). For
example, high CO2 conditions increased chlorophyll content in the calcifying coral
Acropora formosa but did not increase the density of Symbiodinium (Crawley et al.,
2010). However, similar to the results of the current study, acidification increased
symbiont densities in the scleractinian coral Stylophora pistillata but did not increase
95
chlorophyll per cell (Reynaud et al., 2003). Differences in results may be due to
species-specific responses and highlight the complex responses of cnidarian
associations to changing environmental conditions.
Our understanding of the responses of marine biota to hypoxic conditions is hindered
because the majority of hypoxia studies manipulate O2 levels with N2 gas (Gobler &
Baumann, 2016), thereby increasing (up to pH 8.6, see Gobler et al., 2014) and not
decreasing pH. In the current study, the fitness of symbiotic polyps appeared to be
enhanced by acidification under hypoxic conditions, suggesting that studies that do not
account for concurrent changes in O2 and CO2 may produce results that do not
accurately reflect the response of symbiotic biota to hypoxic environments.
Aposymbiotic polyps, however, were negatively affected by hypoxia regardless of the
pH conditions they were exposed to, suggesting that acidification did not exacerbate the
effects of low oxygen availability. Our observations of aposymbiotic polyps are
inconsistent with the only other study to examine the interactive effects of low DO and
pH on non-symbiotic, non-calcifying cnidarians (two species of anemones (Anemonia
alicemartinae and Phymactis papillosa) (Steckbauer et al., 2015). Although both
anemones are naturally non-symbiotic (unlike Cassiopea sp.), the study demonstrated
that exposure to acidification alone increased the metabolism of A. alicemartinae and P.
papillosa but exposure to acidification and hypoxia in combination depressed
metabolism of both species. However, we cannot determine whether our results are
consistent with other studies that mimic hypoxia using N2 gas because we did not
expose aposymbiotic polyps to low DO and high pH in combination; for this, studies
will need to further compare the response of biota to low DO and high pH in
combination to those exposed to hypoxia in isolation to assess the reliability of results
obtained by studies of hypoxia that manipulate O2 levels with N2 gas.
96
Cnidarians that host Symbiodinium can demonstrate flexibility in the composition of
their Symbiodinium communities (Baker, 2003, Thornhill et al., 2006, Putnam et al.,
2012). The ‘holobiont’ may contain genetically distinct symbionts with physiologies
that withstand environmental stress and thus can potentially confer a fitness benefit to
the host (Little et al., 2004, Berkelmans & Van Oppen, 2006). In this study we detected
Symbiodinium subtype C1, which is described as a generalist symbiont (LaJeunesse,
2005) and has been observed in symbiosis with >100 genetically distinct host species,
including Cassiopea (LaJeunesse, 2002, Tonk et al., 2013). Although we did not detect
any Symbiodinium types or subtypes other than C1, cryptic, non-dominant
Symbiodinium may be present at levels below the detection thresholds of techniques
used in the current study. During environmental change or significant stress, a
background population of Symbiodinium spp. at low levels in Cassiopea sp. polyps
could ‘shuffle’ (sensu Baker, 2003) and reorganise in relative abundance according to
differences in competitive abilities or survivorship under ‘new’ conditions. Although
symbiont shuffling could occur over short time-frames (Lewis & Coffroth, 2004) it is
likely that substantial symbiont rearrangement, in the absence of bleaching conditions
(i.e. thermal stress), requires a longer time frame than the one tested here. If, however,
Cassiopea sp. polyps harbour only one Symbiodinium type, they may rely on the uptake
of new symbiont types from the environment to change their symbiont population
(termed symbiont ‘switching’, sensu Baker, 2003). Experimental conditions in the
current study did not introduce exogenous Symbiodinium cells and therefore polyps of
Cassiopea sp. could not have acquired new symbiont types during the experiment
unless symbionts were shared horizontally between individual polyps (see Sachs &
Wilcox, 2006). To more accurately predict how symbiotic cnidarians, as a group, may
respond to hypoxia and acidification we must also consider other possible mechanisms
in which hosts may acquire more resistant symbionts, including types that are known to
be physiologically adapted to extreme environmental conditions (Brading et al., 2011).
97
Various combinations of host and symbiont type may provide physiological
advantages under changing ocean conditions. Our observations suggest that Cassiopea
sp. harbouring Symbiodinium subclade C1 responded positively to acidification and
were unaffected by hypoxia and acidification in combination. Although studies of the
effects of hypoxia and acidification on inhospite Symbiodinium are limited, our results
are consistent with other studies that investigated the effects of acidification on other
Symbiodinium types. Indeed, high CO2 conditions stimulated the productivity of two
anemones, Anthopleura elegantissima and Anemonia viridis, harbouring Symbiodinium
clade B and A19, respectively (Suggett et al., 2012, Towanda & Thuesen, 2012). To
better determine how biota may respond to hypoxia and acidification, we must now
determine whether our results for Symbiodinium C1 and Cassiopea sp. polyps are
consistent with other symbiont types and hosts, and investigate possible interactions
between other environmental stressors. Indeed, Cassiopea spp. harbour other clades of
Symbiodinium including A, B and D (Santos et al., 2002, Thornhill et al., 2006, Mellas
et al., 2014), and whether our observations here scale to other Cassiopea species, life
history stages, and/or symbiont types remains to be tested.
Early life history stages of many marine invertebrates require an exogenous stimulant to
metamorphose into later life history stages (e.g. Fleck & Fitt, 1999, Tran & Hadfield,
2013, Tebben et al., 2015). Indeed, marine bacteria on degraded mangrove leaves of
Rhizophora mangle provide a natural cue for metamorphosis of Cassiopea xamachana
larvae (Fleck & Fitt, 1999). The lack of strobilation of Cassiopea sp. polyps observed
in the current study could, therefore, be attributed to lack of natural environmental cues
under laboratory conditions. We, therefore, advocate that for experiments to accurately
assess the potential effects of hypoxia and acidification on Cassiopea sp. populations,
and perhaps also other cnidarians, experiments need to consider the potential role of
natural metamorphosis cues and thus, the role of metamorphosis in restocking adult
populations.
98
Our observations of Cassiopea sp. polyps suggest that Symbiodinium may play an
important role in mitigating the combined effects of hypoxia and acidification on
cnidarians. These results suggest that symbiotic cnidarians may still thrive under
hypoxic and low pH conditions but non-symbiotic cnidarians may decline when
exposed to the dual stressors. To more accurately predict how cnidarians, as a group,
will respond to hypoxia and acidification we must now determine whether our results
are consistent with other hosts and symbiont types and assess the response of calcifying
cnidarians. Predicting how marine biota, more generally, are likely to respond to
hypoxic systems requires investigation into possible interactions between other cooccurring stressors specific to the ecosystem being tested. Our results highlight the
importance of exposing biota to environmentally relevant levels as a means of assessing
the response of biota to changing ocean conditions.
99
REFERENCE LIST
Altieri AH, Gedan KB (2015) Climate change and dead zones. Global Change Biology,
21, 1395-1406.
Baker AC (2003) Flexibility and specificity in coral-algal symbiosis: diversity, ecology,
and biogeography of Symbiodinium. Annual Review of Ecology, Evolution, and
Systematics, 661-689.
Baker S, Mann R (1994) Description of metamorphic phases in the oyster Crassostrea
virginica and effects of hypoxia on metamorphosis. Marine Ecology Progress
Series, 104, 91-91.
Beer S, Koch E (1996) Photosynthesis of marine macroalgae and seagrasses in globally
changing CO2 environments. Marine Ecology-Progress Series, 141, 199-204.
Berkelmans R, Van Oppen MJ (2006) The role of zooxanthellae in the thermal tolerance
of corals: a ‘nugget of hope’for coral reefs in an era of climate change.
Proceedings of the Royal Society of London B: Biological Sciences, 273, 23052312.
Bockmon E, Frieder C, Navarro M, White-Kershek L, Dickson A (2013) Technical
Note: Controlled experimental aquarium system for multi-stressor investigation
of carbonate chemistry, oxygen saturation, and temperature. Biogeosciences, 10,
5967-5975.
Brading P, Warner ME, Davey P, Smith DJ, Achterberg EP, Suggett DJ (2011)
Differential effects of ocean acidification on growth and photosynthesis among
phylotypes of Symbiodinium (Dinophyceae). Limnology and Oceanography, 56,
927-938.
Cai W-J, Hu X, Huang W-J et al. (2011) Acidification of subsurface coastal waters
enhanced by eutrophication. Nature Geoscience, 4, 766-770.
Chu JW, Tunnicliffe V (2015) Oxygen limitations on marine animal distributions and
the collapse of epibenthic community structure during shoaling hypoxia. Global
Change Biology, 21, 2989-3004.
Clark HR (2015) Response of early life stage bivalves to diurnal changes in carbon
dioxide and dissolved oxygen concentrations, State University of New York at
Stony Brook.
100
Crain CM, Kroeker K, Halpern BS (2008) Interactive and cumulative effects of multiple
human stressors in marine systems. Ecology Letters, 11, 1304-1315.
Crawley A, Kline DI, Dunn S, Anthony KEN, Dove S (2010) The effect of ocean
acidification on symbiont photorespiration and productivity in Acropora
formosa. Global Change Biology, 16, 851-863.
DePasquale E, Baumann H, Gobler CJ (2015) Vulnerability of early life stage
Northwest Atlantic forage fish to ocean acidification and low oxygen. Marine
Ecology Progress Series, 523, 145.
Diaz-Pulido G, McCook LJ, Larkum AW et al. (2007) Vulnerability of macroalgae of
the Great Barrier Reef to climate change.
Diaz RJ, Rosenberg R (2008) Spreading dead zones and consequences for marine
ecosystems. Science, 321, 926-929.
Eerkes-Medrano D, Menge BA, Sislak C, Langdon CJ (2013) Contrasting effects of
hypoxic conditions on survivorship of planktonic larvae of rocky intertidal
invertebrates. Marine Ecology Progress Series, 478, 139-151.
Frieder CA, Gonzalez JP, Bockmon EE, Navarro MO, Levin LA (2014) Can variable
pH and low oxygen moderate ocean acidification outcomes for mussel larvae?
Global Change Biology, 20, 754-764.
Gabay Y, Benayahu Y, Fine M (2013) Does elevated pCO2 affect reef octocorals?
Ecology and evolution, 3, 465-473.
Genty B, Briantais J-M, Baker NR (1989) The relationship between the quantum yield
of photosynthetic electron transport and quenching of chlorophyll fluorescence.
Biochimica et Biophysica Acta (BBA)-General Subjects, 990, 87-92.
Gibbin EM, Putnam HM, Davy SK, Gates RD (2014) Intracellular pH and its response
to CO2-driven seawater acidification in symbiotic versus non-symbiotic coral
cells. Journal of Experimental Biology, 217, 1963-1969.
Gobler CJ, Baumann H (2016) Hypoxia and acidification in ocean ecosystems: coupled
dynamics and effects on marine life. Biology Letters, 12, 20150976.
Gobler CJ, DePasquale EL, Griffith AW, Baumann H (2014) Hypoxia and acidification
have additive and synergistic negative effects on the growth, survival, and
metamorphosis of early life stage bivalves.
Gracey AY, Troll JV, Somero GN (2001) Hypoxia-induced gene expression profiling in
the euryoxic fish Gillichthys mirabilis. Proceedings of the National Academy of
Sciences, 98, 1993-1998.
101
Hofmann DK, Fitt W, Fleck J (1996) Checkpoints in the life-cycle of Cassiopea spp.:
control of metagenesis and metamorphosis in a tropical jellyfish. International
Journal of Developmental Biology, 40, 331-338.
Jakubowska M, Normant M (2015) Metabolic rate and activity of blue mussel Mytilus
edulis trossulus under short-term exposure to carbon dioxide-induced water
acidification and oxygen deficiency. Marine and Freshwater Behaviour and
Physiology, 48, 25-39.
Jansson A, Norkko J, Dupont S, Norkko A (2015) Growth and survival in a changing
environment: Combined effects of moderate hypoxia and low pH on juvenile
bivalve Macoma balthica. Journal of Sea Research, 102, 41-47.
Jones AM, Berkelmans R, Van Oppen MJ, Mieog JC, Sinclair W (2008) A community
change in the algal endosymbionts of a scleractinian coral following a natural
bleaching event: field evidence of acclimatization. Proceedings of the Royal
Society of London B: Biological Sciences, 275, 1359-1365.
Kim T, Barry J, Micheli F (2013) The effects of intermittent exposure to low-pH and
low-oxygen conditions on survival and growth of juvenile red abalone.
Biogeosciences, 10, 7255-7262.
Kroeker KJ, Kordas RL, Crim RM, Singh GG (2010) Meta-analysis reveals negative yet
variable effects of ocean acidification on marine organisms. Ecology Letters, 13,
1419-1434.
