Journal of Gerontology: BIOLOGICAL SCIENCES
1996, Vol. 51 A, No. 1. B66-B75
Copyright 1996 by The Geronlological Society of America
YY1 and Spl Transcription Factors Bind the Human
Transferrin Gene in an Age-Related Manner
Gwen S. Adrian,1 Edward Seto,2 Kathryn S. Fischbach,3
Edna V. Rivera,1 Erie K. Adrian,1 Damon C. Herbert,1
Christi A. Walter,1 Frank J. Weaker,1 and Barbara H. Bowman1
'Department of Cellular and Structural Biology, institute of Biotechnology,
and department of Pathology, University of Texas Health Science Center, San Antonio.
The iron-binding protein transferrin has major roles in transporting, delivering, and sequestering ferric ions acquired
by body tissues. Yet, during aging, serum transferrin levels decrease in humans. Likewise, in transgenic mice carrying
chimeric human transferrin transgenes, liver expression of transferrin transgenes decreases with age. The aging
regulation is due to decreased gene transcription. Electrophoretic mobility shift assays and antibody-recognition have
revealed the binding of 5' regulatory elements of the human transferrin gene by three YY1 proteins, called YY1,
YYl-a, and YYl-b, and an Spl-a transcription factor. An age-related increase in YYl-a and YYl-b binding activities
and a decrease in Spl-like binding activity were shown. Since Spl is a positive transcription factor and YY1 can be a
negative transcription factor, the alterations in their binding with age could cause the decreased transcription of the
human transferrin transgene, and also the age-related decreased serum transferrin levels in humans.
TPRANSFERRIN (TF) has a central role in the manage-•- ment of the body's iron supply. TF is the major irontransport protein in serum and is essential for the appropriate
tissue-distribution of iron (Bernstein, 1987). TF-bound iron
is delivered to cells via membrane-bound TF receptors. The
iron is used as a cofactor of many important proteins (i.e.,
hemoglobin, cytochromes, ribonucleotide reductase, tyrosine hydroxylase), or it is stored in the iron-storage protein
ferritin. Aging, in humans, is known to be accompanied by a
decrease in serum TF levels (Cohn and Kaplan, 1971;
Dybkjaeretal., 1981; Yip et al., 1984; Adrian etal., 1992).
The decrease, by compromising management and supply of
iron, probably has adverse effects in elderly people. Our
laboratory is studying the aging regulation of human TF in
transgenic mice that carry chimeric human TF-chloramphenicol acetyltransferase (TF-CAT) transgenes (Adrian et al.,
1992). Mimicking serum TF levels in humans, expression of
TF-CAT transgenes in liver decreased with age. Expression
of the transgene was determined by CAT enzyme assays.
Additional evidence indicated that the aging regulation was
probably independent of both (a) an inflammatory process
and (b) a response of the transgene to liver iron stores that
had increased with age. Serum levels of two acute phase
proteins, serum amyloid protein and complement component C3, which are elevated in response to inflammation in
mice, were not increased in sera of the same old mice used in
the aging experiments. Injections of iron salts do result in
decreased liver CAT enzyme activity in the TF-CAT
transgenic mice, but the iron stores did not increase with age
in the TF-CAT transgenic mouse livers (Adrian et al., 1992).
In addition, iron regulation is mediated through decreased
translation of the messenger RNA (mRNA) (Cox and Adrian, 1993), and the aging regulation is transcriptional. These
studies and others also demonstrated that the endogenous
mouse transferrin (Tf) expression did not decrease with age
B66
(Yang et al., 1990). Therefore, the human TF-CAT
transgene behaved like the human gene even though the
mouse gene behaved differently. Similar results have been
obtained in a number of other studies of human transgenes in
mice. For example, the C-reactive protein (CRP) gene is
induced during inflammation in humans, but not in mice.
When the human gene was introduced in the mouse genome,
the resulting transgenic mice increased levels of expression
of the human CRP but not the mouse CRP during inflammation (Ciliberto et al., 1987).
The present study investigates the mechanism of expression of the human TF-CAT transgene and its regulation
during aging. TF-CAT mRNA levels in liver decrease with
age although mouse TF mRNA and albumin mRNA do not.
Systematic DNA-protein binding assays using liver nuclear
extracts from mice of different ages revealed a portion of the
human TF gene 5' regulatory region with which there was a
decrease of one DNA-protein complex and an increase of
two other complexes with advanced aging. Analyses of
binding sites, competition mobility shift assays, and antibody recognition revealed that the proteins that formed the
complexes that increase with age were forms of the YY1
transcription factor. Similar studies revealed that the protein
that formed the DNA-protein complex that decreased with
age was Spl or a closely related protein. This result is
consistent with that reported by Ammendola et al. (1992).
They demonstrated that Spl binding efficiency is reduced in
nuclear extracts from aging rat tissues. Spl is a positive
transcription factor, and YY1 may be a positive or a negative
factor depending on the context of its binding site in a gene
(Kakkis et al., 1989; Park and Atchison, 1991; Shi et al.,
1991). The combined reduction of binding of a positive
transcription factor and the increase in binding of a potentially negative transcription factor could certainly contribute
to reduced expression of a gene with age such as is shown
TRANSFERRIN GENE EXPRESSION DURING AGING
here. Therefore, the present study has demonstrated binding
of a transcription factor (YY1) not previously known to bind
human TF, the presence of multiple forms of YY1, a new
site for binding of Spl, and a plausible explanation for the
decreased expression of human TF transgenes with age.
METHODS
Transgenic mice and aging studies. — Details of the
establishment of lines of homozygous transgenic mice that
carry chimeric human TF(0.67)CAT and TF(1.2)CAT
transgenes are described in Adrian et al. (1990). TF(0.67)CAT and TF( 1.2)CAT carry -621 through + 46 bp and
-1152 through +46 bp of the human TF5' regulatory region,
respectively, fused to the CAT gene. The mice were housed
in cages with microisolator filter tops, and cages were only
opened under a laminar flow hood (Adrian et al., 1992).
