Biochem. J. (2012) 445, 413–422 (Printed in Great Britain)
413
doi:10.1042/BJ20112086
Mutational analysis of putative phosphate- and proton-binding sites in the
Saccharomyces cerevisiae Pho84 phosphate:H + transceptor and its effect
on signalling to the PKA and PHO pathways
Dieter R. SAMYN*, Lorena RUIZ-PÁVON*, Michael R. ANDERSSON*1 , Yulia POPOVA†‡1 , Johan M. THEVELEIN†‡ and
Bengt L. PERSSON*†‡2
*School of Natural Sciences, Linnaeus University, SE-391 82 Kalmar, Sweden, †Laboratory of Molecular Cell Biology, Institute of Botany and Microbiology, Katholieke Universiteit
Leuven, Kastelpark Arenberg 31, BE-3001 Leuven-Heverlee, Belgium, and ‡Department of Molecular Microbiology, Vlaams Interuniversitair Instituut voor Biotechnologie (VIB),
Kasteelpark Arenberg 31, BE-3001 Leuven-Heverlee, Belgium
In Saccharomyces cerevisiae, the Pho84 phosphate transporter
acts as the main provider of phosphate to the cell using a proton
symport mechanism, but also mediates rapid activation of the PKA
(protein kinase A) pathway. These two features led to recognition
of Pho84 as a transceptor. Although the physiological role of
Pho84 has been studied in depth, the mechanisms underlying
the transport and sensor functions are unclear. To obtain more
insight into the structure–function relationships of Pho84, we have
rationally designed and analysed site-directed mutants. Using a
three-dimensional model of Pho84 created on the basis of the GlpT
permease, complemented with multiple sequence alignments, we
selected Arg168 and Lys492 , and Asp178 , Asp358 and Glu473 as residues potentially involved in phosphate or proton binding respectively, during transport. We found that Asp358 (helix 7) and Lys492
INTRODUCTION
In Saccharomyces cerevisiae, transport of Pi across the plasma
membrane is mediated by five phosphate transporters, i.e. the
high-affinity transporters Pho84 [1] and Pho89 [2], and three
low-affinity transporters, Pho87 [3], Pho90 and Pho91 [4]. The
high-affinity system is regulated by the phosphate-signalling
PHO pathway [5]. Under external low phosphate conditions,
transcription of the high-affinity transporter genes PHO84 and
PHO89, as well as the secreted acid phosphatase gene PHO5
and other PHO-responsive genes, is up-regulated [6,7]. Under
such phosphate-limiting conditions, the Pho84 protein is the
main permease responsible for the uptake of phosphate in
the cell.
As a member of the phosphate:H + symporter (PHS, TC
2.A.1.9.1) family, belonging to the MFS (major facilitator
superfamily) [8], Pho84 couples an inward flow of external Pi
with the proton-driving force p [9,10]. Moreover, the proton/Pi
ratio was estimated to be 2–3 H + :1 Pi [11,12]. The Pho84
permease (587 amino acid residues) is predicted to consist of 12
transmembrane segments, arranged in two bundles of six helices
[13]. To date the crystal structures of five MFS transporters
have been solved: a glycerol-3-phosphate/phosphate antiporter,
GlpT [14]; a lactose:H + symporter, LacY [15]; the multidrug
resistance protein D, EmrD [16]; the oxalate transporter, OxlT
[17]; and recently the fucose:H + symporter FucP [18], which
has added significantly to our understanding of the structure and
(helix 11) are critical for the transport function, and might be
part of the putative substrate-binding pocket of Pho84. Moreover,
we show that alleles mutated in the putative proton-binding site
Asp358 are still capable of strongly activating PKA pathway
targets, despite their severely reduced transport activity. This
indicates that signalling does not require transport and suggests
that mutagenesis of amino acid residues involved in binding of the
co-transported ion may constitute a promising general approach
to separate the transport and signalling functions in transceptors.
Key words: Pho84, phosphate binding, phosphate transport,
protein kinase A, proton binding, Saccharomyces cerevisiae,
transceptor.
mechanisms of membrane transporters. These high-resolution
structures reveal a common overall architecture in spite of
their sequence divergence. The deduced overall architecture has
strengthened the ‘rocker-switch’ transport mechanism paradigm
for all MFS members [19]. On the basis of these experimentally
determined structures, the predicted structure of several other
MFS members has been in silico modelled. The theoretical model
obtained can be used to rationally design mutant alleles in order
to study structure–function relationships [20,21]. However, the
proposed mechanistic transport model lacks detailed information
concerning the molecular inner workings of these transporters.
Moreover, the diversity in substrate specificity amongst MFS
members hampers any generalization concerning the amino acid
residues involved in the binding of the substrate during transport.
In the case of GlpT, mutational studies, complemented with
molecular dynamics analysis [22,23], have shown that arginine
residues at positions 45 and 269 [14], together with Lys80 [19],
contribute to a positive surface electrostatic potential enabling
initial substrate binding. A similar architecture of the putative
binding site in LacY has been observed, where glutamate residues
at positions 126 and 269, together with Arg144 , are involved
in substrate binding [24]. However, these two proteins are
only distantly related to Pho84 (22 % sequence identity for
GlpT, 25 % for LacY). Thus a molecular understanding of the
mechanism of transport by Pho84 is still hampered by the lack of
experimentally determined structures of proteins with a similar
substrate selectivity.
Abbreviations used: 3D, three-dimensional; H, helix; HPi , high inorganic phosphate; HRP, horseradish peroxidase; LPi , low inorganic phosphate; MFS,
major facilitator superfamily; MSA, multiple sequence alignment; Pho84MUT , Pho84 mutation; Pho84WT , Pho84 wild-type; PKA, protein kinase A; rAPase,
repressible acid phosphatase; SC, synthetic complete; YNB, yeast nitrogen base; YPD, yeast extract/peptone/dextrose.
1
These authors contributed equally to this study.
2
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2012 Biochemical Society
414
D. R. Samyn and others
Pho84 functions not only as a transporter of Pi , but also mediates
rapid activation of PKA (protein kinase A) pathway targets during
growth induction by phosphate in phosphate-deprived fermenting
cells [25]. This has led to the recognition that the transporter is
involved in sensing external Pi levels. Combining the function of a
transporter and a receptor, Pho84 is now considered a transceptor
[26]. Moreover, these two distinct functions are believed to be
related to each other by means of the rocker-switch mechanism.
The binding of a nutrient will induce a conformational change,
which in some way affects a signal-transducing protein to trigger
activation of the PKA pathway [27]. Recently, several nontransported phosphate esters have been shown to be able to interact
with the Pho84 permease, triggering PKA activation [28]. This
indicates that signalling by Pho84 does not require a complete
transport cycle of the substrate.
In addition to signalling the external phosphate condition to
PKA, the level of Pho84 in the plasma membrane affects the
expression level of PHO-responsive genes. Expression of a
functional Pho84 is required for repression of PHO5, and
a loss-of-function mutation in PHO84 results in constitutive
expression of PHO5 [29,30]. It has been argued that, instead of
Pho84 playing a role in communicating the external phosphate
level to the intracellular PHO signalling pathway, an intracellular
phosphate sensor would be involved [4,31]. Moreover, a highthroughput screen of mutants defective in PHO5 regulation
indicated that two small-molecule kinases, Adk1 (adenylate
kinase 1) and Ado1 (adenosine kinase 1), seem to regulate PHO5
expression upstream of Pho81, which acts as a negative regulator
of the Pho80–Pho85 CDK (cyclin-dependent kinase) complex
[32]. Whether Pho84 itself also plays a role in transferring a
plasma membrane-based phosphate-sensing signal directly to the
PHO pathway remains unclear.
