Protein Expression and Purification 26 (2002) 59–64
www.academicpress.com
Cloning and expression of functional shikimate dehydrogenase
(EC 1.1.1.25) from Mycobacterium tuberculosis H37Rv
Maria L.B. Magalh~
aes, Clarissa P. Pereira, Luiz A. Basso,* and Di
ogenes S. Santos1
Rede Brasileira de Pesquisa em Tuberculose, Departamento de Biologia Molecular e Biotecnologia, Universidade Federal do Rio Grande do Sul,
Avenida Bento Goncßalves 9500, Porto Alegre, RS 91501-970, Brazil
Received 31 January 2002, and in revised form 19 April 2002
Abstract
Tuberculosis (TB), caused by Mycobacterium tuberculosis, continues to be one of the deadliest diseases in the world. TB resurged
in the late 1980s and now kills more than 2 million people a year. Possible factors underlying the reemergence of TB are the high
susceptibility of human immunodeficiency virus-infected persons to the disease, the proliferation of multi-drug-resistant (MDR)
strains, patient noncompliance in completing the standard ‘‘short-course’’ therapy, and decline of health care systems. Thus, there is
a need for the development of new antimycobacterial agents to treat MDR strains of M. tuberculosis, to provide for more effective
treatment of latent tuberculosis infection, and to shorten the treatment course to improve patient compliance. The shikimate
pathway is an attractive target for antimicrobial agents development because it is essential in algae, higher plants, bacteria, and
fungi, but absent in mammals. Homologs to enzymes in the shikimate pathway have been identified in the genome sequence of
M. tuberculosis. The M. tuberculosis aroE-encoded shikimate dehydrogenase was PCR amplified, cloned, sequenced, and expressed
in Escherichia coli BL21(DE3). Recombinant protein expression was achieved by a low-cost and simple protocol. Although cell lysis
resulted in the formation of insoluble aggregates of the recombinant protein, soluble and functional M. tuberculosis shikimate
dehydrogenase could be obtained by repeated cycles of freezing and thawing. Enzyme activity measurements demonstrated that
there was approximately a 5-fold increase in specific activity for M. tuberculosis shikimate dehydrogenase. Moreover, the enzyme
activity was linearly dependent upon the amount of recombinant protein added to the assay mixture, thus, confirming cloning and
expression of functional mycobacterial shikimate. Ó 2002 Elsevier Science (USA). All rights reserved.
The fifth annual report on global tuberculosis (TB)2
control of the World Health Organization found that
there were an estimated 8.4 million new cases in 1999, up
from 8.0 million in 1997 [1]. It is expected that there will
be 10.2 million new cases in 2005, if the present trend
continues. Approximately 3 million persons die from the
disease each year [2]. Ninety percent of tuberculosis
cases occur in developing countries, where few resources
are available to ensure proper treatment and where
human immunodeficienty virus (HIV) infection may be
common. In 1990, of the 50.5 million deaths of all causes
*
Corresponding author. Fax: +55-51-33166234.
E-mail addresses: [email protected] (L.A. Basso), [email protected] (D.S. Santos).
1
Also corresponding author.
2
Abbreviations used: DMSO, dimethyl sulfoxide; IPTG, isopropyl-bD -thiogalactopyranoside; LB, Luria–Bertani; MDR, multidrug-resistant; TB, tuberculosis; SD, shikimate dehydrogenase.
worldwide, approximately 2 million were due to TB,
with 98% of these deaths occurring in the demographically developing nations [3]. The concentration of TB
and mortality in the age range of 25–54 years, the most
economically fruitful years of life, cause substantial
losses in productivity and contribute to the impoverishment of third-world countries [4]. Possible factors
underlying the resurgence of TB have been proposed [5]
to be: the HIV epidemic, increase in the homeless population, and decline in health care structures and national surveillance. Another contributing factor to the
failure of tuberculosis control measures is the evolution
of multi-drug-resistant strains of M. tuberculosis (MDRTB), defined as resistant to at least isoniazid and rifampicin, which are the two most effective first-line drugs
[6]. The emergence of MDR-TB in different parts of the
world is particularly worrisome, given the poor therapeutic outcomes when isolates are resistant to both
isoniazid and rifampicin [7]. Furthermore, the cost of
1046-5928/02/$ - see front matter Ó 2002 Elsevier Science (USA). All rights reserved.
