The Plant Journal (2002) 29(1), 99±108
Golgi secretion is not required for marking the preprophase
band site in cultured tobacco cells
Ram Dixit* and Richard Cyr
The Pennsylvania State University, 208 Mueller Laboratory, University Park, PA 16802, USA
Received 23 July 2001; revised 10 October 2001; accepted 17 October 2001.
*
For correspondence (fax +1 814 865 9131; e-mail [email protected]).
Summary
The preprophase band predicts the future cell division site. However, the mechanism of how a transient
preprophase band ful®ls this function is unknown. We have investigated the possibility that Golgi
secretion might be involved in marking the preprophase band site. Observations on living BY-2 cells
labeled for microtubules and Golgi stacks indicated an increased Golgi stack frequency at the
preprophase band site. However, inhibition of Golgi secretion by brefeldin A during preprophase band
formation did not prevent accurate phragmoplast fusion, and subsequent cell plate formation, at the
preprophase band site. The results show that Golgi secretion does not mark the preprophase band site
and thus does not play an active role in determination of the cell division site.
Keywords: preprophase band, Golgi stacks, secretion, brefeldin A, green ¯uorescent protein, red
¯uorescent protein.
Introduction
Microtubules play various essential roles during mitosis.
In the sporophytic cells of higher plants, microtubules
adopt at least three sequential con®gurations during cell
division: the preprophase band (PPB); mitotic spindle; and
phragmoplast (Goddard et al., 1994).
The PPB typically occurs as a band of microtubules
encircling the G2/prophase nucleus (Mineyuki, 1999). The
most intriguing property of the PPB is its location in the
region of the cell cortex where the future cell plate inserts,
thereby serving to predict the future cell division site
(Mineyuki, 1999). Numerous studies have demonstrated
that the phragmoplast (the cytokinetic apparatus which
directs the formation of the nascent cell plate) fuses
accurately at the PPB-de®ned cortical site (Gunning and
Wick, 1985; Mineyuki, 1999; Pickett-Heaps and Northcote,
1966; Wick, 1991). In addition, it has been reported that
aberrant initial trajectory of a phragmoplast with respect to
the PPB site can be corrected, provided the expanding
phragmoplast does not stray beyond a certain `critical
zone' (Galatis et al., 1984a; Galatis et al., 1984b). Thus the
PPB appears to confer some property (or properties) to the
adjacent cortical site that acts to guide/facilitate phragmoplast fusion at that site.
Much attention has been paid as to how a transient PPB
can in¯uence the operation of the future cytokinetic
ã 2002 Blackwell Science Ltd
apparatus. One mechanism involves the role of the PPB
in orientation of the early spindle axis (Cho and Wick, 1989;
Cleary and Hardham, 1989; Wick and Duniec, 1984). The
early spindle is always positioned perpendicular to the
PPB site, and because the phragmoplast arises from
remnants of the spindle, spindle axis orientation directly
in¯uences initial phragmoplast trajectory. However, in
some cells the spindle rotates after formation, and consequently the initial phragmoplast trajectory is not directed
towards the PPB site (Galatis et al., 1984a; Galatis et al.,
1984b; Granger and Cyr, 2000b; Palevitz, 1986; Palevitz and
Hepler, 1974). Nonetheless, in such cells the phragmoplast
®nds its way to the PPB site and inserts properly (Galatis
et al., 1984a; Galatis et al., 1984b; Granger and Cyr, 2000b;
Palevitz, 1986; Palevitz and Hepler, 1974). Therefore a
second mechanism is likely to exist that `marks' the PPB
site such that the marking information persists throughout
mitosis and can guide the trajectory of the expanding
phragmoplast during cytokinesis. These two mechanisms
are not mutually exclusive, and may represent complimentary and hence redundant activities that co-operate to
ensure the accurate placement of the new cell plate.
We are interested in determining the nature of the
marking information at the PPB site. A variety of molecules, such as cyclin-dependent kinases (Colasanti et al.,
99
100
Ram Dixit and Richard Cyr
Figure 1. Primary structure of the N-acetylglucosaminyl transferase I : RFP fusion protein.
The fusion protein consists of 79 amino acids derived from the N-terminus of an Arabidopsis N-acetylglucosaminyl transferase I, linked to the RFP reporter
protein via a short linker sequence (in bold). The predicted transmembrane domain within N-acetylglucosaminyl transferase I protein segment is underlined.
1993; Mineyuki et al., 1991; Stals et al., 1997); g-tubulin (Liu
et al., 1993), centrin; (Del Vicchio et al., 1997); and kinesinlike proteins (Asada et al., 1997; Bowser and Reddy, 1997)
reportedly are associated with PPBs, and an actin-depleted
zone has also been detected at the PPB site (Baluska et al.,
1997; Cleary, 1995; Cleary et al., 1992; Liu and Palevitz,
1992). However, the mechanism(s) by which these factors
mark the PPB site and guide cell-plate positioning is unknown.
Several observations have also indicated that Golgi
activity may be involved in marking the PPB site.
Electron-dense vesicles have been detected at the PPB
site, and some of the vesicles have been observed fusing
with the plasma membrane (Burgess and Northcote, 1968;
Eleftheriou, 1996; Galatis, 1982; Galatis and Mitrakos, 1979;
Gunning et al., 1978; Packard and Stack, 1976). Localized
cell-wall thickening at the PPB site has been detected in
several plants (Galatis and Mitrakos, 1979; Galatis et al.,
1982; Packard and Stack, 1976; Zhao and Sack, 1999),
which suggests targeted Golgi activity to the PPB site.