LaJeunesse T (2002) Diversity and community structure of symbiotic dinoflagellates
from Caribbean coral reefs. Marine Biology, 141, 387-400.
LaJeunesse TC (2005) “Species” radiations of symbiotic dinoflagellates in the Atlantic
and Indo-Pacific since the Miocene-Pliocene transition. Molecular Biology and
Evolution, 22, 570-581.
Landry CA, Steele SL, Manning S, Cheek AO (2007) Long term hypoxia suppresses
reproductive capacity in the estuarine fish, Fundulus grandis. Comparative
Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 148,
317-323.
Laurent J, Tambutté S, Tambutté É, Allemand D, Venn A (2013) The influence of
photosynthesis on host intracellular pH in scleractinian corals. Journal of
Experimental Biology, 216, 1398-1404.
102
Laurent J, Venn A, Tambutté É, Ganot P, Allemand D, Tambutté S (2014) Regulation
of intracellular pH in cnidarians: response to acidosis in Anemonia viridis. Febs
Journal, 281, 683-695.
Lemloh M-L, Fromont J, Brümmer F, Usher KM (2009) Diversity and abundance of
photosynthetic sponges in temperate Western Australia. BMC Ecology, 9, 1.
Lewis CL, Coffroth MA (2004) The acquisition of exogenous algal symbionts by an
octocoral after bleaching. Science, 304, 1490-1492.
Lewis E, Wallace D, Allison LJ (1998) Program developed for CO2 system
calculations, Carbon Dioxide Information Analysis Center, managed by
Lockheed Martin Energy Research Corporation for the US Department of
Energy Tennessee.
Little AF, Van Oppen MJ, Willis BL (2004) Flexibility in algal endosymbioses shapes
growth in reef corals. Science, 304, 1492-1494.
Malcolm JM, Brown WI (1977) Zooxanthellae‐produced O2 promotes sea anemone
expansion and eliminates oxygen debt under environmental hypoxia. Journal of
Experimental Zoology, 201, 149-155.
Mellas RE, Mcilroy SE, Fitt WK, Coffroth MA (2014) Variation in symbiont uptake in
the early ontogeny of the upside-down jellyfish, Cassiopea spp. Journal of
Experimental Marine Biology and Ecology, 459, 38-44.
Melzner F, Thomsen J, Koeve W et al. (2012) Future ocean acidification will be
amplified by hypoxia in coastal habitats. Marine Biology, 1-14.
Mieog JC, Van Oppen MJ, Cantin NE, Stam WT, Olsen JL (2007) Real-time PCR
reveals a high incidence of Symbiodinium clade D at low levels in four
scleractinian corals across the Great Barrier Reef: implications for symbiont
shuffling. Coral Reefs, 26, 449-457.
Park K, Kim C-K, Schroeder WW (2007) Temporal variability in summertime bottom
hypoxia in shallow areas of Mobile Bay, Alabama. Estuaries and Coasts, 30,
54-65.
Putnam HM, Stat M, Pochon X, Gates RD (2012) Endosymbiotic flexibility associates
with environmental sensitivity in scleractinian corals. Proceedings of the Royal
Society of London B: Biological Sciences, rspb20121454.
Raven JA, Beardall J (2003) Carbon acquisition mechanisms of algae: carbon dioxide
diffusion and carbon dioxide concentrating mechanisms. In: Photosynthesis in
algae. pp 225-244. Springer.
103
Regnault M, Aldrich JC (1988) Short‐term effect of hypoxia on ammonia excretion and
respiration rates in the crab Carcinus maenas. Marine & Freshwater Behaviour
& Phy, 13, 257-271.
Reynaud S, Leclercq N, Romaine-Lioud S, Ferrier-Pagés C, Jaubert J, Gattuso J-P
(2003) Interacting effects of CO2 partial pressure and temperature on
photosynthesis and calcification in a scleractinian coral. Global Change Biology,
9, 1660-1668.
Ritchie RJ (2006) Consistent sets of spectrophotometric chlorophyll equations for
acetone, methanol and ethanol solvents. Photosynthesis Research, 89, 27-41.
Sachs JL, Wilcox TP (2006) A shift to parasitism in the jellyfish symbiont
Symbiodinium microadriaticum. Proceedings of the Royal Society of London B:
Biological Sciences, 273, 425-429.
Santos SR, Taylor DJ, Kinzie Iii RA, Hidaka M, Sakai K, Coffroth MA (2002)
Molecular phylogeny of symbiotic dinoflagellates inferred from partial
chloroplast large subunit (23S)-rDNA sequences. Molecular phylogenetics and
evolution, 23, 97-111.
Seutin G, White BN, Boag PT (1991) Preservation of avian blood and tissue samples
for DNA analyses. Canadian Journal of Zoology, 69, 82-90.
SPSS (Released 2013) IBM SPSS Statistics for Windows. Version 22.0, Armonk, NY:
IBM Corp.
Stat M, Bird CE, Pochon X et al. (2011) Variation in Symbiodinium ITS2 sequence
assemblages among coral colonies. PLOS one, 6, e15854.
Steckbauer A, Ramajo L, Hendriks IE, Fernandez M, Lagos NA, Prado L, Duarte CM
(2015) Synergistic effects of hypoxia and increasing CO2 on benthic
invertebrates of the central Chilean coast. Frontiers in Marine Science.
Steindler L, Beer S, Ilan M (2002) Photosymbiosis in intertidal and subtidal tropical
sponges. SYMBIOSIS-REHOVOT, 33, 263-274.
Suggett DJ, Hall‐Spencer JM, Rodolfo‐Metalpa R et al. (2012) Sea anemones may
thrive in a high CO2 world. Global Change Biology, 18, 3015-3025.
Thornhill DJ, Daniel MW, LaJeunesse TC, Schmidt GW, Fitt WK (2006) Natural
infections of aposymbiotic Cassiopea xamachana scyphistomae from
environmental pools of Symbiodinium. Journal of Experimental Marine Biology
and Ecology, 338, 50-56.
104
Tonk L, Bongaerts P, Sampayo EM, Hoegh-Guldberg O (2013) SymbioGBR: a webbased database of Symbiodinium associated with cnidarian hosts on the Great
Barrier Reef. BMC ecology, 13, 1.
Tortell PD, Payne CD, Li Y et al. (2008) CO2 sensitivity of Southern Ocean
phytoplankton. Geophysical Research Letters, 35.
Towanda T, Thuesen EV (2012) Prolonged exposure to elevated CO2 promotes growth
of the algal symbiont Symbiodinium muscatinei in the intertidal sea anemone
Anthopleura elegantissima. Biology open, 1, 615-621.
Tyler RM, Brady DC, Targett TE (2009) Temporal and spatial dynamics of diel-cycling
hypoxia in estuarine tributaries. Estuaries and Coasts, 32, 123-145.
Vaquer-Sunyer R, Duarte CM (2008) Thresholds of hypoxia for marine biodiversity.
Proceedings of the National Academy of Sciences, 105, 15452-15457.
Wang W, Widdows J (1991) Physiological responses of mussel larvae Mytilus edulis to
environmental hypoxia and anoxia. Marine Ecology Progress Series, 70, 223236.
105
CHAPTER 5
Pre-exposure to individual, but not simultaneous, climate change
stressors allow Irukandji jellyfish polyps to cope under future conditions
This chapter includes an unpublished paper. My contribution involved: designing the
study, conducting the experiments, data analysis, interpretation of results and writing
the manuscript. The bibliographical details of the co-authored paper, including all
authors are:
Klein SG, Pitt KA, Carroll AR (submitted) Pre-exposure to individual, but not
simultaneous, climate change stressors allow Irukandji jellyfish polyps to cope under
future conditions.
(Signed) _____________________
Corresponding (1st) author: Shannon Klein
(Countersigned) _____________________
Supervisor (and co-author): Kylie Pitt
106
Abstract
Ocean warming and acidification are occurring concurrently on a global scale. With
growing awareness of the potential devastating effects of warming and acidification on
marine species, researchers have investigated the immediate effects of end-of-century
scenarios on marine species. An emerging area of research, however, suggests that biota
may become more robust to climate change stressors over time. Here we pre-exposed
polyps of an Irukandji jellyfish to elevated temperature (28ºC) and low pH (7.6),
separately and in combination. We then subsequently exposed polyps to either current
(pH 8.0, 25ºC) or future conditions (pH 7.6, 28ºC) during a secondary exposure to
assess potential phenotypic plastic responses that may allow Irukandji polyps to persist
under changing ocean conditions. Daughter polyps were separated from original parent
polyps after 10 days of pre-exposure to assess whether asexual offspring could benefit
from parental pre-exposure to acidification and warming. We measured rates of asexual
reproduction, respiration, prey capture and total protein concentrations of polyps.
Polyps exposed to future conditions had higher rates of respiration regardless of the
conditions they were pre-exposed to, suggesting that metabolic rates will probably be
higher under future conditions. Pre-exposure to elevated temperature and low pH
individually appeared to mitigate the negative effects of future conditions on asexual
reproduction, protein concentrations and prey capture rates of polyps. Pre-exposure to
low pH and elevated temperature in combination, however, resulted in reduced rates of
asexual reproduction, prey-capture and protein concentrations under future conditions
relative to polyps in the control treatment. Observations that parent and daughter polyps
responded similarly to the various treatments tested suggest that short-term preexposure of parent polyps to elevated temperature and low pH did not confer any
benefit to daughter polyps under future conditions. These observations demonstrate that
acclimation can occur over short time-scales and be important in the persistence of
marine species under future warming and acidification conditions.
107
Introduction
Global climate change has had profound impacts on marine ecosystems and is predicted
to adversely affect animal physiology (Doney et al., 2012), change geographic
distributions of marine species (Hoegh-Guldberg & Bruno, 2010) and affect ecosystem
functioning (Best et al., 2015, Albright et al., 2016). With growing awareness of the
vulnerability of marine biota to climate change, many manipulative experiments have
exposed biota to end-of-century predictions for warming and ocean acidification as a
means of assessing their responses to climate change (Munday et al., 2013, Munday,
2014). These studies have documented negative effects on behaviour (Nagelkerken &
Munday, 2015, Nagelkerken et al., 2016), physiology (Portner, 2008), growth and
reproduction of marine species (Harvey et al., 2013). There is an emerging evidence,
however, that biota may become more robust to changing ocean conditions over time
(Munday et al., 2013, van Oppen et al., 2015).
Marine biota may become more robust to changing ocean conditions through genetic
adaptation and non-genetic processes such as acclimation (or acclimatization) (Munday,
2014). Genetic adaptation is defined as a change in the average phenotype from one
generation to another through natural selection (see Munday, 2014, van Oppen et al.,
2015) and is hypothesised to facilitate the persistence of marine species in the face of
climate change (Bell, 2013, Logan et al., 2014). Genetic adaptation, however, typically
occurs over many generations and thus is difficult to test in most metazoans. More rapid
mechanisms such as non-genetic acclimation (see Munday, 2014), however, can occur
over shorter timescales such as weeks (e.g. Bellantuono et al., 2011) and months (e.g.
Form & Riebesell, 2012) and is also considered to be a major determinant of the
persistence of marine species (Somero, 2005). Acclimation refers to the phenotypic
plastic responses in morphology, physiology or behaviour that occur under new
environmental conditions that help maintain fitness of biota (Angilletta, 2009). An
emerging area of research demonstrates that pre-exposure (or preconditioning) to
108
environmental stress may induce phenotypic plastic responses that occur within a single
generation (intra-generational acclimation) (e.g. Brown et al., 2002, Middlebrook et al.,
2008) that help biota maintain fitness when exposed to the same environmental
conditions. These phenotypic plastic responses can be passed across generations.
Indeed, biota exposed to environmental stress may produce offspring that are more
robust to the same environmental stress (termed: trans-generational acclimation) (e.g.
Donelson et al., 2012, Miller et al., 2012). Studies that consider the ability of marine
species to acclimate or adapt to climate change will provide the most realistic
understanding of how biota are likely to respond to future conditions.
Most studies that have examined the ability of marine species to acclimate to future
ocean conditions pre-expose (or precondition) biota to individual climate change
stressors (e.g. Bellantuono et al., 2011, Miller et al., 2012, Towle et al., 2016). Those
that have examined the potential for intra-generational acclimation to warming
demonstrate that pre-exposure to elevated temperature can induce phenotypic plastic
responses and benefit marine organisms when they are subsequently exposed to warmer
conditions (e.g. Middlebrook et al., 2008, Bellantuono et al., 2011). For example,
Acropora aspera preconditioned to elevated temperature (over 48 h) had higher
concentrations of photoprotective compounds and greater photosynthetic efficiency than
corals that were not preconditioned during a 6-day simulated thermal bleaching event
(Middlebrook et al., 2008). Although studies of intra-generational acclimation to
acidification are limited, organisms exposed to elevated pCO2 can produce offspring
that are more robust to future acidification conditions (e.g. Miller et al., 2012, Murray et
al., 2014). For example, the negative effects of acidification on juvenile anemone fish
(Amphiprion melanopus) were absent in those whose parents that had been previously
exposed to elevated CO2 conditions (Miller et al., 2012). One unique study investigated
the role of intra-generational acclimation to elevated pCO2 in mitigating the negative
effects of warming and acidification in combination (Towle et al., 2016). Corals of
109
Porites porites pre-exposed to high CO2 conditions (26ºC, 900ppm CO2) exhibited 44%
lower calcification rates when exposed to future conditions (31ºC, 900ppm CO2)
relative to those in the control treatment (26ºC, 390ppm CO2). Corals pre-exposed to
high CO2 conditions, however, exhibited no negative effects on calcification when
exposed to acidification in isolation (26ºC, 900ppm CO2) (Towle et al., 2016). These
observations demonstrate that pre-exposure to individual climate change stressors may
induce phenotypic plastic responses that help biota cope when exposed to the same
conditions.
