TOXICOLOGICAL SCIENCES 87(2), 483–496 (2005)
doi:10.1093/toxsci/kfi251
Advance Access publication July 7, 2005
Induction of Fibroblast Growth Factor-9 and Interleukin-1a Gene
Expression by Motorcycle Exhaust Particulate Extracts and
Benzo(a)pyrene in Human Lung Adenocarcinoma Cells
Tzuu-Huei Ueng,*,1 Chia-Chi Hung,* Min-Liang Kuo,* Ping-Kun Chan,* Shih-Hsiung Hu,* Pan-Chyr Yang,†
and Louis W. Chang‡
*Institute of Toxicology and †Department of Internal Medicine, College of Medicine, National Taiwan University, Taipei, Taiwan, ROC, and ‡Division of
Environmental Health and Occupational Medicine, National Health Research Institute, Kaohsiung, Taiwan, ROC
Received March 22, 2005; accepted June 23, 2005
Motorcycle exhaust particulates (MEP) contain carcinogenic
polycyclic aromatic hydrocarbons including benzo(a)pyrene. This
study has determined the ability of MEP to alter the expression of
select genes from drug metabolism, cytokine, oncogene, tumor
suppressor, and estrogen signaling families of human lung
adenocarcinoma CL5 cells. cDNA microarray analyses and
confirmation studies were performed using CL5 cells treated with
100 mg/ml MEP extract for 6 h. The results showed that MEP
increased the mRNA levels of metabolic enzymes CYP1A1 and
CYP1B1, proinflammatory cytokines interleukin (IL)-1a, IL-6,
and IL-11, fibroblast growth factor (FGF)-6 and FGF-9, vascular
endothelial growth factor (VEGF)-D, oncogene fra-1, and tumor
suppressor p21. In contrast, MEP decreased tumor suppressor Rb
mRNA in CL5 lung epithelial cells. Treatment with 10 mM
benzo(a)pyrene for 6 h altered gene expression profiles, in a
manner similar to those by MEP. Induction of IL-1a, IL-6, IL-11,
and FGF-9 mRNA by MEP and benzo(a)pyrene was concentration
and time dependent. Cotreatment with 2 mM N-acetylcysteine
blocked the MEP- and benzo(a)pyrene-mediated induction.
Treatment with MEP or benzo(a)pyrene increased IL-6 and IL-11
releases to CL5 cell medium. Incubation of human lung
fibroblast WI-38 with MEP- or benzo(a)pyrene-induced CL5
conditioned medium for 4 days stimulated cell growth of the
fibroblasts. Inhalation exposure of rats to 1:10 diluted motorcycle exhaust 2 h daily for 4 weeks increased CYP1A1, FGF-9,
and IL-1a mRNA in lung. This present study shows that MEP
and benzo(a)pyrene can induce metabolic enzyme, inflammatory
cytokine, and growth factor gene expression in CL5 cells and
stimulate lung epithelium-fibroblast interaction.
Key Words: motorcycle exhaust particulate; benzo(a)pyrene;
fibrobalst growth factor; interleukin; lung epithelial cell.
The authors certify that all research involving human subjects was done
under full compliance with all government policies and the Helsinki
Declaration.
1
To whom correspondence should be addressed at Institute of Toxicology,
College of Medicine, National Taiwan University, 1 Jen Ai Road, Section 1,
Taipei, Taiwan, ROC. Fax: 886–2–2314–0217. E-mail: [email protected].
edu.tw.
The emissions of motorcycle exhaust (ME) are a major
source of air pollution in areas where motorcycles are
a popular means of transportation. The 2- and 4-stroke
motorcycle engines have smaller capacity and poorer combustion efficiency than diesel and gasoline engines. ME also
contains higher levels of carcinogen benzene than exhaust
from gasoline and diesel engines (Jemma et al., 1995). The
motorcycle commuters, therefore, are exposed to higher
levels of benzene, as compared to car commuters (Chan
et al., 1993). Carcinogenic polycyclic aromatic hydrocarbons
(PAH) such as benzo(a)pyrene, benz(a)anthacene, and benzo
(g,h,i)perylene have been detected in the organic solvent
extracts of ME particulates (MEP) from 2-stroke engine (Ueng
et al., 2000). The 2-stroke engine is distinctively different from
other vehicle engines in that the former requires mixing motor
oil with fuel prior to combustion. Studies of exhaust from
this type of engine are of environmental and toxicological
significance because, in addition to motorcycles, the 2-stroke
engines are also widely used in a variety of applications
including outboard boat motors, snowmobiles, lawn mowers,
and trimmers.
ME and MEP have many toxicological properties. For
example, ME inhalation exposure increased lipid peroxidation and decreased cytochrome P450 (CYP) 2B1 protein in
rat lung (Ueng et al., 2004). Treatment of human lung cancer
cells with organic extracts of MEP increased oxidative stress
and DNA damage and decreased gap junctional intercellular
communication (Kuo et al., 1998). Furthermore, MEP extract
was found to enhance vasoconstriction in organ culture of rat
aortas and induce inflammation and hyperresponsiveness in
mouse airways (Lee et al., 2004; Tzeng et al., 2003).
Airway epithelium is a physical barrier to inhaled particulates and toxicants and a critical cell type in the pathogenesis
of lung disease and cancer. The lung epithelial cells are
responsive to the stimulatory effects of diesel exhaust particulates (DEP), which induce production of cytokines and
mediators in human bronchial epithelial cells (Kawasaki
et al., 2001; Steerenberg et al., 1998). Induction of these
Ó The Author 2005. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved.
For Permissions, please email: [email protected]
484
UENG ET AL.
inflammatory mediators is believed to be one of the etiological
factors for asthma and chronic obstructive pulmonary disease
(Mills et al., 1999). Information regarding the effect of MEP on
cytokine production by lung epithelium remains to be explored.
Airway epithelium is a target site of cancers such as lung
adenocarcinoma, which has a high female-to-male ratio and
a large proportion of nonsmokers. Gene and environment
interactions could possibly contribute to the high female
susceptibility to lung adenocarcinoma. CYP enzymes are
involved in activation of pulmonary PAH carcinogens and
mammary carcinogen 17b-estradiol. MEP induced CYP1A1
and CYP1B1 expression in CL5 female lung epithelial
adenocarcinoma cell line (Wang et al., 2002). Oncogene,
tumor suppressor, and estrogen signaling genes may play
significant roles in female lung carcinogenesis. MEP interactions with these genes still need to be elucidated.
The major objective of our studies was to investigate the
interaction of MEP with genes important in the development of
lung disease and cancer in human lung epithelial cells. In this
regard, CL5 cells were treated with MEP extracts, and cDNA
microarrays analyses were conducted using arrays consisting
of 255 genes selected from the metabolic enzyme, cytokine,
oncogene, tumor suppressor, and estrogen signaling families.
Gene alteration and bioactivity studies were extended to
include the prototypic chemical carcinogen benzo(a)pyrene,
for mechanistic and comparison purposes.
PAH of MEP extract was quantified by means of an external calibration curve
built from standard PAH solutions of 2, 5, 10, and 50 lg/ml. If the target PAH
analyte exceeded the linear range of the calibration standards, the MEP extract
sample was further diluted and reanalyzed.
Cells and treatments. The human lung epithelium cell line CL5 was
derived from a lung adenocarcinoma tumor specimen of a 40-year-old women
patient at the Department of Internal Medicine, National Taiwan University
Hospital, Taipei, Taiwan. The cell line has been single-cell cloned and
maintained in RPMI 1640 medium supplemented with 10% fetal calf serum,
2 mM L-glutamine, 100 IU/ml penicillin, 100 lg/ml streptomycin, and 2.0 g/l
sodium bicarbonate at 37°C in a humidified atmosphere of 5% CO2. Human
bronchial epithelial BEAS-2B cells immortalized with SV40 (American Type
Culture Collection, Manassas, VA) were gifts from Dr. Pinpin Lin, Institute of
Toxicology, Chung Shan Medical University, Taichung, Taiwan. BEAS-2B
cells were maintained in serum-free LHC-9 medium with glutamine
(BioSource International Inc., Rockville, MD). WI-38 human normal lung
fibroblast (American Type Culture Collection) was obtained from Food
Industry Research and Development Institute, Hsinchu, Taiwan. WI-38 cells
were maintained in minimum essential medium (MEM) supplemented with
10% fetal bovine serum, 2 mM L-glutamine, 0.1 mM nonessential amino acids,
1.0 mM sodium pyruvate, and 1.5 g/l sodium bicarbonate.
Lung cells were used when the monolayer reached near confluence. The
cell density was about 10 3 106 cells/dish in 10-cm culture dishes for treatment. MEP extract or test compound was dissolved in dimethyl sulfoxide
(DMSO) and added to the medium so that DMSO concentration in the medium
was less than 0.1%. Control cells were treated with 0.1% DMSO in medium.
Cell viability was determined using the colorimetric 3-(4,5-dimethylthiazol2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Carmichael et al., 1987).
Peroxide formation was determined using the oxidation-sensitive probe
2#,7#-dichlorofluorescin diacetate (DCFH-DA) (Lebel et al., 1992).