Recently, the presence of a Golgi belt in the cortex of
metaphase cells, at the site where the future cell plate will
be inserted, has been observed with cells labeled for Golgi
stacks (NebenfuÈhr et al., 2000). These observations support
the hypothesis that the PPB is capable of speci®c recruitment of Golgi activity at its site, and that Golgi secretory
product(s) are important for directing accurate fusion of
the future phragmoplast at the PPB site.
We have investigated the role of Golgi stacks in marking
the PPB site by generating a dual-marker BY-2 (Bright
Yellow-2) tobacco cell line in which both microtubules and
Golgi stacks can be observed in living cells. We tested the
signi®cance of Golgi secretion in determination of the cell
division site by inhibiting Golgi secretion using brefeldin A
(BFA). BFA is a fungal metabolite that affects the morphology and secretory activity of the plant Golgi apparatus
(Driouich et al., 1993; Satiat-Jeunemaitre and Hawes,
1993). Our observations, using the dual-marker cell line,
show that the PPB is associated with a small increase in
Golgi stack frequency; however, BFA has no effect on the
positional information laid down at the PPB site and
therefore Golgi secretory activity does not play a role in
marking the PPB site.
Results
Generation of a microtubule- and Golgi stack-labeled cell
line
BY-2 cells were used to determine whether there is a
relationship between the PPB site and the distribution of
Golgi stacks. Previously, a transgenic BY-2 cell line (designated BD2-5), labeled for microtubules, was generated
(Granger and Cyr, 2000a). BD2-5 cells were transformed
with an RFP-labeled Golgi marker protein to generate a
tobacco cell line that would allow us to visualize both the
PPB and Golgi stacks in living cells.
N-acetylglucosaminyltransferase I (Nag) is a resident
enzyme of the Golgi organelle that participates in the
glycosylation of secretory proteins, and has been used as a
Golgi marker protein (Gleeson, 1998; Munro, 1998). The
transmembrane-stem region of this protein is suf®cient for
retention in Golgi stacks of animal and plant cells (Burke
et al., 1992; Burke et al., 1994; Essl et al., 1999; Grabenhorst
and Conradt, 1999; Jaskiewicz et al., 1996; Nilsson et al.,
1996; Opat et al., 2000; Tang et al., 1992). A chimeric gene
was assembled that encodes a fusion protein consisting of
the N-terminal transmembrane-stem region of an
Arabidopsis Nag homologue with the Discosoma red
¯uorescent protein (RFP; Figure 1). A second chimeric
gene encoding the rat sialyl transferase transmembranestem region (RatST) fused to RFP was also constructed.
RatST has been shown to localize GFP to Golgi stacks (Boevink
et al., 1998). BD2-5 cells were transformed with the chimeric
genes to generate dual-marker cell lines. As a control, BD2-5
cells were also transformed with the RFP gene only.
RFP ¯uorescence in the BD2-5 cells expressing the NagRFP fusion protein (referred to as Nag-RFP cells) is visible
as bright spots distributed in the perinuclear region,
cytoplasmic strands, and cortex of the cytoplasm (Figure
2). RFP ¯uorescence in the Nag-RFP cells is excluded from
the nucleus and vacuoles (Figure 2). This RFP ¯uorescence
pattern is indistinguishable from the RFP ¯uorescence
pattern of BD2-5 cells expressing RatST-RFP (Figure 2).
In sharp contrast to the Nag-RFP and RatST-RFP ¯uorescence patterns, ¯uorescence in BD2-5 cells expressing
RFP alone appears predominantly in the nucleus with
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 99±108
Golgi secretion and PPB site 101
Figure 2. Distribution of RFP ¯uorescence in
the dual-marker BY-2 cell lines.
Representative images of BD2-5 cells
expressing Nag-RFP, RatST-RFP, and RFP
alone. Images are single, confocal, optical
sections through the mid-plane of cells.
Note the punctate distribution of RFP
¯uorescence and its exclusion from the
nucleus (N) in the cell lines expressing NagRFP and RatST-RFP fusion proteins. In
contrast, cells expressing RFP alone display
diffuse cytoplasmic ¯uorescence and
highlighted nuclei. Scale bars, 10 mm.
diffuse labeling of the cytoplasm (Figure 2). We rarely (<5%
of the cells) observed punctate RFP ¯uorescence in the
cells expressing RFP alone.
Biochemical, biophysical and crystallographic data have
indicated that the mature form of RFP is tetrameric (Baird
et al., 2000; Heikal et al., 2000; Yarbrough et al., 2001).
Therefore it is possible that the punctate pattern of RFP
¯uorescence in the Nag-RFP cells is due to an intrinsic
tendency of RFP to form large-order aggregates rather
than RFP localization to Golgi stacks. However, the diffuse
expression pattern of RFP alone does not support this
alternative hypothesis.
Authenticity of Golgi stack labeling in the Nag-RFP cells
Observations on living Nag-RFP cells showed that the RFP
spots display a complexity of motion and morphology that
are identical to those previously reported for Golgi stacks
(Boevink et al., 1998; NebenfuÈhr et al., 1999). Movements of
the RFP spots alternated between rapid translational
motion (streaming) and Brownian motion (wiggling)
(Fig. S1). Streaming activity was most frequently detected
in cytoplasmic strands and cortical regions of the cytoplasm, with maximal velocities reaching 6 mm sec±1.
Streaming of the RFP spots was also dependent on the
presence of an intact actin cytoskeleton, as streaming of the
RFP spots ceased after treatment of the Nag-RFP cells with
10 mM latrunculin B for 30 min (compare Figs S2 and S3).