Despite the co-occurrence of warming and acidification in marine systems only one
study has examined the potential role of pre-exposure to warming and acidification in
combination in mitigating the negative effects of future conditions (Putnam & Gates,
2015). That study, which examined trans-generational acclimation, pre-conditioned
adult corals of Pocillopora damicornis to ambient (26.5 ºC, 417 µatm pCO2) and future
conditions (28.9 ºC, 805µatm pCO2). Larvae of adults pre-conditioned to ambient and
future conditions were then subsequently exposed to either ambient or future conditions
in a secondary exposure. Larvae from adult corals pre-conditioned to future conditions
shrank when they were subsequently exposed to future conditions, relative to those that
were subsequently transferred in to ambient conditions. The respiration rates of larvae
from adults pre-conditioned to ambient conditions did not differ between ambient and
future conditions. Conversely, respiration rates of larvae from adults pre-conditioned to
future conditions were higher when exposed to future conditions than those in ambient
conditions, suggesting that pre-conditioning of adults to future conditions resulted in
greater metabolic acclimation of larvae (Putnam & Gates, 2015). Putnam & Gates
(2015) pre-exposed P. damicornis to warming and acidification in combination to
simulate the most likely future scenario of simultaneous stressors. Although these
results suggest that pre-exposure to warming and acidification in combination may
allow biota to acclimate to future conditions, it still remains unclear whether warming,
110
acidification or the stressors in combination induce physiological changes that may help
biota to acclimate to future conditions.
Trans-generational acclimation may play an important role in the survival of biota under
changing ocean conditions, however, rapid intra-generational acclimation (i.e. within a
sexual generation) may be particularly important for marine organisms that rely mostly
on asexual reproduction and have long-generation times (Sunday et al., 2014, van
Oppen et al., 2015). Phenotypic plastic changes that occur in response to changing
environmental conditions can occur rapidly within a single generation (e.g. Bay &
Palumbi, 2015) and may be passed to asexually reproduced clones (van Oppen et al.,
2015). Although data are limited in marine species, stress-induced changes and their
heritability between asexual generations has been observed in terrestrial plants
(Verhoeven et al., 2010). Indeed, exposure to environmental stress over 10-13 weeks
induced epigenetic changes in the asexual dandelion Taraxacum officinale. After 10-13
weeks of exposure, genetically identical offspring of T. officinale were collected and
kept under ambient conditions. Although the offspring of T. officinale were not exposed
to environmental stress, they exhibited the same epigenetic markers as their pre-exposed
parents (Verhoeven et al., 2010). These results demonstrate that environmental stress
can induce phenotypic plastic responses that can be successfully transmitted to asexual
offspring. We must now determine whether asexually produced offspring may benefit
from parental preconditioning under changing ocean conditions.
Of all marine species that may acclimate to changing ocean conditions venomous
Irukandji jellyfish are of major concern because of their severe socioeconomic impacts
on coastal communities. Irukandji jellyfish, a group of at least six species, cause a suite
of debilitating symptoms known as Irukandji syndrome (Little & Seymour, 2003) and
111
are responsible for two deaths and hundreds of hospitalizations in north Queensland,
Australia (Fenner & Hadok, 2002, Huynh et al., 2003). Northern Australia is a
‘hotspot’ for Irukandji jellyfish but they also occur in many locations worldwide
including parts of the continental United States (Grady & Burnett, 2003), Hawaii
(Yoshimoto & Yanagihara, 2002) and Caribbean (Pommier et al., 2005).
Despite their potential to cause severe socioeconomic effects under changing ocean
conditions, only one study has examined the interactive effects of warming and
acidification on jellyfish (Klein et al., 2014). That study examined the interactive effects
of acidification and warming on the Irukandji jellyfish, Alatina nr mordens. The study
reported that although warming enhanced asexual reproduction, rates of budding were
much slower under low pH conditions (pH 7.6) suggesting that polyp populations may
not thrive in the future (Klein et al., 2014). These results suggest that although jellyfish
may survive future warming and acidification conditions, they are unlikely to thrive or
benefit from changing ocean conditions.
Here we examine the role of pre-exposure to elevated temperature and low pH
separately and in combination, in potentially mitigating the effects of future ocean
conditions on Irukandji jellyfish polyps of Alatina nr mordens. This study consisted of
two parts – (1) the pre-exposure phase that exposed polyps to elevated temperature and
elevated CO2 conditions in an orthogonal design and (2) the secondary exposure, which
subsequently exposed pre-exposed polyps to either ambient or future conditions. We
measured rates of asexual reproduction, respiration, feeding and protein concentrations
of polyps during the secondary exposure. Specifically, we hypothesised that polyps preexposed to ambient conditions would exhibit negative effects on rates of asexual
reproduction, respiration, feeding and protein concentrations when exposed to future
112
conditions. However, pre-exposure to low pH and elevated temperature (separately and
simultaneously) would mitigate the negative effects of future conditions rates of asexual
reproduction, respiration, feeding, and protein concentrations of polyps. To assess
whether pre-exposure of parent polyps would benefit asexual offspring we separated
asexually produced daughter polyps from original parent polyps and exposed them to
either future or current conditions. We hypothesised that rates of asexual reproduction,
respiration, feeding and protein concentrations of daughter polyps would be higher than
those of parent polyps under future conditions.
113
Methods
Species studied
A. nr mordens polyps originated from planula larvae that were collected from adult
medusae sampled from spawning aggregations at Osprey Reef, Australia (13.92°S,
146.63°E) in 2005. Eight A. nr mordens polyps were transferred into 48 glass petri
dishes and single polyps were transferred into 24 12.01mL glass vials (for respiration
measurements) using a stainless steel dissecting probe. Polyps were acclimated to
laboratory conditions for 4 weeks at 25ºC under low light conditions (to prevent
overgrowth of algae). The experiment was done in a controlled temperature laboratory
with the ambient temperature set at 22ºC so that the temperature of all replicate aquaria
could be raised to their respective temperature treatments using aquarium heaters.
Polyps were fed newly hatched Artemia sp. nauplii every third day throughout the
experiment.
Pre-exposure phase
The pre-exposure phase consisted of two orthogonal factors: temperature (two levels:
current (mean ±1SE, 25ºC± 0.01) and future (28ºC± 0.01)) and pH (two levels: current
(pH 8.0± 0.02) and future (pH 7.6±0.01)). Nominal future pH and temperature
conditions (pH 7.6, 28ºC) were based on RCP8.5 pathway projections for ca. 2100
(IPCC, 2014). To accurately mimic natural environmental conditions in coastal
ecosystems we exposed polyps in all treatments to diel fluctuations of pH that were
based on 24h field measurements taken in October, 2014 in Moreton Bay, Australia
(27.13ºS, 153.07ºE). Six 1 L glass aquaria, each containing two polyp dishes (i.e.
sixteen polyps in total) and one respiration vial, were randomly allocated to each
combination of treatments (i.e. n=24). Each replicate aquarium was gently aerated and
partially submerged within an individual 5 L water bath. Lids were placed loosely over
each aquarium with a header space of ~20mm to minimise evaporation. Aquarium
114
heaters placed in the water baths maintained the desired temperatures within 0.4ºC and
aerators circulated water and maintained an even distribution of heat within the water
bath. Approximately 20% of seawater within each replicate aquarium was replaced
every second day. All aquaria were kept in darkness to prevent algal growth except
when polyps were being maintained, ca. 2 h per day.
Each day, polyp dishes were removed from all aquaria and polyps were checked for
new buds. To ensure that parents had been exposed to their respective pre-exposure
treatments for a reasonable time, only daughter polyps produced after 10 days were used
in the secondary exposure. Daughter polyps were transferred into separate glass dishes
and were randomly assigned to new aquaria that were maintained at the same
experimental conditions as their respective treatments (i.e. parent and daughter polyps
were maintained in separate aquaria). Similarly, daughter polyps produced in the
respiration vials after 10 days were transferred into glass vials filled with 10µm filtered
seawater for measurements of respiration and also placed in separate aquaria. At the end
of the pre-exposure phase there were 48 replicate aquaria which consisted of 24 aquaria
containing parent polyps and 24 aquaria containing daughter polyps. The pre-exposure
phase ran for 14 days.
Experimental approach of the secondary exposure
The secondary exposure consisted of four orthogonal factors: temperature pre-exposure
(two levels: ambient (25ºC) and high temperature (28ºC)), pH pre-exposure (two levels:
pH 8.0 and pH 7.6), asexual generation (two levels: parent polyps, daughter polyps) and
climate scenario (two levels: current-day (pH 8.0, 25ºC,) and future (pH 7.6, 28ºC)).
Prior to the commencement of the secondary exposure, the number of polyps in each
dish and respiration vial were counted and, if necessary, any additional polyps that had
budded were removed until only four polyps remained in each dish and one polyp
115
remained in each respiration vial to ensure consistency among replicate aquaria. Three
replicate 1L glass aquaria, each containing two polyp dishes (i.e. a total of 8 polyps in
total) and one glass vial, were assigned to each of their respective treatment
combinations (i.e. total n= 48). Within each replicate aquarium, one polyp dish was
allocated for asexual reproduction measurements and at the end of the secondary
exposure, both polyps dishes were used for measurements of total protein and prey
capture rates. Two polyp dishes were allocated to each replicate aquarium to prevent
overcrowding of polyps and for ease of cleaning excess algal growth.
Manipulation and analysis of water chemistry
To achieve the desired water chemistry conditions of each treatment a series of gas
proportioners were used to deliver CO2, N2 and O2 gas to seawater. The desired gas
compositions were mixed from individual gas cylinders using twelve Omega® mass
flow controllers (FMA-5400s, 0-20 mL/min (CO2), 0-5 L/min (N2), 0-2 L/min (O2)).
Two sets of three mass flow controllers were used to deliver gas mixtures to each pH
treatment (pH 8.0 and pH 7.6). The mass flow controllers were operated and functions
monitored by a desktop PC running NI LabVIEW™ software (32-bit version) with
communication using a voltage generating Omega Expandable Modular Data
Acquisition System® (iNET-400) connected with three Omega® wiring boxes with
screw terminals (iNET-510). After the three gases were mixed in the desired proportion
for each treatment the gases were then combined in a stainless steel manifold before the
gas line was split, providing identical gas mixtures to the replicate aquaria. Flow rates to
replicate aquaria were manually adjusted using secondary stainless steel manifolds with
control valves. For both pH treatments, two gas compositions (i.e. day and night) were
determined to closely mimic diel fluctuations in water chemistry in the natural
environment (Fig. A5.1). NI LabVIEW™ software was used to linearly transition
between the day and night gas mixtures but gas compositions were held constant at
night time (6pm-6am) and between the hours of 10am-2pm (Fig. A5.1).
116
Every third day, temperature, salinity, pH and DO were measured at midday. Salinity
and temperature were measured in each aquarium using a conductivity-salinity metre
(TPS salinity-conductivity metre, MC-84) and thermometer, respectively. The DO
concentration in each aquarium was recorded using an optic DO sensor (Mettler Toledo
OptiOPx, Mettler Toledo Ltd) and exceeded 85% O2 saturation in all replicates
throughout the experiment. The pH of each aquarium was measured using a FiveGo pH
meter (Mettler Toledo Ltd) equipped with an Inlab Expert Pro Electrode (Mettler
Toledo Ltd). Every 2-3 days, pH electrodes were calibrated using TRIS/HCl buffers in
synthetic seawater. To accurately measure diel patterns of pH during the experiment, pH
measurements were taken hourly (between 6am-6pm) from one randomly selected
replicate from each of the treatments once per week. Levels of pCO2 were calculated
based on measured levels of Total Alkalinity (TA), pH, DO, temperature and salinity
using the program CO2SYS (Lewis et al., 1998) (Table 5.1). Every third day, a 100mL
water sample was collected for analysis of TA from one randomly selected replicate
from each of the treatments. 100mL samples of seawater were collected in clean glass
amber bottles using a drawing tube and overfilled for 10 seconds to minimise gas
exchange between the sample water and the atmosphere. All samples were filtered
through 0.22µm filters, spiked with 20µL of mercuric chloride, sealed tightly and stored
at 3ºC to prevent biological activity until samples were analysed. All TA samples were
analysed using a Mettler Toledo T50 Automatic Titrator, which was calibrated on the
total scale using TRIS/HCl buffers in synthetic seawater. TA measurements on 50mL
samples of certified reference material (provided by A. G. Dickson, batch #138) were
used to verify TA values.