Preparations of MEP extract and washed MEP. Organic solvent extracts
of MEP were prepared as described previously (Ueng et al., 2000). A 1992
Yamaha Cabin motorcycle with a 2-stroke 50-cc engine and a variable
carburetor was used. An aerosol monitor model 8520 DUSKTRAK (TSI,
Inc., Shoreview, MN) was used to determine the original concentrations of ME
particles. The mean values of particles concentrations were: PM1, 118 mg/m3;
PM2.5, 216 mg/m3; and PM10, 228 mg/m3. MEP were collected on 0.5-lm
quartz filters. Soxhlet extraction was carried out in dark for 24 h using
dichloromethane:hexane (1:1). The MEP extract was rotor-evaporated to
dryness and stored in the dark at ÿ20°C until analysis. The washed MEP were
prepared essentially as described by Yin et al. (2004). MEP were suspended in
acetone by sonication of the quartz filters. After solvent removal, MEP were
washed consecutively using sterile phosphate-buffered solution, pH 7.4,
dichloromethane, and acetone:methanol (1:1) mixture. The washed MEP were
air dried, weighed, and stored in the dark at ÿ20°C until analysis.
cDNA probe preparation and cDNA microarray analysis. Gene expression profile was analyzed using nonradioactive GEArray pathway-specific
expression arrays (SuperArray Inc., Bethesda, MD). The five arrays used were
the human drug metabolism and common cytokine gene arrays, consisting of
96 genes each, and the human cancer/oncogene, cancer/tumor suppressor, and
estrogen signaling pathway arrays, each consisting of 23 genes. There were
cDNA fragments of 255 individual genes on these nylon-membrane arrays, and
their gene tables are available (www.superarray.com). Total RNA was isolated
from CL5 cells as described previously (Wang et al., 2001) and converted to
biotinylated cDNA probes by reverse transcription with a dNTP mix containing
biotin-dUTP. Biotinylated cDNA probes were hybridized to gene-specific
cDNA fragments spotted on the membranes following manufacture’s protocol.
The GEArray membrane was then blocked with GEAblocking solution and
incubated with alkaline phosphatase conjugated streptavidin. The relative gene
expression levels were detected by chemiluminescence signal using the
alkaline phosphatase substrate, CDP-Star, and X-ray film. The relative
abundance of a particular transcript was estimated by comparing its signal
intensity to the signals derived from internal hybridization controls b-actin and
GAPDH. Image analysis and spot quantitation were carried out using GenePix
3.0 program (Axon Instruments, Union City, CA).
Gas chromatography/mass spectrometry (GC/MS) analysis of MEP
extract. The MEP extract was analyzed for PAH using a Hewlett-Packard
6890 gas chromatograph and a 5973 mass spectrometer equipped with a 7673
autosampler and an HP-5MS capillary column (60 m 3 0.25 mm ID, 0.25 lm
film thickness). The GC/MS operation conditions were as described previously
(Ueng et al., 2000). Helium was used as the GC carrier gas. Following sample
injection, the GC column was held at 80°C for 0.1 min, temperature
programmed to 190°C at 10°C/min, 260°C at 3.5°C/min, and 300°C at
1.4°C/min. The MS was operated under 280°C detector temperature at 70 eV
in the scan and selected ion models for qualitative and quantitative analyses,
respectively. The GC column was calibrated with a standard U.S. Environmental Protection Agency 610 Polynuclear Aromatic Hydrocarbons Mixture
consisting of 16 priority PAH pollutants (Supelco, Inc., Bellefonte, PA). Each
Real-time reverse transcriptase-polymerase chain reaction (RT-PCR)
analysis. Five lg total RNA were reverse transcribed using 1X RT, 2.2 mM
MgCl2, 2.0 mM dNTP, 0.2 U/ml RNAsin, 0.5 mM random hexamer primers,
and 0.3 U/ll MMLV reverse transcriptase in 25 ll reactions using a 2-step
cycle: 70°C, 5 min and 37°C, 2 h. Reverse transcription reagents were
purchased from Promega Corp., Madison, WI. The resulting cDNA was used in
subsequent real-time RT-PCR reactions with fluorescence detection using an
ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City,
CA). Reaction was carried out in microAmp 96-well reaction plates, SYBR
Green PCR Master Mix 2X, DNA polymerase, dNTPs with dUTP, forward and
reverse primers (0.15 lM each) (Invitrogen Corp., Carlsbad, CA), and 200 ng
cDNA in a final volume of 25 ll. Amplification parameters were: denaturation
at 94°C 10 min, followed by 45 cycles of 95°C, 15 s; 60°C, 60 s. All primers
MATERIALS AND METHODS
485
FGF-9 INDUCTION BY MEP AND BENZO(A)PYRENE
TABLE 1
Oligonucleotide Primers Used for Real-Time RT-PCR Analysis of Metabolic Enzyme, Cytokine, Oncogene, Tumor Suppressor,
and Estrogen Signaling Pathway Genes Expression of Human Lung Adenocarcinoma CL5 Cells
Primer name
COX7RP
CYP1A1
CYP1B1
CYP3A7
FGF-6
FGF-9
fra-1
IL-1a
IL-6
IL-11
IL-15
IL-22
p21
p53
Rb
SHC
TNSF10
VEGF-C
VEGF-D
Forward primer (5#-3#)
Reverse primer (5#-3#)
TAGTGGCTTCACGCAGAAGTTG
TGGTCTCCCTTCTCTACACTCTTGT
TCAACCAGTGGTCTGTGAATCAT
GCTATGAAACCACGAGCAGTGTT
AACGCCCAGCTTCCAAGAA
TGTCGCATGCATAATGTATGATG
CCACACCCTCCCTAACTCCTT
TGGCTCATTTTCCCTCAAAAGTTG
CTGCGCAGCTTTAAGGAGTTC
ATGGTGGCTCACGCCTGTA
GATGGATGGCTGCTGGAAA
TCACCAGTTGCTCGAGTTAGAATT
GCCGGCTGATCTTCTCCAA
CTCTCCCCAGCCAAAGAAGA
ACAATCAAAGGACCGAGAAGGA
CGGACTAAGGATCACCGCTTT
GCTGAGGCAGGAGAATCGTTT
GTGTCAGGCAGCGAACAAGAC
CTGGAACAGAAGACCACTCTCATC
ATAGGTGGTGCTTCTGTGGAAAC
ATTTTCCCTATTACATTAAATCAATGGTTC
CCAAGAATCGAGCTGGATCAA
TGCACTTTCTGCTGGACATCA
TGACTCGTAGGCATTGTAATTGTTG
GAGAAGCCTTTAAGTGCAGAACAAA
GCGATGAGCTGAGGCACAA
AGAAATCGTGAAATCCGAAGTCAAG
CAATCTGAGGTGCCCATGCTA
GGTCTCGAACTCTTGGACTTCAG
CTCAAAGCCACGGTAAATCCTTA
CCATAAGGAAAGAGCTCACAGATTT
TCGCGCTTCCAGGACTACA
TCACGCCCACGGATCTG
CAGTGTGATTATTCTGGAGAGGAAGA
GAGATGATGGGCAAGTGATTGTC
GCTGGAGTGTAGTGGCATGATCT
TTCCTGAGCCAGGCATCTG
TCGCAACGATCTTCGTCAAA
Note. Primers were designed using PrimerExpress Software, and real-time fluorescence detection was conducted using an ABI Prism 7700 Sequence Detection
system. PCR reactions were carried out in a PCR buffer Master Mix 2X, DNA polymerase, dNTPs with dUTP, forward and reverse primers, and cDNA as
described in Materials and Methods.
and probes were designed using PrimerExpress software (Table 1). Samples
were analyzed in triplicate, and b-actin was used as an endogenous control.
Quantitation of mRNA transcription was performed using a relative
quantitation method with standard curves constructed from five log RNA
concentrations of a specific gene or b-actin and their respective CT values. The
input amount of a specific gene was calculated from its standard curve and
normalized to the input amount of b-actin calculated from its standard curve.
The relative difference between treatment and control groups was calculated
from the ratio of the amount of specific gene to that of b-actin in each group.
RT-PCR analysis. Two lg total RNA were isolated from CL5, BEAS-2B
cells, or rat lung. cDNA synthesis and PCR were conducted as described
previously (Wang et al., 2001). PCR primers for CYPs, cytokines, and internal
controls were synthesized (Gibco/BRL, Life Technologies, Inc., Gaithersburg,
MD) according to the published sequences (Table 2). All reactions were
conducted with b-actin or cyclophilin primers as internal controls. PCR
products were separated on 2% agarose gels and stained with ethidium
bromide. Intensity of PCR product was quantitated using an IS-1000 Digital
Imaging System (Alpha Innotech Corporation, San Leandro, CA) and
normalized against the intensity of internal control b-actin or cyclophilin.
Relative intensity of target gene PCR product from treated cell culture or rats
was calculated by dividing its intensity by the corresponding intensity from
control cells or rats.
Preparation of cell lysate. CL5 cells were harvested by scraping and
washed in a phosphate buffered saline solution. The following procedures were
carried out at 4°C. Cell suspension was centrifuged at 1,500 rpm for 3 min. The
cell pellet was washed and sonicated in 0.1 M potassium phosphate buffer, pH
7.4. Cell homogenate was centrifuged at 9,000 3 g for 20 min, and the resulting
supernatant, cell lysate, was stored at ÿ80°C prior to analyses of cytokines
concentrations.