The RFP spots in the Nag-RFP cells also displayed a
distinct Golgi stack-like morphology. Most often the spots
were visible as short, elongate images about 1 mm in
length, but occasionally appeared comma-shaped or ringlike in morphology (Fig. S1). Time-lapse microscopy on
living Nag-RFP cells revealed a transmutation of morphã Blackwell Science Ltd, The Plant Journal, (2002), 29, 99±108
ology of the same RFP spots (Supplementary material,
Movie 1), indicating that the various forms of the RFP spots
result from different viewing angles of the same spots.
We looked at the effect of brefeldin A (BFA) treatment on
the RFP ¯uorescence pattern in Nag-RFP cells to determine
the authenticity of Golgi stack labeling. Exposure of plant
cells to BFA results in the aggregation and vesiculation of
Golgi stacks to form so-called BFA compartments
(Driouich et al., 1993; Essl et al., 1999; Satiat-Jeunemaitre
and Hawes, 1992a; Satiat-Jeunemaitre and Hawes, 1992b;
Satiat-Jeunemaitre and Hawes, 1993; Satiat-Jeunemaitre
et al., 1996). Treatment of Nag-RFP cells with 30 mM BFA
results in the clustering of RFP spots identical to the BFA
compartments. The clustering effect is apparent after
15 min treatment (data not shown) and is clearly manifested by 1 h treatment (Figure 3b). Similar data were also
obtained for the RatST-RFP cells (data not shown). NagRFP cells treated with ethanol (the solvent used to prepare
the BFA stock solution) do not display clustering of RFP
spots (Figure 3a). In addition, the clustered RFP spots
revert back to the initial state on removal of BFA (Figure
3c). Importantly, control cells expressing RFP alone do not
display clustering of RFP on BFA treatment (Figure 3d),
indicating that the clustering of ¯uorescent spots in the
Nag-RFP cells is not due to a non-speci®c effect of BFA on
cytoplasmic organization. We conclude from these observations that the RFP spots in the Nag-RFP cells report the
authentic location of Golgi stacks.
Relationship between PPB site and Golgi stack
distribution
The Nag-RFP cell line allowed us to test unequivocally
whether the PPB site is associated with an increased Golgi
102
Ram Dixit and Richard Cyr
Figure 3. Effect of brefeldin A on the
distribution of RFP ¯uorescence.
Transformed BY-2 cells were subjected to
various treatments followed immediately by
confocal microscopy (time = 0 min). At the
indicated time intervals, single, confocal,
optical sections of the same cells were
obtained to determine changes in the
distribution of RFP ¯uorescence over time.
(a) Nag-RFP cells treated with an equivalent
volume of ethanol to that used for the
brefeldin A (BFA) treatments.
(b) Nag-RFP cells treated with 30 mM BFA.
(c) Nag-RFP cells treated with 30 mM BFA for
1 h followed by removal of BFA by washing
the cells, ®ve times, with medium without
BFA (t = 0 min after ®fth wash).
(d) RFP alone cells treated with 30 mM BFA.
Scale bars, 10 mm.
stack frequency. Observation of living Nag-RFP cells
containing PPBs indicated that Golgi stacks do not accumulate exclusively at the PPB site, and only 10% of the
cells had a clearly discernible increased Golgi stack
frequency at the PPB site (Figure 4a). However, there
appeared to be some degree of correlation between the PPB
site and Golgi stack frequency in most cells (Figure 4b,c).
Fifty-two Nag-RFP cells with PPBs were examined to
quantify the relationship between PPB site and Golgi stack
frequency. The average width of a mature PPB in these
cells was about 4 mm, and Golgi stack frequency was
determined in a cortical area 6 mm wide in order to include
the PPB and its immediate vicinity. As a comparison, Golgi
stack frequency was also determined in a cortical area
6 mm wide and 6 mm away from the PPB site. As shown in
Table 1, there is a small but signi®cant increase in Golgi
stack frequency associated with the PPB site.
Golgi secretory activity does not play a role in marking
PPB position
The signi®cant increase in Golgi stack frequency at the PPB
site suggests that secretion through Golgi stacks might
play a functional role in marking the PPB site. If this
hypothesis is true, inhibition of Golgi secretion during PPB
formation should prevent the accurate fusion of the
expanding phragmoplast at the PPB site.
To test this hypothesis, BFA was used to inhibit Golgi
secretion. BFA rapidly inhibits secretion of proteins and
carbohydrates through the Golgi stacks in a variety of plant
cells (Boevink et al., 1999; Driouich et al., 1993; Jones and
Herman, 1993; Satiat-Jeunemaitre and Hawes, 1993).
Recently, 20 mM BFA was also shown to inhibit phragmoplast expansion in BY-2 cells due to curtailment of the
supply of Golgi stack-derived vesicles necessary for cell
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 99±108
Golgi secretion and PPB site 103
Table 1. Correlation between PPB site and Golgi stack frequency
Site
Golgi frequency
PPB
Non-PPB
6.3 6 2.9
4.7 6 2.2*
Golgi stack frequency is presented as the number of discrete
Golgi stacks observed within a cortical area at the PPB site or a
similar cortical area 6 mm away from the PPB site (non-PPB site).
Results represent the mean value 6SD obtained from the
observation of 52 Nag-RFP cells with PPBs. The P value was
determined using Student's t-test.
*, P » 0.0005 for the null hypothesis.
Table 2. Effect of brefeldin A on phragmoplast expansion rate
Figure 4. Spatial relationship between cortical Golgi stack distribution
and PPB site.
