Annals of Human Biology, May–June 2006; 33(3): 319–329 ORIGINAL ARTICLE Haplotype structure of five SNPs within the ACE gene in the Tunisian population MAHA REBAÏ, NAJLA KHARRAT, IMEN AYADI, & AHMED REBAÏ Bioinformatics Unit, Centre of Biotechnology of Sfax, Sfax, Tunisia (Received 24 November 2005; revised 2 January 2006; accepted 23 January 2006) Abstract Background: The Angiotensin-Converting Enzyme (ACE) is a candidate gene in the aetiology of several common diseases. The study of the haplotype structure of this gene is of interest in diagnosis and in pharmacogenomics. Aim: The study investigated the haplotype profile of single nucleotide polymorphisms (SNPs) within the ACE gene in the Tunisian population and compared it with other populations. Subjects and methods: Five SNPs (rs1800764, rs4291, rs4309, rs4331, rs4340) covering a region of 15.6 kb of the ACE gene were typed by PCR-digestion in a sample of 100 healthy subjects. Results: All SNPs were polymorphic and in Hardy–Weinberg equilibrium. A total of 21 haplotypes were identified but only eight had a frequency of more than 1%. The four most common haplotypes had a cumulative frequency of 87.4%. The ‘Yin–Yang’ phenomenon (the two major haplotypes are complementary at all sites) was found. Linkage disequilibrium between all pairs of loci was highly significant (p<105). A simple and efficient statistical procedure was used to identify three important SNPs. Conclusion: The Tunisian population showed a different haplotype structure from the European one for the ACE gene and three important SNPs were identified. These will be very helpful in future association studies in the Tunisian and North African populations. Keywords: ACE, SNP, Tunisian, haplotype, linkage disequilibrium Introduction The analysis of haplotypes for multiple single nucleotide polymorphisms (SNPs) in a gene or a region of interest is a fundamental step in the process of identification of DNA variants underlying complex inherited diseases. With the availability of the whole sequence of the human genome, with more than 10 millions SNPs, and the near-completion of the HapMap project (International HapMap Consortium 2003, 2005a), it is now possible to target Correspondence: Ahmed Reba€ı, E-mail: [email protected] Centre of Biotechnology of ISSN 0301–4460 print/ISSN 1464–5033 online ß 2006 Informa UK Ltd. DOI: 10.1080/03014460600621977 Sfax, PO Box ‘K’, 3038 Sfax, Tunisia. 320 M. Reba€ı et al. association studies by choosing the most appropriate SNPs based on their polymorphism features, position within the gene or region of interest and linkage disequilibrium among them. The HapMap project, started in 2002 has the objective to provide by 2006, a full haplotype map of the human genome including 3.5 million SNPs in four populations of African, European and Asiatic origin (Schmidt 2005). This will provide useful information for geneticists and medical geneticists who are interested in identifying haplotypes associated with particular forms of common diseases or drug response and will open the door for a personalized approach of medicine. One of the major objectives of haplotype studies is to find haplotype tagging SNPs (Johnson et al. 2001), which are SNPs that best represent a gene or region of interest. Finding such SNPs (denoted tagSNP or tSNP and sometimes htSNP) will result in a considerable saving of time and money in genotyping for association and pharmacogenomics studies (Allen-Brady and Camp 2005; Camp et al. 2005). The Angiotensin-Converting Enzyme (ACE) or kininase II (EC 3.4.15.1, MIM 106180) catalyses the conversion of the angiotensin I to the physiologically active peptide angiotensin II, which controls fluid–electrolyte balance and systemic blood pressure. A large number of physiological, pharmacological and genetic studies have shown the importance of ACE and its inhibition in the pathogenesis and treatment of a variety of cardiovascular and associated diseases (see Niu et al. 2002 and Scharplatz et al. 2004 for good reviews). Particularly, DNA variants within the ACE gene were shown to be involved in the aetiology of several common diseases and in the therapeutic response to