Plant Physiology Preview. Published on June 28, 2012, as DOI:10.1104/pp.112.198259
1
Running head:
Novel elicitor-responsive cis-elements
Corresponding author:
Reinhard Hehl
Institut für Genetik
Technische Universität Braunschweig
Spielmannstr. 7
38106 Braunschweig
Germany
Author for correspondence:
Tel. +49-(0)531-391-5772
Fax. +49-(0)531-391-5765
E-mail [email protected]
Research area:
Breakthrough Technologies
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
Copyright 2012 by the American Society of Plant Biologists
2
Integration of Bioinformatics and Synthetic Promoters Leads to Discovery of
Novel Elicitor-Responsive cis-Regulatory Sequences in Arabidopsis thaliana
Jeannette Koschmann1, Fabian Machens1, Marlies Becker1, Julia Niemeyer1, Jutta
Schulze2, Lorenz Bülow1, Dietmar J. Stahl3, Reinhard Hehl1,4
1
Institut für Genetik
Technische Universität Braunschweig
Spielmannstr. 7
38106 Braunschweig
Germany
2
Institut für Pflanzenbiologie
Technische Universität Braunschweig
Humboldtstr. 1
38106 Braunschweig
Germany
3
KWS SAAT AG
Grimsehlstrasse 31
37555 Einbeck
Germany
4
Author for correspondence
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
3
Footnote
This work was supported by the European Union, the State of Lower Saxony,
Germany, and by the KWS SAAT AG, Einbeck, Germany.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
4
ABSTRACT
A combination of bioinformatic tools, high-throughput gene expression profiles, and
the use of synthetic promoters is a powerful approach to discover and evaluate novel
cis-sequences in response to specific stimuli. With Arabidopsis thaliana microarray
data annotated to the PathoPlant database, 732 different queries with a focus on
fungal and oomycete pathogens were performed, leading to 510 upregulated gene
groups. Using the binding-site estimation suite of tools (BEST), 407 conserved
sequence motifs were identified in promoter regions of these coregulated gene sets.
Motif similarities were determined with STAMP, classifying the 407 sequence motifs
into 37 families. A comparative analysis of these 37 families with the AthaMap,
PLACE, and AGRIS databases revealed similarities to known cis-elements but also
led to the discovery of cis-sequences not yet implicated in pathogen response. Using
a parsley protoplast system and a modified reporter gene vector with an internal
transformation control, 25 elicitor-responsive cis-sequences from ten different motif
families were identified. Many of the elicitor-responsive cis-sequences also drive
reporter gene expression in an Agrobacterium infection assay in Nicotiana
benthamiana. The present work significantly increases the number of known elicitorresponsive cis-sequences and demonstrates the successful integration of a diverse
set of bioinformatic resources, combined with synthetic promoter analysis for datamining and functional screening in plant-pathogen interaction.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
5
INTRODUCTION
During plant-pathogen interaction the recognition of conserved molecules, so called
microbe-associated molecular patterns (MAMPs), by pattern recognition receptors
leads to basal immunity via a signaling cascade. Basal immunity is associated with
the upregulation of pathogen response genes (Boller and Felix, 2009). Some
pathogens suppress this immune reaction with effector molecules transferred to the
plant cell (Grant et al., 2006). These effector molecules interfere at different steps in
the signaling process. Some of these molecules, termed avirulence proteins, can be
recognized by the plant cell via resistance proteins which induce effector triggered
immunity (Bent and Mackey, 2007). For establishment of both, basal and effector
triggered immunity, modification of gene expression in the nucleus takes place.
Pathogen-responsive cis-regulatory elements in the promoters of genes play an
important role in regulating these changes.
Several pathogen-responsive transcription factors (TFs) have been identified in
recent years (Tena et al., 2011). Most prominently, the WRKY transcription factors
are major regulators in plant-pathogen interactions (Rushton et al., 2010). Genes
regulated by WRKY transcription factors harbour the W-box (Eulgem et al., 2000). Wboxes are, for example, abundant in genes upregulated during systemic acquired
resistance (Maleck et al., 2000). In A. thaliana WRKY22 and 29 were described as
downstream targets of a flagellin regulated MAP kinase (MPK) signal transduction
pathway involving MPK3 and 6 (Asai et al., 2002). Later WRKY33 was determined to
be a direct target of MPK4 which is part of a different branch of the flagellin activated
MAP kinase pathway (Suarez-Rodriguez et al., 2007). MPK4 forms a nuclear
complex with MKS (MAP kinase substrate) and WRKY33. WRKY33 is released from
this complex upon phosphorylation of MKS by MPK4 and activates transcription of its
target genes (Qiu et al., 2008). Also, WRKY18, 40 and 60 were shown to be involved
in pathogen regulated gene expression (Xu et al., 2006). WRKY transcription factors
have been analysed extensively and are also associated with functions that go
beyond plant-pathogen interactions (Rushton et al., 2010). In addition to WRKY
factors, many more TFs such as members of the bZIP, MYB, and AP2/EREBP
families have been identified to be targets of pathogen-regulated signaling pathways
(Bethke et al., 2009; Pitzschke et al., 2009; Tena et al., 2011).
For only about half of the 60 TF families predicted in A. thaliana (Perez-Rodriguez et
al., 2009), binding site specificities are known (Bülow et al., 2010). Based on this,
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
6
there is ample room for database-assisted data-mining for novel cis-regulatory
elements belonging either to TFs with unkown binding specificity or to previously
undetected combinatorial elements. The identification of cis-regulatory sequences
has been greatly facilitated using bioinformatic approaches and web-queryable
resources (Hehl and Wingender, 2001; Hehl et al., 2004; Hehl and Bülow, 2008;
Brady and Provart, 2009; Priest et al., 2009; Usadel et al., 2009). One approach is
the detection of conserved sequences within coregulated genes. This implies such
sequences are targeted by the same or closely related TFs. Such an analysis can be
performed by submitting sets of genes to database-assisted analysis to identify
known transcription factor binding sites (Galuschka et al., 2007; Chang et al., 2008;
Bülow et al., 2009). Another approach is the discovery of conserved sequence motifs
in a set of coregulated genes regardless if these sequences have been associated
with a function before. This involves the identification of over-represented sequences
in the upstream region of coregulated genes by using pattern mining programs such
as MEME, AlignACE, CONSENSUS, Co-Bind, BioProspector, or MITRA (Bailey and
Elkan, 1995; Roth et al., 1998; Hertz and Stormo, 1999; GuhaThakurta and Stormo,
2001; Liu et al., 2001; Eskin and Pevzner, 2002). To further refine the output of motif
discovery programs, BioOptimizer (Jensen and Liu, 2004) was integrated with
MEME, AlignACE, CONSENSUS, and BioProspector in BEST, the binding site
estimation suite of tools (Che et al., 2005).
In the work presented here, BEST was applied for the discovery of conserved
sequence motifs in promoters of A. thaliana genes upregulated by multiple
pathogenic stimuli. These coregulated genes were identified using microarray
expression data annotated to the PathoPlant database (Bülow et al., 2004; Bülow et
al., 2007). Subsequently, the identified motifs were classified with STAMP (Mahony
and Benos, 2007) and compared to known cis-regulatory sequences annotated to the
AthaMap, PLACE and AGRIS databases (Higo et al., 1999; Davuluri et al., 2003;
Steffens et al., 2004; Bülow et al., 2006; Palaniswamy et al., 2006; Yilmaz et al.,
2011). Sequences showing no or only low similarity to already described regulatory
sequences were analysed with synthetic promoters and the parsley protoplast
system to test for elicitor-responsive gene expression (Hahlbrock et al., 1995;
Sprenger-Haussels and Weisshaar, 2000; Rushton et al., 2002).
RESULTS AND DISCUSSION
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
7
Identification of 37 Motif Families Harbouring Novel and Known cis-Sequences
in Pathogen-Responsive A. thaliana Genes
The goal of this work was the identification of novel pathogen-responsive cisregulatory sequences from groups of genes simultaneously upregulated by
pathogenic stimuli. To achieve this goal, conserved sequences were identified in the
promoters of these upregulated genes. Figure 1 gives an overview over the work
flow. In a first step, microarray experiments annotated to the PathoPlant database
were employed to identify gene sets that are at least twofold upregulated by one to
six pathogen-related stimuli. In total 732 queries were performed. Supplemental
Table S1 lists the parameters for these queries and gives the number of induced
genes obtained. 711 of the 732 queries were performed with microarray data
generated by treatment with Botrytis cinerea, Erysiphe orontii, or Phytophthora
infestans, alone or in combination with other pathogenic stimuli. In total, 510 queries
with one to five stimuli yielded coregulated genes. All queries with six stimuli did not
yield coregulated genes. In cases where more than 120 genes were identified, the
induction factor was increased to reduce the number of upregulated genes to about
120 (Supplemental Table S1). This facilitates subsequent motif detection using
BEST.
In a second step, conserved sequence motifs within the upstream region of the 510
coregulated gene groups were identified (Fig. 1). For this, the software package
BEST was employed (Che et al., 2005). The package combines four different motif
finding programs (MEME, AlignACE, CONSENSUS, BioProspector). For motif
detection, 1,000 bp upstream of all genes in a coinduced gene group were screened
with this software. This analysis resulted in 443 sequence motifs. The alignment
matrices of the 443 motifs are shown in Supplemental Data File S1. In some
instances the same sequence motifs were detected when different queries yield the
same groups of upregulated genes (Supplemental Table S2). When these are
subtracted, 407 different sequence motifs remain. These sequence motifs potentially
represent conserved cis-sequences in pathogen upregulated genes.
The 407 sequence motifs detected with BEST were further analyzed using STAMP
(Step 3, Fig. 1). STAMP not only determines the relationship between the motifs but
also identifies their similarities to known cis-regulatory sequences (Mahony and
Benos, 2007). To display the similarities among all 407 sequence motifs, a tree was
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
8
generated with STAMP and illustrated by the program MEGA (Tamura et al., 2007).