RNA isolation, RNA blot hybridizations, and run-on transcription assays. — RNA was isolated by the acid guanidinium isothiocyanate-phenol-chloroform extraction procedure (Chomczynski and Sacchi, 1987). Northern blot
analyses were performed as described by Sambrook et al.
(1989). DNA probes were 32P-labeled by the oligolabeling
method (Feinberg and Vogelstein, 1983). Blots were stripped between hybridizations with 50% formamide and 6 x
SSC for 30 min at 65 °C. Run-on transcription assays were
performed according to the procedure of McKnight et al.
(1980). Liver nuclei were allowed to transcribe in the presence of 32P-UTP and other nonradioactive NTPs. Newly
synthesized 32P-labeled RNAs were then hybridized to membranes that bound human TF-CAT plasmid DNA. Northerns
and run-on transcription assays were quantitated by Betascope scanning using a Betagen Betascope 603 Blot Analyzer.
Electrophoretic mobility shift assays (EMSAs). — Nuclear extracts were prepared from freshly dissected livers by
the procedure of Gorski et al. (1986). Aliquots of extracts
were stored in liquid nitrogen until use in binding reactions.
Protein concentration of extracts was determined by the
method of Lowry et al. (1951). Binding reactions were
performed as described by Fried (1989). Probe DNA was
incubated with nuclear extract for 30 min on ice in binding
buffer which was 10 mM tris (pH 7.5), 50 mM NaCl, 1 mM
EDTA, 1 mM DTT, 4% sterile glycerol, 2 |xg poly(dl-dC).
Competing DNA and antisera were added as described in
Results. Binding reactions were electrophoresed on 5%
polyacrylamide gels at 4 °C in 0.5 x TBE buffer. Following
electrophoresis, gels were dried and exposed to Kodak XOMAT-AR film. Gels were quantitated by Betascope scanning.
Oligonucleotides used for probes and competition in
EMSAs. —The following double-stranded oligonucleotides
were obtained from Promega Corporation (Madison, Wl):
Spl, top strand = ATTCGATCGG GGCGGGGCGA GC;
AP2, top strand = GATCGAACTG ACCGCCCGCGG
CCCGT. The Spl and AP2 oligonucleotides are both blunt
ended. Other oligonucleotides were synthesized by Genosys
Biotechnologies, Inc. (The Woodlands, TX). They are:
B67
YY1, top strand = AATTCATCGA TGATGCTTCAA
AATGGAGACC CTA, bottom strand = GATCTAGGGT
CTCCATTTTG AAGCATCATC GATG; hYYl, top strand
= AATTCGCGAT GACAATGGCT GCATTGTGCT
TCATG, bottom strand = GATCATGAAG CACAATGCAG CCATTGTCAT CGCG; mYYl, top strand
= AATTGGTGAT AACAAAGAGT GGGTTCTGCT TTTAG, bottom strand = GATCTAAAAG CAGAACCCAC
TCTTTGTTAT CACC; REM, top strand = GACTCTTCCA CTCGCGGGTC GTCTCAGAGC, bottom strand is
exact complement of top strand. REM is blunt-ended. Bluntended oligonucleotides, when used as probes, were endlabeled with 32P-ATP using polynucleotide kinase. Oligonucleotides with 5'-overhanging ends, when used as probes,
were end-labeled by filling in using the appropriate dNTPs,
32
P-dCTP or 32P-dATP, and AMV reverse transcriptase.
RESULTS
Previous studies on TF-CAT transgenic mice carrying
TF(1.2)CAT and TF(0.67)CAT transgenes, which contain
1.2 and 0.67kb, respectively, of the human TF 5' regulatory
region, revealed the following: Expression of the TF-CAT
transgenes, as measured by liver CAT enzyme activity,
increased 15% from 6 months to about 12 months, was
maintained at a constant level from 12 to 18 months, and
subsequently decreased by 51% between 18 and 26 months
of age (Adrian et al., 1992). Mice older than 26 months have
progressively lower liver CAT enzyme activity. In these
same mice no decrease was detected in mouse serum Tf or
mouse liver Tf mRNA with aging (Adrian et al., 1992).
Therefore, the present study compares livers from younger
mice, 12 to 18 months old, i.e., prior to the age-related
decrease in TF-CAT expression, with livers from older mice
that have decreased liver CAT enzyme activity. The goal is
to identify differences that might lead to the lowered expression of the transgene with aging.
TF-CAT, mouse Tf, and albumin mRNA levels in mice of
18 and 25 months of age. — Total RNA was extracted from
livers of male homozygous TF(0.67)CAT transgenic mice of
the A26X line, five 18-month-old mice and seven 25-monthold mice. Northern blot analyses were performed using 30
|xg of RNA from each mouse. The blot was first probed with
32
P-TF-CAT, stripped and reprobed with 32P-albumin cDNA,
and then 32P-mouse Tf cDNA. The blot was quantitated
subsequent to each probing by Betascope scanning. The TFCAT mRNA level decreased by 36% when the 18-month-old
was compared to the 25-month-old group. There was no
significant change in mouse TF or albumin mRNA levels
(Figure 1). Three different run-on transcription assays comparing pooled nuclei from five old mice with nuclei from five
younger mice showed a decrease in TF-CAT mRNA transcription in the older livers that reflected the decrease in liver
CAT enzyme activity. Mouse ages and ratios of old/younger
liver CAT enzyme activity and TF-CAT mRNA transcription are given in Table 1.
Electrophoretic mobility shift assays (EMSAs) of the human TF 5'-regulatory region contained in the TF(0.67)CAT
transgene. — To identify regions of the human TF gene that
ADRIAN ETAL.
B68
might be directing the transcriptional regulation in aging
transgenic mouse liver, systematic DNA-nuclear protein
binding assays were performed. The binding assays utilized
DNA fragments from the 0.67kb 5' regulatory region of the
human TF gene (i.e., the TF sequences present in the
TF(0.67)CAT transgene) and liver nuclear extracts from old
and younger mice. The 0.67 kb 5' TF regulatory region
includes 621 bp of 5' flanking region and 46 bp that correspond to the 5'-untranslated region of the human TF mRNA.