In the present study, we have used the Pho84 theoretical
3D (three-dimensional) model (Protein Model DataBase ID
PM0076296) [33], complemented with MSAs (multiple sequence
alignments) of the Pho84 transporter with other inorganic
phosphate transporter homologues, to identify amino acid
residues that might be involved in phosphate and proton binding
during their translocation. In addition to identifying residues of
the putative binding site, we have also obtained a mutant protein,
which severely reduced transport activity, but has retained its
affinity towards the substrate, as measured by [32 P]Pi uptake.
Moreover, this specific mutant protein also seems to have retained
its PKA signalling capacity, but displays a PHO84 loss-offunction phenotype for repression of PHO5.
database. Seven sequences were selected as representatives
of fungi and plants. The Swiss-Prot protein sequences
were retrieved from the NCBI Protein server (http://www.
ncbi.nlm.nih.gov/protein/). Accession numbers and selected
species are: S. cerevisiae Pho84, P25297; Pholiota nameko,
Q96X52; Glomus intraradices, Q96VN6; Glomus versiforme,
Q00908; Hordeum vulgare, Q8H6E0; Oryza sativa, Q8GSD9;
Medicago truncatula, Q8GSG4; Arabidopsis thaliana PHT1-1,
Q8VYM2; Escherichia coli GlpT, Q8FFN6; and E. coli LacY,
P02920. The sequence for GlpT was included, since this
protein served as a modelling template, and LacY is an
additional MFS member for which the structure has been
solved, both originating from E. coli. The pairwise alignments
showed that all proteins, except LacY, were more than 30 %
identical in sequence to Pho84. All residues were mapped on
the Pho84 theoretical model [available at the Protein Model
DataBase website (http://mi.caspur.it/PMDB/), ID PM0076296].
All structural Figures were created using PyMOL (Molecular
Graphics System, Version 1.3, Schrödinger).
EXPERIMENTAL
Growth conditions
Materials and strains
Cells expressing Pho84WT , Pho84WT –Myc and Pho84MUT –Myc
were precultivated aerobically for 12 h in YPD medium at 30 ◦ C
under continuous agitation (transformed cells were kept in the
presence of 200 μg/ml G418), washed twice and inoculated
(D600 = 0.5) in SC (synthetic complete) HPi (high inorganic
phosphate; 10 mM KH2 PO4 ) or LPi (low inorganic phosphate;
200 μM KH2 PO4 ) medium, supplemented with 2 % (w/v)
glucose. Cells in LPi conditions were grown aerobically at 30 ◦ C
and 200 rev./min for 6 h. Samples for phosphate assays and
Western blot analysis were withdrawn at the indicated time points.
32
[ P]Pi (carrier-free) was obtained from PerkinElmer. Anti-rabbit
IgG and chemiluminescence detection kit were obtained from
GE Healthcare. Anti-Myc–HRP (horseradish peroxidase) and
rabbit HRP-conjugated anti-mouse antibodies were obtained from
Invitrogen. All other materials of reagent grade were obtained
from commercial sources. Haploid prototrophic S. cerevisiae
CEN.PK 113-7D (MATa MAL2-8c SUC2) was provided by
Dr Peter Kötter (Institute for Molecular Biosciences, Goethe
University, Frankfurt, Germany).
Strain construction
The PHO84WT (Pho84 wild-type) gene was amplified from the
genome using sense (5 -GAGAGAGAGACATATGATGAGTTCCGTCAATAAAGAT-3 ) and antisense (5 -GAGAGAGAGAGGATCCTGCTTCATGTTGAAGTTGAGA-3 ) primers and
cloned into the pU6H2MYC plasmid [34] using NdeI and BamHI
endonucleases, yielding the construct pU6H2MYC/PHO84WT .
The mutants were prepared by oligonucleotide-directed sitespecific mutagenesis using the plasmid containing the PHO84WT
gene. The synthetic oligonucleotides used are listed in
Table 1. The mutagenesis was performed using the Stratagene
QuikChangeTM II mutagenesis kit, according to the manufacturer’s
protocol. All mutant constructs were confirmed by DNA
sequencing of the entire gene. With pU6H2MYC/PHO84WT and
pU6H2MYC/PHO84MUT (Pho84 mutation) as templates, a PCRamplified cassette containing the sequence encoding the last
1.3 kb of the PHO84WT and PHO84MUT , the sequence encoding
the c-Myc, hexa-histidine epitope and selection [KanR (kanamycin
resistance)] marker, was subsequently transformed into CEN.PK
113 7D [35] and exchanged by homologous recombination. After
selection on YPD [1 % (w/v) yeast extract/2 % (w/v) peptone/2 %
(w/v) glucose]/G418 (200 μg/ml) plates, colonies were restreaked
on fresh YPD/G418 (200 μg/ml) plates and positive colonies were
verified by PCR, sequencing and immunoblot analysis.
Selection of residues for mutagenesis
Spot tests of yeast growth
To identify functionally important amino acid residues in the
Pho84 sequence, a conservation analysis was performed on
the basis of MSAs and calculated using ClustalW. Pho84
homologues were obtained from a BLAST search of the UniProt
After dilution to a D600 of 0.3, a 10-fold dilution series was spotted
on HPi and LPi SC medium containing 200 μg/ml G418. Plates
were incubated at 30 ◦ C and growth was recorded after 3 days of
culture.
c The Authors Journal compilation c 2012 Biochemical Society
Mutational analysis of yeast Pho84
Table 1 Sequence of oligonucleotides used for site-directed mutagenesis
of the PHO84 gene
Mutated codons within each oligonucleotide are shown in bold with the mutated base(s)
underlined.
Amino acid
substitution
Mutated oligonucleotide (5 →3 )
R168A
R168Q
R168E
D178E
D178N
D358E
D358N
E473Q
E473K
K492A
K492Q
K492E
CGTTGCTGTTTTAACATTCTACGCTATTGTCATGGGTATTGGTATC
CGTTGCTGTTTTAACATTCTACCAAATTGTCATGGGTATTGGTATCGG
CTTCGTTGCTGTTTTAACATTCTACGAGATTGTCATGGGTATTGGTATCGGTG
GTATTGGTATCGGTGGTGAGTACCCACTATCTTCTATTA
GGGTATTGGTATCGGTGGTAACTACCCACTATCTTC
GTTCATGGTTTACCTTAGAGGTTGCTTTCTACGGGTTGA
CTGGTTCATGGTTTACCTTAAATGTTGCTTTCTACGGGTT
ACCTTTATTGTTCCTGGTCAGTGTTTCCCAACTCG
CACCTTTATTGTTCCTGGTAAGTGTTTCCCAACTCGT
TCATGGTATTTCTGCTGCATCTGGTGCGGTCGGTGCCATTAT
GTATTTCTGCTGCATCTGGTCAGGTCGGTGCC
GTATTTCTGCTGCATCTGGTGAGGTCGGTGCC
Phosphate transport measurements
Phosphate uptake in intact S. cerevisiae cells expressing Pho84WT –
Myc or Pho84MUT –Myc grown in LPi medium was assayed
by addition of 2 μl of [32 P]Pi (carrier-free, 0.18 Ci/μmol;
1 mCi = 37 MBq) and phosphate to a final concentration of
0.22 mM. For the determination of total transport activity, a
final phosphate concentration of 0.11 mM was used. Cells were
resuspended at 0.1 mg/ml (wet weight) in buffer containing
25 mM Tris-succinate, pH 4.5, and 3 % (w/v) glucose. Aliquots
of 30 μl were incubated for 10 min at room temperature (22◦ C).