Originally, the tree branches into all 407 motifs with branch length between nodes
becoming shorter as similarities between adjacent motifs become higher. To facilitate
the display of the tree and to generate motif groups for easier analysis, a cut-off
value of 0.035, which is the minimum selected length of a branch between two
nodes, was selected in MEGA. When this cut-off is applied, 39 motif groups are
obtained. Figure 2 shows the motif group tree with branches to 39 motif groups but
only 37 motif groups are designated. This is due to motif groups 20 and 25 in which
two very closely related groups were combined each. Therefore, groups 20 and 25
were generated with a higher cut-off value of 0.043 and 0.045, respectively. These
37 motif groups harbour 2 to 76 single motifs (Fig. 2). The motifs that belong to each
of the 37 motif groups are identified in Supplemental Table S2.
To determine the similarity of the motifs among each other in more detail and to find
similarities to known cis-regulatory sequences, all motifs within each of the 37 motif
groups were submitted to STAMP to generate a so called family binding profile
(FBP). FBPs are constructed through multiple alignments of structurally related DNAbinding motifs (Sandelin and Wasserman, 2004). They can be displayed as a
sequence logo showing the probability of the most frequent nucleotide(s) at each
position (Crooks et al., 2004). All 37 FBPs were then queried with STAMP against
the PLACE, AGRIS and AthaMap databases which contain plant cis-regulatory
sequences (Higo et al., 1999; Palaniswamy et al., 2006; Bülow et al., 2010).
Supplemental Table S3 shows the result of this analysis and shows the most similar
cis-regulatory sequences or transcription factor binding sites (TFBS) obtained for
each FBP with the three databases. The highest similarity is defined by the lowest E
value. For cases where a high similarity (E value lower than 1e-05) to known TF
binding sites was detected with all three databases, the results are shown in Figure
2. This reveals that groups 1, 3, and 7 have a high similarity to bZIP TFBS. Groups
18 and 20 have similarities to MYB and TCP TFBS, respectively, while groups 24
and 35 harbour similarity to ERF and E2F TFBS, respectively. Interestingly, group 27
shows similarity to WRKY TFBS. WRKY TFs play a major role in pathogen-regulated
gene expression (Rushton et al., 2010). WRKY TFBS are therefore expected to show
up in this approach. Even more interesting is that many motif groups do not show
high similarities to known plant cis-regulatory sequences (Fig. 2) and might contain
so far unknown cis-sequences. The following chapters describe the experimental
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
9
analysis of selected cis-sequences from different motif groups (Fig. 1, Step 4). Since
one
in
three
cis-sequences
analysed
were
elicitor-responsive,
no
further
bioinformatic analysis to exclude false positives was performed prior to the
experimental analysis with the identified motifs.
A Modified Reporter Gene Plasmid With an Internal Transformation Control for
Efficient Normalization of Gene Expression
To investigate whether the conserved sequence motifs harbour functional cissequences, the parsley (Petroselinum crispum) protoplast system was used
(Hahlbrock et al., 1995). In this system, parsley protoplasts are generated from a
liquid callus suspension culture, transformed with reporter gene constructs, and
subjected to an oligopeptide elicitor (Pep25) derived from a surface glycoprotein of
the phytopathogenic fungus Phytophthora sojae (Nürnberger et al., 1994; Rushton et
al., 1996). Subsequently, reporter gene activity is compared between Pep25 treated
and untreated cells.
To test selected sequences, a reporter-plasmid based on pBT10GUS harbouring the
ß-glucuronidase (GUS) reporter gene (uidA) was used (Sprenger-Haussels and
Weisshaar, 2000). To quantify expression strength, a second constitutively
expressed reporter gene is usually employed on a cotransformed plasmid. To
facilitate reporter gene assays, pBT10GUS was modified to contain a luciferase
reporter gene under the control of a double 35S CaMV promoter (pBT10GUSd35SLUC). The luciferase gene serves as an internal control to normalize GUS
expression driven by the cloned cis-sequences. This permits the comparison of
independent experiments.
To test this vector, the D element previously shown to confer elicitor (Pep25)responsive expression in parsley protoplasts was used (Rushton et al., 2002). The Dbox is derived from the parsley PR2 gene promoter (van de Löcht et al., 1990; Kirsch
et al., 2000; Rushton et al., 2002). Figure 3 shows a schematic representation of
pBT10GUS-d35SLUC and normalized GUS reporter gene activity in parsley
protoplasts with and without elicitor (Pep25). Reporter gene activity was measured
for pBT10GUS-d35SLUC with a synthetic promoter containing four copies of the Dbox (4D) cloned upstream of the 35S minimal promoter (TATA) and the GUS (uidA)
reporter gene. Furthermore, a vector-only control was analysed (pBT10GUSd35SLUC). All GUS values were normalized by the corresponding level of luciferase
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
10
acitivity. This shows that the synthetic promoter harbouring the D elements confers
strong elicitor-responsive reporter gene activity in parsley protoplasts (Fig. 3B). The
observation that the GUS reporter gene under the control of the minimal promoter
(TATA-box) in pBT10GUS-d35SLUC does not show significant reporter gene
expression with or without Pep25 also demonstrates the lack of background
expression in this modified vector.
Experimental Analysis of Conserved cis-Sequences
In total, 76 single cis-sequences from different potentially pathogen-responsive motifs
which were identified as described above were tested for Pep25-responsiveness. 25
of these sequences were found to be elicitor-responsive in the parsley protoplast
system when four copies of each sequence were cloned upstream to a the 35S
minimal promoter (TATA box) of the uidA reporter gene in pBT10GUS-d35SLUC
(Fig. 3C). Table I lists all 25 elicitor-responsive sequences. The core sequence that
was used by BEST for generating a motif is underlined. Furthermore, the Arabidopsis
gene from which the sequence originates and the position (TAIR10 genome release)
of the core sequence in motif orientation (first nucleotide) upstream to the gene is
identified. Also, the motif group to which the core sequence belongs is listed. The
sequence ID (i. e. 12i) permits the identification of the database query in
Supplemental Table S1, the identification of the respective motif (12i_M1) in
Supplemental Data File S1, and the number of the experimentally tested sequence
(12i_M1_S1, Table I). Table II lists the normalized GUS values (pmol 4-MU min-1 mg
protein-1) and standard deviations (SD) obtained for all reporter gene constructs in
the parsely protoplast system without (-) and with (+) Pep25 treatment. The 25
Pep25-responsive sequences are from 21 different motifs, belong to ten different
motif groups, and are derived from 22 different A. thaliana genes.
Elicitor-Responsive cis-Sequences from the W-Box Related Motif Group 27
Define a Novel cis-Regulatory Sequence
26 of all 407 identified motifs belong to motif group 27 which contains WRKY binding
site similarity. W-box similarity of group 27 originates from the conserved W-box core
sequence TTGAC(C/T) in the family binding profile (FBP) shown in Figure 4C
(Rushton et al., 2010). However, not all sequences that generate this motif family
have the conserved W-box core sequence. To test the functionality of sequences
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
11
from motif group 27, several sequences from this group were tested experimentally.
Seven sequences turned out to be elicitor-responsive. Figure 4A shows the result of
the transient reporter gene assays with sequences 18 through 24 from group 27
(Table I). The tested sequences are derived from five different sets of upregulated
genes. Gene set 21S contains seven genes upregulated by P. infestans 12 hours
post-infection (hpi) and the SA (salicylic acid) analog BTH (benzo[1,2,3]thiadiazole-7carbothioic acid-S-methyl ester), 30I-8 contains 52 genes upregulated by E. orontii
five days post-infection (dpi) and the oomycete derived elicitor NPP1, 27D-10
contains nine genes upregulated by E. orontii (24 hpi) and NPP1, 14S contains nine
genes upregulated by B. cinerea (18 hpi) and BTH, and 30H-8 contains 27 genes
upregulated by E. orontii (4dpi) and NPP1 (Supplemental Table S1). Compared to
the positive control 4D (PC), the sequences do not yield the same level of Pep25responsive reporter gene activity (Table II) but values are clearly above those
obtained for the empty vector without integrated cis-sequences (NC, Fig. 4A).
Although the motif group 27 harbours similarity with WRKY binding sites, this
similarity is not obvious when sequences which confer elicitor-responsive gene
expression are aligned. Figure 4B shows an alignment of the seven experimentally
positive sequences which reveals a novel core sequence GACTTTT. Only two
sequences deviate slightly from this core sequence (23 and 24). For alignment, the
reverse complement of sequences 18, 19, 21, 22, and 23 were used. Two of the
sequences come from the promoter of the same gene (18 and 19, Table I) which was
upregulated in two different queries (21S and 14S). The core sequence of a WRKY
TFBS, the W-box TTGAC(C/T) (Rushton et al., 2010), is only found in three of the
sequences (21, 22, and 24, Fig. 4B). Sequences harbouring this core sequence are
potentially bound by several A. thaliana WRKY TFs (de Pater et al., 1996; Du and
Chen, 2000; Yu et al., 2001; Chen and Chen, 2002; Robatzek and Somssich, 2002;
Xu et al., 2006; Ciolkowski et al., 2008; Kim et al., 2008). Because the other
sequences lack the conserved WRKY core binding site, these elicitor-responsive
sequences from group 27 may be bound either by other WRKY TFs or by TFs not
previously associated with a pathogen response. In this instance it is interesting that
NtWRKY12 binds to the sequence TTTTCCAC that significantly deviates from the
classical W-box (Van Verk et al., 2008). Other WRKY binding sites that deviate from
the W-box are the sugar-responsive element and the PRE4 element (Rushton et al.,
2010).