several drugs (see the Genetic Association Database at http://geneticassociationdb.nih.gov for a large list of references; National Center for Biotechnology Information 2005b). The ACE gene maps to 17q23 region extending over 45 kb genomic size. The two most abundant RNA variants of this gene encode two isozymes, the somatic form and the testicular form that are equally active. The somatic variant is a transcript of 25 exons (exons 1–25 and corresponding to 20 kb genomic size) while the testicular variant includes an alternate in-frame exon in the 50 coding region and results in a different N-terminal part of the protein. The ACE gene has 243 SNPs in the human SNP database (dbSNP, http:// www.ncbi.nlm.nih.gov/SNP, National Center for Biotechnology Information 2005a) build 124 among which 127 are validated. Among these, 50 SNPs within the coding region or in close proximity to the ACE gene were typed in the HapMap project, most of them (37 SNPs) are located in the 50 part of the gene (corresponding to the part coding for the somatic variant). At the current status of the HapMap project (HapMap web site, http:// www.hapmap.org; International HapMap Consortium 2005b), 28 of these 50 SNPs showed no polymorphism in all studied populations. Keavney et al. (1998) studied the haplotype structure of 10 SNPs within the ACE gene in the European (British) population. Zhu et al. (2000) genotyped seven SNPs in the 30 end of ACE in Afro-Caribbean subjects and evaluated the linkage disequilibrium between them, while Zhu et al. (2001) studied the association between 13 SNPs within the ACE gene with the plasma ACE concentration and blood pressure in a Nigerian population sample. However, several recent studies on linkage disequilibrium structure and haplotype distribution of SNPs in different populations have shown that results in this field have limited transferability from one population to another (Nejentsev et al. 2004; Mueller et al. 2005). Here we report the results of haplotype analysis with five SNPs in the ACE gene in a sample of 100 controls from the Tunisian population. Comparison with other populations 321 Haplotype structure of ACE gene SNPs in Tunisia revealed different features in haplotype structure. Based on linkage disequilibrium among markers, three SNPs were retained as being the most important. Materials and methods Subjects A sample of 100 healthy unrelated subjects from southern Tunisia (Sfax region) was recruited for this study. These were chosen randomly from a larger sample of volunteers having given informed consent and blood samples. There were 50 males and 50 females with a mean age of 39 years. Isolation of genomic DNA from peripheral blood Genomic DNA from the blood sample was extracted using a standard phenol–chloroform protocol and was stored at 20 C for SNP genotyping. Genotyping of SNPs The five SNPs typed on controls were chosen from the dbSNP build 121 (2004) according to the following conditions: the average distance between SNPs is 5 kb, and the frequency of the minor allele is more than 5%. We looked preferably for SNPs located in coding and regulatory regions of the somatic isoform. To allow comparison with other populations, we used a subset of SNPs from the study of Keavney et al. (1998) and Zhu et al. (2001). Names, features and positions of the SNPs relative to the gene are given in Table I and Figure 1. The ACE ID (insertion/deletion) polymorphism and four biallelic SNPs were typed by PCR amplification followed by restriction-enzyme digestion. The PCR reactions were performed using a GenAmp PCR system 9600 thermocycler (Perkin–Elmer). PCR products Table I. Features of the five ACE SNPs and primer sequences and enzymes used for their genotyping. SNP Accession number Type Position (bp) ACE3 rs1800764 T/C 3905 ACE4 rs4291 A/T 240 ACE6 rs4309 C/T 5489 ACE7 rs4331 A/G 9618 ACE ID rs4340 I/D 11 698 Primer sequence F: 50 ATAGTGTATATAGGGCTTGGTAC30 R: 50 AGAAGATATTTGCAAAGTATGTACTG30 F: 50 ACCATGGCCTGGTGAAGAAGC30 R: 50 CGGCTCTGCCCCTTCTCCTGCGC3 Fint: 50 TGTCACTCCGGAGGCGGGAGGCT30 Rint: 50 GAGAAAGGGCCTCCTCTCTCT30 F: 50 AGTGCACACGGGTCACGATG30 R: 50 CCCCCCGACGCAGGGAGCC30 F: 50 CACACCCTGAAGTACGGCAC30 R: 50 TCCTCCAGCTCCTGGGCAG30 F: 50 CTGGAGACCACTCCCATCCTTTCT30 R: 50 GATGTGGCCATCACATTGGTCAGAT30 Fv: 50 TGGGACCACAGCGCCCGCCACTAC30 Rv: 50 TCGCCAGCCCTCCCATGCCCATAA30 Restriction enzyme PstI XbaI MspI HaeII Position relative to the first base position of the first exon of the gene. For ACE4, Fint and Rint are internal primers used in nested PCR and for ACE ID Fv and Rv are primers used in homozygotes D/D validation. 