After 10 min, 3 ml of ice-cold 25 mM Tris-succinate buffer,
pH 4.5, was added to stop the initial reaction. The cells were
rapidly filtered (Whatman GF/F) and radioactivity retained on the
filters was determined by liquid scintillation spectrometry.
Isolation of plasma membranes and immunoblotting
Yeast membranes were separated on sucrose gradients as
described previously [36], with some minor changes made to
the protocol. Briefly, cells were grown for 6 h in 400 ml of
LPi medium, harvested and resuspended in sucrose breaking
buffer [0.4 M sucrose, 10 mM Tris/HCl, pH 7.6, 1 mM EDTA
and protease inhibitor cocktail (Sigma)]. After the cells were
disrupted with glass beads (425–600 μm; Sigma), the suspension
was cleared from cell debris and unbroken cells by centrifugation
(530 g for 20 min at 4◦ C). The resulting supernatant was
centrifuged at 21 000 g for 40 min at 4 ◦ C, subsequently the
crude membranes were placed on top of a discontinuous sucrose
gradient (0.4, 1.1, 1.65 and 2.25 M sucrose) containing 10 mM
Tris/HCl, pH 7.6, and 1 mM EDTA. After centrifugation at
29 000 rev./min (Beckman SW55 Ti rotor) for 14 h at 4 ◦ C,
fractions of band 3 from the top, which contained the enriched
plasma membranes, were collected and resuspended in sucrose
breaking buffer. After centrifugation for 21 000 g for 60 min at
4 ◦ C, the pellets were dissolved in 20 mM Tris/HCl, pH 7.6,
50 mM NaCl, 10 % (v/v) glycerol, 1 mM EDTA, 0.1 % n-dodecyl
β-D-maltoside, 1 mM DTT, 1 mM PMSF and protease inhibitor
cocktail, and protein concentration was determined using the BCA
(bicinchoninic acid) method (Pierce). Protein samples (3 μg)
were mixed with sample buffer prior to separation by SDS/PAGE
using a 10 % Laemmli system [37]. Immunoblotting was carried
out on PVDF membranes (Immobilon-P; Millipore) according
to the Western blotting protocol (GE Healthcare). The primary
antibodies used in immunoblotting were monoclonal antibodies
415
against the c-Myc epitope tag (anti-Myc–HRP; 1:4000 dilution),
and against Pma1 (plasma membrane marker; Abcam; 1:5000
dilution). The secondary antibody (HRP-conjugated rabbit antimouse) against Pma1 was used at a dilution of 1:5000. After a
short incubation with chemiluminescent substrate, the blot was
exposed to the X-ray film for 1.5 min. The molecular mass of the
separated proteins was determined by the relative mobility of
the pre-stained protein markers (Fermentas).
Acid phosphatase assays
For liquid assays, rAPase (repressible acid phosphatase) activity
was measured using whole cells as a source of enzyme and
p-nitrophenyl phosphate (Sigma) as substrate, essentially as
described previously [38]. Yeast strains were grown overnight in
5 ml of YPD at 30 ◦ C, centrifuged (5000 g for 5 min at 4◦ C)
and washed twice in LPi SC medium (200 μg/ml G418) and
then resuspended in 15 ml of LPi and HPi (200 μg/ml G418) SC
medium. Cells were grown at 30 ◦ C under continuous agitation
for 3 h, after which 80 μl of cell suspension was harvested and
washed once with acetate buffer (60 mM sodium acetate, pH 4.5),
and resuspended in 80 μl of acetate buffer containing 1 mM
p-nitrophenyl phosphate (final concentration). The reaction was
incubated at 25 ◦ C for 1 h before being stopped by addition of
20 μl of saturated Na2 CO3 . Cells were removed by centrifugation
(5000 g for 5 min at 4◦ C) before measuring the A405 . The relative
rAPase activity was determined by the formula A405 /A600 ×t, where
t is the time in minutes of the incubation.
Trehalase activity measurements
Cells were cultured at 30 ◦ C to exponential phase (D600 = 1.0–1.5)
in SD medium [1.7 g/l of YNB (yeast nitrogen base) and 5 g/l of
(NH4 )2 SO4 ] with 2 % (w/v) glucose. Mid-exponential phase cells
were harvested and transferred to phosphate starvation medium
(5.7 g/l YNB without phosphate with ammonium sulfate) with
4 % (w/v) glucose and appropriate auxotrophic supplements.
Cells were starved of phosphate for 3 days at 30 ◦ C under
continuous shaking and starvation medium was refreshed daily.
The phosphate-starved glucose-repressed cells were rapidly
cooled on ice and harvested by centrifugation (5000 g for 5 min
at 4◦ C). The pellet was washed twice with ice-cold 25 mM Mes
buffer, pH 6.0, and resuspended in phosphate starvation medium
with 4 % (w/v) glucose and incubated at 30◦ C with shaking.
After 30 min of incubation, 1 mM KH2 PO4 was added to the
culture. Samples of 75 mg of cells/ml were taken at the indicated
time points. Cells were rapidly cooled by addition of ice-cold
water, centrifuged (5000 g for 5 min at 4◦ C) and re-suspended
in 0.5 ml of ice-cold 25 mM MES buffer, pH 7.0, for extraction.
Crude cell extracts were prepared as described previously [38]
and dialysed (BRL microdialysis system) against 25 mM Mes
buffer, pH 7.0, with 50 μM CaCl2 at 4 ◦ C. Trehalase activity in
dialysed cell extracts was determined using a coupled enzymatic
reaction of glucose oxidase and peroxidase with glucose as
described previously [39]. The specific activity was expressed
as nmol of glucose liberated per min per mg of protein. The
total amount of protein in the samples was determined using a
standard method described previously [40].
RESULTS
Rationale of the mutagenesis design
To identify residues contributing to phosphate binding and/or
translocation, an MSA of Pho84 with selected phosphate
c The Authors Journal compilation c 2012 Biochemical Society
416
Figure 1
D. R. Samyn and others
Rationale of mutagenesis design
(A) Multiple amino acid sequence alignment of the S. cerevisiae Pho84 protein (P25297) with homologues from P. nameko (Q96X52), G. intraradices (Q96VN6), G. versiforme (Q00908), H. vulgare
(Q8H6E0), M. truncatula (Q8GSG4), O. sativa (Q8GSD9), A. thaliana (Q8VYM2), E. coli GlpT (Q8FFN6) and E. coli LacY (P02920). The residues in the transmembrane (TM) helices possibly
involved in phosphate binding in Pho84 are boxed, with the residues selected for site-directed mutagenesis indicated with an arrow at their position. The conservation coding was kept as in ClustalW
analysis. (B) View from the periplasm of the Pho84 structural model (Protein Model DataBase ID PM0076296) with the TM helix number indicated with roman numerals. (C) Side view of the Pho84
structural model with the residues selected for this study indicated on the model. Helices harbouring the residues selected for mutagenesis are represented as cartoons. Arg168 , Asp178 , Asp358 , Glu473
and Lys492 are represented as sticks. Parts of the N- and C-terminus were removed for a better view of the core of the structure. The structural models in (B) and (C) were created with PyMOL (PyMOL
Molecular Graphics System, Version 1.3, Schrödinger).
transporters from plants, fungi and bacteria was performed. The
highest level of conservation amongst the aligned proteins was
found in the transmembrane helices (Figure 1A). However, not
c The Authors Journal compilation c 2012 Biochemical Society
all transmembrane helices of Pho84 are involved in the lining of
the putative translocation channel. For the members belonging
to the MFS, helices 1, 2, 4, 5, 7, 8, 10 and 11 are predicted to
Mutational analysis of yeast Pho84
be channel-lining domains [41]. Since Pho84 is a member of
the MFS, we selected only these helices for further analysis.