Nag-RFP cells with a PPB (a±c) were observed. Single, confocal, optical
sections through the same cortical plane were collected to visualize RFP
(Golgi stack panels) and GFP (microtubule panels) ¯uorescence. Arrows
point to PPB sites. Scale bars, 10 mm.
plate formation (Yasuhara and Shibaoka, 2000; Yasuhara
et al., 1995). Treatment of Nag-RFP cells with 30 mM BFA
results in the reduction of the phragmoplast expansion
rate, and the extent of this reduction correlates with the
extent of BFA treatment (Table 2). Exposure of cells to
30 mM BFA for 1 h reduces the phragmoplast expansion
rate at least threefold, whereas exposure to 30 mM BFA for
2 h almost completely inhibits phragmoplast expansion
(Table 2). These results indicate that 30 mM BFA exposure
is suf®cient to inhibit Golgi secretion in the Nag-RFP cells.
In addition, the BFA effect is reversible, and the phragmoplast expansion rate recovers to control levels after 1 h
BFA removal (Table 2). We note that other aspects of the
cell cycle, such as PPB formation, PPB disappearance,
nuclear migration, spindle formation and spindle elongation, are not affected by treatment with 30 mM BFA for 2 h
(data not shown).
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 99±108
Treatment
Phragmoplast expansion rate
(mm min±1) 6 SD
Control
30 mM BFA, 1 h
30 mM BFA, 2 h
BFA recovered
0.61
0.19
0.07
0.52
6
6
6
6
0.16
0.10
0.06
0.13
(20)
(10)a
(20)b
(14)c
Nag-RFP cells were treated with 30 mM BFA for 1 or 2 h followed
by time-lapse ¯uorescence microscopy (in the presence of BFA).
The GFP marker was used to follow phragmoplast expansion at
10 sec intervals for 15±20 min. Control cells were treated with an
equivalent volume of ethanol for 2 h. BFA recovery experiments
were carried out by treating cells with 30 mM BFA for 2 h followed
by removal of BFA by washing cells ®ve times with medium
without BFA. Cells were then incubated in the absence of BFA for
1 h, followed by microscopic observation. Numbers in parentheses indicate the number of cells used for each treatment.
P values for the null hypothesis were determined using Student's
t-test: aP < 10±7; bP < 10±16; cP » 0.08.
The maximum time for PPB formation to the onset of
mitosis is about 1 h (average time 50 6 15 min, n = 11
cells) in the Nag-RFP cells. Nag-RFP cells were exposed to
30 mM BFA for 2±3 h, followed by the removal of BFA.
During this treatment, cells in G2 progress normally into
prophase accompanied by formation of the PPB. After BFA
removal, cells with a mature PPB were chosen for observation and the progression of mitosis was followed using
time-lapse microscopy. This treatment regime ensured
that PPB formation in the chosen cells had occurred in the
absence of Golgi secretion, and also allowed for normal
phragmoplast expansion during cytokinesis.
The phragmoplasts in the BFA-treated cells always
inserted at the PPB-de®ned sites, even if they started out
with an aberrant trajectory (Figure 5b; compare Figs S4
104
Ram Dixit and Richard Cyr
Figure 5. Inhibition of Golgi secretion and ®delity of phragmoplast insertion.
Nag-RFP cells were treated with either 30 mM BFA (b) or ethanol (a) for 2 h and then washed, ®ve times, with medium without BFA/ethanol (time = 0 min
after ®fth wash). Cells with a mature PPB were observed immediately following the treatments. The GFP microtubule marker was used to record the
progression of mitosis at 1 min intervals. Select images, representative of the various stages of mitosis, are shown. RFP (Golgi) ¯uorescence was also
recorded at the beginning and end of the mitotic cell cycle to visualize Golgi stack morphology. The last image in each series was captured using bright®eld optics to show the cell plate location (arrows). Arrowheads mark the PPB site; the initial phragmoplast trajectory is indicated by a line. Scale bars,
10 mm.
and S5). This result was observed for 32 cells, even when
the cells had been treated with 100 mM BFA.
It is possible that PPB formation leads to Golgi stack
recruitment at the PPB site during G2/prophase, but that
secretion through the Golgi stacks is triggered only on the
onset of metaphase. In this scenario, a metaphase Golgi
belt would mark the PPB site (NebenfuÈhr et al., 2000). We
have detected a Golgi belt at the PPB site during
metaphase of control cells (Figure 6a). However, a Golgi
belt was never detected at any of the mitotic stages in cells
recovering from BFA treatment (Figure 6b). Hence we rule
out the possibility that the metaphase Golgi belt may be
involved in marking the PPB site.
Discussion
The role of the PPB in determination of the cell division site
has long been a subject of discussion and investigation
(Gunning and Wick, 1985; Mineyuki, 1999; Wick, 1991);
however, mechanistic details of PPB function remain
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 99±108
Golgi secretion and PPB site 105
Figure 6. Absence of a Golgi belt in BFA-treated cells.
Nag-RFP cells were treated either with ethanol (a) or 30 mM BFA (b), for 2 h, then washed ®ve times with medium without ethanol/BFA. At the end of the
treatment, cells with a mature PPB were chosen for observation. Both GFP (microtubules) and RFP (Golgi stacks) ¯uorescence was recorded at various
stages of mitosis. Arrowheads point to the PPB site. Scale bar, 10 mm.
sparse. One of the goals in understanding PPB function has
been to determine the nature of the positional or marking
information retained at the PPB site, which is proposed to
function in determination of the future cell division site. We
have investigated the role of Golgi stacks in providing such
marking information, and have determined that Golgi
secretory activity is not required for PPB marking in BY-2
cells.