Enzyme-linked immunosorbent assay (ELISA). CL5 cells in maintenance medium were plated at 1 3 105 cells per well in 6-well tissue culture
plates. After seeding overnight, maintenance medium was changed to
experimental medium consisting of RPMI 1640 medium supplemented with
1% charcoal-treated fetal calf serum. After 12 h incubation, the medium was
removed, and 1 ml fresh experimental medium containing 100 lg/ml MEP
extract or 10 lM benzo(a)pyrene was added to each well. To control cultures,
0.1% DMSO in fresh medium was added. Twenty-four h after treatment, the
cell-conditioned medium was collected by centrifugation and stored at ÿ20°C
until ELISA. IL-1a, IL-6, and IL-11 levels of conditioned media were
determined by ELISA using human Quantikine human kits (R&D Systems
Inc., Minneapolis, MN). Concentrations of these cytokines in cell lysate were
similarly determined.
Bioactivity assay. CL5 cells in maintenance medium were plated in 6-cm
tissue culture dishes at 5 3 105 cells per dish. After seeding overnight,
maintenance medium was changed to experimental medium consisting of
RPMI 1640 medium supplemented with 1% charcoal-treated fetal calf serum.
After 12 h incubation, the medium was removed and 5 ml fresh experimental
medium containing 100 lg/ml MEP extract or 10 lM benzo(a)pyrene was
added to each dish. To control cultures, 0.1% DMSO in fresh medium was
added. Twenty-four h after treatment, the CL5 cell-conditioned medium
was collected by centrifugation and stored at ÿ20°C until use. WI-38 cells in
maintenance medium were seeded into 24-well culture plates at 1 3 104 cells
per well. After seeding overnight, fibroblasts were serum-deprived for 16 h with
serum-free MEM with supplements. Following serum-deprivation, the serumfree medium was replaced with experimental medium, prepared by 1:1 dilution
of CL5 cell-conditioned medium with serum-free MEM with supplements.
The experimental medium was replaced at 48 h after incubation. Cell growth of
WI-38 fibroblast was determined at 96 h. Cells were fixed and stained with
sulforhodamine B as described by Skehan et al. (1990). The bound dye was
solubilized, and its absorbance was read at 490 nm using an ELISA reader.
Experimental animals and ME inhalation exposure. Seven-week-old
female Wistar rats were purchased from the Animal Center of the College of
Medicine, National Taiwan University, Taipei, Taiwan. Before experiments
began, the animals were allowed 1 week of acclimation at the animal quarter.
486
UENG ET AL.
TABLE 2
Oligonucleotide Primers and Thermal Conditions for RT-PCR Analysis of Cytochromes P450, Proinflammatory Cytokines,
Growth Factors, and Internal Controls of Human Lung Adenocarcinoma CL5 Cells and Rats
Gene
hCYP1A1
hCYP1B1
hIL-1a
hIL-6
hIL-11
hIL-15
hFGF-9
hVEGF-D
hb-Actin
rCYP1A1
rIL-1a
rFGF-9
rCyclophilin
Primer Sense
Primer sequence
FP
RP
FP
RP
FP
RP
FP
RP
FP
RP
FP
RP
FP
RP
FP
RP
FP
RP
FP
RP
FP
RP
FP
RP
FP
RP
TCACAGACAGCCTGATTGAG
GATGGGTTGACCCATAGCTT
AACGTCATGAAGTGCCGTGTGT
GGCCGGTACGTTCTCCAAATC
CAAGGAGAGCATGGTGGTAGTAGCAACCAACG
TAGTGCCGTGAGTTTCCCAGAAGAAGAGGAGG
CTCCTTCTCCACAAGCGCCTTC
GCGCAGAATGAGATGAGTTGTC
ACTGCTGCTGCTGAAGACTCGGCTGTGA
ATGGGGAAGAGCCAGGGCAGAAGTCTG
CAGTGCTACTTGTGTTTACTTC
GCTAGGATGATCAGATTTTC
AGCCCGGTTTTGTTAAGTG
AGTATCGCCTTCCAGTGTC
GTTGCAATGAAGAGAGCCTT
TCCCATAGCATGTCAATAGG
GCACTCTTCCAGCCTTCC
GCGCTCAGGAGGAGCAAT
CCATGACCAGGAACTATGGG
TCTGGTGAGCATCCAGGACA
CTAAGAACTACTTCACATCCGCAGC
CTGGAATAAAACCCACTGAGGTAGG
AGGCAGCTGTACTGCAGGAC
TAGTTCAGGTACTTTGTCAGG
CAGACAAAGTTCCAAAGACAG
CTTGCCATTCCTGGACCCAAAACG
PCR
product (bp)
T
Cycles
432
58
28
Hakkola et al., 1996
360
62
24
Dohr et al., 1995
407
65
28
Mohri et al., 2002
583
58
28
Zhang et al., 2003
322
58
30
Auernhammer and Melmed, 1999
314
58
30
Asadullah et al., 2000
401
57
34
Tsai et al., 2002
213
58
35
Rutanen et al., 2003
228
58
22
Guidice et al., 1997
341
58
24
Schilter et al., 2000
623
60
38
Jordan et al., 2001
411
57
38
Cancilla et al., 1999
377
62
35
Agardh et al., 2002
Reference
Note. RT-PCR was carried out in the presence of the forward (FP) and reverse primer (RP) under the thermocycle conditions at the indicated temperature (T)
and cycle numbers. The PCR products in base pair (bp) from human lung adenocarcinoma CL5 cells and rats were in agreement with the PCR products from their
respective references.
In ME inhalation studies, the animals were exposed to 1:10 diluted ME using
a head-nose-only inhalation chamber (Technical and Scientific Equipment
GMBH, Bad Hamburg, Germany). The animals were exposed to ME from 9 to
10 A.M. and 4 to 5 P.M. daily, Monday through Friday, for 4 weeks. Control rats
were exposed to clean air only. The animal maintenance and the inhalation
chamber and exposure conditions were described previously (Ueng et al., 2004).
The exposure chamber atmospheres were measured using an aerosol monitor
model 8520 DUSKTRAK with a cutoff at 10 lm and a combustion analyzer
model CA-6200 (TSI, Inc.). The control and ME exposure atmospheres components and their mean concentrations were: particles, 0.5 and 21.5 mg/m3;
carbon monoxide, 0.2 and 5.8 ppm; carbon dioxide, 0 and 0.3%; nitric oxide,
0 and 4.5 ppm; nitric dioxide, 0 and 0 ppm; and oxygen, 20.5 and 20.3%, respectively. Animals were killed within 24 h after the last exposure. The Institutional
Animal Care and Use Committee of the National Taiwan University College of
Medicine approved all animal care and experimental procedures.
Statistical analysis. The statistical significance of difference between
control and treatment groups was evaluated by the Student’s t-test of paired
data. A p-value <0.05 was considered statistically significant.
RESULTS
Qualitative GC/MS analysis of MEP extract identified
the presence of 14 PAH in the chemical mixture (Table 3).
Carcinogenic benz(a)anthracene, chrysene, benzo(b)fluoranthene, benzo(k)fluoranthene, benzo(a)pyrene, indeno(1,2,3c,d)pyrene, and benzo(g,h,i)perylene were identified in the
MEP extract. The results of quantitative GC/MS analysis
showed that benzo(a)pyrene was one of the more abundant
carcinogenic PAH in MEP extract. The amounts of these
carcinogenic PAH were smaller than those of noncarcinogenic
PAH such as naphthalene and phenanthrene. For comparison
purposes, benzo(a)pyrene was chosen as the component
compound of MEP extract in the following studies.
A preliminary study was first conducted to determine the
optimal conditions for MEP treatment. In this study, CL5 cells
were treated with increasing concentrations of MEP extract
for various time periods. RT-PCR analysis was performed to
determine the effect of MEP on CYP1A1, the marker of exposure and effect. MTT assay was then carried out to determine the effect on cytotoxicity. It was found that treatment with
100 lg/ml MEP extract for 6 h produced a near maximal
inductive effect on CYP1A1 and minimal cytotoxic effects
(data not shown). These treatment conditions were used in the
subsequent cDNA microarray studies.
487
FGF-9 INDUCTION BY MEP AND BENZO(A)PYRENE
TABLE 3
GC/MS Analysis of PAH in MEP Extract
Compound
Naphthalene
Acenaphthylene
Acenaphthene
Fluorene
Phenanthrene
Anthracene
Fluoranthene
Pyrene
Benz(a)anthracene
Chrysene
Benzo(b)fluoranthene
Benzo(k)fluoranthene
Benzo(a)pyrene
Indeno(1,2,3-c,d)pyrene
Dibenz(a,h)anthracene
Benzo(g,h,i)perylene
Concentration
(ng/mg MEP extract)
1467.1 ± 20.9
96.9 ± 6.9
n.d.*
66.9 ± 7.6
195.7 ± 10.3
101.5 ± 2.2
48.9 ± 2.3
88.6 ± 1.8
17.0 ± 1.1
7.1 ± 0.7
6.1 ± 0.6
5.8 ± 0.8
20.2 ± 1.0
10.6 ± 0.7
n.d.
16.1 ± 0.9
Note. Quantitative determinations of PAH from MEP extract were
conducted following the GC/MS conditions as described in Materials and
Methods. Each value represents the mean ± SD for three determinations.
*n.d.: not detectable.
In the drug metabolism array study, a visual comparison of
the membranes of controls and MEP-treated CL5 cells
demonstrated that MEP-treated cells showed increases of
CYP1A1, CYP3A7, and UGT2B gene expressions (Fig. 1).