PII: S 1 0 4 6 - 5 9 2 8 ( 0 2 ) 0 0 5 0 9 - 0
60
M.L.B. Magalh~aes et al. / Protein Expression and Purification 26 (2002) 59–64
treating MDR-TB can approach US $250,000, about
10–15 times the cost of treating a case of fully drugsensitive tuberculosis [3]. Accordingly, new antimycobacterial agents are needed to treat strains of
Mycobacterium tuberculosis, the causative agent of TB,
resistant to existing drugs and to shorten the treatment
course to improve patient compliance.
The shikimate pathway is an attractive target for the
development of herbicides and antimicrobial agents
because it is essential in algae, higher plants, bacteria,
and fungi, but absent from mammals [8]. In mycobacteria, the shikimate pathway leads to the biosynthesis of
precursors of aromatic amino acids, naphthoquinones,
menaquinones, and mycobactin [9]. Homologs to enzymes in the shikimate pathway have been identified in
the genome sequence of M. tuberculosis [10]. Amongst
them, the shikimate dehydrogenase (SD; EC 1.1.1.25)
encoding gene (aroE, Rv2552c) was proposed to be
present by sequence homology. SD catalyzes the
NADPH-dependent reduction of 3-dehydroshikimate to
shikimate [8,11].
To both pave the way for structural and functional
efforts currently underway in our laboratory and assess
the feasibility of using SD as potential target for antimycobacterial agent development, the aroE gene from
M. tuberculosis H37Rv strain was PCR amplified,
cloned, sequenced, and expressed in Escherichia coli
BL21(DE3) host cells. Protein expression could be
achieved by a low-cost and simple protocol. However,
cell lysis resulted in the formation of insoluble aggregates of recombinant M. tuberculosis SD. A number of
protocols were tested, of which only repeated cycles of
freezing and thawing resulted in soluble and active enzyme. Measurements of the NADPH-dependent reduction of 3-dehydroshikimate to shikimate catalyzed by
SD enzyme activity confirm the correct assignment to
the structural gene encoding SD in M. tuberculosis. SD
purification in large quantities will allow enzyme kinetics and structural studies to be undertaken to provide a
framework on which the design of new agents with antitubercular activity will be based.
was used to amplify the M. tuberculosis aroE-SD encoding gene (810 bp) from genomic DNA using standard PCR conditions and the enzime Pfu DNA
polymerase (Stratagene), which is a thermostable polymerase that exhibits low error rate, thus, lowering the
likelihood of introducing unwanted mutations. To improve the PCR product yield, the following concentrations of the cosolvent dimethyl sulfoxide (DMSO) were
added to the reaction mixture: 0, 1, 5, and 10%. The
PCR product was purified by electrophoresis on lowmelting agarose, digested with NdeI and BamHI, and
ligated into a pET23a(+) expression vector (Novagen),
which had previously been digested with the same restriction enzymes. The DNA sequence of the amplified
M. tuberculosis aroE structural gene was determined,
using the Thermo Sequenase radiolabeled terminator
cycle sequencing kit (Amersham Pharmacia Biotech), to
both confirm the identity of the cloned gene and ensure
that no mutations were introduced by the PCR amplification step.
Expression of SD
The recombinant plasmid was transformed into
electrocompetent E. coli BL21(DE3) cells, unless stated
otherwise, and selected on LB agar plates containing
50 lg ml1 carbenicillin [12]. Control experiments were
performed under the same experimental conditions, except that transformed E. coli cells harbored the expression vector lacking the target gene. Single recombinant
colonies were used to inoculate 5 ml LB medium containing carbenicillin (50 lg ml1 ). Cells were incubated
at 220 rpm at the following temperatures: 20, 25, 30, 37,
and 42 °C. Moreover, the cells were grown for additional 3, 12, 24, and 48 h either with addition of 0.5 mM
or no addition of IPTG to cultures reaching an OD600 of
0.4–0.6. Cells were harvested by centrifugation at
20,800g for 10 min in a 1.7 ml microfuge tube (4.5 ml was
harvested by three successive spins of 1.5 ml) and stored
at )20 °C.