This showed that helices 4, 7, 10 and 11 harboured several
highly conserved residues. The amino acid sequence of LacY
and GlpT were included in the alignment. GlpT is an organic
phosphate/inorganic phosphate antiporter [14], which served as a
template for modelling Pho84, and LacY is a sugar/proton coupled
symporter [15]. Highlighted in Figure 1 are the amino acid
residues Arg168 , Asp178 [both in H4 (helix 4)], Asp358 (H7), Glu473
(H10) and Lys492 (H11), which are conserved in all phosphate
carrier proteins used for the MSA. One of the shared features
amongst the MFS members whose crystal structure has been
resolved is the location of the putative substrate-binding site.
For the GlpT and LacY transporters, the hydrophilic substratebinding sites are formed by H1, H4 and H5 of the N-terminal
domain, and H7 and H11 of the C-terminal domain [42]. A
direct consequence of using the GlpT structure as a template
to model the structure of Pho84 is that the putative substratebinding site might be located at a similar position. The conserved
residues were mapped on the Pho84 3D model (Figures 1B
and 1C), showing their predicted localization. On the Pho84
model, Lys492 (H11) is located in a similar position as Arg268
(H7) in GlpT, albeit in a different helix, making it accessible in
the putative binding/translocation site (Supplementary Figure S1
at http://www.BiochemJ.org/bj/445/bj4450413add.htm). Arg168
(H4) seems to be located towards the periplasmic side, and thus
not in the vicinity of the proposed putative binding site. Although
the location seems to be less favourable, it does not exclude Arg168
from being accessible for substrate interaction. The acidic residues
Asp178 (H4) and Asp358 (H7) possess a side chain that is suitable
for interaction with protons or by hydrogen-bond formation with
inorganic phosphate. Both residues are located in the proposed
putative binding site (Figure 1B; Supplementary Figure S1).
Glu473 (H10) was selected on the basis of the observation that
it is conserved in all aligned proteins, except LacY. However,
this residue does not seem to map in the putative binding site,
but rather is located towards the cytoplasmic side of the model
structure, which harbours most of the glutamic acid residues in
Pho84. Moreover, Glu473 is predicted to make an N–O-bridge with
Arg480 [predicted with VMD software; N–O cutoff was set to 5 Å
(1 Å = 0.1 nm), results not shown]. The distance measured
between the glutamic acid anionic carboxylate and the Arg480
guanidium is approximately 4.9 Å. Since the model is that of
an inward-facing conformation, the distance measured might
be reduced when the outward-facing conformation is obtained,
allowing the formation of a salt bridge.
Impact of mutations on the ability of Pho84 to transport phosphate
Candidate amino acid residues involved in phosphate binding
and/or translocation were selected on the basis of their
conservation and their position in the 3D Pho84 structural model
and subsequently subjected to site-directed mutagenesis.
For this purpose, an integration cassette was constructed
originating from the pU6H2MYC vector and containing wildtype or mutant PHO84 alleles. These cassettes were introduced
into the genome at the pho84Δ locus by means of homologous
recombination so that the wild-type or mutant PHO84 alleles were
expressed under the control of the PHO84 promoter.
Spot tests to assess growth of the mutant strains were performed
to rapidly assess changes in phosphate transport capability
(Figure 2). When compared with the wild-type Pho84 strain
(CEN.PK 113 7D PHO84Myc ), the strain with Asp358 in Pho84
replaced by glutamic acid showed drastically reduced growth
Figure 2
417
Spot tests of yeast growth
Pi uptake activity of strains expressing the mutant forms of Pho84 as inferred from the degree
of growth on solid HPi and LPi medium. All strains were plated out in a dilution series, starting
with an A 600 of 0.3 up to 3×10 − 4 . WT, wild-type.
under LPi conditions. Similarly, replacing Lys492 with glutamic
acid also reduced growth under LPi conditions. Hence these two
residues might be of importance for phosphate uptake. All other
mutants displayed wild-type growth under LPi conditions. Under
HPi growth conditions, all mutant strains displayed wild-type
growth.
In order to determine the impact on total transport activity,
Pi uptake was measured in the Pho84WT and Pho84Mut strains
using 110 μM KH2 PO4 over a period of 10 min at pH 4.5.
The values are shown as a percentage of the wild-type levels
(Figure 3A). Three outcomes can be distinguished: (i) replacement
of Glu473 with glutamine or lysine, and replacement of Lys492 with
alanine or glutamine, does not influence Pi uptake activity; (ii)
approximately 50 % reduction in Pi uptake activity is observed
when Arg168 is replaced with alanine, glutamine or glutamic
acid, when Lys492 is replaced with glutamic acid, and when Asp178
is replaced with glutamic acid or asparagine. The reduction in
activity is more pronounced when the charge of the residue is
altered; (iii) replacement of Asp358 with asparagine or glutamic
acid severely reduces or abolishes activity respectively.
As some of the Pho84 mutants exhibited reduced V max values
in comparison with the wild-type Pho84, the plasma membrane
was isolated, fractionated and analysed by immunoblotting. Three
major fractions (i.e. crude membranes, the light-density fraction
and interphase) were quantified by immunoblot analysis. The
immunoblot analysis showed that Pho84WT co-fractionated with
the marker protein, Pma1 (Figures 3B and 3C), and that all mutant
proteins are expressed in a similar manner (Figure 3D). Any
minor variation in the expression signal detected between the
different strains does not count as a reduction in transport. These
immunoblot variations are due to intrinsic experimental errors
that might occur in plasma membrane fractionation.
c The Authors Journal compilation c 2012 Biochemical Society
418
Figure 3
D. R. Samyn and others
Total uptake activity and immunoblot analysis
(A) Phosphate uptake activity as measured with radioactive phosphate in a short-term uptake assay using a saturating phosphate concentration and cells grown in LPi conditions. Wild-type (WT)
activity (15.29 nmol · min − 1 · g − 1 cells, dry weight) was set as 100 %. The results shown represent the means +
− S.E.M. for two independent experiments (n = 8 per experiment). ***P < 0.05,
significantly different from wild-type (one way ANOVA test); the negative control (Neg. control) and D358E values were excluded from the statistical analysis. (B) Immunoblot analysis to detect
enrichment of plasma membranes using anti-Pma1 antibody. Three major fractions were isolated from the top of the centrifugation tube: I, top fraction; II, light density fraction; and III, plasma
membrane fraction. Molecular masses are shown to the right-hand side. (C) Immunoblot analysis to detect enrichment of plasma membranes, using an anti-c-Myc antibody against Pho84WT –Myc.