117
Table 5.1 Mean ± 1SE water chemistry measurements taken during the 34 day experiment. Temperature, salinity and pH measurements
were taken at 10am every 3 days and TA and pCO2 measurements were taken weekly (Weeks 1, 2, 3, 4 and 5).
Temp (ºC)
Salinity (ppt)
Alkalinity (µeq kg -1)
pH
Calculated pCO2 (µatm)
Ambient
25.1±0.02
35.2±0.05
2246.13± 8.6
8.00±0.01
409.95±34.4
High temp
28.1±0.03
34.8±0.06
2246.20±22.1
8.01±0.02
415.52±28.1
Low pH
25.1±0.02
34.2±0.08
2213.46±16.3
7.62±0.02
1162.25±38.3
High temp, low pH
28.0±0.04
35.3±0.03
2217.18±28.6
7.60±0.01
1182.08±31.2
Ambient
25.2±0.03
35.3±0.08
2258.04± 10.3
8.01±0.03
407.01±32.6
High temp
28.1±0.04
35.2±0.09
2259.72±16.6
8.00±0.02
411.43±26.4
Low pH
25.0±0.06
34.9±0.06
2236.73±18.6
7.61±0.01
1108.02±46.1
High temp, low pH
28.1±0.03
35.0±0.03
2280.85±28.5
7.59±0.03
1156.35±38.9
Treatment
Secondary exp- Current
Secondary exp- Future
118
Data collection
Four response variables were measured: asexual reproduction, respiration, protein
concentration, and prey capture rate. Each day, during the pre-exposure phase, polyps
were removed from aquaria and viewed under a dissecting microscope and the number
of polyps and their developmental stage (i.e. polyp; budding or partial fission; or
juvenile medusae) was recorded. During the secondary exposure, polyps were counted
every third day and at the end of the experiment polyp dishes in each replicate aquarium
were removed to count and collect polyps for estimations of total protein and rates of
prey capture.
Respiration measurements
The respiration rates of polyps in all replicate aquaria were measured at Days 1, 4, 14,
24 and 34 using a Unisense PA200 Picoammeter equipped with a 20-30µm tip O2
microsensor (OX-25 Unisense, Denmark). Single polyps were settled in 12.01mL
borosilicate glass vials. One control (blank) vial was also placed in each replicate
aquarium to account for the respiration of bacterial communities and other microorganisms that had formed during the experiment. All glass vials were sealed with
double wadded caps designed for multi-sampling and were partially submerged in
temperature-controlled water baths that were heated to the same temperature as their
respective thermal treatments. The seawater was 0.22µm filtered and of the same water
chemistry as their respective treatments. Water within each vial was gently mixed
during the incubation and was never <70% O2 saturation. O2 concentrations were
determined using a linear equation calculated from a two-point calibration curve (pA at
100% and 0% O2 saturation). For all replicate vials, oxygen consumed by the
corresponding blank vials were subtracted from polyp vials to obtain respiration rates of
polyps (ng O2 polyp-1 h-1).
119
Protein estimation
Ten polyps from each replicate aquarium were transferred into pre-labelled cryogenic
centrifuge tubes that contained a cocktail of protease inhibitors (P8340, Sigma-Aldrich)
to inhibit protein degradation, diluted to a volume ratio of 1:100 (inhibitor: TRIS
buffer). The QuantiPro™ bicinchoninic acid (BCA) kit (QPBCA, Sigma-Aldrich) was
used to measure protein concentrations and bovine serum albumin (BSA, 1.0mg mL-1 in
0.15M NaCl with 0.05% sodium azide, Sigma-Aldrich) was used as the protein
standard. For standard curve determinations, BSA standards (0.5 to 30 µgmL-1) were
prepared in TRIS and NaCl (artificial seawater) buffers. All samples (in TRIS buffer)
that formed a precipitate were centrifuged after colour development and the absorbance
of the supernatant measured. The absorbance of all samples at 562nm was measured
against a blank using a UV spectrophotometer (UV-1800, Shimadzu). We compared the
standard curves of TRIS and NaCl buffer standards and confirmed that the formation of
the precipitate in TRIS buffer samples did not affect colour development, and thus did
not affect protein estimations of polyp samples.
Measurements of prey capture rates
At the end of the secondary exposure, four polyps from each replicate aquarium were
transferred into individual wells of a 96-well plate. Artemia sp. nauplii were used as
prey to examine the prey capture rate of polyps. Each well contained 10µm filtered
seawater. Polyps were allowed ~1 hour to acclimate to well conditions. During the
acclimation period, seawater was partially replenished every 10 minutes to maintain
normoxic conditions. Approximately 15 Artemia sp. nauplii were added to each well,
and the time and exact number of nauplii added to each well was recorded. Polyps were
allowed 20 minutes to feed before the number of remaining prey was recorded in each
well. Prey capture rates of polyps from each replicate aquarium were summed across the
120
four polyp wells for statistical analyses (i.e. the unit of replication was the average %
prey captured across the four polyp wells for each aquarium).
Statistical analyses
The dependent variables, number of polyps, protein concentration (ng polyp-1) and prey
capture rates (% prey captured) at Day 34, in all treatments were analysed using linear
mixed models (LMMs) in SPSS (SPSS, Released 2013). The four fixed factors were:
temperature pre-exposure, pH pre-exposure, asexual generation and climate scenario.
The dependent variable respiration (ng O2 polyp-1 h-1) in all treatments was analysed
using repeated measures linear mixed models (LMMs). The five fixed factors were:
temperature pre-exposure, pH pre-exposure, asexual generation, climate scenario, and
time, which was the repeated measure. A range of models were investigated to assess
the model of-best-fit by comparing various goodness-of-fit statistics (-2 log likelihood,
AIC, and BIC). For all analyses, data were checked for normality and homoscedasticity
using standardised residual and Q-Q plots and if required, data were either ln or ln(x+1)
transformed. If significant differences were found, estimated marginal means were used
to determine which means differed.
121
Results
Survival and asexual reproduction
All polyps of A. nr mordens survived the secondary exposure and the number of polyps
increased in all treatments. There was no difference between parent and daughter polyps
for any of the response variables tested (Table 5.2, 5.3). At the end of the secondary
exposure, there was substantial variability in the number of polyps produced among
treatments, resulting in a significant pH × temp × climate scenario interaction (Table
5.2, Fig. 5.1). Polyps pre-exposed to ambient conditions produced 56% fewer polyps
when exposed to future conditions than polyps that remained in ambient conditions. In
contrast, polyps pre-exposed to high temperature and low pH individually and in
combination, produced a similar numbers of polyps regardless of whether they were
subsequently exposed to ambient or future conditions (Fig. 5.1). Overall, polyps preexposed to low pH produced a similar number of polyps when exposed to future
conditions to those in the control treatment but substantially more polyps than the
treatment that had been pre-exposed to ambient conditions and transferred to future
conditions. Polyps pre-exposed to elevated temperature produced 29% fewer polyps
when exposed to future conditions relative to those in the control treatment but 52%
more than the treatment that had been pre-exposed to ambient conditions and transferred
to future conditions. Polyps pre-exposed to the stressors simultaneously, however,
produced approximately 43% fewer polyps than those in the control treatment,
regardless of whether they had been transferred to ambient or future conditions (Fig.
5.1).
122
Table 5.2 Summary of results of a LMMs analysis comparing the number of polyps,
protein concentrations (ng polyp-1) and prey capture rates (% captured) between
treatments at Day 34 of the experiment. Df= Degrees of freedom. P values in bold are
statistically significant (P < 0.05) Data were ln transformed.
Variable
Number of
polyps
Protein
(ng polyp-1)
Prey capture
(% captured)
Transformation
Ln
Ln (x+1)
None
Information Criterion
BIC= 20.014
BIC= -23.569
BIC= 268.723
AIC= 17.083
AIC= -26.500
AIC= 265.792
Source of variation
Df
Denominator Df
P
P
P
pH
1
32
0.593
0.207
<0.001
F=0.298
F=1.729
F=33.844
0.144
0.079
<0.001
F=2.355
F=3.509
F=16.828
0.281
0.242
0.483
F=1.244
F=1.474
F=0.503
0.001
0.190
0.022
F=16.157
F=1.872
F=5.754
<0.001
0.002
0.703
F=21.258
F=13.547
F=0.148
0.491
0.644
0.502
F=0.496
F=0.222
F=0.462
0.001
0.512
0.196
F=16.421
F=0.449
F=1.743
0.221
0.968
0.214
F=1.619
F=0.002
F=1.609
0.055
0.039
0.005
F=4.280
F=5.082
F=9.178
0.580
0.419
0.853
F=0.320
F=0.689
F=0.035
0.545
0.123
0.781
F=0.383
F=2.657
F=0.079
0.026
0.016
<0.001
F=6.026
F=7.216
F=16.528
0.302
0.172
0.534
F=1.140
F=2.049
F=0.395
0.652
0.061
0.890
F=0.211
F=4.064
F=0.019
0.720
0.964
0.159
F=0.134
F=0.002
F=2.080
Temp
Parent/ daughter
Climate scenario
pH × Temp
pH × Parent/ daughter
pH × Climate scenario
Temp × Parent/ daughter
Temp × Climate scenario
Parent/ daughter × Climate scenario
pH × Temp × Parent/ daughter
pH × Temp × Climate scenario
1
1
1
1
1
1
1
1
1
1
1
pH × Parent/ daughter × Climate
scenario
1
Temp × Parent/ daughter × Climate
scenario
1
pH × Temp × Parent/ daughter ×
Climate scenario
1
32
32
32
32
32
32
32
32
32
32
32
32
32
32
123
Figure 5.1 Number of polyps (mean ±1SE) recorded at Day 34 of the secondary
exposure (n=48). Letters above data points indicate similarities (e.g. AA) and
differences (e.g. AB) among all treatments, as determined by estimated marginal means.
Respiration rates
The temporal variation in respiration rates differed among treatments, resulting in a
significant pH × climate scenario × day interaction (Table 5.3, Fig. 5.2a, b). Overall,
respiration rates were higher under future conditions compared to ambient conditions,
regardless of whether polyps had been pre-exposed to low or ambient pH (Fig. 5.2a, b).
The only exception was for Day 1 of the secondary exposure where respiration rates did
not differ between ambient and future conditions for polyps pre-exposed to ambient
conditions (Fig. 5.2a). Polyps pre-exposed to ambient pH had respiration rates that were
~63% higher under future conditions than those in ambient conditions (Fig. 5.2a).
Similarly, after Day 1 of the secondary exposure, respiration rates of polyps preexposed to low pH were ~52% higher when exposed to future conditions than those
under ambient conditions (Fig. 5.2b).
124
Table 5.3 Summary of results of a repeated measures LMMs analysis comparing
respiration rates of polyps between treatments throughout the experiment (Days 1, 4, 14,
24 and 34). Df= Degrees of freedom. P values in bold are statistically significant (P <
0.05). Data were ln transformed.
Source
Numerator df
Denominator df
F
Sig.
pH
1
32
0.380
0.542
Temp
1
32
1.148
0.292
Parent/ daughter
1
32
0.886
0.354
Climate scenario
1
32
159.453
<0.001
pH × Temp
1
32
0.128
0.723
pH × Parent/ daughter
1
32
0.768
0.387
pH × Climate scenario
1
32
0.886
0.354
Temp × Parent/ daughter
1
32
1.948
0.172
Temp × Climate scenario
1
32
0.659
0.423
Parent/ daughter × Climate scenario
1
32
0.305
0.585
pH × Temp × Parent/ daughter
1
32
0.237
0.630
pH × Temp × Climate scenario
1
32
0.178
0.676
pH × Parent/ daughter × Climate scenario
1
32
0.085
0.772
Temp × Parent/ daughter × Climate scenario
1
32
1.148
0.292
pH × Temp × Parent/ daughter × Climate scenario
1
32
1.443
0.239
Day
4
128
2.294
0.063
pH × Day
4
128
1.227
0.303
Temp × Day
4
128
0.499
0.736
Parent/ daughter × Day
4
128
0.400
0.808
Climate scenario × Day
4
128
0.472
0.756
pH × Temp × Day
4
128
0.514
0.726
pH × Parent/ daughter × Day
4
128
0.601
0.662
pH × Climate scenario × Day
4
128
3.901
0.005
Temp × Parent/ daughter × Day
4
128
0.571
0.684
Temp × Climate scenario× Day
4
128
0.914
0.458
Parent/ daughter × Climate scenario × Day
4
128
0.445
0.776
pH × Temp × Parent/ daughter × Day
4
128
0.339
0.851
pH × Temp × Climate scenario × Day
4
128
0.212
0.932
pH × Parent/ daughter × Climate scenario × Day
4
128
0.088
0.986
Temp × Parent/ daughter × Climate scenario × Day
4
128
0.356
0.840
pH × Temp × Parent/ daughter × Climate scenario× Day
4
128
1.555
0.190
125
Figure 5.2 Respiration rates of polyps (mean ±1SE) pre-exposed to ambient pH (a) and
low pH (b) conditions recorded at Days 1, 4, 14, 24 and 34 of the secondary exposure
(Days 1-34, n=48). Letters above data points indicate similarities (e.g. AA) and
differences (e.g. AB) among all treatments, as determined by estimated marginal means.