322 M. Reba€ı et al. ACE3 271 +1 −3900 ACE 7 ACE6 ACE 4 −240 Exon1 5394 5617 5489 Exon 8 9485 ACE ID 9643 9914 10001 11689 9618 Exon 15 Exon 16 SNP within 5’UTR Exonic SNP Intronic SNP Figure 1. Positions of the studied SNPs within the ACE gene (The colour version of this figure is included in the online version of the journal). were digested with the appropriate enzyme (Table I) and were run on acrylamide gels (10%) stained with ethidium bromide, and scored by UV visualization. The SNPs ACE3, ACE4, ACE7 were amplified using the conditions described by Zhu et al. (2001) while the SNP ACE6 was amplified following the conditions of Keavney et al. (1998). For the ACE ID, no digestion is needed but the PCR was carried out in two steps; first PCR was performed with the primers from Keavney et al. (1998). Since the preferential amplification of the D allele (190 bp) over the I allele (490 bp) have been reported with these primers (Lindpaintner et al. 1995), a second PCR was performed on putative homozygous individuals, i.e. those having a single D band in first PCR (which may actually be either D/D homozygotes or I/D heterozygotes). This second PCR uses the primers from Yoshida et al. (1995) and gives a PCR product of 335 bp only when the I allele is present, thus allowing us to distinguish I/D from D/D individuals. Positive and negative controls were used in all PCR and digestion reactions in order to check for the correct amplification and restriction of the products. Statistical analysis The estimation of allele frequency and exact test for Hardy–Weinberg equilibrium was performed using the Genetic Data Analyses (GDA) program (version 1.1) (Weir 1996). Inference of haplotypes and their frequencies from genotype data was performed using the PHASE program (version 2.0.2) (Stephens et al. 2001; Stephens and Donnelly 2003). Three measures of linkage disequilibrium (LD) between SNPs were then computed from controls in order to study the LD structure of the gene: gametic disequilibrium from inferred haplotypes, composite LD from genotype data (Weir 1996) and three-locus LD from estimated haplotype frequencies based on the Bennett (1954) coefficient. These measures were standardized as correlation coefficients (r2) so that Nr2 provides a 2 test of LD. The Haploxt (Abecasis and Cookson 2000) program was used to estimate the LD between pairs of loci from inferred haplotypes. We calculated composite LD using the GDA program (Weir 1996). Three locus composite LD were calculated using an Excel worksheet implementing the formula of Bennett’s coefficient provided by Weir (1996). We defined a block of LD as a subset of SNPs where three to five haplotypes represent 75–90% of the observed haplotypes in the population (Patil et al. 2001). The determination of key SNPs was performed using an implementation in R language of the method of Lin and Altman (2004). Haplotype frequencies between samples were compared using exact test of population stratification in GENPOP (Raymond and Rousset 1995). 323 Haplotype structure of ACE gene SNPs in Tunisia Results and discussion Distribution of allelic frequencies The allele frequencies of the five SNPs are given in Table II. No significant deviation from Hardy–Weinberg equilibrium was found for any of the SNPs and all of them have a good information content (observed heterozygosities close to 0.5, the maximal value). The markers ACE3, ACE4 and ACE ID were the most informative. In dbSNP, only the allelic frequencies of the SNPs ACE6 and ACE7 were available (0.607 and 0.499 for C and A alleles, respectively). These values are significantly different from those estimated in our sample (p < 0.005). In the HapMap project, only data for the SNP ACE6 were available for European, Chinese, Japanese