Release of expressed recombinant protein by the freeze/
thaw method
Materials and methods
PCR amplification and cloning of M. tuberculosis aroE
structural gene
Synthetic oligonucleotide primers (50 gccatatgagcga
aggtcccaaaaaagccggc 30 and 50 ggggatccctagtccaacgcgg
ccagcgcg 30 ) were designed, based on the complete
genome sequence of M. tuberculosis H37Rv [10]. These
primers were complementary, respectively, to the aminoterminal coding and carboxyl-terminal noncoding
strands of aroE gene containing 50 NdeI and 30 BamHI
restriction sites, which are in bold. This pair of primers
Host cells expressing recombinant mycobacterial SD
protein were disrupted by the freeze/thaw method [13].
Briefly, cells stored at )20 °C were transferred to a dryice/ethanol bath for 2 min. The sample was then thawed
by transferring it to an ice/water bath for 8 min. This
cycle was repeated either 5 or 10 additional times. The
cells were suspended in 400 ll of 50 mM Tris–HCl, pH
7.8, using the pipette tip and the mixture was placed in
the ice/water bath for an additional 30 min (the microfuge tube was not vortexed, agitated nor mixed). The
sample was centrifuged at 4 °C for 15 min at 20,800g.
The soluble extract containing the expressed protein was
M.L.B. Magalh~aes et al. / Protein Expression and Purification 26 (2002) 59–64
carefully pipetted off from the residual cells. The subunit
molecular weights of soluble protein extracts were analyzed by SDS–PAGE (Laemmli method) [14]. The proportion of SD to total soluble proteins in SDS–PAGE
gels was estimated using a GS-700 imaging densitometer
(Bio-Rad).
Protein determination
Protein concentration was determined by the method
of Bradford et al. [15] using the Bio-Rad protein assay
kit (Bio-Rad) and bovine serum albumin as standard.
SD assay
SD catalyzes the NADPH-dependent reduction of
3-dehydroshikimate to form shikimate and NADPþ .
Enzyme activity was assayed in the reverse direction by
continuously monitoring the increase in NADPH
absorbance at 340 nm (eNADPH ¼ 6:22 103 M1 cm1 ).
All reactions were carried out at 25 °C and initiated with
addition of the same total protein content of either
cloned SD or control extracts. The assay mixture contained 100 mM Tris–HCl, pH 9.0, 4 mM shikimic acid,
and 2 mM NADPþ . Initial steady-state rates were calculated from the linear portion of the reaction curve.
One unit of enzyme activity (U) is defined as the amount
of enzyme catalyzing the conversion of 1 lmol substrate
per minute.
Results and discussion
The probable aroE structural gene was amplified
from M. tuberculosis H37Rv genomic DNA (Fig. 1).
Under the experimental conditions tested, the presence
of 10% DMSO in the reaction mixture proved to be
essential for PCR amplification of aroE structural gene.
Fig. 1. Agarose gel (0.8%) electrophoresis of PCR products amplified
from M. tuberculosis genomic DNA. Lane 1: molecular marker
/ 174 RF DNA/HaeIII + kDNA/HindIII, Life Technologies, Gibco
BRL; lanes 2, 3, 4, and 5: PCR amplification with no DMSO; lanes 6,
7, 8, and 9: DMSO 1%; lanes 10, 11, 12, and 13: DMSO 5%; lanes 14,
15, 16, and 17: amplification of probable aroE gene (810 bp) with
DMSO 10%.
61
DMSO is a cosolvent that improves the denaturation of
GC-rich DNA and helps to overcome the difficulties of
polymerase extension through secondary structures [16].
The need for the presence of DMSO to allow amplification of aroE structural gene is consistent with the
G + C content of 65.6% of M. tuberculosis genomic
DNA [10].