126
Protein concentrations
At the end of the secondary exposure, protein concentrations varied substantially among
treatments, resulting in the pH × temp × climate scenario interaction (Table 5.2, Fig.
5.3). At the end of the secondary exposure, polyps pre-exposed to ambient conditions
had 55% lower protein concentrations when exposed to future conditions than polyps
that remained in ambient conditions. Conversely, polyps pre-exposed to high
temperature and low pH individually and in combination had similar protein
concentrations regardless of whether they were exposed to ambient and future
conditions (Fig. 5.3). Overall, pre-exposure to high temperature and low pH
individually appeared to mitigate the negative effects of future conditions on protein
concentrations because the protein content of these polyps was greater than for the
polyps that had been pre-exposed to ambient conditions and transferred to future
conditions. Polyps pre-exposed to the dual stressors, however, had 48% lower protein
concentrations when exposed to future conditions than those in the control treatment.
The response of these polyps was no different to the polyps raised in ambient conditions
but transferred to future conditions (Fig. 5.3).
127
Figure 5.3 Protein concentrations (mean ±1SE) of polyps sampled at Day 34 of the
secondary exposure (n=48). Letters above data points indicate similarities (e.g. AA) and
differences (e.g. AB) among all treatments, as determined by estimated marginal means.
Rates of prey capture
At the end of the secondary exposure, prey capture rates of polyps varied substantially
among treatments, which resulted in a significant pH × temp × climate scenario
interaction (Table 5.2, Fig. 5.4). Polyps pre-exposed to ambient conditions exhibited
similar rates of prey capture when exposed to future conditions to those that remained in
ambient conditions (Fig. 5.4). Similarly, polyps pre-exposed to high temperature and
low pH individually, exhibited similar rates of pre-capture regardless of whether they
were subsequently exposed to ambient or future conditions. In contrast, polyps preexposed to low pH and high temperature in combination exhibited 75% lower prey
capture rates than those that were subsequently exposed to ambient conditions (Fig.
5.4). Overall, polyps pre-exposed to high temperature and low pH individually had (on
128
average) 32% lower prey capture rates than those in the control treatment, regardless of
the conditions they were subsequently exposed to. These polyps, however, produced
~65% more polyps than the treatment that had been pre-exposed to the dual stressors
and remained in future conditions. Polyps that were pre-exposed to high temperature
and low pH in combination and remained in future conditions were exposed to the dual
stressors for an overall longer period of time than other treatments and exhibited lower
prey-capture rates than those in all other treatments (Fig. 5.4).
Figure 5.4 % prey captured (mean ±1SE) recorded at Day 34 of the secondary exposure
(n=48). Letters above data points indicate similarities (e.g. AA) and differences (e.g.
AB) among all treatments, as determined by estimated marginal means.
129
Discussion
Observations of A. nr mordens polyps supported the hypothesis that pre-exposure to low
pH and elevated temperature separately would mitigate the negative effects of future
conditions. Under future conditions, polyps pre-exposed to low pH had similar protein
concentrations and produced a similar number of polyps to those in the control
treatment and more than polyps pre-exposed to ambient conditions and transferred to
future conditions, suggesting that pre-exposure to low pH alone mitigated the negative
effects of future conditions. Polyps pre-exposed to elevated temperature had similar
protein concentrations when exposed to future conditions to those in the control
treatment. Rates of asexual reproduction, however, were slightly lower under future
conditions relative to polyps in the control treatment but still higher than those preexposed to ambient conditions and transferred to future conditions. The moderate
number of polyps produced in this treatment suggest that pre-exposure to elevated
temperature partly mitigated the negative effects of future conditions on asexual
reproduction. These results suggest that pre-exposure to elevated temperature and low
pH individually may allow polyps to acclimate to future conditions over short time
scales.
Observations of polyps pre-exposed to low pH and elevated temperature in combination
did not support the hypothesis that pre-exposure to the stressors in combination would
mitigate the negative effects of future conditions. Polyps pre-exposed to the stressors in
combination had lower protein concentrations and lower rates of asexual reproduction
when exposed to future conditions relative to those in the control treatment.
Consequently, pre-exposure to the dual stressors did not mitigate the negative effects of
future conditions and polyps may not thrive in response to dual stressors. Indeed, if this
study had only investigated the effects of pre-exposure to the stressors individually,
results of this study would have suggested that Irukandji polyps could acclimate to
future conditions and thrive in the future. These results suggest, however, that Irukandji
130
polyps may reproduce at a slower rate in response to the dual stressors. These
observations highlight the importance of investigating how pre-exposure to multiple
stressors may confer effects that differ from those when biota are pre-exposed to the
stressors individually.
Marine organisms may acclimate to future conditions by altering the relative amount of
energy allocated to metabolic processes to maintain fitness (Sunday et al., 2014).
Although studies of the effects of warming and acidification on physiological trade-offs
in marine organisms are limited, observations of biota exposed to acidification
demonstrate that marine organisms may acclimate to high CO2 conditions by reallocating energy to different functions (e.g. Reipschläger & Pörtner, 1996, Pörtner &
Bock, 2000, Michaelidis et al., 2005). Indeed, exposure to low pH conditions (pH 7.76.8) over 40 days increased rates of calcification and respiration in the brittle star
Amphiura filiformis (Wood et al., 2008). These compensatory mechanisms, however,
coincided with the partial resorption of arm muscles of A. filiformis and suggests that
while the upregulation of metabolism and calcification may potentially mitigate the
effects of acidification conditions on A. filiformis, these mechanisms may come at a
substantial cost because of elevated energy demands under elevated pCO2 conditions
(Wood et al., 2008). In the current study, respiration rates of polyps were higher under
future conditions regardless of the conditions that polyps were pre-exposed to. Our
observations that rates of respiration increased under future conditions are consistent
with the ‘principal’ effect of warming on respiration in other marine invertebrates
(including jellyfish; e.g. Fitt & Costley, 1998, Møller & Riisgård, 2007, Gambill &
Peck, 2014). Observations of asexual reproduction and protein concentrations, however,
demonstrate that only pre-exposure to the stressors individually mitigated the negative
effects of future conditions. Pre-exposure to the stressors individually probably induced
physiological changes that allowed polyps to cope under future conditions, but polyps
pre-exposed to the dual stressors may have re-allocated energy away from reproduction
131
and protein synthesis to support basal maintenance costs under future conditions.
Although the current study did not investigate specific compensatory mechanisms, these
results further support the observations that marine organisms may increase metabolic
rates to compensate for the additional energy expenses of basal maintenance under
changing ocean conditions. (Calow, 1991, Pörtner et al., 2006, Willmer et al., 2009,
Sokolova, 2013).
The ability of marine species to acquire and assimilate food may ultimately determine
their ability to support basal maintenance costs and survive under changing ocean
conditions (Sokolova, 2013). Indeed, reduced rates of feeding and assimilation may
decrease the fitness of biota under climate change conditions because there is less
energy available for growth and reproduction after energy is allocated to maintaining
basal maintenance. For example, consumption rates of the sea urchin Lytechinus
variegatus increased when temperature was elevated to (29ºC) but decreased when
exposed to 31ºC (Lemoine & Burkepile, 2012). Respiration rates of L. variegatus,
however, increased exponentially with increasing temperature (20-31ºC). Reduced
consumption rates and elevated rates of metabolism under more extreme temperature
conditions (31ºC) reduced the ingestion efficiency of L. variegatus by ~50% and was
hypothesised to reduce overall fitness (Lemoine & Burkepile, 2012). In the current
study, polyps pre-exposed to high temperature and low pH in combination, had the
lowest food consumption rates when exposed to future conditions, and, similar to the
results of asexual reproduction and protein concentrations, suggest that basal
maintenance costs of polyps will probably be higher in response to the dual stressors
and ultimately reduce rates of asexual reproduction. We, therefore, advocate that for
experiments to accurately predict the response of marine organisms over longer-time
frames, they should measure multiple physiological responses to assess potential tradeoffs that may lead to overall reductions in fitness.
132
Parent and daughter polyps responded similarly to the various treatments tested. These
observations do not support the hypothesis that pre-exposure of parent polyps to
elevated temperature and low pH would confer benefits to daughter polyps under future
conditions. We cannot determine whether non-genetic changes were passed on to
genetically identical offspring because this study did not identify potential non-genetic
mechanisms (such as the transmission of specific proteins and hormones) or epi-genetic
factors (e.g. DNA methylation) because they typically require advanced whole
transcriptomic approaches (e.g. Moya et al., 2012, Barshis et al., 2013, Pespeni et al.,
2013a, Pespeni et al., 2013b). To better determine whether genetically identical
offspring inherit phenotypic plastic response from parents that are pre-exposed to
climate change stressors we must now identify potential non-genetic mechanisms and
epi-genetic markers that may allow asexual offspring to benefit from parental preexposure.
Observations that pre-exposure to the combined effects of low pH and elevated
temperature did not mitigate the effects of future conditions on A. nr mordens polyps
contrast with those of the only other study to examine whether preconditioning to
warming and acidification in combination could mitigate the negative effects of future
conditions (Putnam & Gates, 2015). Preconditioning of the adult coral, P. damicornis,
to constant levels of elevated temperature and low pH over 1.5 months resulted in
greater metabolic acclimation of larvae under future conditions than those of adults that
were preconditioned to ambient conditions. (Putnam & Gates, 2015). These results
suggest that trans-generational acclimation may play an important role in the persistence
of marine species under the effects of the dual stressors. Results of the current study,
however, suggest that although polyps of A. nr mordens pre-exposed to the dual
stressors survived they may have a limited ability to acclimate to the combined effects
of warming and acidification within a single generation. P. damicornis may have
acclimated to the combined effects of warming and acidification because symbiotic
133
dinoflagellates (such as Symbiodinium) can exert significant control over the internal pH
of host tissues (Chapter 4, Gibbin et al., 2014)) and thus, symbionts probably played an
important role in mitigating the negative effects of acidification on P. damicornis.
Consequently, differences in results between Putnam & Gates (2015) and those in the
current study could be attributed to the absence of zooxanthellae in polyps of A. nr
mordens. These observations highlight how symbiotic and non-symbiotic cnidarians
may acclimate differently to warming and acidification in combination.
The relative rates at which warming and acidification change are likely to determine
whether Irukandji polyps, such as A. nr mordens, can thrive under future conditions. In
the current study, pre-exposure to warming partly mitigated the negative effects of
future conditions and low pH completely mitigated the negative effects of future
conditions on A. nr mordens polyps. Although these results suggest that pre-exposure to
acidification and warming individually could mitigate the negative effects of future
conditions and potentially facilitate the proliferation of polyps, ocean acidification and
warming are unlikely to occur in isolation over the next century (IPCC, 2014). Indeed,
if polyps are exposed to warming and acidification concurrently, A. nr mordens are
likely to survive but asexually reproduce at a slower rate under future ocean conditions.