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
12
The family binding profile determined for motif family 27 resembles a motif identified
in promoters of genes upregulated in plants exposed to methyl viologen, a
superoxide propagator in the light (Scarpeci et al., 2008). Interestingly, motif
sequence 22 from gene At5g24110 (Table I) which codes for AtWRKY30 also
contributes to the previously described motif (Scarpeci et al., 2008). While promoter
reporter gene studies indicate that WRKY30 is induced by reactive oxygen species
(Scarpeci et al., 2008), the work presented here shows that sequence 22 from the
WRKY30 promoter confers elicitor-responsive gene expression in parsley protoplasts
(Fig. 4A).
In a similar study novel cis-regulatory elements conserved in coexpressed genes
from Arabidopsis thaliana were predicted recently (Zou et al., 2011). Most
interestingly the novel core sequence GACTTTT determined by aligning the Pep25responsive sequences from motif group 27 (Fig. 4B) was also detected in their study.
Screening their Supplemental Data File 2 (Zou et al., 2011) revealed that this
sequence was identified either as a stand alone putative cis-regulatory element or as
part of a larger element. For example the reverse complement sequence AAAAGTC
was enriched in promoters of genes responsive to flagellin 22, NPP1, and P.
infestans (Zou et al., 2011). Also, the Pep25-responsive sequences determined in
this study (Fig. 4) were derived from microarray experiments involving NPP1 and P.
infestans supporting the notion that this sequence is either functional alone or part of
a larger or combinatorial cis-regulatory element.
Elicitor-Responsive cis-Sequences from Motif Groups 11 and 12 Harbour MYBLike cis-Regulatory Sequences
Many of the elicitor-responsive sequences belong to motif groups which are not
highly similar to known TFBS (Fig. 2). Figures 5A and 6A show the results of the
transient reporter gene assays with sequences number 5 through 8 and 9 through
12, respectively. These sequences belong to motif groups 11 and 12. Compared to
the positive control 4D (PC), the sequences do not achieve the same level of reporter
gene activity (Table II) but values are higher than those obtained for the plasmid
without integrated cis-sequences (NC, Fig. 5A and 6A). Thus, the sequences clearly
mediate Pep25-responsive reporter gene activity.
The tested sequences from motif group 11 are derived from four different groups of
upregulated genes (Table I). 15AAA contains four genes upregulated by B. cinerea
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
13
(48 hpi) and chitin (10 min), 22A contains five genes upregulated by P. infestans (all)
and chitin (10 min), 22DDD contains nine genes upregulated by P. infestans (12 hpi)
and chitin (3 hrs), and 21G-2 contains 118 genes upregulated by P. infestans (6 hpi)
and SA (Supplemental Table S1). Two of the sequences came from the same gene
(5 and 6, Table I) and were found to be upregulated in two different queries (15AAA
and 22A). Figure 5B shows an alignment of the four sequences tested. For the
alignment the reverse complement of sequences 5, 6, and 7 are shown. Based on
the alignment a new core sequence TGGTTT was identified. This core sequence can
also be seen in the FBP between positions 3 and 8 but it is not highly conserved in all
motifs (Fig. 5C).
The tested sequences from motif group 12 are derived from three different groups of
upregulated genes (Table I). 18H contains 21 genes upregulated by B. cinerea (48
hpi) and NPP1 (1 hr), 38M contains 115 genes upregulated by E. orontii (all) and
Pseudomonas syringae pv. maculicola (avr+), and 26LLL contains 55 genes
upregulated by E. orontii (all) and NPP1 (1 and 4 hrs) (Supplemental Table S1).
Figure 6B shows an alignment of the four sequences tested. For the alignment the
reverse complement of sequences 10, 11, and 12 are shown. Based on the
alignment a new core sequence GTTT was identified which is not seen as highly
conserved in the FBP (Fig. 6C).
The two core sequences derived from Pep25-responsive sequences of motif group
11 (TGGTTT) and 12 (GTTT) illustrate their close relationship in the motif tree (Fig.
2). Interestingly the sequence TGGTTT or its reverse complement was not detected
when cis-regulatory elements recently predicted in a similar study were screened
(Zou et al., 2011; Supplemental Data File 2). The two new core sequences could
indicate that these may be bound by members of the MYB TF family. Interestingly,
AtMYB2 binds to the sequence TGGTTT found in the Arabidopsis Adh1 promoter
(Hoeren et al., 1998). AtMYB2 belongs to subgroup 20 of the R2R3-MYB family and
is implicated in anaerobiosis, drought, salt, and ABA regulated gene expression (Abe
et al., 1997; Hoeren et al., 1998; Abe et al., 2003; Dubos et al., 2010). DNA binding
of AtMYB2 may be redox regulated (Serpa et al., 2007) and recently AtMYB2 was
shown to function in plant senescence (Guo and Gan, 2011). Other Arabidopsis MYB
factors involved in the response to microbes, insects, or other pathogens are, for
example, AtMYB72, AtMYB102, and AtMYB108 (Dubos et al., 2010). AtMYB72 is
activated in roots upon colonization by nonpathogenic Pseudomonas fluorescens
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
14
WCS417r. Knockout mutants of AtMYB72 are incapable of mounting induced
systemic
resistance
against
the
pathogens
P.
syringae
pv.
tomato,
Hyaloperonospora parasitica, Alternaria brassicicola, and B. cinerea (Van der Ent et
al., 2008). AtMYB102 is expressed locally in leaves at the feeding sites of the insect
herbivore Pieris rapae. Knockout AtMYB102 mutant plants allowed a faster
development of P. rapae caterpillars indicating that AtMYB102 contributes to basal
resistance against P. rapae feeding (De Vos et al., 2006). A BOS1 (AtMYB108)
mutant showed increased susceptibility to B. cinerea infection. BOS1 is also required
to restrict the spread of Alternaria brassicicola (Mengiste et al., 2003).
Plant MYB factors show some variability in their binding sites and often regulate gene
expression by interacting with members of the bHLH transcription factor family
(Hoeren et al., 1998; Steffens et al., 2005; Feller et al., 2011). While the FBPs of
groups 11 and 12 do not show the bHLH binding site consensus sequence,
sequence 9 from motif group 12 has a bHLH consensus sequence CANNTG
(Hartmann et al., 2005) between the putative MYB binding site TGGTTT and a Wbox (Fig. 6B). In this respect it is interesting, that sequence 9 was obtained from the
promoter of the AtWRKY53 gene (At4g23810, Table I). AtWRKY53 is a senescence
associated transcription factor which can bind to its own promoter (Miao et al., 2004).
In fact, a W-box core sequence is found in sequence 9 (Fig. 6B). Also sequences 5
and 6 have a W-box core sequence (Fig. 5B). Another W-box core sequence is
generated by the SpeI site in the linker used for cloning of sequence 11 (data not
shown). Despite the possible MYB factor binding, this could also indicate the
involvement of WRKY factors in the inducibility of sequences 5, 6, 9, and 11.
Although core sequences that might play a role in elicitor-responsiveness were
identified in this study, adjacent sequences may also have a profound effect in the
binding of a specifc TFs.
Elicitor-Responsive Sequences from Seven Additional Motif Groups
The seven motif groups 1, 5, 18, 19, 21, 24, and 32 also contain elicitor-responsive
cis-sequences (Table I). Figure 7 and Table II show the results of the transient
reporter gene assays with sequences number 1, 2, 3, 4, 13, 14, 15, 16, 17, and 25.
These sequences are derived from nine queries for upregulated genes (Table I). The
number of upregulated genes in each query and the pathogenic stimuli used in the
queries can be found under the query identifier in Supplemental Table S1. In each of
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
15
the queries either B. cinerea, E. orontii, or P. infestans was combined with NPP1,
BTH, SA, chitin, or methyl jasmonate (MJ). All sequences confer induced reporter
gene activity upon treatment with the elicitor Pep25. Sequences 2 and 15 show the
highest Pep25-responsive GUS activity of all investigated constructs, while sequence
2 also has a relatively high background activity (Table II). Figure 7B shows an
alignment of sequences 2, 3, and 4 from motif group 5 and sequences 15 and 16
from motif group 21 as well as all other single sequences tested. It is remarkable that
sequence 3 which harbours only one nucleotide difference in the conserved core
sequence (TACGTGACG)compared to sequence 2 (TACGTCACG), shows the
weakest Pep25-responsive gene expression (Table II, Fig. 7B). This indicates that
either additional sequences adjacent to, or the single nucleotide change within the
core sequence influence the strength of gene expression. The alignment of the
sequence 4 with 2 and 3 from motif group 5 and sequences 15 and 16 from motif
group 21 did not yield a readily identifieable core sequence each. Motiv groups 1, 3,
and 7 show similarities to bZIP TFBS and group 5 is related to these groups (Fig. 2).
However, only sequences 2 and 3 from group 5 show similarity to bZIP binding sites
(ACGTG) in their core sequence (Fig. 7B). Motif groups 19 and 32 to which the
sequences 14 and 25 belong do not show a strong similarity to known TFBS. In
contrast, motif groups 18 and 24 to which the sequences 13 and 17 belong show
similarity to MYB and ERF TFBS, respectively (Fig. 2). In this context it should be
mentioned that sequence 16 also harbours a core WRKY binding site (Fig. 7B) and
that the SpeI linker ligated to sequence 25 generates a core WRKY binding site (data
not shown).
Experimental Analysis of cis-Sequences in N. benthamiana
To investigate the functionality of the elicitor-responsive cis-sequences in another
system, N. benthamiana leaves were injected with A. tumefaciens harbouring
promoter reporter gene constructs. For this, 19 synthetic promoters were cloned into
a T-DNA vector with a GUS reporter gene harbouring an intron to avoid expression in
A. tumefaciens. Results of GUS stainings after injection of A. tumefaciens harbouring
recombinant T-DNAs are shown in Figure 8. In all cases, except sequence number
21, GUS staining is observed. For sequence 9, the GUS staining was very weak. The
results from this additional experimental system indicate that most of the cissequences also confer reporter gene expression during A. tumefaciens infection.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
16
CONCLUSIONS AND PERSPECTIVES
Synthetic promoters play an important role for the regulation of pathogen responsive
genes in biotechnological applications (Rushton et al., 2002; Venter, 2007). Such
approaches may be the specific expression of genes conferring resistance in
response to pathogen attack. For this and other strategies pathogen-inducible
promoters might be the most useful as they limit the cost of resistance by restricting
expression to infection sites (Gurr and Rushton, 2005). To increase the number of
available cis-regulatory sequences for the design of synthetic promoters, a
bioinformatic approach combining several different databases, software tools, and
web-servers was employed. With these, a large number of known and novel
sequence motifs conserved in pathogen coregulated genes were identified.