Three major fractions were isolated from the top: I, top fraction; II, light density fraction; and III, plasma membrane fraction. (D) Expression levels of c-Myc-tagged Pho84 protein in plasma membrane
fractions. All mutant and wild-type strains were grown in LPi conditions, lanes: 1, wild-type; 2, R168A; 3, R168Q; 4, R168E; 5, D178N; 6, D178E; 7, D385N; 8, D385E; 9, E473Q; 10, E473K; 11,
K492A; 12, K492Q; and 13, K492E.
Apparent K m and V max values of the mutant forms of Pho84
Kinetic characteristics of mutant Pho84 transporters
Table 2
To evaluate the contribution that each residue might have to
transporter functionality, we determined the apparent kinetic
parameters, K m and V max . The results are summarized in Table 2.
The estimated K m and V max for Pho84WT in the present study are
−1
−1
61.90 +
− 14.45 μM and 20.28 +
− 1.911 nmol · min · g of cells ,
dry weight, respectively.
All results are from two independent experiments, with four measurements in each experiment.
Values are means +
− S.D. NA, not acquired.
Conserved positively charged residues appear to be important for recognition
and binding of phosphate
Replacing Lys492 with an alanine or glutamic acid, removing
or switching the charge of the side chain respectively, had
a significant effect on the affinity for inorganic phosphate.
Both replacements caused a more than 3-fold increase in Km
(Table 2). Substitution of Lys492 for the uncharged residue
glutamine also resulted in a higher K m , but to a lesser extent.
For K492Q and K492E, the V max displayed only a minor
c The Authors Journal compilation c 2012 Biochemical Society
Protein
V max (nmol · min − 1 · g of cells − 1 , dry weight)
K m (μM)
Wild-type
R168A
R168Q
R168E
D178E
D178N
D358E
D358N
E473Q
E473K
K492A
K492Q
K492E
20.28 +
− 1.91
11.81 +
− 1.14
17.92 +
− 1.60
11.93 +
− 0.71
12.65 +
− 1.09
9.66 +
− 0.87
NA
3.73 +
− 0.36
33.20 +
− 3.41
21.11 +
− 1.11
41.37 +
− 5.65
24.86 +
− 3.70
16.06 +
− 1.57
61.90 +
− 14.54
58.00 +
− 14.29
84.28 +
− 16.96
83.59 +
− 11.22
34.57 +
− 8.82
40.95 +
− 10.43
NA
61.41 +
− 15.00
122.00 +
− 25.17
64.20 +
− 8.35
168.50 +
− 41.61
101.50 +
− 32.16
181.70 +
− 31.29
Mutational analysis of yeast Pho84
Figure 4
419
Acid phosphatase assay
rAPase activity in cells grown under HPi (closed bars) and LPi (open bars) conditions of strains expressing the mutant forms of Pho84. All measurements were performed in duplicate and results
are means +
− S.E.M. WT, wild-type.
difference compared with the wild-type. Replacing Lys492 with
alanine, on the other hand, caused a 2-fold increase in V max ,
and this resulted in a higher steady-state intracellular Pi concentration (Supplementary Figure S2 at http://www.BiochemJ.
org/bj/445/bj4450413add.htm). Replacing Arg168 with glutamic
acid or glutamine increased the affinity 1.4-fold, whereas R168A
did not seem to alter the affinity. In R168A and R168E, the V max is
reduced 2-fold, whereas for R168E there is only a minor change.
Conserved negatively charged residues are important for the kinetics of
transport
Replacing Asp358 with glutamic acid resulted in a complete loss of
transport activity (Table 2). D358N, which mimics the irreversibly
protonated form of aspartic acid, retained its K m , yet the V max
was severely reduced. Substitution of Asp178 with glutamic acid
or asparagine resulted in both cases in a decreased K m and
V max , with the first substitution having more impact. Replacing
Glu473 with a glutamine had a drastic negative impact on the K m ,
yet the V max was only slightly elevated. In the case of E473K, in
which the charge of the side chain is switched, both kinetic parameters are unchanged compared with the wild-type transporter.
Defects in transport by Pho84 alter the expression of Pho5
To find out whether any defect in phosphate binding/transport
caused by one of the mutations in Pho84 would have an influence
on transcriptional expression of the PHO regulon, we assayed
secreted rAPase activity, which is a marker for the repression
activity of the PHO pathway (Figure 4). The wild-type strain (i.e.
CEN.PK 113 7D PHO84Myc ) behaves as expected under HPi and
LPi conditions, showing increased secreted phosphatase activity
under the latter condition. For most of the mutant Pho84 alleles,
there seems to be only a minor variation in secreted phosphatase
activity compared with the wild-type strain under both HPi and LPi
conditions. Only mutations of Asp358 cause a pronounced increase
in secreted phosphatase activity under HPi conditions. This is
consistent with the impairment of transport activity in this allele
and the well-established observation that complete inactivation of
Pho84 causes derepression of secreted phosphatase activity under
HPi conditions [29].
PKA signalling capacity in transport-impaired mutants
Because of the impact observed on the kinetic parameters in
the Asp358 and Asp178 mutant alleles, we determined whether
these alleles are also affected in Pho84 signalling to the PKA
pathway. Measurement of the activity of the PKA target trehalase
in strains expressing these mutant Pho84 proteins revealed that
all of them are still capable of Pho84-mediated PKA activation
(Figure 5). Interestingly, in spite of the severely impaired transport
activity of the D358N protein, nearly normal signalling to
PKA was observed. Even for the D358E allele, for which
transport was virtually absent, signalling to PKA was only
reduced by approximately 50 % (Figure 5). This is consistent
with previous results indicating that non-transported phosphatecontaining compounds can trigger activation of the PKA pathway
through Pho84 [28]. Also, the D178E and D178N mutant proteins,
which displayed a significant reduction in their V max value, show
almost wild-type trehalase activation.
DISCUSSION
Identification of putative residues involved in phosphate and proton
binding
The high-affinity inorganic phosphate transporter, Pho84, of S.
cerevisiae has been studied extensively as the main provider
of inorganic phosphate under conditions of limited supply of
inorganic phosphate. In spite of the extensive information
available on the regulation of expression of this protein, little is
c The Authors Journal compilation c 2012 Biochemical Society
420
Figure 5
D. R. Samyn and others
PKA activation assay
Activation of the PKA target trehalase after addition of 1 mM phosphate to phosphate-starved
cells of strains harbouring the wild-type (䊉), D178E (䉱), D178N (䊐), D358E (䉬) or D358N
(䉫) Pho84 mutant form.
known about the amino acid residues involved in its transport
function. Popova et al. [28] identified residues of the side
chain that were exposed as the phosphate-binding site using
SCAM (substituted cysteine accessibility method). However, such
residues are not necessarily themselves involved in binding the
substrate.
Pho84 is a proton symporter [10] and thus should have
residues involved in binding the negatively charged phosphate
ion and the positively charged proton. In order to identify such
residues, we first performed a MSA of Pho84 with a series of
homologous proteins from other organisms in order to identify
conserved residues. We subsequently mapped these residues on
a structural model to identify those located in transmembrane
helices probably located adjacent to the phosphate translocation
pathway. This approach provided us with a limited set of
residues that fulfil the criteria of being highly conserved amongst
inorganic phosphate transporters, possessing the correct side
chain charge for binding of phosphate or a proton, and localized
within the transporter so that they are probably accessible
for substrate interaction. This approach provided us with five
good candidate residues: the positively charged residues Arg168
and Lys492 for binding phosphate and the negatively charged
residues Asp178 , Asp358 and Glu473 for binding the proton.