Transformation of the BD2-5 cell line with Nag-RFP
allowed us to visualize both microtubules and Golgi stacks
in living cells. A number of criteria led us to conclude that
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 99±108
the RFP spots in the Nag-RFP cell line truly represent Golgi
stacks: (i) the morphology of the RFP spots is identical to
that previously reported for Golgi stacks (Boevink et al.,
1998; NebenfuÈhr et al., 1999); furthermore, such spots are
not observed in cells expressing RFP alone; (ii) the RFP
spots display actin-dependent stop-and-go streaming
behavior identical to that previously reported for Golgi
stacks (Boevink et al., 1998; NebenfuÈhr et al., 1999); and (iii)
treatment with BFA resulted in clustering of the RFP spots
as expected for plant Golgi stacks (Driouich et al., 1993; Essl
et al., 1999; Satiat-Jeunemaitre and Hawes, 1992a; Satiat-
106
Ram Dixit and Richard Cyr
Jeunemaitre and Hawes, 1992b; Satiat-Jeunemaitre and
Hawes, 1993; Satiat-Jeunemaitre et al., 1996).
The Nag-RFP dual-marker cells allowed us to speci®cally
choose cells containing PPBs, and to directly determine the
relationship between PPB site and Golgi stack distribution.
Our results demonstrate that the PPB site is associated with
a signi®cant increase in Golgi stack frequency in BY-2 cells.
However, it is not known whether this increase in Golgi
stack frequency at the PPB site is due to speci®c recruitment
of Golgi stacks at the PPB site, or is a consequence of the
formation of a phragmosome. NebenfuÈhr et al. (2000)
reported the presence of a cortical Golgi belt in metaphase
cells that was not detectable in interphase cells. However,
as microtubules were not labeled in these cells, the authors
were unable to directly determine the relationship between
PPB site and Golgi stack distribution in interphase, and
whether the Golgi belt in metaphase coincided with the PPB
site. Our observations extend the observations of
NebenfuÈhr et al. (2000) insofar as an increased accumulation of Golgi stacks is indeed detectable at the PPB site.
A correlation between PPB site and increased Golgi stack
frequency raises the possibility that the PPB is capable of
attracting Golgi stacks in its vicinity, and that these stacks
might participate in marking the PPB site. Therefore it
became important to determine whether Golgi secretory
activity is involved in marking the PPB site. We addressed
this question by inhibiting Golgi secretion during PPB
formation using BFA. BFA inhibits Golgi secretion in a
number of plant cells, and inhibition of secretion is
proposed to occur long before any detectable changes in
Golgi morphology (Boevink et al., 1999; Driouich et al.,
1993; Jones and Herman, 1993; Satiat-Jeunemaitre and
Hawes, 1993). Inhibition of Golgi secretion during PPB
formation did not prevent accurate phragmoplast fusion at
the PPB site. Mechanism(s) that correct aberrant initial
phragmoplast trajectory were also intact following BFA
treatment. In addition, a metaphase Golgi belt was never
detected in cells recovering from BFA treatment. Therefore
recruitment of Golgi stacks at the PPB site does not have a
functional role in terms of determination of the cell division
site in BY-2 cells.
(RatST) were ampli®ed from an Arabidopsis thaliana var.
Columbia ¯oral bud cDNA library (gift from Dr June Nasrallah)
and a cell expression plasmid (pSAST2; gift from Dr Sean Munro),
respectively. Nag forward primer: 5¢ AGTCGACA TGGCGAGGATCTCGTGTG 3¢. Nag reverse primer: 5¢ TCCGGTTGTTGCGGCAAGT TCTTCGTCCTGG 3¢. RatST forward primer: 5¢ AGTCGACATGATTCATACCAACTT G 3¢. RatST reverse primer: 5¢ TCCGGTTGTTGCGGCGGCCACTTTCTCCTG 3¢. The red ¯uorescent
protein (RFP) gene (Clontech, Palo Alto, CA) was also ampli®ed
using PCR (Forward primer: 5¢ GCCGCAACAACCGGAGCCATGAGGTCTTCCAAG 3¢; reverse primer: 5¢ TGGATCCCTAAAGGAACAGATGGTG 3¢) to allow the generation of Nag-RFP and
RatST-RFP chimeric genes using two-step recombinant PCR
(Higuchi, 1990). Cloned recombinant PCR products were sequenced to check the sequences of the chimeric genes.
The chimeric genes were introduced between the Cauli¯ower
mosaic virus 35S promoter and nopaline synthase terminator
sequences engineered in the pCAMBIA 1300 plant transformation
vector (CAMBIA, Canberra, Australia). As a control, the RFP gene,
by itself, was also introduced into this plant transformation
vector.
Experimental procedures
All observations were carried out on living cells, immobilized on
poly L-lysine-coated coverslips, maintained in a humid chamber.
All images were collected using a plan-Neo¯uar 40X (NA = 1.3) oil
immersion objective (Zeiss, Thornwood, NY).
Confocal images were obtained using a Zeiss 410 laser scanning microscope (488 nm excitation, 515±565 nm emission for
GFP, and 543 nm excitation, 590LP emission for RFP). Typically,
4 sec scan times and 4-line-averaging was applied for image
acquisition. Quanti®cation of Golgi stacks at the PPB and non-PPB
sites was performed by manually counting the number of discrete
Golgi stacks in a cortical region 6 mm wide. Clusters of
irresolvable Golgi stacks were counted as a single stack.
For epi¯uorescence microscopy, a Zeiss Axiovert S100 TV
microscope was used. Cells were typically illuminated with 10%
Cell culture
The BD2-5 tobacco cell line and culture technique have been
described previously (Granger and Cyr, 2000a). The culture
medium was supplemented with 100 mg l±1 kanamycin (and
40 mg l±1 hygromycin in the case of the dual-marker cell lines)
prior to subculturing cells.