Experimental analysis revealed that these sequence motifs are a useful resource to
identify novel elicitor-responsive sequences. These sequences can be useful for the
design of synthetic promoters and may uncover, through further experimentation,
novel transcription factors involved in plant-pathogen interaction. The approach
presented here may be applicable to identify novel cis-responsive sequences
involved in any stress-response reaction.
MATERIALS AND METHODS
Bioinformatic Analysis
For the identification of genes upregulated by pathogenic stimuli, microarray
expression data were downloaded from TAIR (Reiser and Rhee, 2005) and
annotated to the PathoPlant database (Bülow et al., 2004). The annotation procedure
of cDNA microarray data has been described earlier (Bülow et al., 2007). In the case
of Affymetrix ATH1 microarray expression sets, for each experiment several replica
slides for control and treated plants exist. For every dataset (one control and one
treated plant) the 'array element' (probe set name), the signals, the signal detections
and the p-values were extracted. A Perl script was used to generate an induction
factor from the signals of each dataset if the detection was at least marginal
(GeneChip® Expression Analysis, Data Analysis Fundamentals, Affymetrix). If the
induction factor was <1, the negative reciprocal value was calculated. The processed
datasets (table ‘rawdataaffy’) were imported into the PathoPlant database. For gene
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
17
identification a text file was downloaded from the TAIR microarray resource (GarciaHernandez et al., 2002). This text file includes the information of locus/gene
assignments to single array elements based on BLASTn related genome mapping of
the Affymetrix ATH1 array. A Perl script was used to extract the data and multiple
locus assignments were tagged. The processed data and generated table
'assignments' with array element, gene identification and tag were imported into the
PathoPlant database. The two tables ‘rawdataaffy’ and ‘assignments’ were joined. In
order to merge records representing replicate hybridizations, geometric mean values
and base-10 logarithms of the standard deviations of the individual induction factors
were determined using a MS Visual Basic script and stored in table ‘mean’.
All data as well as links to the microarray source of the expression set can be found
on the PathoPlant site at http://www.pathoplant.de/documentation.php.
Expression data was used to identify genes coregulated upon different pathogenrelated stimuli. Genes upregulated more than 2-fold upon mainly fungal elicitation
were determined using a SQL server query tool. 732 stimulus combinations were
queried including searches for highly induced genes, i.e. genes showing no
background transcription (absent in detection call) in untreated plants within 2
replicates.
PathoPlant’s ‘Microarray expression’ online tool displays a similar functionality to the
query tool described above and can be used to determine sets of genes coregulated
upon pathogen-related stimuli.
For promoter analyses, sequences 1000 nt upstream of the transcription start site of
these genes were extracted (TAIR release 6) and converted into FASTA format. To
identify overrepresented motif sequences within these promoters, the BEST software
package (Che et al., 2005) was locally installed on a Linux SuSE9.2 system.
The package combines 4 different motif finding programs (MEME, AlignACE,
CONSENSUS, BioProspector) and an optimization step. BEST was run with default
parameters and predefined motif lengths of 5 to 10, 10 to 15 and 15 to 20
nucleotides. Overrepresented sequence motifs identified by BEST were further used
if detected by at least 2 out of the 4 motif finding programs. These identified
sequence motifs were submitted to the STAMP web server as TRANSFACcompatible matrices (Matys et al., 2003; Mahony and Benos, 2007). STAMP
classified all motifs based on matrix alignment to a similarity tree given in newick
format that was displayed using MEGA (Tamura et al., 2007). Groups containing
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
18
similar motifs were generally defined by clustering single motifs on branches with
lengths < 0.035. STAMP was further used for generating family binding profiles for all
motifs of each group by multiple alignments. STAMP was also employed for the
identification of motif similarities by comparison with known cis-elements from plant
databases AthaMap, AGRIS and PLACE (Higo et al., 1999; Davuluri et al., 2003;
Steffens et al., 2004).
Plasmid Constructs
For all recombinant DNA work standard protocols were employed (Sambrook and
Russell, 2001). For transient protoplast transformation a plasmid containing a
d35S::LUC cassette and a minimal promoter in front of a GUS reporter gene was
generated as follows: The double 35S CaMV promoter (d35S) was recovered with
HindIII/XhoI digestion from plasmid p70S-ruc (Stahl et al., 2004) and introduced into
HindIII/XhoI digested pBT10-LUC plasmid (Sprenger-Haussels and Weisshaar,
2000) to give pBT10-d35SLUC. The SacI site in pBT10-d35SLUC was removed by
digesting, filling in of sticky ends and religation. The d35S::LUC cassette was
recovered by BmtI/HindIII digestion in which the BmtI site was filled in with T4 DNA
Polymerase. This fragment was introduced into BamHI/HindIII digested pBT10-GUS
(Sprenger-Haussels and Weisshaar, 2000) in which the BamHI site was also filled in
with T4 DNA Polymerase prior to cloning. The resulting plasmid was designated
pBT10GUS-d35SLUC. The integrity of the plasmid was confirmed by partial
sequence and restriction analysis.
All oligonucleotides (Table I) were synthesized with partial SpeI and XbaI sites by
Eurofins MWG Operon (Ebersberg, Germany), annealed and ligated into the
SpeI/XbaI sites of pBT10-GUS. Multimerisation to tetramers was performed as
described previously (Sprenger-Haussels and Weisshaar, 2000; Rushton et al.,
2002). The tetramer sequence was removed by SpeI/XbaI digestion and cloned in
the SpeI/XbaI sites of pBT10GUS-d35SLUC. Plasmid DNA for protoplast
transformation was isolated with the NucleoBondR xtra midi EF kit (Macherey-Nagel
GmbH&Co KG, Düren, Germany) as described by the manufacturer.
For transient promoter studies in N. benthamiana, the synthetic promoter sequences
were
cloned
into
the
T-DNA
vector
pBINGUSintron-sbA-VirG726-pm
(pBINGUSintron, Dietmar Stahl, unpublished). This vector, a derivative of pBI121
(Jefferson et al., 1987) harbours a 35S CaMV promoter-intron-GUS expression
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
19
cassette. The complete synthetic promoters containing tetramers of the cissequences and the 35S minimal promoter were amplified by PCR from recombinant
pBT10-GUS plasmids using primers with HindIII and BamHI sites, respectively (P1:
TAGCAAGCTTGAATTCGGCGCGCCACTAGT; P2: TTGGATCCGGTGGCCACTCG
AGCGTG, 55°C annealing temperature). The CaMV35S promoter in front of the
intron containing GUS gene in pBINGUSintron was removed by HindIII/BamHI
digestion and replaced with HindIII/BamHI digested PCR products. Using the same
strategy, the minimal promoter from empty pBT10-GUS was introduced into
pBINGUSintron to give a negative control for infiltration experiments. Constructs
were confirmed by sequencing and transformed into a A. tumefaciens C58C1 strain
for agroinfiltration experiments.
Transient Reporter Gene Assays in Parsely Protoplasts
Parsley (P. crispum) callus culture Pc 5/3 was cultivated at 23 °C by shaking at
160 rpm in the dark. Subcultures were obtained by transfering 3 to 3.5 g of cells from
a 7 day old culture with a metal sieve into 40 mL fresh HA medium (per liter:
2,500 mg KNO3, 171 mg CaCl2x2H2O, 250 mg MgSO4x7H2O, 134 mg (NH4)2SO4,
150 mg NaH2PO4xH2O, 0.75 mg KI, 3 mg H3BO3, 11.2 mg MnSO4xH2O, 3 mg
ZnSO4x7H2O, 0.25 mg Na2MoO4x2H2O, 0.39 mg CuSO4x5H2O, 0.25 mg
CoCl2x6H2O, 13.9 mg FeSO4x7H2O, 18.6 mg Na2-EDTA, 100 mg myo-inositol, 1 mg
nicotinic acid, 1 mg pyridoxine x HCl, 10 mg thiamine x HCl, 1 mg 2,4-D, 20 g
sucrose, pH 5.5).
To isolate parsley protoplasts, a 5 day old dark grown parsley callus culture was
used. The culture was spinned down for 5 min at room temperature and 300 x g. The
cell pellet was resuspended in 30 mL enzyme solution (0.08 % macerocyme, 0.5 %
cellulase in 0.24 M CaCl2) and filled up to 90 mL with 0.24 M CaCl2. Cells were
shaken for 20 hours at 20 rpm and 23 °C and subsequently for 20 min at 40 - 45 rpm
at the same temperature in the dark. The suspension was divided into two 50 mL
tubes and spinned down for 2 min at 300 x g. Cell pellets where washed each with 20
mL 0.24 M CaCl2 (2 min, 300 x g), resuspended in 25 mL P5 medium (Gamborgs B5
supplemented with 0.28 M sucrose and 1 mg/L 2,4-D, pH 5.7) each and combined.
After centrifugation (5 min, 300 x g), the intact protoplasts flotate on the surface of
the medium. These protoplastes where removed and filled up with P5 medium. This
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
20
flotation procedure was repeated three times. Obtained protoplastes where used for
transformation.
For transformation 10 µg plasmid DNA were mixed with 200 µL PEG solution (25 %
PEG 6000, 450 mM mannitol, 100 mM Ca(NO3)2) in a 15 mL tube. 200 µL
protoplasts were added and mixed slightly. After incubation for 20 min in the dark, 5
mL of 275 mM Ca(NO3)2 supplemented with 2 mM MES (pH 6.0) were used to stop
the transformation. Protoplasts were pelleted by centrifugation at 150 x g for 7 min
and the cell pellet was resuspended in 6 mL P5. Half of the suspension was
transferred in a new 15 mL tube. Pep25 was added to one of the tubes (end
concentration
300
ng/mL).