Arg168 and Asp178 are both present in transmembrane domain 4,
which contains a glycine-rich sequence motif shared by proton-
Figure 6
coupled phosphate transporters in plants, fungi, bacteria and
mammals (TLCFFR168 FWLGFGIGGD178 YPLSATIMSE) [43].
The mapping analysis reveals that Arg168 is located towards the
periplasmic side of the predicted molecular structure. Because
of this location, it seems unlikely that this residue is involved in
the formation of the putative binding site. Mutational analysis of
Arg168 resulted in only minor differences in activity and kinetic
properties as compared with the wild-type protein. Hence, in spite
of its favourable charge and localization in a more hydrophilic
environment, it seems that Arg168 is not directly involved in
phosphate binding and transport. The slight variation in V max
caused by mutagenesis of Arg168 may be explained by interaction
with the neighbouring Lys108 residue. Together, these two residues
could contribute to a positive electrostatic environment, which
might be of importance in attracting the substrate towards the
binding site or guiding it through the translocation channel. A
similar situation has been proposed for FucP [18]. When the
charge on Arg168 is abolished, Lys108 could still contribute enough
positive charge for phosphate to be attracted to the binding
site and/or guided down the hydrophilic translocation pathway
supporting effective transport, but the reduced efficiency due to
the absence of the Arg168 positive charge would lead to the lower
V max observed.
Residues Asp178 , Asp358 and Lys492 are located somewhat closer
to the cytoplasmic side of the protein and therefore they may form
the putative binding site in Pho84. In GlpT, the phosphate-binding
site is composed of Arg268 and Arg45 [14] (Supplementary Figure
S1), which provide the required positive charges to interact with
the substrate. Lys492 could serve a phosphate-binding function
similar to Arg45 of GlpT. Under acidic conditions, inorganic
phosphate occurs mainly as dihydrogen phosphate (H2 PO4 − ).
This monovalent negatively charged form might interact with
Lys492 . In all alleles with mutant forms of Lys492 , the affinity
towards phosphate is reduced. The need for a positively charged
residue is indicated by the K492A mutation, which causes a loss
in affinity. When mutated to glutamic acid, the reduced affinity
observed might be a consequence of the repulsion between the
negative charges of the residue and phosphate. Introducing a
glutamine has a milder effect on affinity owing to the conserved
polarity of the residue. In all cases, the V max is the same as in the
wild-type transporter or even increases. At first sight, this might
seem contradictory to the loss in affinity.
Of the two negatively charged residues in the putative binding
site, mutational analysis of Asp358 indicates that this residue is
of pivotal importance for transport activity. When replaced by
asparagine, the permease loses transport capacity to a great extent,
but retains normal affinity towards the substrate. This indicates
that this residue is not involved in direct substrate recognition, but
rather in the translocation itself. Since translocation is dependent
on proton coupling, Asp358 appears to be a good candidate residue
Postulated mechanism for H + /Pi co-transport
Schematic overview of the amino acid residues proposed to be involved in the binding of phosphate and the symported proton. The black circle represents a proton and the light grey circle an
inorganic phosphate molecule. Black and grey triangles indicate the concentration gradient of H + and Pi respectively. occl., occluded.
c The Authors Journal compilation c 2012 Biochemical Society
Mutational analysis of yeast Pho84
for binding the co-transported proton. The replacement of Asp358
with Asn, which mimics a protonated form of Glu, still enables
the transporter to bind phosphate with normal affinity in the
binding pocket, but the phosphate is very poorly transported.
This might indicate that, in the wild-type transporter, Asp358
becomes deprotonated followed by the release of phosphate, a
mechanism proposed for the FucP and LacY transporters, where
protonation events are predicted to evoke conformational changes
which allow substrate binding [18,24]. When replacing Asp358
with a glutamic acid, i.e. extending the side chain with one carbon,
the activity is abolished. This might be due to sterical hindrance
by Trp354 . Replacement of Asp178 with either glutamic acid or
asparagine reduces both the K m and V max to a similar extent. The
kinetic behaviour of these mutant alleles suggests a mechanism of
uncompetitive inhibition (results not shown). This might indicate
that Asp178 becomes involved in transport after phosphate has
interacted with Lys492 and Asp358 .
Glu473 is located towards the cytoplasmic side of the protein,
and our mutational analysis indicates that this residue has a
functional role in transport. Whether the predicted N–O- or saltbridge formation with Arg480 is relevant to the transport function
needs further investigation.
Mutagenesis of putative proton binding residues strongly reduces
Pho84 transport without preventing signalling to the PKA pathway
Previous work has identified non-transported phosphatecontaining compounds that were able to trigger rapid activation
of the PKA pathway in a Pho84-dependent manner [28]. This
has provided strong evidence that Pho84 acts as a receptor or
transceptor for phosphate activation of the PKA pathway and
it showed that signalling by the Pho84 transceptor does not
require complete transport of the substrate. Similar results were
obtained for the Gap1 amino acid transceptor [44]. Moreover,
the observation that certain competitive inhibitors of phosphate
transport by Pho84 or amino acid transport by Gap1 were able to
trigger signalling and others not indicated that the ligand substrate
had to induce a specific conformational state in the transceptor,
possibly the occluded or a similar intermediate conformation.
These results suggested that mutagenesis of the amino acid
residues responsible for the binding of the co-transported proton
of these symporters could block the transport without affecting
the signalling capacity. Our present results support this idea.
Mutagenesis of Asp358 to asparagine strongly reduced transport
capacity, but caused only a slight reduction in the signalling
capacity for phosphate activation of the PKA pathway. Even
mutagenesis of Asp358 to glutamic acid, which completely
abolished transport activity, caused only a partial reduction in
phosphate-induced signalling. These two Pho84 alleles are the
first transceptor alleles in which such a clear separation of
transport and signalling is obtained. These results strongly suggest
that the proton symport mechanism is only required for transport
and not for signalling. Hence, binding of phosphate into the
phosphate-binding site of Pho84 is apparently enough to induce
the specific conformation that triggers signalling. Binding of the
proton is not required to obtain a signalling conformation.
Reduction in Pho84 transport activity correlates with reduction in
PHO pathway activity
PHO80, PHO85 and PHO84 are required for repression of PHO5,
and loss-of-function mutations in these genes cause constitutive
expression of PHO5 under HPi conditions [4]. The only two Pho84
alleles for which we observe a similar constitutive expression
421
under HPi conditions are the Asp358 mutant alleles. Immunoblot
analysis shows that both proteins are expressed normally in
the plasma membrane. Since both mutant alleles show strongly
reduced transport, signalling to the PHO pathway seems to
correlate with Pho84 transport activity. Also, in several other
alleles with partially reduced transport activity, a partial elevation
of rAPase activity under HPi conditions can be observed. Hence
it can be concluded that signalling to the PKA and PHO pathway
by the Pho84 transceptor has different requirements and therefore
the mechanisms involved are probably different.