The PCR fragment was cloned into pET23a(+) expression vector between the NdeI and BamHI restriction
sites. DNA sequencing of the entire aroE structural gene
by the dideoxy chain termination method both confirmed the identity of the cloned PCR product and
showed that no mutations were introduced by the DNA
amplification step. Recombinant plasmids were transformed into E. coli BL21(DE3) electrocompetent cells
and a number of protocols were tested to produce soluble mycobacterial SD. A preliminary screening of experimental conditions at 37 °C that would allow
recombinant mycobacterial SD expression was tested.
To evaluate SD protein expression as a function of time,
cell growth was tested for 3, 12, 24, and 48 h either with
or without IPTG induction. After cell lysis by sonication, the cell debris was removed by centrifugation and
the soluble and insoluble fractions were analyzed by
SDS–PAGE. The highest recombinant protein yield was
obtained from cells grown for 24 h at 37 °C in the absence of inducer. However, a substantial fraction of recombinant SD remained in the insoluble fraction. The
pET system makes use of the powerful T7 RNA polimerase, under control of IPTG-inducible lacUV5
promoter, to transcribe target genes of interest [17]. It
has been shown that high levels of protein production
can be obtained in stationary phase for cells growing in
the absence of inducer [16,18]. It has been suggested that
this phenomenon is due to derepression of lac operon
requiring cyclic-AMP [19].
A traditional approach to reduce protein aggregation
is through fermentation engineering, most commonly by
reducing the cultivation temperature [20]. Accordingly,
the cultures were grown at the following temperatures:
20, 25, and 30 °C for 24 h in the absence of IPTG induction. Disappointingly, growth at low temperatures
did not result in improved solubility of the recombinant
protein. On the other hand, although a substantial
fraction of the expressed recombinant protein remained
in the insoluble fraction, growth at 37 and 42 °C resulted
in improved protein solubility. Cell growth at 37 °C was
chosen to avoid possible protein denaturation at high
temperatures [21].
Although inclusion body formation can greatly simplify protein purification, there is no guarantee that the
in vitro refolding will yield large amounts of biologically
active product. Moreover, inclusion body purification
schemes present a number of problems such as: use of
denaturants that are expensive and can cause irreversible
modifications of protein structure that will elude all of
62
M.L.B. Magalh~aes et al. / Protein Expression and Purification 26 (2002) 59–64
the most sophisticated analytical tests, refolding usually
must be done in very dilute solution and the protein
reconcentrated, and refolding encourages protein isomerization, leading to precipitation during storage [21].
Since one of the goals of the present work is to confirm
the correct assignment to the structural gene encoding
SD in M. tuberculosis, efforts were made to express recombinant M. tuberculosis SD in its soluble, active form
avoiding unfolding and refolding protocols.
It is well established that efficient post-translational
folding of some proteins in E. coli is mediated by
specialized proteins termed molecular chaperones. The
demonstration that efficient production and assembly
of a number of proteins required GroES and GroEL
coproduction led to an increasing interest in the use of
molecular chaperones for high-level gene expression in
E. coli [22]. However, the experimental results from the
use of chaperones have been inconsistent and the effects of chaperone coproduction on gene expression in
E. coli appear to be protein specific [22,23]. Moreover,
factors that may affect protein expression in soluble
form such as coexpression of chaperones cloned from
the same source as the target protein and growth
temperature may have to be considered. More recently,
a novel function of molecular chaperones as agents for
catalytic solubilization and refolding of stable protein
aggregates has been put forward [24]. However, the
efficiency of in vitro refolding reactions is remarkably
low.
In practice, it is usually worthwhile to test several
different vector/host combinations to obtain the best
possible yield of protein in its desired form. Accordingly, a number of commercially available strains of E.
coli host cells were tested in an attempt to increase the
proportion of soluble form of M. tuberculosis SD. Genetic selection for mutants in which disulfide bonds are
formed in a protein localized to the cytoplasm has
shown that the mutations were mapped to trxB gene,
which codes for thioredoxin reductase, thus, allowing
disulfide bond formation in the E. coli cytoplasm [25].