Pep25
elicitor
(Peptide:
DVTAGAEVWNQPVRGFKVYEQTEMT) from Phytophthora sojae (Nürnberger et al.,
1994) was synthesized by SeqLab, Göttingen, Germany. Protoplasts were cultured in
the dark at 23 °C for 24 hours. After this cultivation time protoplasts were harvested
by adding 9 mL of 0.24 M CaCl2 and centrifugating for 10 min at 1,400 x g. Cell
pellets were frozen in liquid nitrogen and stored at -80 °C until GUS/LUC analysis.
150 µL of LUC extraction buffer (0.1 M NaH2PO4, pH 7.8 supplemented with 1 mM
DTT) were added to the frozen samples. After shaking (mixer 5432, Eppendorf) for
20 min at 4 °C, extracts were centrifuged for 10 min at 4 °C and 25,000 x g. The
supernatant was kept on ice and was used for protein quantification and GUS/LUC
assays. Total protein was determined according to Bradford (Bradford, 1976) and a
defined amount of 4 µg protein in 50 µL LUC extraction buffer was used for LUC
assays. LUC assays were prepared according to de Wet et al. (de Wet et al., 1987).
Diluted samples were put into the wells of white 96 well microtiter plates and plates
were inserted into a TriStar LB 941 microplate reader (Berthold Technologies GmbH
& Co. KG, Bad Wildbad, Germany). 50 µL of luciferin (0.2 µM in Glycylglycin, pH 7.8)
and 175 µL of LUC reaction buffer (15 mM MgSO4, 25 mM Glycylglycin, pH 7.8, 5
mM ATP) were added by the TriStar and the luminescence was measured for 15 sec.
For GUS analysis (Jefferson et al., 1987) 25 µL of the diluted protein extract (2 µg)
were transferred into a well of a black 96 well microtiter plate. 225 µL of GUS
reaction buffer (50 mM NaPO4, pH 7.0, 10mM Na2EDTA, 0.1 % triton X-100, 0.1 %
N-lauryl sarcosine, 10 mM ß-mercaptoethanol, 1 mM 4-methylumbelliferyl-β-Dglucuronide) were added, the plate was inserted into the TriStar, and incubated at 37
°C for 10 min prior to measurements at 37 °C. For continuous measurement of GUS
activity, the samples in each well were then measured every 15 min for 1 s over the
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
21
next 3 h (excitation 360 nm, emission 460 nm). Afterwards, for each well, a linear
regression over the time period with a linear increase of fluorescence was performed.
Non-linear parts were excluded from the regression. The slope of the regression line
was then transformed into pmol 4-MU min-1 mg protein-1. For this, a calibration of
fluorescence units with defined amounts of 4-MU was performed in the TriStar. A
linear increase of fluorescence units with 4-MU concentration has been observed up
to at least 75 μM. This linear correlation was then used for the transformation
mentioned above.
For each synthetic promoter at least three independent experiments with two
transformations each were carried out. To obtain comparable results that are
independent from transformation efficiencies, all GUS values were normalized with
the help of their corresponding LUC values. Only LUC values obtained without elicitor
were used for normalisation because the same transformation gives lower LUC
values after elicitor treatment although the transformation efficiency is the same. For
normalisation of the GUS values, one LUC value (without Pep25 elicitor) was
selected and all other LUC values without elicitor were divided by this selected LUC
value. The obtained quotients were used to divide corresponding GUS values with
and without elicitor. Standard deviations were calculated from these normalized GUS
values. GUS values and standard deviations from controls (TATA and 4D) were
calculated from all performed experiments.
Agroinfiltration of N. benthamiana Leaves
The inoculum for infiltration experiments was prepared as described (Wroblewski et
al., 2005) with minor changes: Agrobacteria harbouring the promoter-GUS fusions in
pBINGUSintron (see above) were grown on LB plates with rifampicin (c=50 μg/mL),
kanamycin (c=50 μg/mL) and carbenicillin (c=100 μg/mL) at 25 °C for 48 hours. A
single colony was used to inoculate 5 mL of LB broth with the same antibiotics as
above. The starter culture was grown for 24 h at 25 °C, then added to 45 mL fresh LB
broth (with antibiotics, see above) and cultivated for further 5-6 h. Cells were
harvested by centrifugation at 3000 x g for 10 min and resuspended in dH20 to a final
OD600 of 0.4–0.5.
The N. benthamiana plants used for the infiltration experiments were either soil
grown in the greenhouse (during summer) or in a 25 °C light chamber (16 h light, 8 h
dark, during winter). The bacterial suspension was infiltrated into the abaxial side of
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
22
fully expanded N. benthamiana leaves using a needleless 1 mL syringe. For each
experiment the positive control (pBINGUSintron with 35S-GUS), the negative control
(TATA-GUS in pBINGUSintron) and the construct under investigation were infiltrated
in different areas of the same leaf. A second leaf from a different plant was infiltrated
in the same way as technical replicate. After infiltration the plants were kept in the
greenhouse for 3 days.
For subsequent GUS-staining 2-5 leaf discs (Ø 8 mm) were excised from each
infiltrated area of one leaf. GUS-staining was then performed as described (Jefferson
et al., 1987). The staining was stopped after 16 – 20 h and leaf discs were stored in
ethanol to extract chlorophyll and facilitate photographic documentation. Each
experiment was done at least twice independently.
Supplemental Data
The following materials are available in the online version of this article
Supplemental Table S1: PathoPlant database queries to identify common genes
upregulated by pathogens or pathogen-related stimuli.
Supplemental Table S2: Sequence motif families identified with STAMP.
Supplemental Table S3: Similarity of motif families to known cis-regulatory
sequences in the AthaMap, AGRIS, and PLACE databases.
Supplemental Data File S1: Sequence motifs identified with BEST.
ACKNOWLEDGEMENTS
We would like to thank Imre Somssich, MPI for Plant Breeding Research, Cologne,
Germany, for providing the parsley callus culture and Fridtjof Weltmeier, KWS SAAT
AG, Einbeck, Germany, for stimulating discussions. We also thank Claudia
Galuschka for advice establishing bioinformatic query tools and Henning Schmidt for
critical reading of the manuscript.
LITERATURE CITED
Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003)
Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional
activators in abscisic acid signaling. Plant Cell 15: 63-78
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
23
Abe H, Yamaguchi-Shinozaki K, Urao T, Iwasaki T, Hosokawa D, Shinozaki K
(1997) Role of Arabidopsis MYC and MYB homologs in drought- and abscisic
acid- regulated gene expression. Plant Cell 9: 1859-1868
Asai T, Tena G, Plotnikova J, Willmann MR, Chiu WL, Gomez-Gomez L, Boller
T, Ausubel FM, Sheen J (2002) MAP kinase signalling cascade in
Arabidopsis innate immunity. Nature 415: 977-983
Bailey TL, Elkan C (1995) The value of prior knowledge in discovering motifs with
MEME. Proc Int Conf Intell Syst Mol Biol 3: 21-29
Bent AF, Mackey D (2007) Elicitors, effectors, and R genes: the new paradigm and
a lifetime supply of questions. Annu Rev Phytopathol 45: 399-436
Bethke G, Unthan T, Uhrig JF, Poschl Y, Gust AA, Scheel D, Lee J (2009) Flg22
regulates the release of an ethylene response factor substrate from MAP
kinase 6 in Arabidopsis thaliana via ethylene signaling. Proc Natl Acad Sci
USA 106: 8067-8072
Boller T, Felix G (2009) A renaissance of elicitors: perception of microbe-associated
molecular patterns and danger signals by pattern-recognition receptors. Annu
Rev Plant Biol 60: 379-406
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal.
Biochem. 7: 248-254
Brady SM, Provart NJ (2009) Web-queryable large-scale data sets for hypothesis
generation in plant biology. Plant Cell 21: 1034-1051
Bülow L, Brill Y, Hehl R (2010) AthaMap-assisted transcription factor target gene
identification in Arabidopsis thaliana. Database (Oxford) 2010: baq034
Bülow L, Engelmann S, Schindler M, Hehl R (2009) AthaMap, integrating
transcriptional and post-transcriptional data. Nucleic Acids Res 37: D983D986
Bülow L, Schindler M, Choi C, Hehl R (2004) PathoPlant: A database on plantpathogen interactions. In Silico Biol 4: 529–536
Bülow L, Schindler M, Hehl R (2007) PathoPlant: a platform for microarray
expression data to analyze co-regulated genes involved in plant defense
responses. Nucleic Acids Res 35: D841-D845
Bülow L, Steffens NO, Galuschka C, Schindler M, Hehl R (2006) AthaMap: from
in silico data to real transcription factor binding sites. In Silico Biol 6: 243-252
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
24
Chang WC, Lee TY, Huang HD, Huang HY, Pan RL (2008) PlantPAN: Plant
promoter analysis navigator, for identifying combinatorial cis-regulatory
elements with distance constraint in plant gene groups. BMC Genomics 9: 561
Che D, Jensen S, Cai L, Liu JS (2005) BEST: binding-site estimation suite of tools.