Conclusions
We have succeeded in identifying the Arg168 and Asp358 residues
in the Pho84 phosphate:H + symporter as probably involved in
binding the phosphate molecule and the proton respectively. By
mutating the Asp358 residue, we have obtained the first transceptor
alleles with a clear loss of transport activity without loss of
signalling capacity. This suggests that mutagenesis of putative
proton-binding residues in transceptors may be a valid general
strategy for separating transport and signalling. Finally, we have
obtained new evidence that Pho84 transport activity correlates
with signalling capacity to the PHO pathway, indicating a different
mechanism from that involved in activation of the PKA pathway.
On the basis of our data we suggest the following translocation
trajectory (summarized in Figure 6) and events in which: (i)
Arg168 may be important for the initial interaction with phosphate.
This might be in collaboration with a lysine residue at position
106; (ii) Asp358 and Lys492 seem to be directly involved in the
transport and recognition of phosphate, and we suggest that these
residues are part of the putative binding site. Phosphate ions are
recognized by Lys492 , which might result in a hydrogen bond
formation with Asp358 . In order for the phosphate ions to be
released downstream, Asp358 might have to be deprotonated; (iii)
following the deprotonation of Asp358 , Asp178 becomes protonated
and interacts with the phosphate ion.
AUTHOR CONTRIBUTION
Dieter Samyn wrote the paper, and performed the selection and creation of the mutant
alleles, the functional analysis of the mutant alleles, including spot tests, phosphate
transport measurements, plasma membrane isolation, acid phosphatase assays, data
analysis, and produced the Figures. Lorena Ruiz-Pávon performed the functional analysis
of the mutant alleles, including phosphate transport measurements and data analysis.
Michael Andersson performed immunoblot analysis of isolated plasma membranes. Yulia
Popova performed the trehalase assay. Johan Thevelein wrote the paper. Bengt Persson
supervised the project and wrote the paper.
ACKNOWLEDGEMENT
We thank Ran Friedman for discussing structural biology issues.
FUNDING
This work was supported by the Fund for Scientific Research – Flanders, Interuniversity
Attraction Poles Network P6/14 and the Research Fund of the KULeuven (Concerted
Research Actions) to J.M.T. and by the Swedish Research Council [grant number 6212007-6144 (to B.L.P)].
REFERENCES
1 Bun-ya, M., Nishimura, M., Harashima, S. and Oshima, Y. (1991) The PHO84 gene of
Saccharomyces cerevisiae encodes an inorganic-phosphate transporter. Mol. Cell. Biol.
11, 3229–3238
2 Martinez, P. and Persson, B. L. (1998) Identification, cloning and characterization of a
derepressible Na + -coupled phosphate transporter in Saccharomyces cerevisiae . Mol.
Gen. Genet. 258, 628–638
c The Authors Journal compilation c 2012 Biochemical Society
422
D. R. Samyn and others
3 Bun-ya, M., Shikata, K., Nakade, S., Yompakdee, C., Harashima, S. and Oshima, Y. (1996)
Two new genes, PHO86 and PHO87 , involved in inorganic phosphate uptake in
Saccharomyces cerevisiae . Curr. Genet. 29, 344–351
4 Wykoff, D. D. and O’Shea, E. K. (2001) Phosphate transport and sensing in
Saccharomyces cerevisiae . Genetics 159, 1491–1499
5 Persson, B. L., Lagerstedt, J. O., Pratt, J. R., Pattison-Granberg, J., Lundh, K.,
Shokrollahzadeh, S. and Lundh, F. (2003) Regulation of phosphate acquisition in
Saccharomyces cerevisiae . Curr. Genet. 43, 225–244
6 Ogawa, N., DeRisi, J. and Brown, P. O. (2000) New components of a system for phosphate
accumulation and polyphosphate metabolism in Saccharomyces cerevisiae revealed by
genomic expression analysis. Mol. Biol. Cell 11, 4309–4321
7 Oshima, Y. and Halvorson, H. (1994) Regulation of phosphate metabolism in
Saccharomyces cerevisiae . In Phosphate in Microorganisms: Cellular and Molecular
Biology (Gorini, A. T., Yagil, E. and Silver, S., eds), p. 55, American Society for
Microbiology, Washington
8 Pao, S. S., Paulsen, I. T. and Saier, M. H. (1998) Major facilitator superfamily. Microbiol.
Mol. Biol. Rev. 62, 1–34
9 Fristedt, U., Weinander, R., Martinsson, H. S. and Persson, B. L. (1999) Characterization
of purified and unidirectionally reconstituted Pho84 phosphate permease of
Saccharomyces cerevisiae . FEBS Lett. 458, 1–5
10 Fristedt, U., van Der Rest, M., Poolman, B., Konings, W. N. and Persson, B. L. (1999)
Studies of cytochrome-c oxidase-driven H + -coupled phosphate transport catalyzed by
the Saccharomyces cerevisiae Pho84 permease in co-reconstituted vesicles.
Biochemistry 38, 16010–16015
11 Cockburn, M., Earnshaw, P. and Eddy, A. A. (1975) The stoicheiometry of the absorption
of protons with phosphate and L-glutamate by yeasts of the genus Saccharomyces .
Biochem. J. 146, 705–712
12 Borst-Pauwels, G. W. (1993) Mutual interaction of ion uptake and membrane potential.
Biochim. Biophys. Acta 1145, 15–24
13 Persson, B. L., Petersson, J., Fristedt, U., Weinander, R., Berhe, A. and Pattison, J. (1999)
Phosphate permeases of Saccharomyces cerevisiae : structure, function and regulation.
Biochim. Biophys. Acta, Rev. Biomemb. 1422, 255–272
14 Huang, Y. F., Lemieux, M. J., Song, J. M., Auer, M. and Wang, D. N. (2003) Structure and
mechanism of the glycerol-3-phosphate transporter from Escherichia coli . Science 301,
616–620
15 Abramson, J., Smirnova, I., Kasho, V., Verner, G., Kaback, H. R. and Iwata, S. (2003)
Structure and mechanism of the lactose permease of Escherichia coli . Science 301,
610–615
16 Yin, Y., He, X., Szewczyk, P., Nguyen, T. and Chang, G. (2006) Structure of the multidrug
transporter EmrD from Escherichia coli . Science 312, 741–744
17 Hirai, T., Heymann, J. A., Shi, D., Sarker, R., Maloney, P. C. and Subramaniam, S. (2002)
Three-dimensional structure of a bacterial oxalate transporter. Nat. Struct. Biol. 9,
597–600
18 Dang, S. Y., Sun, L. F., Huang, Y. J., Lu, F. R., Liu, Y. F., Gong, H. P., Wang, J. W. and Yan,
N. E. (2010) Structure of a fucose transporter in an outward-open conformation. Nature
467, 734–738
19 Law, C. J., Maloney, P. C. and Wang, D. N. (2008) Ins and outs of major facilitator
superfamily antiporters. Annu. Rev. Microbiol. 62, 289–305
20 Ruiz-Pavón, L., Karlsson, P. M., Carlsson, J., Samyn, D., Persson, B., Persson, B. L. and
Spetea, C. (2010) Functionally important amino acids in the Arabidopsis thylakoid
phosphate transporter: homology modeling and site-directed mutagenesis. Biochemistry
49, 6430–6349
21 Soares-Silva, I., Sá-Pessoa, J., Myrianthopoulos, V., Mikros, E., Casal, M. and Diallinas,
G. (2011) A substrate translocation trajectory in a cytoplasm-facing topological model of
the monocarboxylate/H + symporter Jen1p. Mol. Microbiol. 81, 805–817
22 Law, C. J., Enkavi, G., Wang, D. N. and Tajkhorshid, E. (2009) Structural basis of
substrate selectivity in the glycerol-3-phosphate:phosphate antiporter GlpT. Biophys.