and Nigerian population samples. Frequencies of C allele in these four populations are given in Table III. We see that the frequency in our population is significantly different from all other populations (all p < 0.001), being midway between the frequencies in European and African populations. Note also that the heterozygosity in our population is midway between those of African and European samples of the HapMap project. Haplotypes analysis Twenty one haplotypes were inferred but only eight have a frequency greater than 1% (Table IV). Cumulative frequency of these eight haplotypes was 90%. The four first Table II. Allelic frequencies of the five SNPs in a sample of 100 controls from the Tunisian population. SNP ACE3 ACE4 ACE6 ACE7 ACE ID Frequency Observed H Expected H p-value of HWE C: 0.57; T: 0.43 A: 0.66; T: 0.34 C: 0.75; T: 0.25 A: 0.695; G: 0.305 I: 0.325; D: 0.675 0.440 0.460 0.340 0.390 0.450 0.493 0.451 0.377 0.426 0.441 0.21 0.97 0.21 0.27 0.96 H, Heterozygosity. Observed H is the ratio of number of heterozygotes to total number of individuals. Expected H is calculated as one minus sum of squares of allele frequencies. HWE, Hardy–Weinberg equilibrium. Exact p-values for HWE were calculated using the permutation procedure in GDA (Weir 1996). Table III. Frequency of the C allele of the SNP ACE6 according to the HapMap project and comparison with the present study. Population Chinese Japanese European Present study Nigerian n Frequency H (%) 2 test p-value 45 0.244 44.4 65.74 <106 43 0.488 55.8 18.66 1.6 105 60 0.542 41.7 14.77 1.2 104 100 0.75 34.0 – – 60 0.917 13.3 18.56 2.2 104 n is the number of individuals genotyped, H is the observed heterozygosity in % and 2 test is the Chi-square test for comparison of allele frequency in that population to allele frequency in the population in the present study. 324 M. Reba€ı et al. Table IV. Haplotype frequencies of five SNPs in Tunisian and British population samples. Haplotypes CTCAD TATGI CACAD TACAD CTCGI TACAI TACGI CACAI Present study (n ¼ 100) Keavney et al. (1998) study (n ¼ 555) 2 test p-value 0.295 0.227 0.201 0.151 0.033 0.022 0.019 0.011 0.298 0.360 0.076 0.095 0.008 0.005 0.050 0.003 0.01 13.84 30.57 5.63 10.16 7.81 3.60 2.37 0.93 0.0002 <106 0.017 0.0014 0.0051 0.057 0.123 2 test is the Chi-square test for comparison of haplotype frequency between the present study and that of Keavney et al. (1998). haplotypes (CTCAD, TATGI, CACAD, TACAD) are the most frequent and represent 87.4% of the haplotypes, suggesting that the five SNPs belong to a single block of LD. The two most frequent haplotypes, CTCAD and TATGI, complement each other at all sites. This phenomenon, known as ‘Ying–Yang haplotypes’, has been reported by Zhang et al. (2003) for many genes in the human genome and seems to be a general characteristic of eukaryotic genomes. According to the estimation of these authors, this phenomenon would be present in 75–85% of the human genomic regions. The Ying–Yang phenomenon was also observed in the ACE gene in the study of Keavney et al. (1998) for the 10 SNPs studied. We have recomputed haplotype frequencies for the five SNPs studied here, from the data of Keavney et al. (1998) on 10 SNPs. We noticed that the number of the observed haplotypes in our population (21 haplotypes) is larger than that found in the study of Keavney et al. (19 haplotypes). Fourteen haplotypes were common to both studies. It can be seen from Table IV that the order of the four most frequent haplotypes is different in the two studies. The most discordant haplotypes among those that are common are TATGI (14% more frequent in the British population) and CACAD (12.5% more frequent in our population), which are complementary for all SNPs except ACE4. Exact test of population differentiation based on haplotype counts revealed a significant difference in haplotype structure of the two populations (p ¼ 0.006). Haplotype diversities (calculated as one minus the sum of squares of haplotype frequencies) were, respectively, 0.7992 0.0085 (standard error) and 0.7672 0.0057, indicating that diversity is significantly larger in our population. Many studies have, in fact, reported a greater