Bioinformatics. 21: 2909-2911
Chen C, Chen Z (2002) Potentiation of Developmentally Regulated Plant Defense
Response by AtWRKY18, a Pathogen-Induced Arabidopsis Transcription
Factor. Plant Physiol 129: 706-716
Ciolkowski I, Wanke D, Birkenbihl RP, Somssich IE (2008) Studies on DNAbinding selectivity of WRKY transcription factors lend structural clues into
WRKY-domain function. Plant Mol Biol 68: 81-92
Crooks GE, Hon G, Chandonia JM, Brenner SE (2004) WebLogo: a sequence logo
generator. Genome Res 14: 1188-1190
Davuluri RV, Sun H, Palaniswamy SK, Matthews N, Molina C, Kurtz M,
Grotewold E (2003) AGRIS: Arabidopsis Gene Regulatory Information
Server, an information resource of Arabidopsis cis-regulatory elements and
transcription factors. BMC Bioinformatics 4: 25
de Pater S, Greco V, Pham K, Memelink J, Kijne J (1996) Characterization of a
zinc-dependent transcriptional activator from Arabidopsis. Nucleic Acids Res
24: 4624-4631
De Vos M, Denekamp M, Dicke M, Vuylsteke M, Van Loon L, Smeekens SC,
Pieterse CM (2006) The Arabidopsis thaliana Transcription Factor AtMYB102
Functions in Defense Against the Insect Herbivore Pieris rapae. Plant Signal
Behav 1: 305-311
de Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S (1987) Firefly
luciferase gene: structure and expression in mammalian cells. Mol Cell Biol 7:
725-737
Du L, Chen Z (2000) Identification of genes encoding receptor-like protein kinases
as possible targets of pathogen- and salicylic acid-induced WRKY DNAbinding proteins in Arabidopsis. Plant J 24: 837-847
Dubos C, Stracke R, Grotewold E, Weisshaar B, Martin C, Lepiniec L (2010)
MYB transcription factors in Arabidopsis. Trends Plant Sci 15: 573-581
Eskin E, Pevzner PA (2002) Finding composite regulatory patterns in DNA
sequences. Bioinformatics 18 Suppl 1: S354-S363
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
25
Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000) The WRKY superfamily
of plant transcription factors. Trends Plant Sci 5: 199-206
Feller A, Machemer K, Braun EL, Grotewold E (2011) Evolutionary and
comparative analysis of MYB and bHLH plant transcription factors. Plant J 66:
94-116
Galuschka C, Schindler M, Bülow L, Hehl R (2007) AthaMap web-tools for the
analysis and identification of co-regulated genes. Nucleic Acids Res 35: D857D862
Garcia-Hernandez M, Berardini TZ, Chen G, Crist D, Doyle A, Huala E, Knee E,
Lambrecht M, Miller N, Mueller LA, Mundodi S, Reiser L, Rhee SY, Scholl
R, Tacklind J, Weems DC, Wu Y, Xu I, Yoo D, Yoon J, Zhang P (2002)
TAIR: a resource for integrated Arabidopsis data. Funct Integr Genomics 2:
239-253
Grant SR, Fisher EJ, Chang JH, Mole BM, Dangl JL (2006) Subterfuge and
manipulation: type III effector proteins of phytopathogenic bacteria. Annu Rev
Microbiol 60: 425-449
GuhaThakurta D, Stormo GD (2001) Identifying target sites for cooperatively
binding factors. Bioinformatics 17: 608-621
Guo Y, Gan S (2011) AtMYB2 regulates whole plant senescence by inhibiting
cytokinin-mediated branching at late stages of development in Arabidopsis.
Plant Physiol 156: 1612-1619
Gurr SJ, Rushton PJ (2005) Engineering plants with increased disease resistance:
how are we going to express it? Trends Biotechnol 23: 283-290
Hahlbrock K, Scheel D, Logemann E, T. N, Parniske M, Reinold S, Sacks W,
Schmelzer E (1995) Oligopeptide elicitor-mediated defense gene activation in
cultured parsley cells. Proc Natl Acad Sci USA 92: 4150-4157
Hartmann U, Sagasser M, Mehrtens F, Stracke R, Weisshaar B (2005) Differential
combinatorial interactions of cis-acting elements recognized by R2R3-MYB,
BZIP, and BHLH factors control light-responsive and tissue-specific activation
of phenylpropanoid biosynthesis genes. Plant Mol Biol 57: 155-171
Hehl R, Bülow L (2008) Internet resources for gene expression analysis in
Arabidopsis thaliana. Current Genomics 9: 375-380
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
26
Hehl R, Steffens NO, Wingender E (2004) Isolation and analysis of gene regulatory
sequences. In P Christou, H Klee, eds, Handbook of Plant Biotechnology.
John Wiley and Sons Ltd., pp 81-102
Hehl R, Wingender E (2001) Database-assisted promoter analysis. Trends in Plant
Sci. 6: 251-255
Hertz GZ, Stormo GD (1999) Identifying DNA and protein patterns with statistically
significant alignments of multiple sequences. Bioinformatics 15: 563-577
Higo K, Ugawa Y, Iwamoto M, Korenaga T (1999) Plant cis-acting regulatory DNA
elements (PLACE) database: 1999. Nucleic Acids Res 27: 297-300
Hoeren FU, Dolferus R, Wu Y, Peacock WJ, Dennis ES (1998) Evidence for a role
for AtMYB2 in the induction of the Arabidopsis alcohol dehydrogenase gene
(ADH1) by low oxygen. Genetics 149: 479-490
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: ß-glucuronidase as a
sensitive and versatile gene fusion marker in higher plants. EMBO J 6: 39013907
Jensen ST, Liu JS (2004) BioOptimizer: a Bayesian scoring function approach to
motif discovery. Bioinformatics 20: 1557-1564
Kim KC, Lai Z, Fan B, Chen Z (2008) Arabidopsis WRKY38 and WRKY62
transcription factors interact with histone deacetylase 19 in basal defense.
Plant Cell 20: 2357-2371
Kirsch C, Takamiya-Wik M, Schmelzer E, Hahlbrock K, Somssich IE (2000) A
novel regulatory element involved in rapid activation of parsley ELI7 gene
family members by fungal elicitor or pathogen infection. Mol Plant Pathol 1:
243-251
Liu X, Brutlag DL, Liu JS (2001) BioProspector: discovering conserved DNA motifs
in upstream regulatory regions of co-expressed genes. Pac Symp Biocomput
6: 127-138
Mahony S, Benos PV (2007) STAMP: a web tool for exploring DNA-binding motif
similarities. Nucleic Acids Res 35: W253-W258
Maleck K, Levine A, Eulgem T, Morgan A, Schmid J, Lawton KA, Dangl JL,
Dietrich RA (2000) The transcriptome of Arabidopsis thaliana during systemic
acquired resistance. Nat Genet 26: 403-410
Matys V, Fricke E, Geffers R, Gossling E, Haubrock M, Hehl R, Hornischer K,
Karas D, Kel AE, Kel-Margoulis OV, Kloos DU, Land S, Lewicki-Potapov
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
27
B, Michael H, Münch R, Reuter I, Rotert S, Saxel H, Scheer M, Thiele S,
Wingender E (2003) TRANSFAC: transcriptional regulation, from patterns to
profiles. Nucleic Acids Res 31: 374-378
Mengiste T, Chen X, Salmeron J, Dietrich R (2003) The BOTRYTIS
SUSCEPTIBLE1 gene encodes an R2R3MYB transcription factor protein that
is required for biotic and abiotic stress responses in Arabidopsis. Plant Cell 15:
2551-2565
Miao Y, Laun T, Zimmermann P, Zentgraf U (2004) Targets of the WRKY53
transcription factor and its role during leaf senescence in Arabidopsis. Plant
Mol Biol 55: 853-867
Nürnberger T, Nennstiel D, Jabs T, Sacks WR, Hahlbrock K, Scheel D (1994)
High affinity binding of a fungal oligopeptide elicitor to parsley plasma
membranes triggers multiple defense responses. Cell 78: 449-460
Palaniswamy SK, James S, Sun H, Lamb RS, Davuluri RV, Grotewold E (2006)
AGRIS and AtRegNet. a platform to link cis-regulatory elements and
transcription factors into regulatory networks. Plant Physiol 140: 818-829
Perez-Rodriguez P, Riano-Pachon DM, Correa LG, Rensing SA, Kersten B,
Mueller-Roeber B (2009) PlnTFDB: updated content and new features of the
plant transcription factor database. Nucleic Acids Res 38: D822-827
Pitzschke A, Djamei A, Teige M, Hirt H (2009) VIP1 response elements mediate
mitogen-activated protein kinase 3-induced stress gene expression. Proc Natl
Acad Sci USA 106: 18414-18419
Priest HD, Filichkin SA, Mockler TC (2009) cis-Regulatory elements in plant cell
signaling. Curr Opin Plant Biol 12: 643-649
Qiu JL, Fiil BK, Petersen K, Nielsen HB, Botanga CJ, Thorgrimsen S, Palma K,
Suarez-Rodriguez MC, Sandbech-Clausen S, Lichota J, Brodersen P,
Grasser KD, Mattsson O, Glazebrook J, Mundy J, Petersen M (2008)
Arabidopsis MAP kinase 4 regulates gene expression through transcription
factor release in the nucleus. EMBO J 27: 2214-2221
Reiser L, Rhee SY (2005) Using the Arabidopsis Information Resource (TAIR) to
find information about Arabidopsis genes. Curr Protoc Bioinformatics Chapter
1: Unit 1 11
Robatzek S, Somssich IE (2002) Targets of AtWRKY6 regulation during plant
senescence and pathogen defense. Genes Dev 16: 1139-1149
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
28
Roth FP, Hughes JD, Estep PW, Church GM (1998) Finding DNA regulatory motifs
within unaligned noncoding sequences clustered by whole-genome mRNA
quantitation. Nat Biotechnol 16: 939-945
Rushton PJ, Reinstadler A, Lipka V, Lippok B, Somssich IE (2002) Synthetic
Plant Promoters Containing Defined Regulatory Elements Provide Novel
Insights into Pathogen- and Wound-Induced Signaling. Plant Cell 14: 749-762
Rushton PJ, Somssich IE, Ringler P, Shen QJ (2010) WRKY transcription factors.
Trends Plant Sci 15: 247-258
Rushton PJ, Torres JT, Parniske M, Wernert P, Hahlbrock K, Somssich IE
(1996) Interaction of elicitor-induced DNA-binding proteins with elicitor
response elements in the promoters of parsley PR1 genes. EMBO J 15: 56905700
Sambrook J, Russell DW (2001) Molecular cloning. A laboratory manual., Ed 3rd.