Image analysis of transcript intensity indicated that MEP
increased CYP1A1, CYP3A7, UGT2B, and UGT1A1 mRNA
by 9-, 3-, 4-, and 2-fold, respectively (Table 4). In the cytokine
FIG. 1. cDNA microarray analysis of drug metabolism gene expression of
controls and human lung adenocarcinoma CL5 cells treated with MEP extract.
CL5 cells were treated with 100 lg/ml MEP extract for 6 h. Control (C) cells
were treated with 0.1% DMSO only. Total RNA was prepared and converted to
biotinylated cDNA probes for microarray analysis and chemiluminescence
detection procedures as described in Materials and Methods. The representative
scan images of the arrays show: 1. CYP1A1; 2. CYP3A7; and 3. UGT2B
cDNAs that exhibited differential expression compared to controls as marked
by squares. The array blots were reproducible in another experiment.
TABLE 4
Alteration of Gene Expression by MEP Extract in
Human Lung Adenocarcinoma CL5 Cells Analyzed by
cDNA Microarray
Gene function
Drug metabolism
Cytokine
Oncogene
Tumor suppressor
Estrogen signaling
pathway
Gene name
Fold change
CYP1A1
CYP3A7
UGT2B
UGT1A1
FGF-6
FGF-9
IL-1a
IL-22
TNFSF10
VEGF-D
fra-1
c-src
SHC
p21
p53
Rb
COX7RP
9.10
2.60
3.53
2.22
3.83
1.82
4.66
6.24
4.81
9.08
4.12
6.34
3.87
1.58
0.41
0.37
1.99
Note. CL5 cells were treated with 100 lg/ml MEP extract for 6 h. Total
RNA was prepared, and cDNA microarray analyses were conducted using the
pathway specific arrays from SuperArray Inc. Control cells were treated with
0.1% DMSO only. Image intensities on the arrays from controls and MEPtreated cells were quantitated. Changes in gene expression greater than 50%
were included. These results were the average of at least two experiments.
array study, MEP elevated expression of fibroblast growth
factor (FGF)-6, FGF-9, IL-1a, and IL-22 genes (Fig. 2). Image
analysis further showed that MEP increased FGF-6, FGF-9,
and vascular endothelial growth factor (VEGF)-D mRNA by
4-, 2-, and 9-fold, respectively; IL-1a and IL-22 by 5- and
6-fold; and TNFSF10 by 5-fold. The results of oncogene,
tumor suppressor, and estrogen signaling pathway arrays
studies indicated that MEP extract produced 4-, 6-, and 4-fold
increases of oncogenes fra-1, c-src, and SHC and resulted in
2-fold increases of tumor suppressor p21 and estrogen response
gene COX7RP (Table 4). In contrast, MEP decreased tumor
suppressors p53 and Rb expression by about 60%. The data
from these five arrays studies collectively showed that MEP
up-regulated the expression of 15 genes and down-regulated
2 genes. No remarkable alterations on the expressions of the
other 238 genes were detected on the arrays.
To evaluate the validity of gene alterations identified in the
arrays, confirmation studies were carried out using CL5 cells
treated with 100 lg/ml MEP extract for 6 h. Additional cells
were treated with 10 lM benzo(a)pyrene, a constituent of MEP,
for 6 h. Under this treatment condition maximal effects on
CYP1A1 mRNA and minimal effects on cytotoxicity could be
induced (data not shown). Total RNA was prepared from the
control and treated cells, and real-time RT-PCR analysis was
performed. This study showed that MEP produced an 11-fold
488
UENG ET AL.
TABLE 5
Alteration of Gene Expression by MEP Extract and
Benzo(a)pyrene in Human Lung Adenocarcinoma CL5 Cells
Analyzed by Real-Time RT-PCR
MEP
Gene function
Drug metabolism
Cytokine
FIG. 2. cDNA microarray analysis of cytokine gene expression of controls
and human lung adenocarcinoma CL5 cells treated with MEP extract. CL5 cells
were treated with 100 lg/ml MEP extract for 6 h. Control (C) cells were treated
with 0.1% DMSO only. Total RNA was prepared and converted to biotinylated
cDNA probes for microarray analysis and chemiluminescence detection
procedures as described in Materials and Methods. The representative scan
images of the arrays show: 1. FGF-6; 2. FGF-9; 3. IL-1a; and 4. IL-22 cDNAs
that exhibited differential expression compared to controls as marked by
squares. The array blots were reproducible in another experiment.
Oncogene
Tumor suppressor
Estrogen signaling pathway
increase of CYP1A1; 3-, 5-, 6-, and 3-fold increases of IL-1a,
FGF-6, FGF-9, and VEGF-D; and 2-fold increases of fra-1 and
p21 mRNA, respectively (Table 5). Furthermore, MEP resulted
in a 47% decrease of Rb expression. These gene alterations
were in agreement with those identified in the arrays. The realtime RT-PCR data indicated that MEP did not produce marked
effects on CYP3A7, IL-22, TNFSF10, SHC, p53, or COX7RP
mRNA, in variation from the array data. In these confirmation
studies, the effects of MEP and benzo(a)pyrene on five related
genes were determined. MEP induced the expression of
CYP1B1, IL-6, and IL-11 by 4-, 2-, and 3-fold, without
affecting IL-15 and VEGF-C. Treatment of CL5 cells with
benzo(a)pyrene increased the expression of metabolic enzymes
CYP1A1 and CYP1B1; proinflammatory cytokines IL-1a, IL6, IL-11, and IL-15; growth factors FGF-6, FGF-9, and VEGFD; oncogene fra-1; and tumor suppressor p21. Benzo(a)pyrene
decreased tumor suppressor Rb expression, without affecting
CYP3A7, IL-22, TNFSF10, VEGF-C, SHC, or COX7RP
(Table 5). The degrees of alterations of these 12 genes induced
by benzo(a)pyrene were in general similar to those induced
by MEP, except that the PAH produced a 2-fold increase of
IL-15 mRNA level which was not altered by MEP.
Concentration-response and time-course studies were
carried out to better characterize the inductive effects of
MEP and benzo(a)pyrene on FGF-9, IL-1a, IL-6, and IL-11
mRNA. In concentration-response studies, CL5 cells were
treated with increasing concentrations of MEP extract or
benzo(a)pyrene for 6 h. The results of RT-PCR analysis showed
that 1, 10, 100, and 200 lg/ml MEP extract produced
concentration-dependent increases of FGF-9 mRNA (Fig. 3,
Gene name
CYP1A1
CYP1B1
CYP3A7
FGF-6
FGF-9
IL-1a
IL-6
IL-11
IL-15
IL-22
TNFSF10
VEGF-C
VEGF-D
fra-1
SHC
p21
p53
Rb
COX7RP
PR
BaP
Fold change
10.70
4.06
1.21
4.48
6.35
2.82
2.30
3.15
0.74
0.72
0.71
0.66
2.94
1.85
0.92
2.21
0.91
0.43
0.84
0.91
11.60
5.41
1.08
4.65
11.50
3.88
2.45
1.60
1.85
0.53
1.22
0.67
1.69
1.70
0.85
1.67
0.88
0.46
0.84
0.91
Note. CL5 cells were treated with 100 lg/ml MEP extract or 10 lM
benzo(a)pyrene (BaP) for 6 h. Control cells were treated with 0.1% DMSO
only. Total RNA was prepared and real-time RT-PCR analysis was conducted
as described in Materials and Methods. mRNA levels of a specific gene in the
control and treated cells were determined using a relative quantitation method.
Each value represents the average of at least two experiments.
top). Near-maximal increases were observed at 100 and
200 lg/ml MEP. Treatment with 0.1, 1, 10, and 50 lM
benzo(a)pyrene increased FGF-9 expression in a concentrationdependent manner, showing a maximal increase at 50 lM
(Fig. 3, bottom). Similar to the induction kinetics observed with
FGF-9, MEP and benzo(a)pyrene also produced concentrationdependent increases of IL-1a, IL-6, and IL-11 mRNA with
maximal increases at 100 or 200 lg/ml MEP and 50 lM
benzo(a)pyrene, respectively (Table 6). In time-course studies,
CL5 cells were treated with 100 lg/ml MEP extract or 10 lM
benzo(a)pyrene for 3 to 48 h. The results of RT-PCR analysis showed that MEP produced time-dependent increases of
FGF-9 mRNA at 3 and 6 h following treatment (Fig. 4, top).
These increases declined time-dependently at 12, 24, and 48 h.
In parallel to MEP, benzo(a)pyrene resulted in maximal
increases of FGF-9 at 3 and 6 h with gradual decline at the
subsequent time points (Fig. 4, bottom). Similar time courses
of inductive effects were also observed with IL-1a, IL-6, and
IL-11 (Table 7). As with these inflammatory cytokines, IL15 mRNA was likewise induced concentration- and timedependently by benzo(a)pyrene (data not shown).
FGF-9 INDUCTION BY MEP AND BENZO(A)PYRENE
FIG. 3. Concentration-response relationships of effects of MEP extract and
benzo(a)pyrene on FGF-9 mRNA in human lung adenocarcinoma CL5 cells.
CL5 cells were treated with MEP extract or benzo(a)pyrene (BaP) at the
concentrations indicated for 6 h. Total RNA was prepared, and RT-PCR analysis
was conducted using the primers specific for FGF-9 and the internal control bactin following the conditions described in Table 2.