*§
-TF-CAT
-mTF
-Alb
25 months
18
B
18 mo
25 mo
Mouse Ago (months)
Figure I. Human TF-CAT aging regulation involves a decrease in TFCAT mRNA levels. Northern blot analyses were performed on total RNA
from homozygous male mice carrying the TF(0.67)CAT transgene (A26X
founder line). Thirty p,g of RNA was fractionated in each lane. (A)
Autoradiographs after probing with 32P-TF-CAT, stripping and reprobing
with mouse Tf (mTF), and subsequently albumin (Alb) cDNA. (B) Bar
graph comparing relative RNA levels at 25 mo with those at 18 mo. Actual
values in cpm ± SEM were: hTF-CAT mRNA, 18 mo = 148 ± 21.8, 25
mo = 95 ± 14.6; mTF mRNA, 18 mo = 1278 ± 102, 25 mo = 1133 ±
125; albumin mRNA, 18 mo = 1961 ± 144, 25 mo = 2049 ± 248.
The 0.67 kb TF region was chosen for analysis since it was
the smaller of the two TF regions contained in transgenes,
TF(0.67)CAT and TF(1.2)CAT that demonstrated decreased expression during aging. Three fragments were
tested to see if reproducible differences could be demonstrated between the binding of nuclear extracts of old and
younger mice that might correlate with the difference seen in
expression of the transgene. The first fragment tested was
212 bp, TF gene sequences -621 through -410 bp. Results
with the 212 bp fragment were inconclusive, in that decreased binding was occasionally, but not consistently, seen
with liver extracts from old mice when compared with
extracts from younger mice. The second fragment tested was
a 102 bp, TF gene sequences -409 through -308 bp. The 102
bp fragment, also called the hTFPP fragment since its ends are
at Pstl sites, gave a single shifted DNA-protein complex
with nuclear extracts and showed no difference in the intensity of the band between extracts from old and younger
mouse livers. The third fragment tested was 156 bp, TF gene
sequence -307 through -152 bp. The fragment is also
referred to as the hTFre fragment because it lies between a
Pstl and an Sstl site. EMS As with the PS fragment and
nuclear extract from 14- and 28-month-old mice yielded a
pattern of 4 distinct bands representing 4 different DNAprotein complexes. To define the optimal amount of extract
for comparison of binding reactions between old and younger mouse livers, initial shifts were performed with progressively increasing amounts of 0.5 to 8 |xg extract per binding
reaction. In the experiment, binding became apparent with
about 2 (xg of extract, and the two most rapidly migrating
complexes were increased when liver extracts from 28month-old mice were compared with those from 14-monthold mice (not shown). The assay was repeated using the 32PhTFre fragment as probe and including as competition
double-stranded oligonucleotides containing consensus
binding sites for known transcription factors that had homology to sequences within the PS fragment. The upper band
was competed with by the nonradioactive SP1 consensus
binding site (Figure 2, band Spl-a); the binding activity for
the Spl-a band was reduced when extracts from 28-monthold mouse livers were used. The second band, labeled YY1
(left panel), was competed by the YY1 oligonucleotide;
binding activity for the band did not change perceptibly with
age. The third and fourth bands in the shift, labeled YYl-a
and YYl-b, were also competed by the YY1 oligonu-
Table 1. Comparisons of TF-CAT Transcription and CAT Enzyme Activity
Experiment
Ratio, Old/Younger
Age"
Liver CAT
Activity1"
"P-TF-CAT
mRNAc
CAT Activity
Transcription
28
15
4,105
10,021
40
106
.41
.38
28
15
7,261
11,935
70
284
.61
.24
28
16
4,843
9,816
120
247
.49
.49
•Age in months.
•CAT enzyme activity in cpm x 1O~3/5OO U
| Lg protein.
c32p_TF-CAT mRNA transcription in net cpm.
B69
TRANSFERRIN GENE EXPRESSION DURING AGING
cleotide, and the binding affinity for these bands was greater
with the extract from the older mouse liver, as had been seen
in the previous experiment. Additional evidence that YY1
might be the protein involved in forming the second complex
Comp DNA:
-
Nuc Ext:
Liver Nuc Ext
Mouse age (mo):
Liver
Comp DNA: _ PS PP
Sp1-a-
YY1-
YY1-aYY1-b32p-hTF PS 32p. Y Y1
Figure 2. YY1 and Spl-like transcription factors bind the hTFre fragment, and binding differences occur with age. Competition mobility shift
assays. (Left panel) Binding reactions contained 4 jig of liver nuclear
extract from a 14-month-old mouse or a 28-month-old mouse and 10,000
cpm of 32P-hTFre DNA (~0.3 ng). The age (in months) of mice from which
the liver nuclear extracts were prepared and the competing DNA used are
noted at the top of figure. (-) in lane indicates no addition. Competing
DNAs (Comp DNA) were in a 50-fold molar excess to probe DNA. See
Methods for additional details. (Right Panel) Binding reactions contained 3
u,g of mouse liver nuclear extract (Extract batch 1, 15-month-old mouse)
and 10,000 cpm of 32P-YY1 (~0.5 ng). A 40-fold molar excess of competing hTFre (PS) or hTFpp (PP) DNA was used. To best show competition for
the YY1 band, a short exposure and less extract were used in these EMS As.
With longer exposure, YYl-a and YYl-b bands were visible on this shift
and were also competed for by hTF re .
was gained by using a 32P-YY1 oligonucleotide and competing with the hTFre and hTFPP fragments. The hTFps fragment
competed for binding but the hTFPP did not (Figure 2, right
panel). These results suggested that Spl and YYl-like transcription factors might be involved in gene regulation during
aging.
To assess the reproducibility of the altered binding affinities of the complexes with age, seven EMS As were performed comparing binding reactions with extracts from old
and younger mouse livers. In each assay the extracts that are
compared were prepared simultaneously, i.e., from a single
liver nuclear extract preparation. This was done in case
slight variations in buffer, protease inhibitor concentrations,
or some other conditions might affect the extracts. Results of
the first six assays are shown in Table 2. Three different
probes were used in the assays: hTFre, YY1, and Spl.