Cold Spring Harbor Laboratory Press, New York
Sandelin A, Wasserman WW (2004) Constrained binding site diversity within
families of transcription factors enhances pattern discovery bioinformatics. J
Mol Biol 338: 207-215
Scarpeci TE, Zanor MI, Carrillo N, Mueller-Roeber B, Valle EM (2008) Generation
of superoxide anion in chloroplasts of Arabidopsis thaliana during active
photosynthesis: a focus on rapidly induced genes. Plant Mol Biol 66: 361-378
Serpa V, Vernal J, Lamattina L, Grotewold E, Cassia R, Terenzi H (2007)
Inhibition of AtMYB2 DNA-binding by nitric oxide involves cysteine Snitrosylation. Biochem Biophys Res Commun 361: 1048-1453
Sprenger-Haussels M, Weisshaar B (2000) Transactivation properties of parsley
proline-rich bZIP transcription factors. Plant J 22: 1-8
Stahl DJ, Kloos DU, Hehl R (2004) A sugar beet chlorophyll a/b binding protein
promoter void of G-box like elements confers strong and leaf specific reporter
gene expression in transgenic sugar beet. BMC Biotechnol 4: 31
Steffens NO, Galuschka C, Schindler M, Bülow L, Hehl R (2004) AthaMap: an
online resource for in silico transcription factor binding sites in the Arabidopsis
thaliana genome. Nucleic Acids Res 32: D368-D372
Steffens NO, Galuschka C, Schindler M, Bülow L, Hehl R (2005) AthaMap web
tools for database-assisted identification of combinatorial cis-regulatory
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
29
elements and the display of highly conserved transcription factor binding sites
in Arabidopsis thaliana. Nucleic Acids Res 33: W397-W402
Suarez-Rodriguez MC, Adams-Phillips L, Liu Y, Wang H, Su SH, Jester PJ,
Zhang S, Bent AF, Krysan PJ (2007) MEKK1 is required for flg22-induced
MPK4 activation in Arabidopsis plants. Plant Physiol 143: 661-669
Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596-1599
Tena G, Boudsocq M, Sheen J (2011) Protein kinase signaling networks in plant
innate immunity. Curr Opin Plant Biol 14: 519-529
Usadel B, Obayashi T, Mutwil M, Giorgi FM, Bassel GW, Tanimoto M, Chow A,
Steinhauser D, Persson S, Provart NJ (2009) Co-expression tools for plant
biology: opportunities for hypothesis generation and caveats. Plant Cell
Environ 32: 1633-1651
van de Löcht U, Meier I, Hahlbrock K, Somssich IE (1990) A 125 bp promoter
fragment is sufficient for strong elicitor-mediated gene activation in parsley.
EMBO J 9: 2945-2950
Van der Ent S, Verhagen BW, Van Doorn R, Bakker D, Verlaan MG, Pel MJ,
Joosten RG, Proveniers MC, Van Loon LC, Ton J, Pieterse CM (2008)
MYB72 is required in early signaling steps of rhizobacteria-induced systemic
resistance in Arabidopsis. Plant Physiol 146: 1293-1304
Van Verk MC, Pappaioannou D, Neeleman L, Bol JF, Linthorst HJM (2008) A
novel WRKY transcription factor is required for induction of PR-1a gene
expression by salicylic acid and bacterial elicitors. Plant Physiol 146: 19831995
Venter M (2007) Synthetic promoters: genetic control through cis engineering.
Trends Plant Sci 12: 118-124
Wroblewski T, Tomczak A, Michelmore R (2005) Optimization of Agrobacteriummediated transient assays of gene expression in lettuce, tomato and
Arabidopsis. Plant Biotechnol J 3: 259-273
Xu X, Chen C, Fan B, Chen Z (2006) Physical and functional interactions between
pathogen-induced
Arabidopsis
WRKY18,
WRKY40,
transcription factors. Plant Cell 18: 1310-1326
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
and
WRKY60
30
Yilmaz A, Mejia-Guerra MK, Kurz K, Liang X, Welch L, Grotewold E (2011)
AGRIS: the Arabidopsis Gene Regulatory Information Server, an update.
Nucleic Acids Res 39: D1118-D1122
Yu D, Chen C, Chen Z (2001) Evidence for an important role of WRKY DNA binding
proteins in the regulation of NPR1 gene expression. Plant Cell 13: 1527-1540
Zou C, Sun K, Mackaluso JD, Seddon AE, Jin R, Thomashow MF, Shiu SH
(2011) Cis-regulatory code of stress-responsive transcription in Arabidopsis
thaliana. Proc Natl Acad Sci USA 108: 14992-14997
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
31
Figure 1. Bioinformatic identification and experimental analysis of conserved
sequence motifs in pathogen coregulated genes.
Figure 2. Classification of sequence motif groups.
A motif relationship tree generated by STAMP and illustrated with MEGA is shown.
The number of motifs in each of the 37 motif families is given in parenthesis.
Similarities to transcription factor binding sites were determined using STAMP. Motif
groups showing high similarity to known cis-regulatory sequences are indicated by
the designation of the corresponding transcription factor family and the lowest E
value.
Figure 3. The pBT10GUS-d35SLUC vector for transient reporter gene assays.
A) A schematic representation of pBT10GUS-d35SLUC with relevant restriction sites
and positions of the GUS (uidA) and LUC reporter genes. Also shown are double
CaMV 35S promoter (d35S), CaMV 35S minimal promoter (TATA), nopaline
synthase terminator (Tnos), origin of replication (ColE1), and ampicillin resistance
gene (bla). B) Quantitative GUS reporter gene assays using pBT10GUS-d35SLUC
alone and the same vector containing synthetic promoter 4D driving GUS expression.
Plasmids were transformed into parsley protoplasts and treated without (-) and with
(+) Pep25 elicitor. All normalized GUS values are shown in Table II. C) Schematic
representation of four copies of cis-sequences cloned upstream of the 35S minimal
promoter (TATA) and the GUS (uidA) reporter gene in pBT10GUS-d35SLUC.
Figure 4. Elicitor-responsive sequences from motif group 27.
A) Quantitative GUS reporter gene assays using pBT10GUS-d35SLUC (NC) and the
same plasmid containing synthetic promoters 4D (PC) or four copies of single
sequences 18 through 24 (Table I) driving GUS expression. Plasmids were
transformed into parsley protoplasts and treated without (-) and with (+) Pep25
elicitor. B) Alignment of elicitor-responsive sequences 18 through 24. Underlined are
W-box core sequences. A core sequence determined from the alignment is shaded.
C) Family binding profile (FBP) generated by STAMP with all 26 motifs in motif group
27 (Fig. 2).
Figure 5. Elicitor-responsive sequences from motif group 11.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
32
A) Quantitative GUS reporter gene assays using pBT10GUS-d35SLUC (NC) and the
same plasmid containing synthetic promoters 4D (PC) or four copies of single
sequences 5 through 8 (Table I) driving GUS expression. Plasmids were transformed
into parsley protoplasts and treated without (-) and with (+) Pep25 elicitor. B)
Alignment of elicitor-responsive sequences 5 through 8. Underlined are W-box core
sequences. A core sequence determined from the alignment is shaded. C) Family
binding profile (FBP) generated by STAMP with all 10 motifs in motif group 11 (Fig.
2).
Figure 6. Elicitor-responsive sequences from motif group 12.
A) Quantitative GUS reporter gene assays using pBT10GUS-d35SLUC (NC) and the
same plasmid
containing synthetic promoters 4D (PC) or four copies of single
sequences 9 through 12 (Table I) driving GUS expression. Plasmids were
transformed into parsley protoplasts and treated without (-) and with (+) Pep25
elicitor. B) Alignment of elicitor-responsive sequences 9 through 12. Underlined is a
W-box core sequence. A core sequence determined from the alignment is shaded.
C) Family binding profile (FBP) generated by STAMP with all 21 motifs in motif group
12 (Fig. 2).
Figure 7. Elicitor-responsive sequences from seven motif groups.
A) Quantitative GUS reporter gene assays using pBT10GUS-d35SLUC (NC) and the
same plasmid containing synthetic promoters 4D (PC) or four copies of single
sequences 1 through 4, 13 through 17, and 25 (Table I) driving GUS expression.
Plasmids were transformed into parsley protoplasts and treated without (-) and with
(+) Pep25 elicitor. B) Single sequences from motif groups 1 (Sequence 1), 5 (2, 3, 4),
18 (13), 19 (14), 21 (15, 16), 24 (17), and 32 (25), respectively (Table I). Elicitorresponsive sequences 2, 3, and 4 from motif group 5 and 15 and 16 from group 21
are aligned. Underlined is a W-box core sequence. A core sequence determined
from the alignment of sequences 2 and 3 is shaded.
Figure 8. Transient reporter gene acticivity of elicitor-responsive sequences on TDNA constructs infiltrated with A. tumefaciens in N. benthamiana.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
33
PC and NC are reporter gene constructs with a 35S CaMV and a minimal promoter,
respectively. The numbers correspond to the sequence numbers shown in Table I
and 2.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
34
Table I. Elicitor-responsive cis-sequences.