Because CL5 is a tumor-derived cell line, it was important to
examine the effects of MEP and benzo(a)pyrene on gene
expression using a noncancerous human lung epithelial cell
line. In this study, human bronchial epithelial BEAS-2B cells
TABLE 6
Concentration-Response Relationships of Effects of MEP
Extract and Benzo(a)pyrene on Cytokines mRNA in
Human Lung Adenocarcinoma CL5 Cells
MEP (lg/ml)
Cytokine
IL-1a
IL-6
IL-11
BaP (lM)
1
10
100
200
0.1
1.0
10
50
1.07
1.16
1.22
1.21
1.36
1.38
2.14
1.73
1.85
Fold of
1.58
1.76
2.38
control
0.90
1.49
1.18
1.76
1.65
1.56
4.10
1.72
1.61
6.96
1.78
1.64
Note. CL-5 cells were treated with MEP extract or benzo(a)pyrene (BaP) at
the concentrations indicated for 6 h. Control cells were treated with 0.1%
DMSO. Total RNA was prepared, and RT-PCR analysis was conducted using
the primers specific for the cytokines and the internal control b-actin following
the conditions described in Table 2. Relative intensity of cytokine PCR product
was determined as described in Materials and Methods and expressed as fold
of control.
489
FIG. 4. Time courses of effects of MEP extract and benzo(a)pyrene on
FGF-9 mRNA in human lung adenocarcinoma CL5 cells. CL5 cells were
treated with 100 lg/ml MEP extract (M) or 10 lM benzo(a)pyrene (B) for the
time periods indicated. Control (C) cells were treated with 0.1% DMSO only.
Total RNA was prepared and RT-PCR analysis was conducted using the primers
specific for FGF-9 and the internal control b-actin following the conditions
described in Table 2.
were treated with MEP extract or benzo(a)pyrene for 6 h, total
RNA was isolated, and RT-PCR analysis was conducted. It was
noted that treatment with 1, 10, and 100 lg/kg MEP produced
concentration-dependent increases of CYP1A1 and CYP1B1
mRNA (Fig. 5, left). It was also found that treatment with 0.1,
1, and 10 lM benzo(a)pyrene increased CYP1A1 and CYP1B1
concentration-dependently (Fig. 5, right). Thus the inductive
effects of MEP and benzo(a)pyrene in BEAS-2B cells were
quite similar to the respective effects found in CL-5 cells.
However, MEP extract and benzo(a)pyrene had no marked
effects on the proinflammatory cytokines IL-a, IL-6, IL-11, and
IL-15; growth factors FGF-6, FGF-9, and VEGF-D; oncogene
fra-1; and tumor suppressors p21 and Rb mRNA levels in the
BEAS-2B cells (data not shown).
Studies were performed to investigate the effects of MEP
and benzo(a)pyrene on peroxide production and to explore
its possible mechanistic role in cytokine induction of CL5 cells.
In these studies, CL5 cells were treated with 2 mM Nacetylcysteine, 100 lg/ml MEP extract, and 10 lM benzo(a)pyrene, respectively or in combination, for 6 h, peroxide
formation was determined by DCFH oxidation method
490
UENG ET AL.
TABLE 7
Time Courses of Effects of MEP Extract and
Benzo(a)pyrene on Cytokines mRNA in Human Lung
Adenocarcinoma CL5 Cells
MEP (h)
Cytokine
IL-1a
IL-6
IL-11
BaP (h)
3
6
12
24
48
1.41
1.82
1.08
2.42
3.89
1.78
1.73
2.56
1.41
1.38
2.52
1.51
Fold of
1.08
0.87
1.29
3
6
control
2.25 2.28
1.56 2.54
1.12 2.62
12
24
48
1.69
2.75
2.25
0.88
1.64
2.04
1.10
1.18
1.20
Note. CL-5 cells were treated with 100 lg/ml MEP extract or 10 lM
benzo(a)pyrene (BaP) for the time periods indicated. Control cells of each
time period were treated with 0.1% DMSO. Total RNA was prepared, and RTPCR analysis was conducted using the primers specific for the cytokines and
the internal control b-actin following the conditions described in Table 2.
Relative intensity of cytokine PCR product was determined as described in
Materials and Methods and expressed as fold of control.
(Lebel et al., 1992), and cytokine mRNA levels were analyzed
by RT-PCR procedures. The antioxidant N-acetylcysteine
resulted in a 52% decrease of peroxide production, and the
MEP extract produced a 32% increase, as compared to the
controls (Fig. 6). Peroxide formation in cells cotreated with
MEP extract and N-acetylcysteine was similar to the formation
observed in control cells. Benzo(a)pyrene increased peroxide
production by 27%. Cotreatment with benzo(a)pyrene and the
antioxidant reduced the benzo(a)pyrene-mediated increase of
peroxides. The results of RT-PCR analysis showed that Nacetylcysteine had no marked effects on IL-1a, IL-6, FGF-9,
FIG. 5. Concentration-response relationships of effects of MEP extract and
benzo(a)pyrene on CYP1A1 and CYP1B1 mRNA in human bronchial
epithelial BEAS-2B cells. BEAS-2B cells were treated with MEP extract or
benzo(a)pyrene (BaP) at the concentrations indicated for 6 h. Total RNA was
prepared, and RT-PCR analysis was conducted using the primers specific for
CYP1A1 and CYP1B1 and the internal control b-actin following the conditions
described in Table 2.
FIG. 6. Effects of N-acetylcysteine, MEP extract, and benzo(a)pyrene on
peroxide production in human lung adenocarcinoma CL5 cells. CL5 cells were
treated with 2 mM N-acetylcysteine (NAC), 100 lg/ml MEP extract, and 10 lM
benzo(a)pyrene (BaP), respectively or in combination as indicated, for 6 h prior
to analysis of intracellular peroxide production. Control (C) cells were treated
with 0.1% DMSO only. Fluorescence of DCFH was quantitated using a flow
cytometer as described in Materials and Methods. Each value represents the
mean ± SE for three determinations. *Value significantly different from the
control value, p < 0.05.
and VEGF-D mRNA of CL5 cells (Fig. 7). Treatment with
MEP extract elevated mRNA levels of these cytokines as
expected. Cotreatment with MEP and N-acetylcysteine reduced
the MEP-elevated mRNA levels of IL-1a, IL-6, FGF-9, and
VEGF-D to their respective levels as in controls. Similarly,
cotreatment with benzo(a)pyrene and the antioxidant reduced
the benzo(a)pyrene-elevated cytokines mRNA levels. These
results clearly indicated that increase of peroxide formation was
involved in cytokine induction by MEP and benzo(a)pyrene.
To further investigate the induction properties, the abilities
of MEP and benzo(a)pyrene in increasing protein productions
of IL-1a, IL-6, and IL-11 were examined. CL5 cells were
treated with 100 lg/ml MEP extract or 10 lM benzo(a)pyrene
for 24 h, and cytokine productions in culture medium and cell
lysate were determined by ELISA. It was found that MEP
produced no effect on IL-1a and 57% and 51% increases of
IL-6 and IL-11 production, respectively, in culture medium
(Table 8). The effects of benzo(a)pyrene on these cytokine
productions were qualitatively similar to the effects of MEP.
Production of IL-6 was higher than that of IL-1a and IL-11 in
control and treated-cell culture media. In cell lysate, MEP
resulted in a 28% increase, no effect, and a 41% increase of
IL-1a, IL-6, and IL-11 concentrations, respectively. Benzo(a)pyrene produced 32%, 99%, and 38% increases of the
respective cytokine concentrations. IL-1a concentration in cell
lysate was greater than the corresponding concentrations of
IL-6 and IL-11. These ELISA data indicated a general pattern
that MEP and benzo(a)pyrene induced intracellular concentrations of IL-1a, IL-6, and IL-11 and increased releases
of IL-6 and IL-11 to cell medium.
491
FGF-9 INDUCTION BY MEP AND BENZO(A)PYRENE
FIG. 7. Effects of N-acetylcysteine on induction of IL-1a, IL-6, FGF-9,
and VEGF-D mRNA by MEP extract and benzo(a)pyrene in human lung
adenocarcinoma CL5 cells. CL5 cells were treated with 2 mM N-acetylcysteine
(NAC), 100 lg/ml MEP extract, and 10 lM benzo(a)pyrene (BaP), respectively
or in combination as indicated, for 6 h. Control (C) cells were treated with 0.1%
DMSO only. Total RNA was prepared and RT-PCR analysis was conducted
using the primers specific for IL-1a, IL-6, FGF-9, VEGF-D, and the internal
control b-actin following the conditions described in Table 2.
The subsequent bioactivity study was conducted to investigate the effects of increased cytokine and growth factor
production on the cell growth of WI-38 human lung fibroblast.
Conditioned medium was collected from CL5 cells treated with
100 lg/ml MEP or 10 lM benzo(a)pyrene for 24 h. Exposure
of WI-38 cells to this MEP-induced conditioned medium for
4 days produced a 36% increase of cell growth of the fibroblasts
(Fig. 8). Exposure to benzo(a)pyrene-induced conditioned
medium resulted in a 51% increase of WI-38 cell growth.
Treatment of WI-38 cells with 50 ng/ml recombinant human
FGF-9, a positive control, for 4 days increased cell growth by
57%. These bioactivity data showed that MEP and benzo(a)pyrene enhanced the ability of CL5 epithelial cells to stimulate
the growth of lung fibroblast.