Extracts from livers of male and female mice were used. The
results were relatively consistent and mean values indicated
no significant change in YY1, average cpm older/cpm younger of 1.1, a significantly increased binding activity with age
for YYla and YYlb, average ratios of 2.6 and 2.5, and a
decreased binding activity of Spl, average ratio of 0.89.
One-way analyses of variance of the data in Table 2 were
used to determine if the values obtained for each of the
protein complexes are significantly different between older
and younger mice. The probability that younger and older
values are members of the same population, p-values, are as
follows: For YY1, .60; for YYl-a, <.0001; for YYl-b,
<.0001; and for Spl, .125. Spl binding decreased with age
in this study, mean of 0.89 cpm older/cpm younger in Table
2, but the trend is not statistically significant based on thepvalue of .125. The decrease of Spl is consistent, however,
with the reports of Ammendola et al. (1992) and Vellanoweth et al. (1994). To determine how binding activities for
the PS fragment compared at younger and older ages, extracts were prepared from livers of mice ranging from 7 to 34
months of age (Figure 3). Consistent with the previous
experiments, the YYl-a binding activity increased with age,
starting at 7 through 26 months; binding activity of extracts
Table 2. Relative Abundances of SPl-a, YY1, YYl-a, and YYl-b Binding Activities During Aging'
Experiment
Number
Extract
Batch
Sex
Ages
(mo)
1
Batch 2
M
16.7 vs 27.5
2
Batch 1
Batch 3
M
F
15 vs 26.5
14 vs 28
Cpm Older/Cpm Younger ± SEM
Probe
YY1
YYl-a
YYl-b
PS"
1.4 ± 0.05
2.2 ± 0.14
1.8 ± 0.05
PS
PS
1.3
1.2
2.0
3.0
—
1.2
0.79
0.64 ± 0.10
3
Batch 3
PS
0.89 ± 0.08
3.3 ± 0.50
3.1 ± 0.59
Batch 3
F
F
14 vs 28
4
14 vs 28
YY1
0.83
3.1
2.2
5
Batch 5
M
14 vs 27
YY1
0.79
2.2
2.7
6
Batch 1
M
15 vs 26.5
Spl
1.1
2.6
2.5
Mean Values
Spl-a
1.1 ± 0.01
0.71
0.89
•The relative abundances of specific Spl-a, YY1, YYl-a, or YYl-b protein-DNA complexes during aging are the ratios of the net Betascope counts for
liver extracts from older mice divided by the values for younger mice. In Experiments 1 and 3 the standard error values were calculated from three and five
different assays, respectively, comparing the extracts from an older vs a younger mouse. Other values are results from a single pair of binding reactions (older
vs younger, Experiments 4 and 6) or the mean of two pairs of binding reactions using extracts from two older vs two younger mouse livers (Experiments 2 and
5). In Experiment 2, values for YY 1 -b were not obtained because the complex migrated too close to the free probe; however, the autoradiograph showed that
the trend was the same for YYl-b as for YYl-a. Statistical analyses and significance of the data are described in the text.
b
PS probe refers to the 32P-hTFre probe.
ADRIAN ET AL.
B70
Proteins:
Anti-huSp1:
•— Sp1 Sp1 Liv Liv
— —
+
—
+
Sp1
Sp1
Sp1-a
4O
YY1
Age (months)
Figure 3. YY1, YYl-a, and Spl-like binding activities from 7 mo to 34
mo of age. For comparison with experimental results in Table 2, additional
EMSAs were performed with mice of a broader age range. The liver nuclear
extracts were prepared from mice of the following numbers and ages: 1-7
mo, 2-16 mo, 1-24 mo, 1-28 mo, and 1-34 mo (Extract batch 4). Binding
reactions included 4 jig of liver nuclear extract and 10,000 cpm of 32P-hTFre
probe (—0.3 ng). YYl-a, YY1, and Spl-a complexes were quantitated by
Betascope scanning. The YYl-b complexes migrated too close to the free
probe to be quantitated, but the X-ray film revealed that their intensities
were similar to the YYl-a complexes. For comparison of trends, values
plotted are cpm of each complex/cpm of 7 mo complex. Actual values in net
cpm for 7 mo complexes are: Spl-a = 43cpm, YY1 = 86 cpm, and YYl-a
= 16 cpm. To assure accurate quantitation the blot was scanned for 30 min.
Therefore, the total net Betascope counts for the YYl-a 7 mo complex was
483 counts. The counting efficiency of the Betascope for 32P is approximately 11%.
32
from the 28-month-old mouse was slightly elevated compared to the 16-month extract. Essentially no change was
observed between 7 and 34 months for YY1 binding. Spl
binding activity increased between 7 and 16 months and
decreased after 16 months to 27% of the 16-month value by
34 months of age. From these seven binding studies, YYl-a
and YYl-b complexes consistently increased when extracts
from old mice (26 to 28 months old) were compared with
those of younger mice.
Binding of the hTFPS fragment by recombinant Spl protein and its antibody recognition. — The hTFre contains a
GC box, GCCCGCCG human TF gene sequence -273
through -266bp, which would be expected to be bound by
Spl since the complementary sequence GGCGGG showed
binding by Spl (Gidoni et al., 1984). Recombinant human
Spl protein obtained from Promega Corporation (Madison,
WI) contains two Spl proteins, one of 95 and one of 105 kd,
which differ due to posttranslational modifications. An
EMSA with the 32P-hTFps probe showed binding by the
recombinant protein which was recognized by an Spl antibody in a supershift assay (Figure 4), The Spl antibody was
obtained from Santa Cruz (CA) Biotechnology, Inc. (directed against a C terminal peptide of human Spl). Migration of the lower Spl complex was similar to that of Spl-a,
but the bands did not exactly comigrate. The slight differ-
P-hTF P S
Figure 4. Recombinant Spl protein binds the hTFre fragment. Supermobility shift assay. Binding reactions contained either 1 footprinting unit of
Spl protein or 4 ng of mouse liver extract, as indicated, plus 10,000 cpm
(~0.6ng) of "P-hTFps probe DNA. Proteins used in the binding reactions
and the presence or absence of antibody directed against the human Spl
carboxyl terminal amino acids (anti-huSpl) are noted at the top of the
figure. Recombinant human Spl protein contains 95 and 105 kd forms
(Promega Corporation). Arrows indicate migrations of Spl, Spl-a, YY1,
YYl-a, and YYl-b complexes.
ence in migration could be due to the different species of
origin of the proteins, one a human protein, the other a
mouse protein. The Spl antibody did not recognize the Spla complex. Since the recombinant Spl protein binds the
region of the hTFre fragment that contains the Spl site, and a
specific complex that almost comigrates with an Spl complex can be readily competed with by the Spl oligonucleotide (Figure 2), the protein forming the Spl-a complex
will be referred to as Spl-like.