genetic diversity among the old African population than among Europeans (Gabriel et al. 2002). Due to its special geographic location in the Mediterranean basin, Tunisia, whose indigenous inhabitants were African Berbers, has been subject, during its recent history (from 814 BC to 1830), to many conquests by several populations, including Phoenicians, Romans, Arabs, Vandals and Ottomans (Julien 2003). This may have resulted in a particular genetic composition, in between African and Caucasian populations. Linkage disequilibrium analysis Table V gives the r2 measures of pairwise LD (haplotypic and composite). Significant LD was found for all SNP pairs. All p-values of 2 test were <0.0001. The strongest LD was Haplotype structure of ACE gene SNPs in Tunisia 325 Table V. Gametic and composite linkage disequilibrium r2 coefficients between five SNPs. SNP Gametic r2 Composite r2 0.389 0.354 0.320 0.366 0.134 0.114 0.132 0.675 0.575 0.783 0.417 0.379 0.303 0.315 0.201 0.134 0.140 0.706 0.599 0.785 ACE3–ACE4 ACE3–ACE6 ACE3–ACE7 ACE3–ACE ID ACE4–ACE6 ACE4–ACE7 ACE4–ACE ID ACE6–ACE7 ACE6–ACE ID ACE7–ACE ID See text for definition of r2 coefficients. 1 0.9 rs= −0.5 0.8 Haplotypic LD 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 0 2000 4000 6000 8000 10000 12000 14000 16000 Physical distance (bases) Figure 2. Relation between linkage disequilibrium and physical distance for the SNPs studied. observed between SNPs ACE7 and ACE ID (r2 ¼ 0.783). The correlation between haplotypic and composite r2 values is very high (r ¼ 0.99, p < 0.001). This correlation provides a measure of the precision of haplotype inference. In Figure 2 we plotted haplotypic LD measure r2 against physical distance. The relation between these two measures is non-linear. Spearman rank correlation was rs ¼ 0.50, indicating that physical distance explains only 50% of the LD variation between loci. In particular, a strong LD is observed between two distant loci (ACE6 and ACE ID) whereas a weak LD is observed between two close loci (ACE3 and ACE4). This relation is similar to that found in genome-wide studies; for example, Abecasis et al. (2001) reported a correlation of rs ¼ 0.49 from LD data between 127 SNPs in three genomic regions. Fitting a polynomial quadratic model to our data allows us to predict that useful LD (r2 > 0.1) will exist on average between loci that are 8 kb apart in the ACE gene region. We also calculated the LD between three adjacent loci based on the Bennett (1954) coefficient. Among the combinations tested, only the SNPs ACE6–ACE7–ACE ID showed 326 M. Reba€ı et al. a significant LD ( p ¼ 0.011), suggesting that those markers constitute a block of LD. In fact, LD between three loci is rarely found in the human genome; a 5 kb region on chromosome 12 is the only genome region that has been reported to harbour loci with high three-point LD (Meng et al. 2003). Identification of key SNP In order to find the most important SNP among the five studied, we first calculated the number of representative SNP based on the formula of Nyholt (2004): Neff ¼ 1 þ ðL 1Þð1 VarðÞ=LÞ where L is the total number of SNP and Var() is the variance of eigenvalues of the matrix of pairwise LD coefficients. We found Neff ¼ 3.4, indicating that three SNPs among the five studied might be enough to represent the gene region studied. In order to identify the three most representative SNPs we used the method Lin and Altman (2004), which eliminates one by one the least informative SNPs, i.e. those SNPs that are associated (after varimax rotation) with the eigenvectors having the smallest eigenvalues of the LD matrix. The two least important eigenvectors have eigenvalues of 0.01 and 0.22 and are, respectively, associated with ACE7 and ACE6 SNPs. The key SNPs that are identified by this approach are thus ACE3, ACE4 and ACE ID. It is appealing that the two SNPs removed are those located in coding exons (but are non-synonymous) of the gene while two of the three kept are located in the 50 regulatory region. ACE ID polymorphism, located in the middle of the gene (intron 16), is known as being one of the most important markers of the ACE gene. Many studies have associated