Glutathione reductase, encoded by the gor gene, is the
other central enzyme in cytoplasmic disulfide metabolism [26]. The SD from M. tuberculosis possesses three
cysteine residues (Cys43, Cys171, and Cys263). Although E. coli SD has no disulfide bridges, despite
possessing three cysteine residues, there is no experimental evidence for the mycobacterial enzyme. Thus, E.
coli BL21trxB(DE3) and Origami(DE3) host cells which
are, respectively, trxB and trxB/gor mutants (Novagen)
were transformed with the recombinant plasmid. Cells
were incubated at different temperatures ranging from
20 to 42 °C for 24 h with no IPTG induction. In addition, since M. tuberculosis aroE gene possesses a rare
codon (CUA) for leucine at position 254, insufficient
tRNA pool could lead to premature translational termination or amino acid misincorporation that might
result in expression of nonproperly folded recombinant
protein [27]. To test this possibility, the recombinant
plasmid was transformed into Rosetta(DE3) host cell
(Novagen), which carries a plasmid containing tRNA
genes for all of the rarely used E. coli codons. Cells were
incubated at 37 °C for 24 h with no IPTG induction.
Unfortunately, none of the protocols tested yielded
soluble SD protein.
Insoluble agreggates, that result from coaggregation
of heterologous recombinant protein with E. coli outer
membrane components upon bacterial lysis, may be
solubilized by the addition of Sarkosyl (N-laurylsarcosine) to cell extracts during or after lysis [28]. E. coli cell
extracts of mycobacterial SD were suspended in 400 ll
of 50 mM Tris–HCl, pH 7.8, containing the following
concentrations of Sarkosyl: 0.02; 0.04; 0.2 and 2%, lysed
by sonication, centrifuged, and the soluble and insoluble
fractions were analyzed by SDS–PAGE. Digitonin and
sodium deoxycholate, which are, respectively, nonionic
and ionic surfactants, were also tested under the same
experimental conditions, as those described for Sarkosyl, except the range of concentrations, which was 0.05,
0.1, and 1% for digitonin, and 0.2, 0.1, 1, and 2% for
deoxycholate. None of the protocols tested resulted in
the production of soluble mycobacterial SD protein.
To test if the cell lysis method would have an impact
on the yield of soluble recombinant protein, cells were
disrupted using french press, enzymatic lysis by lysozyme, and sonication methods. All of these methods led
to insoluble aggregates. A simple method of releasing
cytoplasmic proteins without cell lysis by repeated cycles
of freezing and thawing has been shown to be efficient
for a number of recombinant proteins [13]. Accordingly,
the freeze/thaw method was used to release recombinant
SD. This method permitted to obtain approximately 8%
of soluble M. tuberculosis SD (Fig. 2). Moreover, the
recombinant protein could be obtained in functional
form, as indicated both by the 5-fold increase in specific
Fig. 2. SDS–PAGE analysis of soluble protein extracts. Cell disruption
was carried out by the freeze/thaw method using either 5 (lanes 1 and
2) or 10 (lane 3) cycles. Lane 4: MW marker ‘‘High range’’ (Gibco
BRL).
M.L.B. Magalh~aes et al. / Protein Expression and Purification 26 (2002) 59–64
63
Acknowledgments
Financial support for this work was provided by
Millenium Initiative Program MCT-CNPq, Ministry of
Health–Secretary of Health Policy (Brazil) to D.S.S. and
L.A.B. D.S.S. and L.A.B. also acknowledge grants
awarded by PADCT, CNPq, and FINEP. We thank
Professor John S. Blanchard for generously supporting
this work.