Antibody recognition of YY1 proteins that bind the hTFPS
probe and comigration of an authentic YY1 protein-32PhTFPS complex with the YY1 band. — Antibody directed
against a C terminal peptide of YY1 was obtained from
Santa Cruz Biotechnology. The YY1 peptide was also ob-
TRANSFERRIN GENE EXPRESSION DURING AGING
tained for use as a control to determine if it could compete for
binding of the antibody to the complexes called YYl, YY1a, and/or YYl-b (Figure 2). In an EMS A using the 32P-hTFre
probe, the 1 and 0.1 |xg of antibody recognized all three YYl
bands (Figure 5). Prior addition of the YYl peptide abolished binding of the YYl complexes. Another antibody,
directed against the AP2 transcription factor, did not recognize the complexes. The extract was from a 17-month-old
mouse liver. An EMS A using recombinant YYl protein
yielded a shifted band that comigrated with the YYl band,
providing additional evidence that YYl binds the hTFre
fragment (not shown).
Proteins which bind a 32P-YYI probe are also recognized
by the YYl antibody. — The YYl antibody also recognizes
the proteins that bind the YYl consensus binding site oli-
Nuc Ext (mouse age):
-
Antibody (ug):
-
-
aY aY aY aY 0) (0-1) (0.1) (0-1)
YY1 Peptide:
-
-
-
Liver (17 mo)
-
+
-
+
aA
(0.1)
B71
gonucleotide (Figure 6). The shift in Figure 6 clearly shows
the increase in YYl-a and YYl-b complexes with the extracts from the older mouse liver. Since YYl, YYl-a, and
YYl-b are all recognized by the YYl antibody and are all
competed with by the YYl oligonucleotide, they are forms
of a YYl protein. YYl-a and YYl-b may be smaller forms
of YYl, and they must contain the C-terminal amino acids
that the antibody recognizes.
What sequences in the nP-hTFPS fragment are recognized
by YYl protein? — The hTFre fragment and a doublestranded YYl consensus binding site oligonucleotide were
both shown to bind to three forms of YYl protein, but the
YYl binding site on the hTFre fragment remained to be
identified. The sequence was searched for the YYl consensus binding sites, CCATTTT (Shi et al., 1991). The region
of the hTFre fragment with the greatest homology to YY1
Liver Nuc Ext
Mouse Age (mo): — 14 28 14 28 14 28
Antibodies: -— -— —
- aY aY aA aA
-
Sp1-aYY1
YY1
YY1-aYY1-b32
P-hTFPS-
YY1-aYY1-b-
32p. YY 1
Figure 5. YY I antibody recognizes the three bands that are competed by
the YYl consensus oligonucleotide. Supermobility shift assays. Binding
reactions contained 3 ngof liver nuclear extract and 15,000 cpm (—0.3 ng)
of 32P-hTFre probe DNA. The presence and amount of antibody directed
against the C-terminal peptide of YYl transcription factor (aY) or the AP2
transcription factor (aA) are indicated at top of figure. The presence ( + ) or
absence (-) of I pig of the YYl peptide that the anti-YYI antibody was
raised against is also noted. Arrows indicate migrations of Spl-a, YYl,
YYl-a, and YYl-b complexes.
Figure 6. Proteins that bind YYl consensus oligonucleotide are recognized by YYl antibody. YYl-a and YYl-b bands increase in the aging
process. Supermobility shift assay. Binding reactions contained 3 jxg of
liver nuclear extract from a 14- or28-month-old mouse and 25,000 cpm 32PYYI probe DNA (-0.2 ng). Antibody directed against YYl (aY) or AP2
(aA) was added as indicated. Arrows indicate migrations of YYl, YYl-a,
and YYl-b complexes.
B72
ADRIAN ETAL.
binds since it competes for binding of YY1, YYl-a, and
YYl-b to the 32P-hTFps probe, and when hYYI is used as a
probe, all three complexes, YY1, YYl-a, and YYl-b, are
obtained. In contrast, the mYYl oligonucleotide did not
bind liver nuclear proteins or compete for their binding of the
hYYI oligonucleotide. A second oligonucleotide, REM,
which also lies in the hTFre region, between -182 and -153
bp of the human TF gene, did not compete for binding by the
YY1 proteins or bind liver nuclear proteins. Therefore, the
binding site for YY1 in the hTFre fragment was identified,
and the lack of binding to the mYYl site was established in
these binding reactions.