this polymorphism with the levels of circulating enzyme or cardiovascular pathophysiologies (see the Genetic Association Database web site, http://geneticassociationdb.nih.gov). The most important marker (associated with the highest eigenvalue, 3.46) identified in this study is ACE3 located in the 50 regulatory region of the gene, at about 4 kb upstream of the first codon of the gene. This SNP may become a key marker for future association studies. Haplotype diversity calculated with these three SNPs is close to its value calculated with all five SNPs (0.762 vs. 0.799), indicating that the loss of information is minor. Conclusion We have studied the haplotype structure of the ACE gene in a sample of the Tunisian population using five SNPs within this gene: ACE3 (rs1800764), ACE4 (rs4291), ACE6 (rs4309), ACE7 (rs4331) and ACE ID (rs4340). The statistical analysis of the genotypes of these SNPs allowed us to show that there is a significant difference in haplotype distribution between our population and the British population studied by Keavney et al. (1998). The Yin–Yang phenomenon was found in both studies. Strong LD was found among all SNPs studied, covering a region of about 16 kb within the ACE gene. Among these, three SNPs were identified as key SNPs based on a simple statistical procedure: ACE3 (rs1800764), ACE4 (rs4291) and ACE ID (rs4340). These key SNPs will be very valuable for future effective association studies of the ACE gene polymorphisms with diseases or pharmacogenetic studies in the Tunisian and similar North African populations. Haplotype structure of ACE gene SNPs in Tunisia 327 Acknowledgements This work was supported by the Ministry of Scientific Research, Technology and Human Resources, Tunisia. References Abecasis G, Cookson WO. 2000. GOLD—graphical overview of linkage disequilibrium. Bioinformatics 16:182–183. Abecasis GR, Noguchi E, Heinzmann A, Traherne JA, Bhattacharyya S, Leaves NI, Anderson GG, Zhang Y, Lench NJ, Carey A, et al. 2001. Extent and distribution of linkage disequilibrium in three genomic regions. Am J Hum Genet 68:191–197. Allen-Brady K, Camp NJ. 2005. Characterization of the linkage disequilibrium structure and identification of tagging-SNPs in five DNA repair genes. BMC Cancer 5:1–10. Bennett JH. 1954. On the theory of random mating. Ann Eugen 18:311–317. Camp NJ, Swensen J, Horne BD, Farnham JM, Thomas A, Cannon-Albright LA, Tavtigian SV. 2005. Characterization of linkage disequilibrium structure, mutation history, and tagging SNPs, and their use in association analyses: ELAC2 and familial early-onset prostate cancer. Genet Epidemiol 28:232–243. Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, Blumenstiel B, Higgins J, DeFelice M, Lochner A, Faggart M, et al. 2002. The structure of haplotype blocks in the human genome. Science 296:2225–2229. International HapMap Consortium. 2003. The International HapMap Project. Nature 426:789–796. International HapMap Consortium. 2005a. A haplotype map of the human genome. Nature 437:1299–1320. International HapMap Consortium. 2005b. International HapMap Project [Internet]. International HapMap Consortium. Available online at: http://www.hapmap.org/, accessed 23 November 2005. Johnson GC, Esposito L, Barratt BJ, Smith AN, Heward J, Di Genova G, Ueda H, Cordell HJ, Eaves IA, Dudbridge F, et al. 2001. Haplotype tagging for the identification of common disease genes. Nat Genet 29:233–237. Julien CA. 2003. Histoire de l’Afrique du Nord: des origines à 1830 (livre 1). Ceres Eds, p 483. Keavney B, McKenzie CA, Connell JMC, Julier C, Ratcliffe PJ, Eric S, Lathrop M, Farrall M. 1998. Measured haplotype analysis of the angiotensin-I-converting enzyme gene. Hum Mol Genet 7:1745–1751. Lin Z, Altman RB. 2004. Finding haplotype tagging SNPs by use of principal components analysis. Am J Hum Genet 75:850–861. Lindpaintner K, Pfeffer MA, Kreutz R, Stampfer MJ, Frodstein F, LaMotte F, Buring J, Hennekens H. 1995. A prospective evaluation of an angiotensin-converting-enzyme gene polymorphism and the risk of ischemic heart disease. N Engl J Med 332:706–711. Meng Z, Zaykin DV, Xu CF, Wagner M, Ehm MG. 2003. Selection of genetic markers for association analyses, using linkage disequilibrium and haplotypes. Am J Hum Genet 73:115–130. Mueller JC, Lohmussaar E, Magi R, Remm M, Bettecken T, Lichtner P, Biskup S, Illig T, Pfeufer A, Luedemann J, et al. 2005. Linkage disequilibrium patterns and tagSNP transferability among European populations. Am J Hum Genet 76:387–388. National Center for Biotechnology Information. 