The following studies were done to determine the abilities
of washed MEP and benzo(e)pyrene, an isomer of benzo(a)pyrene, to induce gene expression in CL5 cells. CYP1A1,
FGF-9, and IL-1a were selected to represent drug metabolism,
growth factor, and inflammatory cytokine families, respectively. CL5 cells were treated with 100 lg/ml washed MEP or
10 lM benzo(e)pyrene for 6 h. Additional cells were treated
with 100 lg/ml MEP or 10 lM benzo(a)pyrene for 6 h, for
comparison purposes. Total RNA was isolated, and RT-PCR
analysis was carried out. The results showed that washed
MEP and benzo(e)pyrene had no marked effects on CYP1A1,
FGF-9, or IL-1a mRNA levels, unlike the inductive effects of
MEP and benzo(a)pyrene (Fig. 9). In concentration-response
and time-course studies, treatment with 1, 10, and 100 lg/ml
washed MEP or 0.1, 1, 10, and 50 lM benzo(e)pyrene for 6 h
and treatment with 100 lg/ml washed MEP or 10 lM
benzo(e)pyrene for 3, 6, and 12 h did not increase the metabolic
enzyme and cytokines mRNA. These treatment conditions did
not show cytotoxicity based on MTT assay (data not shown).
The above gene expression studies were conducted mostly
using female lung adenocarcinoma CL5 cells treated with MEP
extract in vitro; therefore it was of interest to investigate the
ability of the environmental mixture ME to induce CYP1A1,
TABLE 8
Effects of MEP Extract and Benzo(a)pyrene on Cytokines Concentrations in Culture Medium and Cell Lysate of Human
Lung Adenocarcinoma CL5 Cells
Culture medium
(pg/ml)
Treatment
Control
MEP
BaP
Cell lysate
(pg/mg protein)
IL-1a
IL-6
IL-11
IL-1a
IL-6
IL-11
143 ± 65
141 ± 76
176 ± 72
2,909 ± 30
4,554 ± 544*
7,115 ± 1,315*
462 ± 30
699 ± 49*
667 ± 31*
5,470 ± 208
7,011 ± 502*
7,230 ± 385*
172 ± 21
184 ± 24
343 ± 47*
839 ± 32
1,185 ± 38*
1,159 ± 79*
Note. CL-5 cells were treated with 100 lg/ml MEP extract or 10 lM benzo(a)pyrene (BaP) for 24 h. Culture medium was collected, and cell lysate was
prepared. Cytokines concentrations were determined as described in Materials and Methods. Each value represents the mean ± SE for three experiments.
*Value was significantly different from the respective control, p < 0.05.
492
UENG ET AL.
TABLE 9
Effects of ME Inhalation Exposure on Body and Tissue
Weights of Rats
Control
Body weight (g)
Liver/body weight ratio 3
100 (g/g)
Kidney/body weight ratio 3
100 (g/g)
Lung/body weight ratio 3
100 (g/g)
FIG. 8. Effect of human lung adenocarcinoma CL5 cell-conditioned media
on the cell growth of WI-38 human lung fibroblast. CL5 cells were treated with
100 lg/ml MEP extract, 10 lM benzo(a)pyrene (BaP), or 50 ng/ml
recombinant human FGF-9 (R&D Systems, Inc.) for 24 h, and conditioned
media were collected. WI-38 cell cultures were exposed to CL5 cellconditioned media for 4 days, and cell growth was determined as described
in Materials and Methods. Each value represents the mean ± SE for six
replicates. *Asterisk represents value was significantly different from the
control value, p < 0.05. These results were reproducible in another two
experiments.
FGF-9, and IL-1a mRNA in vivo. In this regard, female rats
were exposed to 1:10 diluted ME by inhalation for 1 h each in
the morning and afternoon daily, Monday through Friday, for
4 weeks, aiming to provide more environmentally realistic
ME
239.3 ± 9.8
4.128 ± 0.103
219.8 ± 3.2
4.065 ± 0.092
0.757 ± 0.017
0.721 ± 0.014
0.471 ± 0.016
0.502 ± 0.020
Note. Female Wistar rats were exposed to 1:10 diluted ME from 9 to 10 A.M.
and 4 to 5 P.M. daily, Monday through Friday, for 4 weeks using a head-noseonly inhalation chamber as described in Materials and Methods. Control rats
were exposed to clean air only. Each value represents the mean ± SE for six
animals. These results were reproducible in another inhalation experiment.
conditions. The ME inhalation exposure had no effects on
body weight or lung, liver, and kidney relative tissue weights
(Table 9). RT-PCR analysis of lung RNA showed that ME
inhalation exposure produced 3-fold increases of CYP1A1
and FGF-9 and a 2-fold increase of IL-1a mRNA levels,
respectively (Fig. 10). The results of this rat inhalation study
and those of cell culture studies showed that the metabolism,
growth factor, and proinflammatory cytokine genes expression
in lung cells were upregulated by ME in vivo and MEP extract
in vitro.
DISCUSSION
FIG. 9. Effects of MEP extract, washed MEP, benzo(a)pyrene, and
benzo(e)pyrene on CYP1A1, FGF-9, and IL-1a mRNA in human lung
adenocarcinoma CL5 cells. CL5 cells were treated with 100 lg/ml MEP
extract, 100 lg/ml washed MEP (wMEP), 10 lM benzo(a)pyrene (BaP), or 10
lM benzo(e)pyrene (BeP) for 6 h. Total RNA was prepared, and RT-PCR
analysis was conducted using the primers specific for CYP1A1, FGF-9, IL-1a,
and the internal control b-actin following the conditions described in Table 2.
These results were reproducible in another two experiments.
Findings from this present study show that MEP extract and
benzo(a)pyrene can alter the expression of an array of genes
belonging to the metabolic enzyme, proinflammtory cytokine,
growth factor, oncogene, and tumor suppressor families in
human lung epithelial cells. To the best of our knowledge, this
report is the first to show environment and gene interactions of
IL-1a, IL-11, FGF-9, and VEGF-D. IL-1a is an intracellular
messenger in epithelial and endothelial cells where the
autocrine plays a regulatory role in cell differentiation. IL-11
is a member of IL-6-type cytokines, which are involved in
acute-phase response to injury and activation of target genes
associated with cell differentiation, proliferation, and survival
(Heinrich et al., 2003). FGF-9 belongs to the FGF superfamily,
which regulates cell differentiation, proliferation, and migration during embryonic development and controls tissue repair
and response to injury in adult organism (Ornitz and Itoh,
2001). FGF-9 may also play an oncogenic role in human lung
cancer (Matsumoto-Yoshitomi et al., 1997). The VEGF family
is known to promote endothelial cell proliferation and vascular
permeability. VEGF-D induces both tumor angiogenesis and
lymphangiogenesis and increases lymphatic spread of tumors
(Stacker et al., 2001). These bioactivities indicate that MEP
FGF-9 INDUCTION BY MEP AND BENZO(A)PYRENE
493
FIG. 10. Effects of ME inhalation exposure on CYP1A1, FGF-9, and IL-1a mRNA in rat lung. Adult female Wistar rats were exposed to 1:10 diluted ME from
9 to 10 A.M. and 4 to 5 P.M. daily, Monday through Friday, for 4 weeks using a head-nose-only inhalation chamber as described in Materials and Methods. Control
(C) rats were exposed to clean air only. Lung total RNA was prepared, and RT-PCR analysis was conducted using the primers specific for rat CYP1A1, FGF-9, IL1a, and the internal control cyclophilin (CP) following the conditions described in Table 2. The results from three representative controls (lanes 1–3) and MEtreated rats (lanes 4–6) are shown in the figure (left). Relative intensity of target gene PCR product was determined as described in Materials and Methods and
expressed as fold of control (right). Each value in bar graph represents the mean ± SE for six animals. *Asterisk represents value was significantly different from the
respective control value, p < 0.05. These results were reproducible in another ME inhalation experiment.
and benzo(a)pyrene elevate the expression of genes whose
products are important regulators of defense mechanisms, cell
growth, and tumor progression during the multiple development stages of lung disease and cancer.
This study also demonstrates that gene alteration properties
of MEP mimic the properties of benzo(a)pyrene, a constituent
of MEP. Therefore the biological effects of MEP may be
attributed, at least in part, to benzo(a)pyrene and related
PAH present in MEP. Induction of IL-1a, IL-6, FGF-9, and
VEGF-D by MEP and benzo(a)pyrene was associated with
increased peroxide formation and blocked by the antioxidant
N-acetylcysteine in CL5 cells. These data and the CYP1A1 and
CYP1B1 induction data together strongly suggest a possible
sequent series of events leading to upregulation of proinflammatory cytokines and growth factors. The events involve (1)
induction of metabolic enzymes by MEP and benzo(a)pyrene,
which increases metabolic activation of protoxicants and
formation of reactive oxygen species, and (2) the increased
cellular oxidative stress in turn would activate, via signaling pathways, those transcription factors such as activator
protein-1 and nuclear factor-kappa B, which could induce the
expression of proinflammatory cytokines and growth factors.
Additional studies are required to confirm this hypothesis.
MEP and benzo(a)pyrene decreased Rb mRNA in the human
lung cells, unlike the increases observed with the other genes.