References
Fig. 3. Linear dependence of shikimate dehydrogenase activity on
soluble cell extract volume. The rates of enzyme activity were carried
out in the reverse direction by continuously monitoring the increase of
NADPH absorbance at 340 nm.
activity of mycobacterial SD (1.0 U mg1 ) as compared
to negative control (0.2 U mg1 ) and the linear dependence of mycobacterial SD steady-state velocity on extract volume added to the reaction mixture (Fig. 3). This
method releases a substantial fraction of expressed recombinant proteins without lysing the cells because the
cell envelope is damaged by the freeze/thaw cycles,
leading to the formation of transient pores without
causing total destruction of the cell. Protein solubility is
a clearly important factor governing the release of a
protein by this method and protein which forms inclusion bodies are not released [13]. Moreover, the freeze/
thaw method is effective for monomeric and dimeric
proteins with molecular weights ranging from 8.5 to
29 kDa. The E. coli SD has been shown to be a monomer of 30 kDa [29]. Whether M. tuberculosis SD is
monomeric or oligomeric is still unknown. However,
solubilization of recombinant mycobacterial SD by the
freeze/thaw method indicates that this enzyme may be
monomeric (expected to be 27 kDa). Moreover, the results presented suggest that a large proportion of M.
tuberculosis SD protein is in inclusion bodies inside the
cell and the remaining is in soluble form that is released
into solution by the freeze/thaw method. To the best of
our knowledge, this is the first report of cloning and
expression of soluble and active M. tuberculosis SD. The
expression M. tuberculosis SD will provide protein in
quantities necessary for both crystallization trials aiming
at X-ray data collection and determination of the enzyme mechanism of action by steady-state and presteady-state kinetics. Crystallization and preliminary
analysis of X-ray diffraction data on E. coli SD has recently been reported [30], which should facilitate
screening of experimental conditions to obtain crystals
of M. tuberculosis SD protein. Structural and enzymological studies of M. tuberculosis SD should help in the
design of enzyme inhibitors to be tested as antimycobacterial agents.
[1] World Health Organization, Global Tuberculosis Control,
WHO Report 2001, Geneva, Switzerland, WHO/CDS/TB/2001.
287.
[2] N.E. Dunlap, J. Bass, P. Fujiwara, P. Hopewell, C.R. Horsburgh
Jr., M. Salfinger, P.M. Simione, Diagnostic standards and
classification of tuberculosis in adults and children, Am. J. Respir.
Crit. Care Med. 161 (2000) 1376–1395.
[3] J.D. McKinney, W.R. Jacobs Jr., B.R. Bloom, Persisting problems in tuberculosis, in: R.M. Krause (Ed.), Emerging Infections,
Academic Press, New York, 1998, pp. 51–146.
[4] C.J.L. Murray, Issues in operational, social, and economic
research on tuberculosis, in: B.R. Bloom (Ed.), Tuberculosis:
Pathogenesis, Protection, and Control, ASM Press, Washington,
DC, 1994, pp. 583–622.
[5] B.R. Bloom, C.J.L. Murray, Tuberculosis: commentary on a
reemergent killer, Science 257 (1992) 1055–1064.
[6] L.A. Basso, J.S. Blanchard, Resistance to antitubercular drugs,
Adv. Exp. Med. Biol. 456 (1998) 115–144.
[7] M. Goble, M.D. Iseman, L.A. Madsen, D. Waite, L. Ackerson,
C.R. Horsburgh, Treatment of 171 patients with pulmonary
tuberculosis resistant to isoniazid and rifampin, N. Engl. J. Med.
328 (1993) 527–532.
[8] R. Bentley, The shikimate pathway—a metabolic tree with many
branches, Crit. Rev. Biochem. Mol. Biol. 25 (1990) 307–
384.
[9] C. Ratledge, Nutrition, growth and metabolism, in: C. Ratledge,
J.L. Stanford (Eds.), The Biology of the Mycobacteria, vol. 1,
Academic Press, London, 1982, pp. 185–271.
[10] S.T. Cole, R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D.
Harris, S.V. Gordon, K. Eiglmeier, S. Gas, C.E. Barry III, F.
Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R.
Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin,
S. Holroyd, T. Hornsby, K. Jagels, B.G. Barrel, Deciphering the
biology of Mycobacterium tuberculosis from the complete genome
sequence, Nature 393 (1998) 537–544.
[11] I.A. Anton, J.R. Coggins, Sequencing and overexpression of the
Escherichia coli aroE gene encoding shikimate dehydrogenase,
Biochem. J. 249 (1988) 319–326.