2005a. dbSNP, Single Nucleotide Polymorphism Database [Internet]. National Center for Biotechnology Information, Bethesda, USA. Available online at: http:// www.ncbi.nlm.nih.gov/SNP/, accessed 23 November 2005. National Center for Biotechnology Information. 2005. Genetic Association Database [Internet]. National Center for Biotechnology Information, Bethesda, USA. Available from: http://geneticassociationdb.nih.gov/, accessed 23 November 2005. Nejentsev S, Godfrey L, Snook H, Rance H, Nutland S, Walker NM, Lam AC, Guja C, Ionescu-Tirgoviste C, Undlien DE, et al. 2004. Comparative high-resolution analysis of linkage disequilibrium and tag single nucleotide polymorphism between populations in the vitamin D receptor gene. Hum Mol Genet 13:1633–1639. Niu T, Chen X, Xu X. 2002. Angiotensin converting enzyme gene insertion/deletion polymorphism and cardiovascular disease. Drugs 62:977–993. Nyholt DR. 2004. A simple correction for multiple testing for single-nucleotide polymorphisms in linkage disequilibrium with each other. Am J Hum Genet 74:765–769. 328 M. Reba€ı et al. Patil N, Berno AJ, Hinds DA, Barrett WA, Doshi JM, Hacker CR, Kautzer CR, Lee DH, Marjoribanks C, McDonough DP, et al. 2001. Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21. Science 294:1719–1723. Raymond M, Rousset F. 1995. Population genetics software for exact tests and ecumenicism. J Hered 86:248–249. Scharplatz M, Puhan MA, Steurer J, Bachmann LM. 2004. What is the impact of the ACE gene insertion/deletion (I/D) polymorphism on the clinical effectiveness and adverse events of ACE inhibitors?—Protocol of a systematic review. BMC Med Genet 5:1–6. Schmidt C. 2005. Latest HapMap update aims to direct researchers to genetic basis of disease. J Natl Cancer Inst 97:1638–1640. Stephens M, Donnelly P. 2003. A comparison of bayesian methods for haplotype reconstruction from population genotype data. Am J Hum Genet 73:1162–1169. Stephens M, Smith NJ, Donnelly P. 2001. A new statistical method for haplotype reconstruction from population data. Am J Hum Genet 68:978–989. Weir BS. 1996. Genetic data analysis. Sunderland, MA: Sinauer Associates. Yoshida H, Mitarai T, Kawamura T, Kitajima T, Miyazaki Y, Nagasawa R, Kawaguchi Y, Kubo H, Ichikawa I, Sakai O. 1995. Role of the deletion of polymorphism of the angiotensin converting enzyme gene in the progression and therapeutic responsiveness of IgA nephropathy. J Clin Invest 96:2162–2169. Zhang J, Rowe WL, Clark AG, Buetow KH. 2003. Genomewide distribution of high-frequency, completely mismatching SNP haplotype pairs observed to be common across human populations. Am J Hum Genet 73:1073–1081. Zhu X, Bouzekri N, Southam L, Cooper RS, Adeyemo A, McKenzie CA, Luke A, Chen G, Elston RC, Ward R. 2001. Linkage and association analysis of angiotensin I converting enzyme (ACE) gene polymorphisms with ACE concentration and blood pressure. Am J Hum Genet 68:1139–1148. Zhu X, McKenzie CA, Forrester T, Nickerson DA, Broeckel U, Schunkert H, Doering A, Jacob HJ, Cooper RS, Rieder MJ. 2000. Localization of a small genomic region associated with elevated ACE. Am J Hum Genet 67:1144–1153. Résumé. Arrie`re plan: Le gène de l’enzyme de conversion de l’angiotensine (ECA) peut être potentiellement impliqué dans l’étiologie de plusieurs maladies courantes. L’étude de la structure de son haplotype est donc utile pour la diagnose comme pour les recherches pharmacogénomiques. Objectif: Etudier le profile haplotypique des polymorphismes de nucléotides uniques (PNU) dans le gène ECA de la population tunisienne et le comparer à d’autres populations. Trois PNU importants pour leur emploi dans les futures études d’association ont été identifiés. Sujets et me´thodes: Cinq PNU (rs1800764, rs4291, rs4309, rs4331, rs4340) couvrant une région de 15,6 kb du gène ECA ont été