1
12i_M1_S1
Motif
Sequence
Group
1
TCTCATCTCTCGACACGCAACTTCC
2
20u_M1_S1
5
3
20u_M1_S2
4
28M-1_M1_S1
5
No. Sequence ID
Position Gene ID
-81
At5g04340
TGTTGAGTCGTTTACGTCACGTCGAGAATTTTCTC
-52
At1g13990
5
TGTCATTATTAATACGTGACGAAACTGTAGCTCTG
-181
At4g05020
5
TTACGTGTCAAGAAGTGATTGGAGAGGACACTCTAC
-84
At1g09080
15AAA_M1_S1 11
GACTTTTGACCTAAACCATTTCCAT
-106
At2g40140
6
22A_M1_S1
11
GTTTTGACTTTTGACCTAAACCATTTCCATGTAGAA
-105
At2g40140
7
22DDD_M1_S1 11
CCGTCTTAGTTTACCGAAACCAAAGTGGCTTTTTCT
-187
At3g14990
8
21G-2_M1_S2
11
CGTAATAATGGTTTGGTTTGGTTTGATCAAGTCTT
-157
At3g55470
9
38M_M1_S1
12
AAATAATTATTTATGGTTTGGTCATTTGGTCAAAT
-85
At4g23810
10
26LLL_M1_S2
12
AGTCAAAACGTAGACCAAAACAAAAACATGTAACT
-86
At4g01700
11
18H_M2_S1
12
CAACACAAAACGCAAACGCAGACCTC
-46
At1g70170
12
18H_M2_S3
12
AATTGACAAAAGACACGCAAACGATTCCAACGACC
-86
At1g70170
13
12G_M2_S1
18
CCATACAATATAAACCACCAAACCATAACCACAAA
-143
At1g61800
14
30I-6_M2_S1
19
TTAGAAAAGTAGGAAAGAGTTGGTCACCCAAATTA
-68
At3g22600
15
27G-8_M1_S1
21
AGGACTTTTCACCAGTTGGACTTTGAAGCCACCAA
-121
At2g38860
16
15CCC_M1_S1 21
CACACACGTGTACTAGGTCAAACCA
-239
At1g27730
17
21Q_M1_S1
24
GCTTAAGCCGCCTGGCCGCCTCTGGAGGGACCAAAA -133
At5g61160
18
21S_M3_S1
27
TAATTTCTCTTGCGTAGAAAAGTCTGATCGGGAAG
-130
At1g76960
19
14S_M1_S1
27
TTCTCTTGCGTAGAAAAGTCTGATCG
-131
At1g76960
20
30I-8_M1_S1
27
ACAACAGACGACTTTTCATAATTCA
-791
At5g12930
21
30I-8_M1_S2
27
CTATATGACAAAAGTCAAACATAAA
-73
At1g26390
22
30I-8_M1_S3
27
TCGTTCTTCAGTCAAAAAGTCAAACTATCTCTCTC
-65
At5g24110
23
27D-10_M1_S2 27
TGTTCACTTTGAAAAGTATTCTTTGAG
-169
At3g26830
24
30H-8_M1_S2
27
TGGTCAGCATGTTGGACTTTCCAAATTCATTGACC
-133
At5g24110
25
12r_M1_S1
32
CAATCTACTCGTCTCTTCTCTTACAT
-43
At1g73480
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
35
Table II. Normalized GUS values (pmol 4-MU min-1 mg protein-1) and standard
deviations (SD) obtained for reporter gene constructs in a parsely protoplast system
without (-) and with (+) Pep25 treatment.
No.
Sequence ID
-Pep25
SD
+Pep25
SD
-
pBT10-GUS/LUC
552
386
528
321
-
4D
2,116
769
71,006
14,524
1
12i_M1_S1
16,485
5,165
47,882
11,165
2
20u_M1_S1
20,878
10,366
130,301
48,986
3
20u_M1_S2
1,415
220
2,835
599
4
28M-1_M1_S1
10,152
2,030
26,467
4,561
5
15AAA_M1_S1
505
178
9,653
5,604
6
22A_M1_S1
531
126
14,991
3,841
7
22DDD_M1_S1
1,808
416
10,419
5,444
8
21G-2_M1_S2
678
231
18,437
7,534
9
38M_M1_S1
960
354
15,990
5,345
10
26LLL_M1_S2
1,029
303
7,010
2,532
11
18H_M2_S1
407
95
16,444
3,964
12
18H_M2_S3
2,672
525
20,035
2,768
13
12G_M2_S1
4,289
1,107
9,064
2,337
14
30I-6_M2_S1
1,720
700
11,112
5,905
15
27G-8_M1-S1
3,421
1,003
76,866
14,085
16
15CCC_M1_S1
2,936
597
16,911
5,985
17
21Q_M1_S1
866
227
2,674
433
18
21S_M3_S1
4,069
1,106
9,532
4,859
19
14S_M1_S1
1,747
824
3,390
1,348
20
30I-8_M1_S1
3,984
2,539
16,204
11,485
21
30I-8_M1_S2
2,142
1,153
16,303
7,953
22
30I-8_M1_S3
1,958
358
15,462
4,784
23
27D-10_M1_S2
2,651
688
39,217
11,829
24
30H-8_M1_S2
470
277
26,447
9,674
25
12r_M1_S1
622
92
9,177
2,958
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
1. Step
732 PathoPlant database queries for genes
Upregulated more than twofold by
pathogen related stimuli
510 upregulated gene
groups identified
2. Step
Identification of conserved sequence motifs within
1,000 bp upstream sequence of 510 upregulated
gene groups using BEST
443 motifs identified
3. Step
Motif classification
using STAMP
37 motif groups
identified
4. Step
Selection of cis-sequences,construction of
synthetic promoters, and experimental analysis
for elicitor-responsive gene expression
25 elicitor-responsive
sequences discovered
Figure 1. Bioinformatic identification and experimental analysis of conserved sequence motifs in
pathogen coregulated genes.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
Figure 2. Classification of sequence motif
groups.
A motif relationship tree generated by STAMP
and illustrated with MEGA is shown. The
number of motifs in each of the 37 motif
families is given in parenthesis. Similarities to
transcription factor binding sites were
determined using STAMP. Motif groups
showing high similarity to known cisregulatory sequences are indicated by the
designation of the corresponding transcription
factor family and the lowest E value.
0.1
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
A
B
C
SpeI
XbaI
4 x cis-sequences
TATA
uidA
Figure 3. The pBT10GUS-d35SLUC vector for transient reporter gene assays.
A) A schematic representation of pBT10GUS-d35SLUC with relevant restriction sites and
positions of the GUS (uidA) and LUC reporter genes. Also shown are double CaMV 35S
promoter (d35S), CaMV 35S minimal promoter (TATA), nopaline synthase terminator
(Tnos), origin of replication (ColE1), and ampicillin resistance gene (bla). B) Quantitative
GUS reporter gene assays using pBT10GUS-d35SLUC aloneand the same vector
containing synthetic promoter 4D driving GUS expression. Plasmids were transformed into
parsley protoplasts and treated without (-) and with (+) Pep25 elicitor. All normalized GUS
values are shown in Table II. C) Schematic representation of four copies of cis-sequences
cloned upstream of the 35S minimal promoter (TATA) and the GUS (uidA) reporter gene in
pBT10GUS-d35SLUC.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
A
B
C
Figure 4. Elicitor-responsive sequences from motif group 27.
A) Quantitative GUS reporter gene assays using pBT10GUS-d35SLUC (NC) and the same
plasmid containing synthetic promoters 4D (PC) or four copies of single sequences 18 through
24 (Table I) driving GUS expression. Plasmids were transformed into parsley protoplasts and
treated without (-) and with (+) Pep25 elicitor. B) Alignment of elicitor-responsive sequences 18
through 24. Underlined are W-box core sequences. A core sequence determined from the
alignment is shaded. C) Family binding profile (FBP) generated by STAMP with all 26 motifs in
motif group 27 (Fig. 2).
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
A
B
C
Figure 5. Elicitor-responsive sequences from motif group 11.
A) Quantitative GUS reporter gene assays using pBT10GUS-d35SLUC (NC) and the same
plasmid containing synthetic promoters 4D (PC) or four copies of single sequences 5 through
8 (Table I) driving GUS expression. Plasmids were transformed into parsley protoplasts and
treated without (-) and with (+) Pep25 elicitor. B) Alignment of elicitor-responsive sequences 5
through 8. Underlined are W-box core sequences. A core sequence determined from the
alignment is shaded. C) Family binding profile (FBP) generated by STAMP with all 10 motifs
in motif group 11 (Fig. 2).
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
A
B
C
Figure 6. Elicitor-responsive sequences from motif group 12.
A) Quantitative GUS reporter gene assays using pBT10GUS-d35SLUC (NC) and the
same plasmid containing synthetic promoters 4D (PC) or four copies of single
sequences 9 through 12 (Table I) driving GUS expression. Plasmids were transformed
into parsley protoplasts and treated without (-) and with (+) Pep25 elicitor. B) Alignment
of elicitor-responsive sequences 9 through 12. Underlined is a W-box core sequence. A
core sequence determined from the alignment is shaded. C) Family binding profile (FBP)
generated by STAMP with all 21 motifs in motif group 12 (Fig. 2).
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
A
B
Figure 7. Elicitor-responsive sequences from seven motif groups.
A) Quantitative GUS reporter gene assays using pBT10GUS-d35SLUC (NC) and the
same plasmid containing synthetic promoters 4D (PC) or four copies of single sequences
1 through 4, 13 through 17, and 25 (Table I) driving GUS expression. Plasmids were
transformed into parsley protoplasts and treated without (-) and with (+) Pep25 elicitor. B)
Single sequences from motif groups 1 (Sequence 1), 5 (2, 3, 4), 18 (13), 19 (14), 21 (15,
16), 24 (17), and 32 (25), respectively (Table I). Elicitor-responsive sequences 2, 3, and 4
from motif group 5 and 15 and 16 from group 21 are aligned. Underlined is a W-box core
sequence. A core sequence determined from the alignment of sequences 2 and 3 is
shaded.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.
PC
NC
6
7
11
12
19
20
1
2
5
8
9
10
15
16
18
22
23
21
25
Figure 8. Transient reporter gene acticivity of elicitor-responsive sequences on TDNA constructs infiltrated with A. tumefaciens in N. benthamiana.
PC and NC are reporter gene constructs with a 35S CaMV and a minimal promoter,
respectively. The numbers correspond to the sequence numbers shown in Table I
and 2.
Downloaded from on June 14, 2017 - Published by www.plantphysiol.org
Copyright © 2012 American Society of Plant Biologists. All rights reserved.