-
hYY1
REM
-
-
-
-
1
Liver
-
-
Liver
-
hYY1
REM
Liver
mYY1
B
-
-
8
hYY1
B
-
1
REM
-
-
Liver
-
hYY1
LAAM
Comp DNA
or Antibody:
Liver
—
TFp S
REM
Liver
-
REM
Nuc Ext:
32p-Probe:
hYY1
consensus binding sites was hTF sequence -233 through
-218 bp; two potential binding sites are present in this
region. A double-stranded oligonucleotide called hYYI,
which contained the sequence plus some flanking nucleotides, was synthesized (see Figure 7 and Methods). The
comparable oligonucleotide from the mouse Tf gene, called
mYYl, was also synthesized. The mYYl sequence is located between -279 and -264 bp and has considerable
homology to the hYYI oligonucleotide. Yet, 6 bp in the
region with overlapping YY1 consensus binding site homology differ (see lower case bases in Figure 7). The hYYI
sequence was shown to be the hTFps region to which YY1
Sp1-a-
•B
YY1-
»««W
YY1
YY1-aYY1-b-
i
•*
•YY1-a
YY1-b
hYY1: AATTCGCGATGACAATGGCTGCATTGTGCTTCATG
mYY1:
AATTGGTGATAACAAaGaaTGaaTTcTGCTTTTAG
REM:
GACTCTTCCACTCGCGGGTCGTCTCAGAGC
Figure 7. Identification of the YY1 element in hTFps and comparison with the corresponding sequence of the mouse TF gene. Supermobility shift assays
and competitions. Binding reactions contained 15,000 cpm of 32P-hTFre (TFre) probe DNA (-0.3 ng) or 20,000 cpm of 32P-hYYl, 32P-REM, or 32P-mYYl
(~0.2 ng), as indicated, and 4 jxg mouse liver nuclear extract, where indicated. Competing DNAs and antibodies included in individual reactions are shown
at the figure top. Competing DNAs were at 50 and 100 fold molar excess, respectively, for hYY 1 and REM with the 32P-hTFre probe (right panel, lanes 3 and
4, lanes 5 and 6). Competing DNAs were all 50 fold molar excess for oligonucleotide probes. Antibodies used were directed against YY 1 (aY) and AP2 (<xA).
Sequences of the top strand of the hYYI, m Y Y1, and REM oligonucleotides are shown at the bottom of the figure. Regions with homology to Y Y1 consensus
binding sites are underlined. Lower case bases in underlined portion of mYY 1 oligonucleotide are those that differ from hYY I. Arrows indicate migrations of
Spl-a, YY1, YYl-a, and YYl-b complexes.
TRANSFERRIN GENE EXPRESSION DURING AGING
DISCUSSION
Since TF has a critical role in iron management, the
decrease of serum TF in elderly people may present special
problems. For example, oxidative damage of cells by ferric
ions may be exacerbated in the elderly due to the decreased
TF levels. TF has an antioxidant role because of its high
binding affinity for ferric ions (Huebers and Finch, 1987).
Also, major decreases in serum TF levels may lead to
anemia in the elderly. Other factors such as inflammation are
known to decrease human TF levels (Castell et al., 1988). If
these factors are superimposed on the reduced serum TF
levels found in the elderly, anemia may result since a supply
of TF-bound iron is essential for erythropoiesis. TF-CAT
transgenic mice were developed for this study to better
understand expression of the human TF gene and its agerelated regulation. Transgenic mice furnish a unique opportunity to study age-related regulation of a human gene since
aging can be observed within approximately a two-year life
span.
The goal of the study was to define the mechanism of agerelated regulation of human TF. Initial work demonstrated
that in the liver, expression of human TF-CAT genes, as
measured by CAT enzyme activity, reflected the behavior of
serum TF levels observed in humans and decreased with
advanced age, even though expression of the mouse Tf gene
did not decrease with age (Adrian et al., 1992). The present
study established the following: (a) age-related regulation is
at the level of transcription of the human TF-CAT transgene;
(b) sequences within the hTFps region of the human TF gene
5' regulatory region are bound by transcription factors Spl
and YY1; and (c) the binding activities for Spl-a, YYl-a,
and YYl-b, but not YY1, seem to be altered in an agerelated manner.
Spl-like binding activity decreased after the age of 14 to
16 months in most of the binding assays comparing extracts
from old and younger mice, with the decrease being especially obvious in the 34-month-old mouse extract (Figure 3).
Spl binding activity is also reported to decrease with age in
rat brain and liver; the decreased binding is associated with a
50% decrease in expression of the H ferritin mRNA (Ammendola et al., 1992; Vellanoweth et al., 1994). Spl is a
positive transcription factor that was first identified by its
interaction with a simian virus 40 promoter; it appears to be
ubiquitous in mammalian tissues and is known to enhance
the transcription of many genes (Dynan and Tjian, 1983;
Safferetal., 1991).
Competition and immunologic EMSAs have demonstrated that YY1 binds the hTFre fragment. YY1, or yinyang
1, was so named because the transcription factor can enhance or suppress transcription of a gene depending on its
context in the gene (Kakkis et al., 1989; Park and Atchison,
1991; Shi et al., 1991). Three different complexes with the
hTFps fragment were identified that are recognized by the
YY1 antibody. Binding activities of the slowest migrating
complex called YY1, which comigrates in EMSAs with a
recombinant YY1 protein complex, do not change with age.
No consistent difference in binding activity was seen with
liver extracts of mice from 7 to 34 months of age (Figure 3).
Binding activities increase two- to threefold with age for the
two faster migrating complexes, YYl-a and YYl-b (Table
B73
2). With very old mice, YYl-a and YYl-b binding activities
begin to decrease (Figure 3). Since YYl-a and YYl-b bind
the same sites and are recognized by the same antibody, they
must be closely related to YY1. The relationship between
YY1, YYl-a, and YYl-b is not clear. Several possibilities
exist: (1) One possibility is that YYl-a and YYl-b are
proteolytic products of YY1. Assuming that the binding
activities reflect concentrations of factors of different sizes in
the extract, that YYl-a and YYl-b are proteolytic products
of YY1 is unlikely since the YYl-a and YYl-b binding
activities are consistently and significantly greater in liver
extracts from older mice than from younger mice, while
activities of YY1 do not change (Table 2). Unless there is
some YY1 feedback mechanism, such degradation would
probably require that YY1 decrease in an amount proportional to the increase in YYl-a and YYl-b. This, however,
does not occur. (2) Another possibility is that YYl-a and
YYl-b are protein products from modified YY1 RNA species. The possibility is supported by a report of multiple
forms of YY1 mRNA which may arise by differential splicing of the YY1 precursor mRNA (Hariharan et al., 1991).
(3) A third possibility is that the different DNA-protein
complexes result from interaction of YY1 with other proteins since YY1 is known to associate with other proteins.
YY1 is known to bind proteins such as Spl (Seto et al.,
1993) and Myc (Shrivastava et al., 1993). The presence of
more than one YY1 complex has also been reported by Mills
etal. (1994).