The exact reasons for the decrease are still not clear. The tumor
suppressor Rb plays a crucial role in cell cycle control in which
phosphorylation of Rb protein is necessary for cell progression
though G1 phase (Shackelford et al., 1999). The decrease of Rb
expression possibly indicated that exposure to environmental
chemicals might contribute to dysregulation of cell cycle
controls by altering the expression of Rb and related cell cycle
regulators. Benzo(a)pyrene elevated the level of IL-15 mRNA
in CL5 cells. IL-15 plays unique roles in both innate and
adaptive immune cell homeostasis (Lodolce et al., 2002). The
significance of benzo(a)pyrene induction of IL-15 in lung
epithelial cells remains to be further elucidated. Dissimilar to
their counterparts of CL5 cells, the proinflammatory cytokines
and growth factors of BEAS-2B cells were refractory to the
stimulatory effects of MEP and benzo(a)pyrene. Concentrationresponse and time-course studies using additional cancer and
noncancer cell lines such as normal human bronchial cells will
be required to determine whether this dissimilarity was a reflection of differences in the induction kinetics in these two specific
cell lines or an indication of selectivity of gene induction in
cancer cells.
Exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD),
a potent arylhydrocarbon receptor agonist, is associated with
chronic obstructive pulmonary disease and increased risk to
lung cancer in humans (Steenland et al., 1999). cDNA microarray analysis of human lung adenocarcinoma A549 cells
revealed that 68 out of 2091 genes changed their expression
levels at 24 h following treatment of the cells with 0.1, 1, and
10 nM TCDD (Martinez et al., 2002). With these gene changes
there was induction of metabolic enzymes CYP1A1 and
CYP1B1, cytokines IL-8 and leukemia inhibitory factor, and
growth factors FGF-2 and VEGF. In parallel to TCDD,
benzo(a)pyrene and MEP induced the same metabolic enzymes and the genes of the same families in human lung
adenocarcinoma CL5 cells. These findings suggest the possibility that TCDD, benzo(a)pyrene, and MEP induced similar
changes in gene categories of lung adenocarcinomal cell lines.
Given that CYP1A1 induction is a hallmark indicating the
biochemical effect of arylhydrocarbon receptor agonists,
these present findings also suggest that it would be important
to investigate the role of arylhydrocarbon receptors in the
integrated pathways leading to formation and progression of
lung adenocarcinoma.
494
UENG ET AL.
Exposures to diesel exhaust and DEP have been associated
with respiratory and allergic diseases such as asthma. DEP
has been reported to promote release of specific cytokines,
chemokines, and related mediators, which initiates a cascade
resulting in airway inflammation (Pandya et al., 2002).
Exposure of BEAS-2B cells to 40 to 300 lg/ml DEP for 24
or 48 h produced increases of IL-6 and chemokine IL-8
production (Steerenberg et al., 1998). Treatment of BEAS-2B
cells with 5 and 25 lg/ml DEP for 24 h increased production
of granulocyte macrophage-colony stimulating factor and
regulated on activation, normal T cells expressed and secreted
as well as IL-8 (Kawasaki et al., 2001). Similar to DEP, MEP
induced IL-6 expression in CL5 cells. However, the results of
cytokine array studies indicated that MEP had no marked
effects on IL-8 or granulocyte macrophage-colony stimulating
factor in CL5 cells (data not shown). Further studies will be
needed to better define the effects of MEP on those cytokines,
chemokines, and mediators inducible by DEP in order to
properly assess the respiratory health risk of ME exposure,
relative to that of DE exposure.
The present study showed that MEP and benzo(a)pyrene
increased the releases of IL-6 and IL-11, but not of IL-1a, by
CL5 cells. IL-1a and its immature form, pro-IL-1a, were found
to remain mainly in the cytoplasm and carried out their
activities intracellularly (Roux-Lombard, 1998). Accordingly,
the present ELISA data also demonstrated that MEP and
benzo(a)pyrene increased IL-1a production in CL5 cell lysate,
but not in culture medium. FGF-9, which was originally called
glial-activating factors, was discovered as a secreted factor
from human glioma cell line. Expression of FGF-9 in COS
cells demonstrated that it was glycosylated and efficiently
secreted (Miyamoto et al., 1993). However, the effects of
MEP and benzo(a)pyrene on FGF-9 protein expression of CL5
cells still need to be explored.
A major finding in the present study was the stimulation of
cell growth in human lung fibroblast by conditioned medium
from MEP- or benzo(a)pyrene-induced CL5 epithelial cells. An
underlying basis for the stimulatory effect was the expression
of receptors for the proinflammatory cytokine and growth
factor induced by the environmental chemicals. The lung cell
types which could express receptors for IL-1a, IL-6, FGF-9,
and VEGF-D included macrophage, mast cells, and endothelium, in addition to epithelium and fibroblast (Heinrich et al.,
2003; Roux-Lombard, 1998). With such wide distribution of
the receptors, it is not unreasonable that MEP and benzo(a)pyrene can stimulate epithelial cells interactions with a variety
of cells, including fibroblast, macrophage, and other cell types,
that play a role in maintaining the homeostasis of the
microenvironment in the lung.
In the present studies, CL5 cells were treated with 100 lg/ml
MEP extract or 10 lM benzo(a)pyrene in cell medium for 6 h.
The following calculation was done to further assess the
significance of the concentrations of the environmental
chemicals used. The yield of MEP extract from MEP was
56% (g/g). Consequently, 100 lg/ml MEP extract was equivalent to 179 lg/ml (1.79 3 105 mg/m3 ) MEP in CL5 cell
medium. A typical PM10 concentration in ME was 228 mg/ m3.
Therefore the MEP concentration in cell medium would be at
least 785 times higher than the concentration in ME. Benzo(a)pyrene concentration in MEP extract was 20.2 ng/mg (Table 3).
Ten lM benzo(a)pyrene in CL5 cell medium was equivalent to
125 mg/ml MEP extract, which would be 1250-fold higher than
the 100 lg/ml MEP extract used to treat CL5 cells. The results
of these calculation analysis indicated that the MEP extract and
benzo(a)pyrene concentrations for treatment of CL5 cells were
not compatible with the environmental levels that humans may
be exposed to. Extrapolation of these findings with the treated
CL5 cells to adverse health effects associated with human
exposure requires further experimental studies and physiological toxicokinetic modeling and considerations.
The present findings with CL5 cells have provided new
mechanistic and predictive information regarding the gene
regulation properties of MEP. This is supported by the findings
of experimental animal study that inhalation exposure to
ME under environmentally relevant conditions induced
CYP1A1, FGF-9, and IL-1a genes expression in rat lung
(Fig. 10). The induction by ME in rat lung also suggests that the
MEP-mediated induction of metabolism, growth factor, and
inflammatory cytokine genes in human lung adenocarcinoma
CL5 cells is not just an artifact of a tumor cell line. The
induction in CL5 cells indicates several possible consequences,
such as that, upon exposure to MEP, the lung tumor cells might
increase production of cytokines including the proangiogenic
FGF-9, which would increase the invasiveness of the tumor
cells. Induction of the same metabolic enzyme and cytokines
in CL5 cells and rat lung by MEP and ME emphasizes that it
may be necessary to study their differential toxicological
effects on normal and tumor cells.
In summary, MEP and benzo(a)pyrene induce an array of
altered gene expression including induction of genes involved
in metabolic activation, inflammation, and angiogenesis in
lung epithelial cells. The findings on induction of FGF-9,
VEGF-D, IL-1a, and IL-11 have further elucidated the roles of
environment and gene interactions which may be important in
the promotion of lung diseases including cancer.
ACKNOWLEDGMENTS
The authors thank the technical assistance of Ms. T.-C. Tien and Ms.
S.-C. Chen. This work was supported by grants DOH91-0543–003B,
NHRI92A1-NSCLC19-5, and NHRI93A1-NSCLC19-5 from the Department
of Health, ROC. Conflict of interest: none declared.
REFERENCES
Agardh, C. D., Israelsson, B., Thuesen-Olesen, B., and Agardh, E. (2002).
Application of quantitative competitive polymerase chain reaction for
measurements of mRNA from antioxidative enzymes in the diabetic rat
retina and kidney. Metabolism 51, 1279–1284.
FGF-9 INDUCTION BY MEP AND BENZO(A)PYRENE
495
Asadullah, K., Haeussler-Quade, A., Gelrich, S., Hanneken, S., Hansen-Hagge,
T. E., Docke, W. D., Volk, H. D., and Sterry, W. (2000). IL-15 and IL-16
overexpression in cutaneous T-cell lymphomas: Stage-dependent increase in
mycosis fungoides progression. Exp. Dermatol. 9, 248–251.
(FGF-9) and its possible participation in human oncogenesis. Int. J. Cancer
71, 442–450.
Mills, P. R., Davies, R. J., and Devalia, J. L. (1999). Airway epithelial cells,
cytokines, and pollutants. Am. J. Respir. Crit. Care Med. 160, S38–S43.
Auernhammer, C. J., and Melmed, S. (1999). Interleukin-11 stimulates
proopiomelanocortin gene expression and adrenocorticotropin secretion in
corticotroph cells: Evidence for a redundant cytokine network in the
hypothalamo-pituitary-adrenal axis. Endocrinology 140, 1559–1566.
Miyamoto, M., Nauro, K., Seko, C., Matsumoto, S., Kondo, T., and Kurokawa, T.
(1993). Molecular cloning of a novel cytokine cDNA encoding the ninth
member of the fibroblast growth factor family, which has a unique secretion
property. Mol. Cell. Biol. 13, 4251–4259.
Cancilla, B., Ford-Perris, M. D., and Bertram, J. F. (1999). Expression and
localization of fibroblast growth factors and fibroblast growth factor
receptors in the developing rat kidney. Kidney Int. 56, 2025–2039.