Construction of plant transformation plasmids
Gene segments encoding the transmembrane-stem regions of
Arabidopsis N-acetylglucosaminyl transferase I (Nag; GenBank
accession number AJ243198) and rat a-2,6-sialyltransferase
Generation of dual-marker cell cultures
Nag-RFP, RatST-RFP and RFP plant transformation constructs
were introduced into BD2-5 tobacco cells using Agrobacteriummediated transformation (Granger and Cyr, 2000a). Selection of
dual-marker cells was performed using 100 mg l±1 kanamycin and
40 mg l±1 hygromycin. Several calli (representing independent
transformation events) were used to initiate cell cultures that were
screened for GFP and RFP ¯uorescence.
Chemical treatments
Latrunculin B (LatB; Calbiochem, La Jolla, CA) was prepared as a
2 mM stock solution in dimethyl sulfoxide (DMSO). Brefeldin A
(BFA; Sigma, St Louis, MO) was prepared as a 30 mM stock
solution in absolute ethanol.
Cells were exposed to 10 mM LatB for 30 min, then observed in
the presence of LatB. An equivalent volume of DMSO was used
for the control treatments.
Cells were exposed to 30 or 100 mM BFA for varying periods (as
indicated in the text) with the same results. An equivalent volume
of ethanol was used for the control treatments. BFA treatment
was stopped, when needed, by replacement of the BFA-containing medium with culture medium without BFA, ®ve times. The
BFA washout step took less than 5 min.
Microscopy
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 99±108
Golgi secretion and PPB site 107
light intensity from a variable-intensity mercury arc lamp (Zeiss
AttoArc) and digital images captured with a Hamamatsu Orca
CCD camera (Hamamatsu Corp, Bridgewater, NJ) controlled by
ISEE software (Inovision Corp, Durham, NC). GFP (450±490 nm
excitation, 520±560 nm emission) and RFP (500±540 nm excitation, 570±610 nm emission) ®lter sets were used to discriminate
between the two ¯uorochromes.
Acknowledgements
We thank Drs June Nasrallah and Sean Munro for kindly
providing us with an Arabidopsis ¯oral bud cDNA library and
rat sialyl transferase cDNA, respectively, and Deborah Fisher for
critical reading of the manuscript. This research was supported by
USDA grant # 98-35304-6668.
Supplementary material
The following material is available from http://www.blackwellscience.com/products/journals/suppmat/TPJ/TPJ1202/
TPJ1202sm.htm
Figure S1. Golgi stack movement.
Time-lapse microscopy of Nag-RFP cells. Images were captured at
1 sec intervals for 5 mins.
Figure S2. Latrunculin B-treated cells. Time-lapse microscopy of
Nag-RFP cells treated with 10 mM latrunculin B for 30 mins. Cells
were observed in the presence of latrunculin B. Images were
captured at 1 sec intervals for 4 mins.
Figure S3. DMSO-treated cells.
Time-lapse microscopy of Nag-RFP cells treated with an equivalent volume of DMSO for 30 mins, as a control for the latrunculin
B treatment. Cells were observed in the presence of DMSO.
Images were captured at 1 sec intervals for 4 mins.
Figure S4. BFA-treated cells.
Nag-RFP cells were treated with 30 mM brefeldin A (BFA) for 2 h,
followed by removal of BFA by washing the cells ®ve times with
medium not containing BFA. Images were captured at 1 min
intervals until the end of cytokinesis.
Figure S5. Control cell.
Nag-RFB cells were treated with an equivalent volume of ethanol
for 2 h, as a control for the brefeldin A treatment, followed by
removal of ethanol by washing the cells ®ve times with medium
not containing ethanol. Images were captured at 1 min intervals
until the end of cytokinesis.
References
Asada, T., Kuriyama, R. and Shibaoka, H. (1997) TKRP125, a
kinesin-related protein involved in the centrosomeindependent organization of the cytokinetic apparatus in
tobacco BY-2 cells. J. Cell Sci. 110, 179±189.
Baird, G.S., Zacharias, D.A. and Tsien, R.Y. (2000) Biochemistry,
mutagenesis, and oligomerization of DsRed, a red ¯uorescent
protein from coral. Proc. Natl Acad. Sci. USA, 97, 11984±11989.
Baluska, F., Vitha, S., Barlow, P.W. and Volkmann, D. (1997)
Rearrangement of F-actin arrays in growing cells of intact maize
root apex tissues: a major developmental switch occurs in the
postmitotic transition region. Eur. J. Cell Biol. 72, 113±121.
Boevink, P., Oparka, K., Cruz, S.S., Martin, B., Betteridge, A. and
Hawes, C. (1998) Stacks on tracks: the plant Golgi apparatus
traf®cs on an actin/ER network. Plant J. 15, 441±447.
Boevink, P., Martin, B., Oparka, K., Cruz, S.S. and Hawes, C. (1999)
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 99±108
Transport of virally expressed green ¯uorescent protein
through the secretory pathway in tobacco leaves is inhibited
by cold shock and brefeldin A. Planta, 208, 392±400.
Bowser, J. and Reddy, A.S.N. (1997) Localization of a kinesin-like
calmodulin-binding protein in dividing cells of Arabidopsis and
tobacco. Plant J. 12, 1429±1437.
Burgess, J. and Northcote, D.H. (1968) The relationship between
the endoplasmic reticulum and microtubular aggregation and
disaggregation. Planta, 80, 1±14.
Burke, J., Pettitt, J.M., Schachter, H., Sarkar, M. and Gleeson, P.A.
(1992) The transmembrane and ¯anking sequences of b-1,2-Nacetylglucosaminyltransferase-I specify medial-Golgi localization. J. Biol. Chem. 267, 24433±24440.