[12] J. Sambrook, E.F. Fritsch, T. Maniatis, in: Molecular Cloning: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, New
York, 1989, p. A.1.
[13] B.H. Johnson, M.H. Hecht, Recombinant proteins can be isolated
from E. coli cells by repeated cycles of freezing and thawing, Bio/
technology 12 (1994) 1357–1360.
[14] U.K. Laemmli, Cleavage of structural proteins during the
assembly of the head of bacteriophage T4, Nature 227 (1970)
680–685.
[15] M.M. Bradford, R.A. McRorie, W.L. Williams, A rapid and
sensitive method for the quantification of microgram quantities of
protein utilizing the principle of protein-dye binding, Anal.
Biochem. 72 (1976) 248–254.
64
M.L.B. Magalh~aes et al. / Protein Expression and Purification 26 (2002) 59–64
[16] P.R. Winship, An improved method for directly sequencing PCR
amplified material using dimethyl sulphoxide, Nucleic Acids Res.
17 (1989) 1266.
[17] K.C. Kelley, K.J. Huestis, D.A. Austen, C.T. Sanderson, M.A.
Donoghue, S.K. Stickel, E.S. Kawasaki, M.S. Osburne, Regulation of CD4-183 gene expression from phage-T7-based vectors in
Escherichia coli, Gene 156 (1995) 33–36.
[18] J.S. Oliveira, C.A. Pinto, L.A. Basso, D.S. Santos, Cloning and
overexpression in soluble form of functional shikimate kinase
and 5-enolpyruvylshikimate 3-phosphate synthase enzymes from
Mycobacterium tuberculosis, Protein Expr. Purif. 22 (2001) 430–
435.
[19] T.H. Grossman, E.S. Kawasaki, S.R. Punreddy, M.S. Osburne,
Spontaneous cAMP-dependent derepression of gene expression in
stationary phase plays a role in recombinant expression instability,
Gene 209 (1998) 95–103.
[20] G. Hannig, S.C. Makrides, Strategies for optimizing heterologous
protein expression in Escherichia coli, Trends Biotechnol. 16
(1998) 54–60.
[21] C.H. Schein, Production of soluble recombinant proteins in
bacteria, Bio/technology 7 (1989) 1141–1149.
[22] S.C. Makrides, Strategies for achieving high-level expression of
genes in Escherichia coli, Microbiol. Rev. 60 (1996) 512–538.
[23] F. Baneyx, Recombinant protein expression in Escherichia coli,
Curr. Opin. Biotechnol. 10 (1999) 411–421.
[24] A.P. Ben-Zvi, P. Goloubinoff, Review: mecanisms of disaggregation and refolding of stable protein aggregates by molecular
chaperones, J. Struct. Biol. 135 (2001) 84–93.
[25] A.I. Derman, W.A. Prinz, D. Belin, J. Beckwith, Mutations that
allow disulfide bond formation in the cytoplasm of Escherichia
coli, Science 262 (1993) 1744–1747.
[26] W.A. Prinz, F. Aslund, A. Holmgren, J. Beckwith, The role of the
thioredoxin and glutaredoxin pathways in reducing protein
disulfide bonds in the Escherichia coli cytoplasm, J. Biol. Chem.
272 (1997) 15661–15667.
[27] C. Kurland, J. Gallant, Errors of heterologous protein expression,
Curr. Opin. Biotechnol. 7 (1996) 489–493.
[28] S. Frankel, R. Sohn, L. Leinwand, The use of Sarkosyl in
generating soluble protein after bacterial expression, Proc. Natl.
Acad. Sci. USA 88 (1991) 1192–1196.
[29] S. Chaudhuri, J.R. Coggins, The purification of shikimate dehydrogenase from Escherichia coli, Biochem. J. 226 (1985) 217–223.
[30] J. Maclean, S.A. Campbell, K. Pollock, S. Chackrewarthy, J.R.
Coggins, A.J. Lapthorn, Crystallization and preliminary X-ray
analysis of shikimate dehydrogenase from Escherichia coli, Acta
Crystallogr. D—Biological Crystallography 56 (2000) 512–515.