Mohri, M., Reinach, P. S., Kanayama, A., Shimizu, M., Moskovitz, J.,
Hisatsune, T., and Miyamoto, Y. (2002). Suppression of the TNFa-induced
increase in IL-1a expression by hypochlorite in human corneal epithelial
cells. Invest. Ophthalmol. Vis. Sci. 43, 3190–3195.
Carmichael, J., DeGraff, W. G., Gazdar, A. F., Minna, J. D., and Mitchell, J. B.
(1987). Evaluation of a tetrazolium based semiautomated colorimetric assay:
Assessment of chemosensitivity testing. Cancer Res. 47, 936–942.
Ornitz, D. M., and Itoh, N. (2001). Fibroblast growth factors. Genome Biol. 2,
1–12.
Chan, C. C., Lin, S. H., and Her, G. R. (1993). Student’s exposure to volatile
organic compounds while commuting by motorcycle and bus in Taipei City.
J. Air Waste Manage. Assoc. 43, 1231–1238.
Pandya, R. J., Solomon, G., Kinner, A., and Balmes, J. R. (2002). Diesel
exhaust and asthma: Hypothesis and molecular mechanisms. Environ. Health
Perspect. 110(Suppl. 1), 103–112.
Dohr, O., Vogel, C., and Abel, J. (1995). Different response of 2,3,7,8tetrachlorodibenzo-p-dioxin (TCDD)-sensitive genes in human breast
cancer MCF-7 and MDA-MB 231 cells. Arch. Biochem. Biophys. 321,
405–412.
Roux-Lombard, P. (1998). The interleukin-1 family. Eur. Cytokine Netw. 9,
565–576.
Guidice, J. M., Marez, D., Sabbagh, N., Legrand-Andreoletti, M., Spire, C.,
Alcaide, E., Lafitte, J. J., and Broly, F. (1997). Evidence for CYP2D6
expression in human lung. Biochem. Biophys. Res. Commun. 241, 79–85.
Hakkola, J., Pasanen, M., Hukkanen, J., Pelkonen, O., Maenpaa, J., Edwards,
R. J., Boobis, A. R., and Raunio, H. (1996). Expression of xenobioticmetabolizing cytochome P450 forms in human full-term placenta. Biochem.
Pharmacol. 51, 403–411.
Heinrich, P. C., Behmann, I., Haan, S., Hermanns, H. M., Muller-Newen, D.,
and Schaper, F. (2003). Principles of interleukin (IL)-6-type cytokine
signaling and its regulation. Biochem. J. 374, 1–20.
Jemma, C. A., Shore, P. R., and Widdicombe, K. A. (1995). Analysis of C1-C16
hydrocarbons using dual-column capillary GC: Application to exhaust
emissions from passenger car and motorcycle engine. J. Chomatogr. Sci.
33, 34–38.
Jordan, J. E., Motalto, M. C., and Stahl, G. L. (2001). Inhibition of mannosebinding lectin reduces postischemic myocardial reperfusion injury. Circulation 104, 1413–1418.
Kawasaki, S., Takizawa, H., Takami, K., Desaki, M., Okazaki, H., Kasama, T.,
Kobayashi, K., Yamamoto, K., Nakahara, K., Tanaka, M., et al. (2001).
Benzene-extract induced components are important for the major activity
of diesel exhaust particles: Effect on interleukin-8 gene expression in
human bronchial epithelial cells. Am. J. Respir. Cell Mol. Biol. 24, 419–426.
Kuo, M. L., Jee, S. H., Chou, M. H., and Ueng, T. H. (1998). Involvement of
oxidative stress in motorcycle exhaust particle-induced DNA damage and
inhibition of intercellular communication. Mutat. Res. 413, 143–150.
Lebel, C. P., Ishiropoulo, H., and Bondy, S. C. (1992). Evaluation of the probe
2#,7#-dichlorofluorescin as an indicator of reactive oxygen species formation
and oxidative stress. Chem. Res. Toxicol. 5, 227–231.
Lee, C. C., Liao, J. W., and Kang, J. J. (2004). Motorcycle exhaust particles
induce airway inflammation and airway responsiveness in BALB/c mice.
Toxicol. Sci. 79, 326–334.
Lodolce, J. P., Burkett, P. R., Koka, R. M., Boone, D. L, and Ma, A. (2002).
Regulation of lymphoid homoestasis by interleukin-15. Cytokine Growth
Factor Rev. 13, 429–439.
Martinez, J. M., Afshari, C. A., Bushel, P. R., Masuda, A., Takahashi, T., and
Walker, N. J. (2002). Differential toxicogenomic responses to 2,3,7,8tetrachlorodibenzo-p-dioxin in malignant and nonmalignant human airway
epithelial cells. Toxicol. Sci. 69, 409–423.
Matsumoto-Yoshitomi, S., Habshita, J., Nomura, C., Kuroshima, K., and
Kurokawa, T. (1997). Autocrine transformation by fibroblast growth factor 9
Rutanen, J., Leppanen, P., Tuomisto, T. T., Rissanen, T. T., Hiltunen, M. O.,
Vajanto, I., Niemi, M., Hakkinen, T., Karkola, K., Stacker, S. A., et al.
(2003). Vascular endothelial growth factor-D expression in human
atherosclerotic lesions. Cardiovasc. Res. 59, 971–979.
Schilter, B., Andersen, M. R., Acharya, C., and Omiecinski, C. J. (2000).
Activation of cytochrome P450 gene expression in the rat brain by
phenobarbital-like inducers. J. Pharmacol. Exp. Ther. 294, 916–922.
Shackelford, R. E., Kaufmann, W. K., and Paules, R. S. (1999). Cell cycle
control, checkpoint mechanisms, and genotoxic stress. Environ. Health
Perspect. 107(Suppl. 1), 5–24.
Skehan, P., Storeng, R., Scudiero, D., Monks, A., McMahon, J., Vistica D,
Warren, J. T., Bokesch, H., Kenney, S., and Boyd, M. R. (1990). New
colorimetric cytotoxicity assay for anticancer-drug screening. J. Natl.
Cancer Inst. 82, 1107–1112.
Stacker, S. A., Caesar, C., Baldwin, M. E., Thornton, G. E., Williams,
R. A., Prevo, R., Jackson, D. G., Nishikawa, S., Kubo, H., and Achen,
M. G. (2001). VEGF-D promotes the mestastatic spread of tumor cells via
the lymphatics. Nat. Med. 7, 186–191.
Steenland, K., Piacitelli, L., Deddens, J., Fingerhut, M., and Chang, L. I.
(1999). Cancer, heart disease, and diabetes in workers exposed to 2,3,7,8tetrachlorodibenzo-p-dioxin. J. Natl. Cancer Inst. 91, 779–786.
Steerenberg, P. A., Zonnenberg, J. A., Dormans, J. A., Joon, P. N., Wouters,
I. M., van Bree, L., Scheepers, P. T., and Van Loveren, H. (1998). Diesel
exhaust particles induced release of interleukin 6 and 8 by (primed) human
bronchial epithelial cells (BEAS 2B) in vitro. Exp. Lung Res. 24, 85–100.
Tsai, S. J., Wu, M. H., Chen, H. M, Chuang, P. C., and Wing, L. Y. (2002).
Fibroblast growth factor-9 is an endometrial stromal growth factor.
Endocrinology 143, 2715–2721.
Tzeng, H. P., Yang, R. S., Ueng, T. H., Lin-Shiau, S. Y., and Liu, S. H. (2003).
Motorcycle exhaust particles enhanced vasoconstriction in organ culture of
rat aortas and involve reactive oxygen species. Toxicol. Sci. 75, 66–73.
Ueng, T. H., Hu, S. H., Chen, R. M., Wang, H. W., and Kuo, M. L. (2000).
Induction of cytochome P450 1A1 in human hepatoma HepG2 and lung
carcinoma NCI-H322 cells by motorcycle exhaust particulate. J. Toxicol.
Environ. Health A 60, 101–119.
Ueng, T. H., Wang, H. W., Hung, C. C., and Chang, H. L. (2004). Effects of
motorcycle exhaust inhalation exposure on cytochome P-450 2B1, antioxidant enzymes, and lipid peroxidation in rat liver and lung. J. Toxicol.
Environ. Health A 67, 875–888.
Wang, H. W., Chen, T. L., Yang, P. C., and Ueng, T. H. (2001). Induction of
cytochomes P450 1A1 and 1B1 by emodin in human lung adenocarcinoma
cell line CL5. Drug Metab. Dispos. 29, 1229–1235.
496
UENG ET AL.
Wang, H. W., Chen, F. W., and Ueng, T. H. (2002). Induction of cytochomes
P-450 1A1 and 1B1 by motorcycle exhaust particulate in human breast
cancer MCF-7 cells. J. Toxicol. Environ. Health A 65, 101–117.
Yin, X. J., Ma, J. Y. C., Antonini, J. M., Castranova, V., and Ma, J. K. H.
(2004). Roles of reactive oxygen species and heme oxygenase-1 in mod-
ulation of alveolar macrophage-mediated pulmonary immune responses to
Listeria monocytogenes by diesel exhaust particles. Toxicol. Sci. 82, 143–153.
Zhang, J., Xu, K., Ambati, B., and Yu, F. S. X. (2003). Toll-like receptor
5-mediated corneal epithelial inflammatory responses to Pseudomonas
aeruginosa flagellin. Invest. Ophthalmol. Vis. Sci. 44, 4247–4254.