Burke, J., Pettitt, J.M., Humphris, D. and Gleeson, P.A. (1994)
Medial-Golgi retention of N-acetylglucosaminyltransferase-Icontribution from all domains of the enzyme. J. Biol. Chem.
269, 12049±12059.
Cho, S.-O. and Wick, S.M. (1989) Microtubule orientation during
stomatal differentiation in grasses. J. Cell Sci. 92, 581±594.
Cleary, A.L. (1995) F-actin redistributions at the division site in
living Tradescantia stomatal complexes as revealed by
microinjection of rhodamin-phalloidin. Protoplasma, 185, 152±
165.
Cleary, A.L. and Hardham, A.R. (1989) Microtubule organization
during development of stomatal complexes in Lolium rigidum.
Protoplasma, 149, 67±81.
Cleary, A.L., Gunning, B.E.S., Wasteneys, G.O. and Hepler, P.K.
(1992) Microtubule and F-actin dynamics at the division site in
living Tradescantia stamen hair cells. J. Cell Sci. 103, 977±988.
Colasanti, J., Cho, S.-O., Wick, S.M. and Sundaresan, V. (1993)
Localization of the functional p34cdc2 homolog of maize in root
tip and stomatal complex cells: association with predicted
division sites. Plant Cell, 5, 1101±1111.
Del Vicchio, A.J., Harper, J.D.I., Vaughn, K.C., Baron, A.T.,
Salisbury, J.L. and Overall, R.L. (1997) Centrin homologues in
higher plants are prominently associated with the developing
cell plate. Protoplasma, 196, 224±234.
Driouich, A., Zhang, G.F. and Staehelin, L.A. (1993) Effect of
brefeldin A on the structure of the Golgi apparatus and on the
synthesis and secretion of proteins and polysaccharides in
Sycamore Maple (Acer pseudoplatanus) suspension-cultured
cells. Plant Physiol. 101, 1363±1373.
Eleftheriou, E.P. (1996) Developmental features of protophloem
sieve elements in roots of wheat (Triticum aestivum L.).
Protoplasma, 193, 204±212.
Essl, D., Dirnberger, D., Gomord, V., Strasser, R., Faye, L., GloÈssl,
J. and Steinkellner, H. (1999) The N-terminal 77 amino acids
from tobacco N-acetylglucosaminyl transferase I are suf®cient
to retain a reporter protein in the Golgi apparatus of Nicotiana
benthamiana cells. FEBS Lett. 453, 169±173.
Galatis, B. (1982) The organization of microtubules in guard cell
mother cells of Zea mays. Can. J. Bot. 60, 1148±1166.
Galatis, B. and Mitrakos, K. (1979) On the differential divisions
and preprophase bands involved in the development of
stomata of Vigna sinensis L. J. Cell Sci. 37, 11±37.
Galatis, B., Apostolakos, P., Katsaros, C. and Loukari, H. (1982)
Preprophase microtubule band and local wall thickening in
guard cell mother cells of some Leguminosae. Ann. Bot. 50,
779±791.
Galatis, B., Apostolakos, P. and Katsaros, C. (1984a) Positional
inconsistency between preprophase microtubule band and
®nal cell plate arrangement during triangular subsidiary cell
and atypical hair cell development in two Triticum species. Can.
J. Bot. 62, 343±359.
108
Ram Dixit and Richard Cyr
Galatis, B., Apostolakos, P. and Katsaros, C. (1984b) Experimental
studies on the function of the cortical cytoplasmic zone of the
preprophase microtubule band. Protoplasma, 122, 11±26.
Gleeson, P.A. (1998) Targeting of proteins to the Golgi apparatus.
Histochem. Cell Biol. 109, 517±532.
Goddard, R.H., Wick, S.M., Sil¯ow, C.D. and Snustad, D.P. (1994)
Microtubule components of the plant cell cytoskeleton. Plant
Physiol. 104, 1±6.
Grabenhorst, E. and Conradt, H.S. (1999) The cytoplasmic,
transmembrane, and stem regions of glycosyltransferases
specify their in vivo functional sublocalization and stability in
the Golgi. J. Biol. Chem. 274, 36107±36116.
Granger, C.L. and Cyr, R.J. (2000a) Microtubule reorganization in
tobacco BY-2 cells stably expressing GFP-MBD. Planta, 210,
502±509.
Granger, C.L. and Cyr, R.J. (2000b) Use of abnormal preprophase
bands to decipher division plane determination. J. Cell Sci. 114,
599±607.
Gunning, B.E.S. and Wick, S.M. (1985) Preprophase bands,
phragmoplasts, and spatial control of cytokinesis. J. Cell Sci.
Suppl. 2, 157±179.
Gunning, B.E.S., Hardham, A.R. and Hughes, J.E. (1978)
Preprophase bands of microtubules in all categories of
formative and proliferative cell division in Azolla roots. Planta,
143, 145±160.
Heikal, A.A., Hess, S.T., Baird, G.S., Tsien, R.Y. and Webb, W.W.
(2000) Molecular spectroscopy and dynamics of intrinsically
¯uorescent proteins: Coral red (dsRed) and yellow (Citrine).
Proc. Natl Acad. Sci. USA, 97, 11996±12001.
Higuchi, R. (1990) Recombinant PCR. In PCR Protocols (Innis,
M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J., eds). New
York, NY: Academic Press, pp. 177±182.
Jaskiewicz, E., Zhu, G.F., Taatjes, D.J., Darling, D.S., Zwanzig,
G.E.
and
Young,
W.W.
(1996)
Cloned
b-1,4acetylgalactosaminyltransferase: subcellular localization and
formation of disul®de bonded species. Glycoconjugate J. 13,
213±223.