Marine biota are often subject to fluctuations in environmental conditions due to
changes associated with tidal and diel cycles (Hofmann et al., 2011), nutrient input
(Frieder et al., 2014) and seasonal extremes (Pennington & Chavez, 2000). In some
cases, diel fluctuations in pH and temperature exceed future climate change projections
(e.g. pH, Hofmann et al., 2011; and temperature, Oliver & Palumbi, 2011) and may act
to precondition or pre-expose biota to elevated temperature and low pH conditions and
thus biota may become more robust to future ocean conditions (Byrne & Przeslawski,
2013). To persist under future climate change conditions, however, phenotypic plastic
responses induced by environmental fluctuations must persist when environmental
134
conditions return to ambient. In the current study, polyps pre-exposed to elevated
temperature and low pH individually (but not simultaneously) had similar protein
concentrations, rates of asexual reproduction and prey-capture regardless of whether
they subsequently transferred to future or ambient conditions. Although data are limited,
our observations are generally consistent with studies that demonstrate that phenotypic
plastic responses persist when biota are subsequently returned to ambient (or control)
conditions (e.g. Middlebrook et al., 2008, Hettinger et al., 2012, Putnam & Gates,
2015). For example, exposing larvae of the Olympia oyster (Ostrea lurida) to
acidification reduced juvenile shell sizes and these changes persisted for >1.5 months
after juveniles were subsequently transferred to ambient conditions (Hettinger et al.,
2012). These observations thus demonstrated persistent carry-over effects from the
larval phase. Taken together these observations highlight the need to examine the
duration and magnitude of acclimation processes and that phenotypic plastic responses
that occur during environmental fluctuations may ultimately determine the response of
biota to future climate change conditions. (
Northern Australia is a ‘hot spot’ for dangerous cubozoan jellyfish but envenomations
occur throughout the tropics worldwide (Gershwin et al., 2010). Our results suggest
that, if other cubozoan jellyfish respond similarly, polyp populations are likely to persist
but asexually reproduce at a slower rate in response to the dual stressors. To more
accurately predict how Irukandji jellyfish, as a group, are likely to respond to future
conditions we must now determine whether results of the current study are consistent
with other species and other life history stages. To better determine whether asexual
offspring of other non-calcifying cnidarians may benefit from parental pre-exposure in
the face of climate change we must also identify potential non-genetic mechanisms and
epi-genetic factors that may be passed to asexual offspring. Importantly, we highlight
the need to investigate how pre-exposure to individual stressors may impart effects that
135
differ from those of pre-exposure to multiple stressors and demonstrate that biota may
acclimate to future climate change conditions over short time scales.
136
REFERENCE LIST
Albright R, Caldeira L, Hosfelt J et al. (2016) Reversal of ocean acidification enhances
net coral reef calcification. Nature, 531, 362-365.
Angilletta MJ (2009) Thermal adaptation: A Theoretical and Empirical Synthesis,
Oxford University Press.
Barshis DJ, Ladner JT, Oliver TA, Seneca FO, Traylor-Knowles N, Palumbi SR (2013)
Genomic basis for coral resilience to climate change. Proceedings of the
National Academy of Sciences, 110, 1387-1392.
Bay RA, Palumbi SR (2015) Rapid acclimation ability mediated by transcriptome
changes in reef-building corals. Genome Biology and Evolution, 7, 1602-1612.
Bell G (2013) Evolutionary rescue and the limits of adaptation. Philosophical
Transactions of the Royal Society of London B: Biological Sciences, 368,
20120080.
Bellantuono AJ, Hoegh-Guldberg O, Rodriguez-Lanetty M (2011) Resistance to
thermal stress in corals without changes in symbiont composition. Proceedings
of the Royal Society of London B: Biological Sciences, rspb20111780.
Best RJ, Stone MN, Stachowicz JJ (2015) Predicting consequences of climate change
for ecosystem functioning: variation across trophic levels, species and
individuals. Diversity and Distributions, 21, 1364-1374.
Brown B, Dunne R, Goodson M, Douglas A (2002) Experience shapes the susceptibility
of a reef coral to bleaching. Coral Reefs, 21, 119-126.
Byrne M, Przeslawski R (2013) Multistressor impacts of warming and acidification of
the ocean on marine invertebrates’ life histories. Integrative and Comparative
Biology, 53, 582-596.
Calow P (1991) Physiological costs of combating chemical toxicants: ecological
implications. Comparative Biochemistry and Physiology Part C: Comparative
Pharmacology, 100, 3-6.
Donelson J, Munday P, McCormick M, Pitcher C (2012) Rapid transgenerational
acclimation of a tropical reef fish to climate change. Nature Climate Change, 2,
30-32.
Doney SC, Ruckelshaus M, Duffy JE et al. (2012) Climate change impacts on marine
ecosystems. Marine Science, 4.
137
Fenner PJ, Hadok JC (2002) Fatal envenomation by jellyfish causing Irukandji
syndrome. Medical journal of Australia, 177, 362-363.
Fitt WK, Costley K (1998) The role of temperature in survival of the polyp stage of the
tropical rhizostome jellyfish Cassiopea xamachana. Journal of Experimental
Marine Biology and Ecology, 222, 79-91.
Fleck J, Fitt WK (1999) Degrading mangrove leaves of Rhizophora mangle Linne
provide a natural cue for settlement and metamorphosis of the upside down
jellyfish Cassiopea xamachana Bigelow. Journal of Experimental Marine
Biology and Ecology, 234, 83-94.
Form AU, Riebesell U (2012) Acclimation to ocean acidification during long‐term CO2
exposure in the cold‐water coral Lophelia pertusa. Global Change Biology, 18,
843-853.
Frieder CA, Gonzalez JP, Bockmon EE, Navarro MO, Levin LA (2014) Can variable
pH and low oxygen moderate ocean acidification outcomes for mussel larvae?
Global Change Biology, 20, 754-764.
Gambill M, Peck MA (2014) Respiration rates of the polyps of four jellyfish species:
potential thermal triggers and limits. Journal of Experimental Marine Biology
and Ecology, 459, 17-22.
Gershwin LA, De Nardi M, Winkel KD, Fenner PJ (2010) Marine Stingers: Review of
an Under-Recognized Global Coastal Management Issue. Coastal Management,
38, 22-41.
Gibbin EM, Putnam HM, Davy SK, Gates RD (2014) Intracellular pH and its response
to CO2-driven seawater acidification in symbiotic versus non-symbiotic coral
cells. Journal of Experimental Biology, 217, 1963-1969.
Grady JD, Burnett JW (2003) Irukandji-like syndrome in South Florida divers. Annals
of Emergency Medicine, 42, 763-766.
Harvey BP, Gwynn‐Jones D, Moore PJ (2013) Meta‐analysis reveals complex marine
biological responses to the interactive effects of ocean acidification and
warming. Ecology and Evolution, 3, 1016-1030.
Hettinger A, Sanford E, Hill TM et al. (2012) Persistent carry‐over effects of planktonic
exposure to ocean acidification in the Olympia oyster. Ecology, 93, 2758-2768.
Hoegh-Guldberg O, Bruno JF (2010) The Impact of Climate Change on the World’s
Marine Ecosystems. Science, 328, 1523-1528.
138
Hofmann GE, Smith JE, Johnson KS et al. (2011) High-frequency dynamics of ocean
pH: a multi-ecosystem comparison. PLOS one, 6, e28983.
Huynh TT, Seymour J, Pereira P, Mulcahy R, Cullen P, Carrette T, Little M (2003)
Severity of Irukandji syndrome and nematocyst identification from skin
scrapings. Medical journal of Australia, 178, 38-41.
IPCC (2014) Climate Change 2014: Synthesis Report. Contribution of Working Groups
I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on
Climate Change.
Klein SG, Pitt KA, Rathjen KA, Seymour JE (2014) Irukandji jellyfish polyps exhibit
tolerance to interacting climate change stressors. Global Change Biology, 20,
28-37.
Lemoine NP, Burkepile DE (2012) Temperature‐induced mismatches between
consumption and metabolism reduce consumer fitness. Ecology, 93, 2483-2489.
Lewis E, Wallace D, Allison LJ (1998) Program developed for CO2 system
calculations, Carbon Dioxide Information Analysis Center, managed by
Lockheed Martin Energy Research Corporation for the US Department of
Energy Tennessee.
Little M, Seymour J (2003) Another cause of Irukandji stingings. Medical journal of
Australia, 179.
Logan CA, Dunne JP, Eakin CM, Donner SD (2014) Incorporating adaptive responses
into future projections of coral bleaching. Global Change Biology, 20, 125-139.
Michaelidis B, Ouzounis C, Paleras A, Pörtner HO (2005) Effects of long-term
moderate hypercapnia on acid–base balance and growth rate in marine mussels
Mytilus galloprovincialis. Marine Ecology Progress Series, 293, 109-118.
Middlebrook R, Hoegh-Guldberg O, Leggat W (2008) The effect of thermal history on
the susceptibility of reef-building corals to thermal stress. Journal of
Experimental Biology, 211, 1050-1056.
Miller GM, Watson S-A, Donelson JM, McCormick MI, Munday PL (2012) Parental
environment mediates impacts of increased carbon dioxide on a coral reef fish.
Nature Climate Change, 2, 858-861.
Møller LF, Riisgård HU (2007) Respiration in the scyphozoan jellyfish Aurelia aurita
and two hydromedusae (Sarsia tubulosa and Aequorea vitrina): effect of size,
temperature and growth. Marine Ecology Progress Series, 330, 149-154.
139
Moya A, Huisman L, Ball E et al. (2012) Whole transcriptome analysis of the coral
Acropora millepora reveals complex responses to CO2‐driven acidification
during the initiation of calcification. Molecular ecology, 21, 2440-2454.
Munday PL (2014) Transgenerational acclimation of fishes to climate change and ocean
acidification. F1000Prime Reports, 6, 99.
Munday PL, Warner RR, Monro K, Pandolfi JM, Marshall DJ (2013) Predicting
evolutionary responses to climate change in the sea. Ecology Letters, 16, 14881500.
Murray CS, Malvezzi A, Gobler CJ, Baumann H (2014) Offspring sensitivity to ocean
acidification changes seasonally in a coastal marine fish. Marine Ecology
Progress Series, 504, 1-11.
Nagelkerken I, Munday PL (2015) Animal behaviour shapes the ecological effects of
ocean acidification and warming: moving from individual to community‐level
responses. Global Change Biology, 22, 974-989.
Nagelkerken I, Pitt KA, Rutte MD, Geertsma RC (2016) Ocean acidification alters fish–
jellyfish symbiosis, Proceeding of the Royal Society B, DOI:
10.1098/rspb.2016.1146.
Oliver T, Palumbi S (2011) Do fluctuating temperature environments elevate coral
thermal tolerance? Coral Reefs, 30, 429-440.
Pennington JT, Chavez FP (2000) Seasonal fluctuations of temperature, salinity, nitrate,
chlorophyll and primary production at station H3/M1 over 1989–1996 in
Monterey Bay, California. Deep Sea Research Part II: Topical Studies in
Oceanography, 47, 947-973.
Pespeni MH, Barney BT, Palumbi SR (2013a) Differences in the regulation of growth
and biomineralization genes revealed through long‐term common‐garden
acclimation and experimental genomics in the purple sea urchin. Evolution, 67,
1901-1914.
Pespeni MH, Sanford E, Gaylord B et al. (2013b) Evolutionary change during
experimental ocean acidification. Proceedings of the National Academy of
Sciences, 110, 6937-6942.
Pommier P, Coulange M, De Haro L (2005) Systemic envenomation by jellyfish in
Guadeloupe: Irukandji-like syndrome?. Medecine Tropicale: Revue Du Corps
De Sante Colonial, 65, 367-369.
140
Portner H (2008) Ecosystem effects of ocean acidification in times of ocean warming: a
physiologist's view. Marine Ecology Progress Series, 373, 203-217.
Pörtner HO, Bock C (2000) A contribution of acid-base regulation to metabolic
depression in marine ectotherms. In: Life in the Cold. pp 443-458. Springer.
Pörtner HO, Peck LS, Hirse T (2006) Hyperoxia alleviates thermal stress in the
Antarctic bivalve, Laternula elliptica: evidence for oxygen limited thermal
tolerance. Polar Biology, 29, 688-693.
Putnam HM, Gates RD (2015) Preconditioning in the reef-building coral Pocillopora
damicornis and the potential for trans-generational acclimatization in coral
larvae under future climate change conditions. The Journal of Experimental
Biology, 218, 2365-2372.
Reipschläger A, Pörtner H-O (1996) Metabolic depression during environmental stress:
the role of extracellular versus intracellular pH in Sipunculus nudus. Journal of
Experimental Biology, 199, 1801-1807.
Sokolova IM (2013) Energy-limited tolerance to stress as a conceptual framework to
integrate the effects of multiple stressors. Integrative and Comparative Biology,
219, 1-12.
Somero GN (2005) Linking biogeography to physiology: evolutionary and acclimatory
adjustments of thermal limits. Frontiers in Zoology, 2, 1-1.
SPSS (Released 2013) IBM SPSS Statistics for Windows. Version 22.0, Armonk, NY:
IBM Corp.
Sunday JM, Calosi P, Dupont S, Munday PL, Stillman JH, Reusch TB (2014) Evolution
in an acidifying ocean. Trends in Ecology & Evolution, 29, 117-125.
Tebben J, Motti C, Siboni N et al. (2015) Chemical mediation of coral larval settlement
by crustose coralline algae. Scientific reports, 5, 10803.
Towle EK, Baker AC, Langdon C (2016) Preconditioning to high CO2 exacerbates the
response of the Caribbean branching coral Porites porites to high temperature
stress. Marine Ecology Progress Series, 546, 75-84.
Tran C, Hadfield MG (2013) Localization of sensory mechanisms utilized by coral
planulae to detect settlement cues. Invertebrate Biology, 132, 195-206.
Van Oppen MJ, Oliver JK, Putnam HM, Gates RD (2015) Building coral reef resilience
through assisted evolution. Proceedings of the National Academy of Sciences,
112, 2307-2313.