In mouse liver, human TF-CAT transgene expression
decreases with age, but mouse Tf expression does not. Also,
the region of the mouse Tf gene (mYY 1) that is comparable
to hYYl does not bind YY1 proteins, but hYYl does. These
correlations suggest several possibilities that may be relevant to the age-related decline in hTF-CAT expression.
Since YY1 is known to sometimes suppress transcription,
the age-related increase in binding of YYl-a and YYl-b
proteins may lead to the decreased hTF-CAT transcription.
As mentioned above, perhaps YYl-a and YYl-b are altered
forms of YY1, and they compete for or interfere with a
positive function of YY 1. Perhaps a change in an interaction
between YY1 and Spl, both due to the increased YYl-a and
YYl-b forms and the decrease of Spl binding, leads to the
age-related decrease in transcription. Confirmation that the
YY1 and Spl sequences are required for aging regulation
may be obtained by developing transgenic mice that carry
mutated human TF-CAT transgenes, e.g., a transgene construct in which the hYYl sequence has been changed to the
mYYl sequence, and determining if liver expression of the
mutated transgene still decreases with aging.
In addition to this study, several other reports describe
age-related alterations in levels or binding activities of specific transcription factors. As mentioned above, Ammendola
et al. (1992) reported reduced Spl binding activity in nuclear
extracts from aged rat tissues. Supakar et al. (1995) demonstrated a progressive age-related increase in binding activity
of the p50/p50 form of nuclear factor-KB (NF-KB) from rat
liver nuclear extracts to the rat androgen receptor (rAR)
promoter. The transcription factor seems to function as a
transcription repressor for the rAR gene; mutation of the NFKB binding site resulted in increased expression of rAR-
B74
ADRIAN ET AL.
driven luciferase genes in transiently transfected CHO cells.
The same group also reported an age-related decrease in
expression of a positive transcription factor for rAR called
age-dependent factor (ADF, Supakar et al., 1993). The
alterations in levels of ADF and the p50/p50 form of NF-KB
may cooperate in implementation of the downregulation of
rAR during aging. Sikora et al. (1992) compared response of
lymphocytes isolated from spleens of old (>18-month-old)
mice with those of young (3-month-old) mice. Following
concanavalin A stimulation, the older cells expressed less cfos mRNA, and their nuclear extracts contained less Apl
transcription factor binding activity. The Apl transcription
factor is often a heterodimer composed of c-fos and c-jun.
The downregulation of c-fos seemed specific since the nuclear extracts from old and young mice did not differ in
binding activities for AP2 and AP3 transcription factors.
Somewhat similar responses have been found in studies of
senescent compared to presenescent human fibroblasts. Associated with senescence, binding activities of some transcription factors decrease (E2F, API, cAMP response element binding protein, CAAT-binding transcription factor),
some are unchanged ( N F - K B , and glucocorticoid response
element binding protein), and some increase (octamer binding protein transcription factor, and one transcription factor
IID complex) (Dimri and Campisi, 1994; Dimri et al.,
1994). Seshadri et al. (1993) reported that senescent human
fibroblasts also contained five- to tenfold lower levels of six
ribosomal protein RNAs than presenescent cells. Yet, protein synthesis was not decreased in the senescent cells.
In conclusion, this study utilized the transgenic mouse
model to obtain information about the regulation of a human
gene for which expression is altered during aging.
Transgenic mice have also been used to study expression of
human TF transgenes in early development (Lu et al., 1993).
The present study disclosed previously unrecognized binding sites in the human TF gene for YYI and Spl transcription factors and revealed differences in binding activities that
correlate with aging.
ACKNOWLEDGMENTS
This research was supported by Grant AG-06872 and Training Grant
AG-00165 from the National Institutes of Health.
Address correspondence to Dr. Gwen S. Adrian, Department of Cellular
and Structural Biology, The University of Texas Health Science Center,
7703 Floyd Curl Drive, San Antonio, TX 78284-7762.
REFERENCES
Adrian, G.S.; Bowman, B.H.; Herbert, D.C.; Weaker, F.J.; Adrian, E.K.;
Robinson, L.K.; Walter, C.A.; Eddy, C.A.; Riehl, R.; Pauerstein,
C.J., Yang, F. Human transferrin. Expression and iron modulation of
chimeric genes in transgenic mice. J. Biol. Chem. 265:13344-13350;
1990.
Adrian, G.S.; Herbert, D.C.; Robinson, L.K.; Walter, C.A.; Buchanan,
J.M.; Adrian, E.K.; Weaker, F.J.; Eddy, C.A.; Yang, F.; Bowman,
B.H. Expression of a human chimeric transferrin gene in senescent
transgenic mice reflects the decrease of transferrin levels in aging
humans. Biochim. Biophys. Acta 1132:168-176; 1992.
Ammendola, R.; Mesuraca, M.; Russo, T.; Cimino, F. Spl DNA binding
efficiency is highly reduced in nuclear extracts from aged rat tissues. J.
Biol. Chem. 267:17944-17948; 1992.
Bernstein, S.E. Hereditary hypotransferrinemia with hemosiderosis, a
murine disorder resembling human atransferrinemia. J. Lab. Clin. Med.
110:690-705; 1987.
Castell,J.V.;Gomez-Lechon,M.J.; David, M.;Hirano,T.;Kishimoto,T.;
Heinrich, P.C. Recombinant human interleukin-6 (IL-6/BSF-2/HSF)
regulates the synthesis of acute phase proteins in human hepatocytes.
FEBS Lett. 232:347-450; 1988.
Chomczynski, P.; Sacchi, N. Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159; 1987.
Ciliberto, G.; Arcone, R.; Wagner, E.F.; Ruther, U. Inducible and tissuespecific expression of human C-reactive protein in transgenic mice.
EMBOJ. 6:4017-4022; 1987.
Cohn, C ; Kaplan, A. Blood chemistry. In: Miller, S.E.; Weller, J.M., eds.
Textbook of clinical pathology. 8th ed. Baltimore: Williams and
Wilkins, 1971:264.
Cox, L.A.; Adrian, G.S. Posttranscriptional regulation of chimeric human
transferrin genes by iron. Biochemistry 32:4738-4745; 1993.