J. 97, 1346–1353
Received 29 November 2011/14 May 2012; accepted 15 May 2012
Published as BJ Immediate Publication 15 May 2012, doi:10.1042/BJ20112086
c The Authors Journal compilation c 2012 Biochemical Society
23 Enkavi, G. and Tajkhorshid, E. (2010) Simulation of spontaneous substrate binding
revealing the binding pathway and mechanism and initial conformational response of
GlpT. Biochemistry 49, 1105–1114
24 Guan, L. and Kaback, H. R. (2006) Lessons from lactose permease. Annu. Rev. Biophys.
Biomol. Struct. 35, 67–91
25 Giots, F., Donaton, M. C. V. and Thevelein, J. M. (2003) Inorganic phosphate is sensed by
specific phosphate carriers and acts in concert with glucose as a nutrient signal for
activation of the protein kinase A pathway in the yeast Saccharomyces cerevisiae . Mol.
Microbiol. 47, 1163–1181
26 Holsbeeks, I., Lagatie, O., Van Nuland, A., Van de Velde, S. and Thevelein, J. M. (2004)
The eukaryotic plasma membrane as a nutrient-sensing device. Trends Biochem. Sci. 29,
556–564
27 Thevelein, J. M. and Voordeckers, K. (2009) Functioning and evolutionary significance of
nutrient transceptors. Mol. Biol. Evol. 26, 2407–2414
28 Popova, Y., Thayumanavan, P., Lonati, E., Agrochao, M. and Thevelein, J. M. (2010)
Transport and signaling through the phosphate-binding site of the yeast Pho84 phosphate
transceptor. Proc. Natl. Acad. Sci. U.S.A. 107, 2890–2895
29 Ueda, Y. and Oshima, Y. (1975) A constitutive mutation, phoT, of the repressible acid
phosphatase synthesis with inability to transport inorganic phosphate in Saccharomyces
cerevisiae . Mol. Gen. Genet. 136, 255–259
30 Bun-ya, M., Nishimura, M., Harashima, S. and Oshima, Y. (1991) The PHO84 gene of
Saccharomyces cerevisiae encodes an inorganic phosphate transporter. Mol. Cell. Biol.
11, 3229–3238
31 Auesukaree, C., Homma, T., Tochio, H., Shirakawa, M., Kaneko, Y. and Harashima, S.
(2004) Intracellular phosphate serves as a signal for the regulation of the PHO pathway in
Saccharomyces cerevisiae . J. Biol. Chem. 279, 17289–17294
32 Huang, S. and O’Shea, E. K. (2005) A systematic high-throughput screen of a yeast
deletion collection for mutants defective in PHO5 regulation. Genetics 169, 1859–1871
33 Lagerstedt, J. O., Voss, J. C., Wieslander, A. and Persson, B. L. (2004) Structural
modeling of dual-affinity purified Pho84 phosphate transporter. FEBS Lett. 578, 262–268
34 De Antoni, A. and Gallwitz, D. (2000) A novel multi-purpose cassette for repeated
integrative epitope tagging of genes in Saccharomyces cerevisiae . Gene 246, 179–185
35 Gietz, R. D. and Woods, R. A. (2002) Transformation of yeast by lithium
acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 350,
87–96
36 Panaretou, B. and Piper, P. (2006) Isolation of yeast plasma membranes. Methods Mol.
Biol. 313, 27–32
37 Laemmli, U. K. (1970) Cleavage of structural proteins during assembly of head of
bacteriophage-T4. Nature 227, 680–685
38 Tohe, A., Ueda, Y., Kakimoto, S. I. and Oshima, Y. (1973) Isolation and characterization of
acid-phosphatase mutants in Saccharomyces cerevisiae . J. Bacteriol. 113, 727–738
39 Pernambuco, M. B., Winderickx, J., Crauwels, M., Griffioen, G., Mager, W. H. and
Thevelein, J. M. (1996) Glucose-triggered signalling in Saccharomyces cerevisiae :
different requirements for sugar phosphorylation between cells grown on glucose and
those grown on non-fermentable carbon sources. Microbiology 142, 1775–1782
40 Lowry, O. H., Rosebrough, N. J., Farr, A. L. and Randall, R. J. (1951) Protein
measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275
41 Goswitz, V. C. and Brooker, R. J. (1995) Structural features of the
uniporter/symporter/antiporter superfamily. Protein Sci. 4, 534–537
42 Abramson, J., Kaback, H. R. and Iwata, S. (2004) Structural comparison of lactose
permease and the glycerol-3-phosphate antiporter: members of the major facilitator
superfamily. Curr. Opin. Struct. Biol. 14, 413–419
43 Harrison, M. J., Dewbre, G. R. and Liu, J. (2002) A phosphate transporter from Medicago
truncatula involved in the acquisition of phosphate released by arbuscular mycorrhizal
fungi. Plant Cell 14, 2413–2429
44 Van Zeebroeck, G., Bonini, B. M., Versele, M. and Thevelein, J. M. (2009) Transport and
signaling via the amino acid binding site of the yeast Gap1 amino acid transceptor. Nat.
Chem. Biol. 5, 45–52
Biochem. J. (2012) 445, 413–422 (Printed in Great Britain)
doi:10.1042/BJ20112086
SUPPLEMENTARY ONLINE DATA
Mutational analysis of putative phosphate- and proton-binding sites in the
Saccharomyces cerevisiae Pho84 phosphate:H + transceptor and its effect
on signalling to the PKA and PHO pathways
Dieter R. SAMYN*, Lorena RUIZ-PÁVON*, Michael R. ANDERSSON*1 , Yulia POPOVA†‡1 , Johan M. THEVELEIN†‡ and
Bengt L. PERSSON*†‡2
*School of Natural Sciences, Linnaeus University, SE-391 82 Kalmar, Sweden, †Laboratory of Molecular Cell Biology, Institute of Botany and Microbiology, Katholieke Universiteit
Leuven, Kastelpark Arenberg 31, BE-3001 Leuven-Heverlee, Belgium, and ‡Department of Molecular Microbiology, Vlaams Interuniversitair Instituut voor Biotechnologie (VIB),
Kasteelpark Arenberg 31, BE-3001 Leuven-Heverlee, Belgium
Figure S1
Putative binding sites in Pho84
Overlap between the GlpT crystal structure (blue) and Pho84 in silico (yellow) structure. The
residues indicated are part of the binding site in GlpT (Arg269 and Arg45 ; blue sticks) and
the putative binding site of Pho84 (Asp178 , Asp358 and Lys492 ; yellow sticks).
Figure S2
Saturation kinetics in wild-type and mutant Pho84 forms
Assays were carried out using different concentrations of KH2 PO4 , up to 220 μM for wild-type
(WT) and all mutant forms of Pho84.
Received 29 November 2011/14 May 2012; accepted 15 May 2012
Published as BJ Immediate Publication 15 May 2012, doi:10.1042/BJ20112086
1
2
These authors contributed equally to this study.
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2012 Biochemical Society