141
Verhoeven KJ, Jansen JJ, Van Dijk PJ, Biere A (2010) Stress‐induced DNA
methylation changes and their heritability in asexual dandelions. New
Phytologist, 185, 1108-1118.
Willmer P, Stone G, Johnston I (2009) Environmental physiology of animals, John
Wiley & Sons.
Wood HL, Spicer JI, Widdicombe S (2008) Ocean acidification may increase
calcification rates, but at a cost. Proceedings of the Royal Society of London B:
Biological Sciences, 275, 1767-1773.
Yoshimoto CM, Yanagihara AA (2002) Cnidarian (coelenterate) envenomations in
Hawai'i improve following heat application. Transactions of the Royal Society of
Tropical Medicine and Hygiene, 96, 300-303.
142
CHAPTER 6- GENERAL DISCUSSION
143
Synthesis of key findings
Jellyfish blooms can proliferate rapidly, directly interfere with human health or
enterprise and impart severe socio-economic effects (Richardson et al., 2009, Lucas et
al., 2014). Despite concern that jellyfish populations are increasing globally in response
to environmental change (Richardson et al., 2009, Lynam et al., 2011, Purcell, 2012),
few studies have empirically examined the effects of environmental stressors on
jellyfish. In this thesis, manipulative experiments were used to test hypotheses about the
influence of environmental stressors on jellyfish polyps (Chapters 3, 4, 5) and medusae
(Chapter 1).
Importance of studying the interactive effects of co-occurring stressors
Anthropogenic stressors rarely occur in isolation and have the potential to influence
jellyfish populations. Relatively few studies have empirically examined the potential
interactive effects of multiple stressors on jellyfish (e.g. Klein et al., 2014, AlgueróMuñiz et al., 2016). Chapter 2 assessed the interactive effects of reduced salinity and a
PSII herbicide (atrazine) on the zooxanthellate jellyfish, Cassiopea sp. during a
simulated rainfall event. Cassiopea sp. medusae exposed to high concentrations of
atrazine and reduced salinity individually exhibited negative effects, but when exposed
to reduced salinity and high concentrations of atrazine simultaneously medusae died.
Medusae that survived the pulse event, however, recovered quickly. These results
suggest that medusae can tolerate mild to moderate rainfall events but may not survive
heavy rainfall events which typically expose biota to high levels of herbicide runoff and
reduced salinity. These observations highlight the need to examine the potential
interactive effects of co-occurring stressors under environmentally relevant scenarios
and, if appropriate, examine how jellyfish may recover after episodic events as a means
of assessing how jellyfish may respond to environmental stressors on a local and
regional scale.
144
Chapter 4 compared the response of symbiotic and non-symbiotic jellyfish polyps of
Cassiopea sp. to low pH and low DO conditions that typically occur during hypoxic
events in coastal ecosystems. Exposure to hypoxia negatively affected symbiotic and
non-symbiotic polyps. Acidification, however, negatively affected only non-symbiotic
polyps. Although non-symbiotic polyps exposed to hypoxia and acidification in
combination survived, the dual stressors exacerbated the negative effects relative to
those exposed to the stressors individually. Symbiotic polyps exposed to both hypoxia
and acidification, however, responded similarly to those exposed to ambient conditions,
suggesting that the presence of symbionts mitigated the negative effects of the dual
stressors. Consequently, symbiotic polyps may still thrive when hypoxia and
acidification co-occur, however, non-symbiotic polyps may decline during hypoxic
events. Importantly, the results obtained in Chapter 2 and Chapter 4 and do not
support claims that jellyfish are robust to environmental stressors that occur on local
and regional scales.
Our understanding of how jellyfish may respond to global climate change is limited by
single stressor studies that focus on the effects of elevated temperature. Indeed, some
researchers hypothesise that ocean warming could enhance jellyfish populations
because warming generally increases rates of growth and asexual reproduction of
polyps (e.g. Widmer, 2005, Wilcox et al., 2007, Purcell et al., 2009). Chapter 3
investigated the potential interactive effects of ocean warming projections and future
UV-B radiation scenarios (both increasing and decreasing) for the yr. 2100 on polyps of
the zooxanthellate jellyfish Cassiopea sp. Under low UV-B conditions warming
enhanced rates of asexual reproduction and did not affect the photochemical efficiency
of symbionts relative to those under current conditions. However, warming reduced the
asexual reproduction of polyps and photochemical efficiency of symbionts under
current and high UV-B conditions. Indeed, if warming coincides with reduced UV-B
145
conditions then Cassiopea sp. polyps may continue to thrive, however, if warming
coincides with elevated UV-B populations are unlikely to proliferate in the future.
These results further support the observation that jellyfish are not immune to the effects
of UV-B radiation (Salonen et al., 2012) and suggestions that jellyfish may benefit from
climate change may be premature.
Ocean acidification is also occurring concurrently with ocean warming on a global
scale. Chapter 5 assessed the role of acclimation in potentially mitigating the effects of
future ocean conditions on Irukandji jellyfish polyps of A. nr mordens. Short-term preexposure to elevated temperature and low pH individually mitigated the negative effects
of future conditions on polyps. Pre-exposure to the dual stressors, however, did not
mitigate the negative effects of future conditions. Although these results suggest that
pre-exposure to warming and acidification individually could potentially facilitate the
proliferation of polyps, ocean warming and acidification are unlikely to occur in
isolation (IPCC, 2014). Collectively, the results obtained in Chapter 3 and Chapter 5
do not support claims that jellyfish polyps may thrive or benefit from climate change
(Richardson et al., 2009, Lynam et al., 2011, Purcell, 2012) and highlight the
complexity of responses of jellyfish to co-occurring climate change stressors. We,
therefore, advocate that results of single-stressors studies, particularly those of the
effects of elevated temperature, should be interpreted cautiously when predicting how
jellyfish populations may respond to future ocean conditions.
Coping with environmental stress: acclimation and mitigation
With growing awareness that climate change may affect jellyfish populations, many
manipulative experiments have exposed jellyfish to levels of climate change stressors
projected for the end-of-century to assess how jellyfish may respond in the future (e.g.
Klein et al., 2014, Lesniowski et al., 2015). Chapter 3, which tested the immediate
146
effects of warming and UV-B after a 4-day acclimation period, reported that Cassiopea
sp. polyps did not appear to acclimate to elevated UV-B and warming conditions over
37 days. It is possible, however, that jellyfish may become more robust over time. Preexposure to elevated temperature and low pH, individually but not simultaneously, may
help jellyfish polyps of A. nr. mordens to cope under future conditions (Chapter 5). To
more accurately determine how jellyfish populations may respond to environmental
stressors that occur over long time frames (e.g. climate change stressors) researchers
should consider the potential for jellyfish to acclimate when conducting manipulative
experiments.
Symbiotic jellyfish may have an ecological advantage over non-symbiotic jellyfish
under environmental stress. Symbiodinium appear to be important in mitigating the
negative effects of hypoxia and acidification on jellyfish and thus, symbiotic jellyfish
may proliferate over non-symbiotic jellyfish during hypoxic events (Chapter 4).
Symbiotic jellyfish, however, may not be robust to other co-occurring stressors such as
reduced salinity and herbicides (Chapter 2) that coincidentally, also occur when runoff
from heavily impacted coastlines enters coastal waters (Islam & Tanaka, 2004). Nonsymbiotic jellyfish may, therefore, be more robust when exposed to environmental
stressors that directly affect photosynthesis of their symbionts. Chapter 2, however, did
not examine the potential negative effects of reduced salinity and PSII herbicides on
non-symbiotic jellyfish. Indeed, herbicides (Kawano et al., 2005) and other chemical
pollutants (Sánchez-Bayo, 2012, Stanley & Preetha, 2016) may affect non-target
organisms that are non-photosynthetic. To more accurately predict how jellyfish, as a
group, may respond to changing ocean conditions we must consider the role of
symbionts in potentially mitigating (or exacerbating) the negative effects of
environmental stressors on jellyfish and consider how symbiotic and non-symbiotic
jellyfish may respond differently to co-occurring environmental stressors.
147
Future directions for research
Our understanding of how jellyfish populations may respond to environmental stressors
is hindered by manipulative experiments that do not accurately mimic conditions that
jellyfish are exposed to in the natural environment. The experiments conducted in
Chapters 2, 3, 4 and 5 aimed to accurately mimic conditions that biota experience in
the natural environment by incorporating environmentally relevant levels of cooccurring stressors and, where appropriate, exposing biota to diel changes. Most studies
that investigate the effects of environmental stressors on jellyfish expose biota to
constant levels of stressors (e.g. Shoji et al., 2005b, Algueró-Muñiz et al., 2016). In the
natural environment, however, biota are often exposed to diel fluctuations of
environmental stressors (such as DO, pH and UV-B irradiance). As an example, most
studies of the effects of UV-B radiation on marine species investigate the effects of
constant levels UV-B irradiance (e.g. Lesser, 1996, Fischer & Phillips, 2014). In the
natural environment, however, UV-B fluctuates throughout the day (Helmuth et al.,
2002). It is still not clear, however, whether experiments that expose jellyfish to
constant levels of stressors yield different results to those that expose jellyfish to diel
fluctuations of stressors. Although studies that investigate the effects of diel variation of
stressors on jellyfish are limited, studies conducted on other marine organisms
demonstrate that diel fluctuations can impart effects that differ from those when biota
are exposed to constant levels of stressors (e.g. Frieder et al., 2014, Clark, 2015). For
example, juvenile bivalves exposed to diel fluctuations of low DO and low pH had
higher rates of mortality than those exposed to constant levels of the stressors (Clark,
2015). Accurately predicting how jellyfish populations respond to environmental
stressors in the natural environment, therefore, requires investigation into whether
different methods used to manipulate levels of environmental stressors (i.e. constant vs.
variable) may change the response of jellyfish in manipulative experiments.
148
Marine organisms may acclimate to environmental stress within (e.g. Brown et al.,
2002, Bellantuono et al., 2011) and across sexual generations (e.g. Donelson et al.,
2012, Miller et al., 2012). Although pre-exposure to warming and acidification in
combination did not allow polyps of A. nr mordens to acclimate to future ocean
conditions (Chapter 5), it is possible that trans-generational acclimation could be
important in persistence of jellyfish populations in the face of climate change. Although
the role of trans-generational acclimation has not yet been investigated in jellyfish
(probably because of the difficulty involved in culturing multiple generations), several
studies of other marine organisms have demonstrated that parental pre-exposure to
climate change stressors can help offspring acclimate to future conditions (e.g. Munday,
2014, Putnam & Gates, 2015). For example, preconditioning of adult reef-building
coral P. damicornis to warming and acidification conditions improved the metabolic
acclimation of their brooded larvae when exposed to future conditions (Putnam &
Gates, 2015). To more accurately determine how jellyfish may respond to changing
ocean conditions we must now investigate the potential for jellyfish to acclimate to
other environmental stressors and determine whether trans-generational acclimation
could facilitate jellyfish populations.
Research chapters within this thesis examined the influence of environmental stressors
on individual jellyfish species. There is now ample evidence, however, that
environmental stressors impact ecological interactions between marine species (Walther
et al., 2002, Rosenblatt & Schmitz, 2014). The degree to which manipulative
experiments, such as those undertaken here, accurately predict how jellyfish may
respond under environmental stress may, therefore, depend on ecological interactions
between jellyfish and other biota. As an example, hypoxia is hypothesised to facilitate
the proliferation of jellyfish populations (Purcell et al., 2007) because jellyfish can be
more tolerant of hypoxia (<2.0mgO2L-1) than other metazoans such as fish (<4.0mgO2L1
) (Shoji et al., 2005a). Few manipulative experiments, however, have examined the
149
effects of hypoxia on jellyfish and possible interactions with other organisms (but see,
Decker et al., 2004, Shoji et al., 2005b). Only by understanding the effects of
environmental stressors on ecological interactions between jellyfish and other biota, is it
possible to obtain a realistic understanding of how jellyfish populations will respond to
environmental change.
Most studies of the effects of environmental stressors on jellyfish have focused on
species of the genera Aurelia and Mnemiopsis (Pitt et al., in review), both of which are
considered as common and sometimes problematic (Dong et al., 2010, Thein et al.,
2012). Common jellyfish species may be particularly robust to environmental stressors
and share behavioural and physiological traits that allow them to persist. For example,
elevated pCO2 conditions (800ppm) did not affect the growth of polyps of two common
scyphozoan species, Cyanea capillata and Chrysaora hysoscella (Lesniowski et al.,
2015). Other less common species, however, may not share these traits and respond
differently under environmental stress. For example, Irukandji jellyfish polyps of
Alatina nr mordens exposed to elevated pCO2 conditions (pH 7.6) exhibited lower rates
of asexual reproduction than those exposed to ambient pCO2 conditions (pH 7.9) (Klein
et al., 2014). These observations highlight that we need to consider that although some
species of jellyfish may be robust to environmental stressors, others may respond
negatively and robust evidence for the role of environmental stressors in the facilitation
of all jellyfish populations is limited.