Dimri, G.P.; Campisi, J. Altered profile of transcription factor-binding
activities in senescent human fibroblasts. Exp. Cell Res. 212:132--140;
1994.
Dimri, G.P.; Hara, E.; Campisi, J. Regulation of two E2F-related genes in
presenescent and senescent human fibroblasts. J. Biol. Chem.
269:16180-16186;1994.
Dybkjaer, R.; Lauritzen, M.; Krakauer, R. Relative reference values for
clinical chemical and haematological quantities in 'healthy' elderly
people. Acta Med. Scand. 209:1-9; 1981.
Dynan, W.S.; Tjian, R. The promoter-specific transcription factor Spl
binds to upstream sequences in the SV40 early promoter. Cell 35:7987;1983.
Feinberg, A.P.; Vogelstein, B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem.
132:6-13; 1983.
Fried, M. Measurement of protein-DNA interaction parameters by eksctrophoresis mobility shift assay. Electrophoresis 10:366-376; 1989.
Gidoni, D.; Dynan, W.S.; Tjian, R. Multiple specific contacts between a
mammalian transcription factor and its cognate promoters. Nature
312:409-413;1984.
Gorski, K.; Carneiro, M.; Schibler, U. Tissue-specific in vitro transcription
from the mouse albumin promoter. Cell 47:767-776; 1986.
Hariharan, N.; Kelley, D.E.; Perry, R.P. 8, a transcription factor that binds
to downstream elements in several polymerase II promoters, is a
functionally versatile zinc finger protein. Proc. Natl. Acad. Sci. USA
88:9799-9803; 1991.
Huebers, H.A.; Finch, C.A. The physiology of transferrin and transferrin
receptors. Physiol. Rev. 67:520-582; 1987.
Kakkis, E.; Riggs, K.G.; Gillespie, W.; Calame, K. A transcriptional
repressorofc-myc. Nature 339:718-721; 1989.
Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the folin phenol reagent. J. Biol. Chem. 193:265-275;
1951.
Lu, Y.; Cox, L.A.; Herbert, D.C.; Weaker, F.J.; Walter, C.A.; Adrian,
G.S. Expression of chimeric human transferrin-chloramphenicol acetyltransferase genes in liver and brain of transgenic mice during development. Dev. Biol. 155:452-458; 1993.
McKnight, G.S.; Lee, D.C.; Palmiter, R.D. Transferrin gene expression.
Regulation of mRNA transcription in chick liver by steroid hormones
and iron deficiency. J. Biol. Chem. 255:148-153; 1980.
Mills, L.K.; Shi, Y.; Millette, R.L. YYI is the cellular factor shown
previously to bind to regulatory regions of several leaky-late (B-y, 7,)
genes of herpes simplex virus type I. J. Virology 68:1234-1238; 1994.
Park, K.; Atchison, M.L. Isolation of a candidate repressor/activator, NFEl (YY-1, 8), that binds to the immunoglobulin K3' enhancer and the
immunoglobulin heavy-chain JJLEI site. Proc. Natl. Acad. Sci. USA
88:9804-9808; 1991.
Saffer, J.D.; Jackson, S.P.; Annarella, M.B. Developmental expression of
Spl in the mouse. Mol. Cell. Biol. 11:2189-2199; 1991.
Sambrook, J.; Fritsch, E.F.; Maniatis, T. Electrophoresis of RNA through
gels containing formaldehyde. In: Molecular cloning, a laboratory
manual. Cold Spring Harbor, NY: Cold Spring Harbor Press,
1989:7.43-7.52.
Seshadri, T.; Uzman, J.A.; Oshima, J.; Campisi, J. Identification of a
transcript that is down-regulated in senescent human fibroblasts. Cloning, sequence analysis, and regulation of the human L7 ribosomal
protein gene. J. Biol. Chem. 268:18474-18480; 1993.
Seto, E.; Lewis, B.; Shenk, T. Interaction between transcription factors
Spl and YYI. Nature 365:462-464; 1993.
TRANSFERRIN GENE EXPRESSION DURING AGING
Shi, Y.; Seto, E.; Chang, L.; Shenk, T. Transcriptional repression by YY1,
a human GLl-Kruppel-related protein, and relief of repression by
adenovirus El A protein. Cell 67:377-388; 1991.
Shrivastava, A.; Saleque, S.; Kalpana, G.V.; Artandi, S.; Goff, S.P.;
Calame, K. Inhibition of transcriptional regulator Yin-Yang-1 by association with c-myc. Science 262:1889-1892; 1993.
Sikora, E.; Kaminska, B.; Radziszewska, E.; Kaczmarek, L. Loss of
transcription factor Ap-1 DNA binding activity during lymphocyte
aging in vivo. FEBS Lett. 312:179-182; 1992.
Supakar, P.C.Jung, M.H.; Song, C.S.;Chatterjee,B.; Roy, A.K. Nuclear
factor KB functions as a negative regulator for the rat androgen receptor
gene and NF-KB activity increases during the age-dependent desensitization of the liver. J. Biol. Chem. 270:837-842; 1995.
Supakar, P.C.; Song, C.S.; Jung, M.H.; Slomczynska, M.A.; Kim, J.-M.;
Vellanoweth, R.L.; Chatterjee, B.; Roy, A.K. A novel regulatory
B75
element associated with age-dependent expression of the rat androgen
receptor gene. J. Biol. Chem. 268:26400-26408; 1993.
Vellanoweth, R.L.; Supakar, P.C.; Roy, A.K. Biology of disease. Transcription factors in development, growth, and aging. Lab. Invest.
70:784-799;1994.
Yang, F.; Friedrichs, W.E.; Buchanan, J.M.; Herbert, D.C.; Weaker, F.J.;
Brock, J.H.; Bowman, B.H. Tissue specific expression of mouse
transferrin during development and aging. Mech. Ageing Dev. 56:187—
197;1990.
Yip, R.; Johnson, C ; Dallman, P.R. Age-related changes in laboratory
values used in the diagnosis of anemia and iron deficiency. Am J. Clin.
Nutr. 39:427-436; 1984.
Received December 29, 1994
Accepted May 15, 1995