Jones, A.M. and Herman, E.M. (1993) KDEL-containing auxinbinding protein is secreted to the plasma membrane and cell
wall. Plant Physiol. 101, 595±606.
Liu, B. and Palevitz, B.A. (1992) Organization of cortical
micro®laments in dividing root cells. Cell Mot. Cytoskel. 23,
252±264.
Liu, B., Marc, J., Joshi, H.C. and Palevitz, B.A. (1993) A g-tubulinrelated protein associates with the microtubule arrays of higher
plants in a cell cycle-dependent manner. J. Cell Sci. 104, 1217±
1228.
Mineyuki, Y. (1999) The preprophase band of microtubules: its
function as a cytokinetic apparatus in higher plants. Int. Rev.
Cytol. 187, 1±49.
Mineyuki, Y., Yamashita, M. and Nagahama, Y. (1991) p34cdc2
kinase homologue in the preprophase band. Protoplasma, 162,
182±186.
Munro, S. (1998) Localization of proteins to the Golgi apparatus.
Trends Cell Biol. 8, 11±15.
NebenfuÈhr, A., Gallagher, L.A., Dunahay, T.G., Frohlick, J.A.,
Mazurkiewicz, A.M., Meehl, J.B. and Staehelin, L.A. (1999)
Stop-and-go movements of plant Golgi stacks are mediated by
the acto-myosin system. Plant Physiol. 121, 1127±1141.
NebenfuÈhr, A., Frohlick, J.A. and Staehelin, A. (2000)
Redistribution of Golgi stacks and other organelles during
mitosis and cytokinesis in plant cells. Plant Physiol. 124, 135±
151.
Nilsson, T., Rabouille, C., Hui, N., Watson, R. and Warren, G.
(1996) The role of the transmembrane-spanning domain and
stalk region of N-acetylglucosaminyltranferase-I in retention,
kin recognition and structural maintenance of the Golgi
apparatus in HeLa cells. J. Cell Sci. 109, 1975±1989.
Opat, A.S., Houghton, F. and Gleeson, P.A. (2000) Medial Golgi
but not late Golgi glycosyltransferases exist as high molecular
weight complexes ± role of the luminal domain in complex
formation and localization. J. Biol. Chem. 275, 11836±11845.
Packard, M.J. and Stack, S.M. (1976) The preprophase band:
possible involvement in the formation of the cell wall. J. Cell
Sci. 22, 403±411.
Palevitz, B.A. (1986) Division plane determination in guard
mother cells of Allium: video time-lapse analysis of nuclear
movements and phragmoplast rotation in the cortex. Dev. Biol.
117, 644±654.
Palevitz, B.A. and Hepler, P.K. (1974) The control of the plane of
division during stomatal differentiation in Allium I. Spindle
reorientation. Chromosoma, 46, 297±326.
Pickett-Heaps, J.D. and Northcote, D.H. (1966) Organization of
microtubules and endoplasmic reticulum during mitosis and
cytokinesis in wheat meristems. J. Cell Sci. 1, 109±120.
Satiat-Jeunemaitre, B. and Hawes, C. (1992a) Reversible
dissociation of the plant Golgi apparatus by brefeldin A. Biol.
Cell. 74, 325±328.
Satiat-Jeunemaitre, B. and Hawes, C. (1992b) Redistribution of a
Golgi glycoprotein in plant cells treated with brefeldin A. J. Cell
Sci. 103, 1153±1156.
Satiat-Jeunemaitre, B. and Hawes, C. (1993) The distribution of
secretory products in plant cells is affected by brefeldin A. Cell
Biol. Int. 17, 183±193.
Satiat-Jeunemaitre, B., Steele, C. and Hawes, C. (1996) Golgimembrane dynamics are cytoskeleton dependent: a study on
Golgi stack movement induced by brefeldin A. Protoplasma,
191, 21±33.
Stals, H., Bauwens, S., Traas, J., Van Montagu, M., Engler, G. and
Inze, D. (1997) Plant CDC2 is not only targeted to the
preprophase band, but also co-localizes with the spindle,
phragmoplast, and chromosomes. FEBS Lett. 418, 229±234.
Tang, B.L., Wong, S.H., Low, S.H. and Hong, W.J. (1992) The
transmembrane domain of N-glucosaminyltransferase-I
contains a Golgi retention signal. J. Biol. Chem. 267, 10122±
10126.
Wick, S.M. (1991) The preprophase band. In The Cytoskeletal
Basis of Plant Growth and Form (Lloyd, C.W., ed.). London:
Academic Press, pp. 231±244.
Wick, S.M. and Duniec, J. (1984) Immuno¯uorescence
microscopy of tubulin and microtubule arrays in plant cells. II.
Transition between the pre-prophase band and the mitotic
spindle. Protoplasma, 122, 45±55.
Yarbrough, D., Wachter, R.M., Kallio, K., Matz, M.V. and
Remington, S.J. (2001) Re®ned crystal structure of DsRed, a
red ¯uorescent protein from coral, at 2.0-AÊ resolution. Proc.
Natl Acad. Sci. USA, 98, 462±467.
Yasuhara, H. and Shibaoka, H. (2000) Inhibition of cell-plate
formation by brefeldin A inhibited the depolymerization of
microtubules in the central region of the phragmoplast. Plant
Cell Physiol. 41, 300±310.
Yasuhara, H., Sonobe, S. and Shibaoka, H. (1995) Effects of
brefeldin A on the formation of the cell plate in tobacco BY-2
cells. Eur. J. Cell Biol. 66, 274±281.
Zhao, L. and Sack, F.D. (1999) Ultrastructure of stomatal
development in Arabidopsis (Brassicaceae) leaves. Am. J. Bot.
86, 929±939.
ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 99±108