typés par PCR-RFLP dans un échantillon de 100 personnes en bonne santé. Re´sultats: Tous les PNU étaient polymorphiques et en équilibre de Hardy-Weinberg. Un total de 21 haplotypes ont été identifiés, mais seulement huit avaient une fréquence supérieure à 1%. Les quatre haplotypes les plus communs avaient une fréquence cumulée de 87,4%. On a rencontré le phénomène ‘‘Yin-Yang ’’ (les deux haplotypes majeurs sont complémentaires à tous les sites). Le déséquilibre de linkage entre toutes les paires de loci était hautement significatif (p < 10–5). Une méthode statistique simple et efficace a été utilisée pour identifier trois PNU importants. Conclusion: La population tunisienne présente une structure haplotypique différente de celle des européens pour le gène ECA et trois PNU importants ont été identifiés. Ils seront très utiles pour les futures études d’association dans les populations tunisienne et nord-africaines. Zusammenfassung. Hintergrund: Das Angiotensin-Converting Enzym (ACE) ist ein Kandidatengen in der Ätiologie verschiedener häufiger Krankheiten. Die Untersuchung der Haplotypstruktur dieses Gens ist bei der Diagnostik und der Pharmakogenomik von Interesse. Ziel: Die Studie untersuchte das Haplotypprofil von Einzelnukleotidpolymorphismen (single nucleotide polymorphisms, SNPs) innerhalb des ACE-Gens in der Tunesischen Bevölkerung und verglich es mit anderen Populationen. Drei für den späteren Gebrauch in Assoziationsstudien bedeutsame SNPs wurden identifiziert. Probanden und Methoden: Fünf SNPs (rs1800764, rs4291, rs4309, rs4331, rs4340), die sich über eine Region von 15,6 kb des ACE-Gens erstrecken, wurden mit PCR-RFLP in einer Stichprobe von 100 gesunden Probanden typisiert. Haplotype structure of ACE gene SNPs in Tunisia 329 Ergebnisse: Alle SNPs waren polymorph und im Hardy–Weinberg Gleichgewicht. Insgesamt 21 Haplotypen wurden identifiziert, aber nur acht traten in einer Häufigkeit von über 1% auf. Die vier häufigsten Haplotypen hatten eine kumulative Häufigkeit von 87,4%. Das ‘Yin–Yang’-Phänomen wurde gefunden (die beiden wichtigsten Haplotypen sind allseits komplementär). Das Kopplungsungleichgewicht zwischen den jeweils gepaarten Loci war hochsignifikant (p < 105). Ein einfaches und effizientes statistisches Verfahren wurde genutzt, um drei bedeutsame SNPs zu identifizieren. Zusammenfassung: Die Tunesische Bevölkerung zeigte eine gegenüber der Europäischen unterschiedliche Haplotypstruktur des ACE-Gens, und es wurden drei bedeutsame SNPs identifiziert. Diese werden für spätere Assoziationsstudien bei Tunesischen und anderen Nordafrikanischen Populationen hilfreich sein. Resumen Antecedentes: El enzima convertidor de la angiotensina (ECA) es un gen candidato en la etiologı́a de varias enfermedades comunes. El estudio de la estructura haplotı́pica de este gen es de interés en diagnóstico y farmacogenómica. Objetivos: El estudio investigó el perfil haplotı́pico de los polimorfismos de nucleótidos simples (SNPs) dentro del gen ECA en la población de Túnez, y lo comparó con otras poblaciones. Se identificaron tres importantes SNPs para su futuro uso en estudios de asociación. Sujetos y me´todos: Se tiparon cinco SNPs (rs1800764, rs4291, rs4309, rs4331, rs4340), que cubren una región de 15,6 kb del gen ECA, utilizando PCR-RFLP en una muestra de 100 sujetos sanos. Resultados: Todos los SNPs fueron polimórficos y estaban en equilibrio de Hardy-Weinberg. Se identificaron un total de 21 haplotipos, pero solo ocho presentaban una frecuencia mayor de 1%. Los cuatro haplotipos más comunes presentaban una frecuencia acumulada del 87,4%. Se observó el fenómeno ‘‘Yin-Yang’’ (dos haplotipos mayores son complementarios en todos los sitios). El desequilibrio de ligamiento entre todos los pares de loci fue altamente significativo ( p<105). Se utilizó un procedimiento estadı́stico simple y eficiente para identificar tres SNPs importantes. Conclusio´n: La población de Túnez mostró una estructura haplotı́pica diferente de la europea para el gen ECA y se identificaron tres SNPs importantes, los cuales serán de gran ayuda en futuros estudios de asociación en poblaciones de Túnez y del norte de África.
© Copyright 2026 Paperzz