Conclusions
This thesis examined the response of jellyfish to the interactive effects of co-occurring
stressors that occur on local, regional and global scales, investigated the role of
symbionts in potentially mitigating the negative effects of stressors on jellyfish and
tested ability of jellyfish to acclimate to climate change. Importantly, the results
150
obtained in this thesis do not support claims that jellyfish benefit from environmental
stress. Although warming ocean temperatures are hypothesised to facilitate jellyfish
populations in the future, other stressors that co-occur on global and local scales have
the potential to interact and potentially mitigate the positive effects of warming on
jellyfish. Symbionts may be important in the proliferation of jellyfish populations and
these findings highlight that symbiotic and non-symbiotic jellyfish may respond
differently under changing ocean conditions. Pre-exposure to climate change stressors
individually may allow jellyfish to acclimate over short time-scales, however, jellyfish
are unlikely to acclimate in response to dual climate change stressors. These findings
demonstrate that not all jellyfish species are robust to co-occurring environmental
stressors and suggest that symbionts and acclimation may be important in the
persistence of jellyfish under changing environmental conditions.
151
REFERENCE LIST
Algueró-Muñiz M, Meunier CL, Holst S, Alvarez-Fernandez S, Boersma M (2016)
Withstanding multiple stressors: ephyrae of the moon jellyfish (Aurelia aurita,
Scyphozoa) in a high-temperature, high-CO2 and low-oxygen environment.
Marine Biology, 163, 185.
Bellantuono AJ, Hoegh-Guldberg O, Rodriguez-Lanetty M (2011) Resistance to
thermal stress in corals without changes in symbiont composition. Proceedings
of the Royal Society of London B: Biological Sciences, rspb20111780.
Brown B, Dunne R, Goodson M, Douglas A (2002) Experience shapes the susceptibility
of a reef coral to bleaching. Coral reefs, 21, 119-126.
Clark HR (2015) Response of early life stage bivalves to diurnal changes in carbon
dioxide and dissolved oxygen concentrations, State University of New York at
Stony Brook.
Decker MB, Breitburg D, Purcell JE (2004) Effects of low dissolved oxygen on
zooplankton predation by the ctenophore Mnemiopsis leidyi. Marine Ecology
Progress Series, 280, 163-172.
Donelson J, Munday P, McCormick M, Pitcher C (2012) Rapid transgenerational
acclimation of a tropical reef fish to climate change. Nature Climate Change, 2,
30-32.
Dong Z, Liu D, Keesing JK (2010) Jellyfish blooms in China: dominant species, causes
and consequences. Marine Pollution Bulletin, 60, 954-963.
Fischer J, Phillips NE (2014) Carry-over effects of multiple stressors on benthic
embryos are mediated by larval exposure to elevated UV-B and temperature.
Global Change Biology, 20, 2108-2116.
Frieder CA, Gonzalez JP, Bockmon EE, Navarro MO, Levin LA (2014) Can variable
pH and low oxygen moderate ocean acidification outcomes for mussel larvae?
Global Change Biology, 20, 754-764.
Helmuth B, Harley CD, Halpin PM, O'donnell M, Hofmann GE, Blanchette CA (2002)
Climate change and latitudinal patterns of intertidal thermal stress. Science, 298,
1015-1017.
152
IPCC (2014) Climate Change 2014: Synthesis Report. Contribution of Working Groups
I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on
Climate Change.
Islam S, Tanaka M (2004) Impacts of pollution on coastal and marine ecosystems
including coastal and marine fisheries and approach for management: a review
and synthesis. Marine Pollution Bulletin, 48, 624-649.
Kawano T, Kosaka T, Hosoya H (2005) Impact of a sulfonylureic herbicide on growth
of photosynthetic and non-photosynthetic protozoa. In: Environmental
Chemistry. pp 495-504. Springer.
Klein SG, Pitt KA, Rathjen KA, Seymour JE (2014) Irukandji jellyfish polyps exhibit
tolerance to interacting climate change stressors. Global Change Biology, 20,
28-37.
Lesniowski TJ, Gambill M, Holst S et al. (2015) Effects of food and CO2 on growth
dynamics of polyps of two scyphozoan species (Cyanea capillata and
Chrysaora hysoscella). Marine Biology, 162, 1371-1382.
Lesser MP (1996) Elevated temperatures and ultraviolet radiation cause oxidative stress
and inhibit photosynthesis in symbiotic dinoflagellates. Limnology and
Oceanography, 41, 271-283.
Lucas CH, Gelcich S, Uye S-I (2014) Living with Jellyfish: Management and
Adaptation Strategies. In: Jellyfish Blooms. pp 129-150. Springer.
Lynam C, Lilley M, Bastian T, Doyle T, Beggs S, Hays G (2011) Have jellyfish in the
Irish Sea benefited from climate change and overfishing? Global Change
Biology, 17, 767-782.
Miller GM, Watson S-A, Donelson JM, McCormick MI, Munday PL (2012) Parental
environment mediates impacts of increased carbon dioxide on a coral reef fish.
Nature Climate Change, 2, 858-861.
Munday PL (2014) Transgenerational acclimation of fishes to climate change and ocean
acidification. F1000Prime Reports, 6, 99.
Pitt KA, Lucas C, Condon R, Duarte C (2016) How robust is the evidence that
anthropogenic stressors cause jellyfish blooms? (in review).
Purcell JE (2012) Jellyfish and Ctenophore Blooms Coincide with Human Proliferations
and Environmental Perturbations. Annual Review of Marine Science, 4, 209-235.
153
Purcell JE, Hoover RA, Schwarck NT (2009) Interannual variation of strobilation by the
scyphozoan Aurelia labiata in relation to polyp density, temperature, salinity,
and light conditions in situ. Marine Ecology Progress Series, 375, 139-149.
Purcell JE, Uye S, Lo W (2007) Anthropogenic causes of jellyfish blooms and their
direct consequences for humans: a review. Marine Ecology Progress Series,
350, 153-174.
Putnam HM, Gates RD (2015) Preconditioning in the reef-building coral Pocillopora
damicornis and the potential for trans-generational acclimatization in coral
larvae under future climate change conditions. The Journal of Experimental
Biology, 218, 2365-2372.
Richardson AJ, Bakun A, Hays GC, Gibbons MJ (2009) The jellyfish joyride: causes,
consequences and management responses to a more gelatinous future. Trends in
ecology & evolution, 24, 312-322.
Rosenblatt AE, Schmitz OJ (2014) Interactive effects of multiple climate change
variables on trophic interactions: a meta-analysis. Climate Change Responses, 1,
1.
Salonen K, Högmander P, Langenberg V, Mölsä H, Sarvala J, Tarvainen A, Tiirola M
(2012) Limnocnida tanganyicae medusae (Cnidaria: Hydrozoa): a
semiautonomous microcosm in the food web of Lake Tanganyika.
Hydrobiologia, 690, 97-112.
Sánchez-Bayo F (2012) Insecticides mode of action in relation to their toxicity to nontarget organisms. J Environ Anal Toxicol S, 4, 2161-0525.
Shoji J, Masuda R, Yamashita Y, Tanaka M (2005a) Effect of low dissolved oxygen
concentrations on behavior and predation rates on red sea bream Pagrus major
larvae by the jellyfish Aurelia aurita and by juvenile Spanish mackerel
Scomberomorus niphonius. Marine Biology, 147, 863-868.
Shoji J, Masuda R, Yamashita Y, Tanaka M (2005b) Predation on fish larvae by moon
jellyfish Aurelia aurita under low dissolved oxygen concentrations. Fisheries
Science, 71, 748-753.
Stanley J, Preetha G (2016) Pesticide Toxicity to Non-target Organisms: Exposure,
Toxicity and Risk Assessment Methodologies, Springer.
Thein H, Ikeda H, Uye S-I (2012) The potential role of podocysts in perpetuation of the
common jellyfish Aurelia aurita (Cnidaria: Scyphozoa) in anthropogenically
perturbed coastal waters. Hydrobiologia, 690, 157-167.
154
Walther GR, Post E, Convey P et al. (2002) Ecological responses to recent climate
change. Nature, 416, 389-395.
Widmer CL (2005) Effects of temperature on growth of north-east Pacific moon
jellyfish ephyrae, Aurelia labiata (Cnidaria: Scyphozoa). Journal of the Marine
Biological Association of the United Kingdom, 85, 569-573
Wilcox ST, Moltschaniwskyj NA, Crawford CM (2007) Asexual reproduction in
scyphistomae of Aurelia sp.: Effects of temperature and salinity in an
experimental study. Journal of Experimental Marine Biology and Ecology, 353,
107-114.
155
APPENDIX
156
APPENDIX (CHAPTER 3)
Fig. S1 Field measurements of UV-B radiation (Wm-2) and temperature (ºC) recorded
on the 9th January, 2015 at Saltwater Creek, southeast Queensland (SEQ), Australia (27.90ºS, 153.37ºE).
157
APPENDIX (CHAPTER 4)
Figure A4.1 Mean (±1SE) pH and DO measurements taken in (a) ambient treatments
(b) low pH and DO treatments taken at hourly intervals throughout the day.
Figure A4.1 Mean (±1SE) pH and DO measurements taken in (a) ambient treatments
(b) low pH and DO treatments taken at hourly intervals throughout the day.
158
Table A4.1 Full factorial results of a LMMs analysis comparing day and night pH
microelectrode measurements between treatments at Day 22 of the experiment. The
model-of-best-fit was AR(1), BIC (Bayesian Information Criterion) = -1045.115, AIC
(Akaike’s Information Criterion) = -1056.104. Df= Degrees of freedom. P values in
bold are statistically significant (P < 0.05).
Source
Day/ Night
Symbiont
Oxygen
pH
Day/ Night × Symbiont
Day/ Night × Oxygen
Day/ Night × pH
Symbiont × Oxygen
Symbiont × pH
Oxygen × pH
Day/ Night × Symbiont × Oxygen
Day/ Night × Symbiont × pH
Day/ Night × Oxygen × pH
Symbiont × Oxygen × PH
Day/ Night × Symbiont × Oxygen × pH
Distance
Day/ Night × Distance
Symbiont × Distance
Oxygen × Distance
pH × Distance
Day/ Night × Symbiont × Distance
Day/ Night × Oxygen × Distance
Day/ Night × pH × Distance
Symbiont × Oxygen × Distance
Symbiont × pH × Distance
Oxygen × pH × Distance
Day/ Night × Symbiont × Oxygen ×
Distance
Day/ Night × Symbiont × pH × Distance
Day/ Night × Oxygen × pH × Distance
Symbiont × Oxygen × pH × Distance
Day/ Night × Symbiont × Oxygen × pH ×
Distance
Numerator
df
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
5
5
5
5
5
5
5
5
5
5
5
5
Denominator
df
47.916
47.916
47.916
47.916
47.916
47.916
47.916
47.916
47.916
47.916
47.916
47.916
47.916
47.916
47.916
145.035
145.035
145.035
145.035
145.035
145.035
145.035
145.035
145.035
145.035
145.035
145.035
F
Sig.
192.545
74.747
0.394
2366.626
61.419
1.349
4.812
0.510
10.856
1.013
0.013
6.528
0.668
0.054
0.124
70.592
29.885
53.912
1.079
17.608
49.310
0.662
19.436
0.926
8.137
1.602
0.291
<0.001
<0.001
0.533
<0.001
<0.001
0.251
0.033
0.479
0.002
0.319
0.911
0.014
0.418
0.817
0.726
<0.001
<0.001
<0.001
0.374
<0.001
<0.001
0.653
<0.001
0.466
<0.001
0.163
0.917
5
5
5
5
145.035
145.035
145.035
145.035
6.370
1.314
0.974
0.310
<0.001
0.261
0.436
0.906
159
Table A4.2 Internal transcribed spacer 2 (ITS2) sequences used to genotype
Symbiodinium cells in Cassiopea sp. polyps in this study. Note: only the sequences
retrieved by this study with 100% query coverage to previously described
Symbiodinium genotypes have been deposited in NCBI genbank.
pH treatment
DO treatment
Sequence length (bp)
Accession
(Genbank)
Symbiodinium Sub-type
Low pH
Control
291
KX533944
C1
Low pH
Control
291
KX533945
C1
Low pH
Control
291
KX533946
C1
Low pH
Control
301
KX533947
C1
Control
Low DO
302
KX533948
C1
Control
Low DO
291
KX533949
C1
Control
Low DO
291
KX533950
C1
Control
Low DO
302
KX533951
C1
Low pH
Low DO
291
KX533952
C1
Low pH
Low DO
291
KX533953
C1
Low pH
Low DO
291
KX533954
C1
160
APPENDIX (CHAPTER 5)
Figure A5.1 Mean (±1SE) pH taken in (a) ambient pH treatments (b) low pH treatments
taken at hourly intervals throughout the day.
161