J Vector Borne Dis 54, March 2017, pp. 54–60
Evaluation of SYBR green I based visual loop-mediated isothermal
amplification (LAMP) assay for genus and species-specific diagnosis
of malaria in P. vivax and P. falciparum endemic regions
Ruchi Singh1-2, Dhirendra Pratap Singh1, Deepali Savargaonkar1, Om P. Singh1, Rajendra M.
Bhatt3 & Neena Valecha1
National Institute of Malaria Research (ICMR), Dwarka; 2National Institute of Pathology (ICMR), Safdarjung Hospital Campus,
New Delhi; 3National Institute of Malaria Research, Field Unit, Raipur, Chhattisgarh, India
1
Abstract
Background & objectives: Loop-mediated isothermal amplification (LAMP) is an emerging nucleic acid based diagnostic approach that is easily adaptable to the field settings with limited technical resources. This study was aimed
to evaluate the LAMP assay for the detection and identification of Plasmodium falciparum and P. vivax infection in
malaria suspected cases using genus and species-specific assay.
Methods: The 18S rRNA-based LAMP assay was evaluated for diagnosis of genus Plasmodium, and speciesspecific diagnosis of P. falciparum and P. vivax, infection employing 317 malaria suspected cases, and the results
were compared with those obtained by 18S nested PCR (n-PCR). All the samples were confirmed by microscopy
for the presence of Plasmodium parasite.
Results: The n-PCR was positive in all Plasmodium-infected cases (n=257; P. falciparum=133; P. vivax=124) and
negative in microscopy negative cases (n=58) except for two cases which were positive for P. vivax, giving a sensitivity of 100% (95% CI: 97.04–100%) and a specificity of 100% (95% CI: 88.45–99.5%). Genus-specific LAMP
assay missed 11 (3.2%) microscopy and n-PCR confirmed vivax malaria cases. Considering PCR results as a reference, LAMP was 100% sensitive and specific for P. falciparum, whereas it exhibited 95.16% sensitivity and 96.7%
specificity for P. vivax. The n-PCR assay detected 10 mixed infection cases while species-specific LAMP detected
five mixed infection cases of P. vivax and P. falciparum, which were not detected by microscopy.
Interpretation & conclusion: Genus-specific LAMP assay displayed low sensitivity. Falciparum specific LAMP
assay displayed high sensitivity whereas vivax specific LAMP assay displayed low sensitivity. Failed detection of
vivax cases otherwise confirmed by the n-PCR assay indicates exploitation of new targets and improved detection
methods to attain 100% results for P. vivax detection.
Key words LAMP; malaria; molecular diagnosis; PCR; Plasmodium falciparum; P. vivax
Introduction
Malaria is one of the major public health problems
of the developing countries resulting in considerable
morbidity, mortality and economic loss. World Malaria
Report, 2013 illustrated that 97 out of 104 malaria-endemic countries had ongoing transmission of the malaria parasite in 2013 with an estimated 3.4 billion people at risk, of
which 1.2 billion are at high risk1. India’s National Vector
Borne Disease Control Programme (NVBDCP) has reported about 1.0 million cases each year from 2011–152.
In India, the incidence of malaria has declined over the
years but it still bears the highest malaria burden in Southeast Asia, the second most affected region in the world
after Africa1.
Early and accurate malaria diagnosis is essential for
appropriate treatment of patients. Microscopy is the most
suitable and cost-effective technique for the diagnosis of
malaria in field settings. In ideal conditions, 4–20 parasites/µl can be detected in the Giemsa-stained thick blood
film by a well-trained staff but in the field condition this
threshold decreases to 50–100 parasites/µl. Antigen-capture immunochromatographic technology based malaria
rapid diagnostic tests (RDTs) for detection of the P. falciparum–specific antigen histidine-rich protein 2 (PfHRP2)
or parasite-specific lactate dehydrogenase (pLDH) are
also widely used. RDTs provide the improved speed and
precision for malaria diagnosis in areas where standard
laboratory diagnosis is not available. Low detection limit
of >200 parasites/µl and false positive results due to the
persistence of antigen after parasite clearance are major concerns with RDTs3. Further, recent reports of false
Singh et al: Rapid molecular diagnosis of malaria
negative results by RDTs due to deletion of Pfhrp2 and
Pfhrp3 genes poses problem in the detection of P. falciparum4-5. The low parasitaemia in vivax patients and instability of lactate dehydrogenase at higher temperatures
pose difficulty in RDT based detection of P. vivax.
Several nucleic acid amplification methods like nested PCR (n-PCR) and real-time quantitative PCR have
been developed for the diagnosis of malaria. Compared to
microscopy, these methods have higher sensitivity, with
detection limit of 1–5 parasites/µl of peripheral blood,
and greater specificity for mixed infection6-10. However,
the long turn around time, high cost, and availability only
in well-equipped laboratories render these methods inadequate for routine diagnosis in hospital laboratories and
field clinics in the areas endemic for malaria.
Loop-mediated isothermal amplification (LAMP) is
a nucleic acid amplification method that relies on autocycling strand-displacement DNA synthesis performed
with Bst DNA polymerase. The amplification products are
stem-loop DNA structures with several inverted repeats
of the target and structures with multiple loops11. The
principal merit of this method is that it does not require
denaturation of the DNA template, and all the reactions
can be conducted under isothermal conditions (ranging
from 60 to 65°C). The method produces a large amount of
amplified product, resulting in easier detection simply by
the visual judgment of the turbidity or fluorescence of the
reaction mixture12. Several investigators have reported
and commended the usefulness of LAMP methods for the
rapid identification of Plasmodium, Trypanosoma, Babesia and Leishmania, etc13-16. LAMP has relevant characteristics of a potential point of care test for diagnosis of
malaria as it exhibits high sensitivity with detection limit
of 0.2–5 parasite/µl and the cost of reagent is equivalent
to market cost of RDTs17.
First report on the use of LAMP assay for diagnosis of
malaria in the clinically proven cases dates back in 2006,
wherein Poon et al14 reported the detection of highly conserved 18S ribosomal RNA gene of P. falciparum. The
malaria diagnosis by LAMP does not require expensive
reagents (for DNA extraction), turbidimeter, thermal
cycler, or skilled technicians and can easily be adapted
to the field settings with limited technical resources/support14,18. There are many reports where the LAMP assay
has been used for Plasmodium spp. detection in blood
with high sensitivity and specificity14,19-23. Recently, the
assay has been found to be applicable for noninvasive detection of P. vivax and P. falciparum using saliva and urine
samples24-25. The Pan/Pf LAMP kit has shown promising
results in field-based diagnosis and was found reliable for
the detection of low parasitaemia from filter paper derived
55
samples26-27. LAMP assays based on real-time measurement of DNA amplification have been applied with high
sensitivity and specificity for Plasmodium detection28-29.
Although, P. falciparum causes the most severe form
of the disease, its geographic distribution overlaps with P.
vivax in India and therefore, it requires the LAMP assay
capable for identification of both species, as the mixed infection often remains unrecognized. In the present study,
the applicability of the LAMP assay was evaluated for detection and identification of P. falciparum and P. vivax in
malaria suspected cases and further the results of LAMP
assay were compared with those of conventional microscopy and nested PCR.
MATERIAL & METHODS
Study subjects and sample collection
A total of 317 febrile individuals suspected of having
malaria, attending/referred to the clinic at the National
Institute of Malaria Research (NIMR), New Delhi from
July 2011 to August 2013, and at NIMR Field Unit, Raipur between the months of December 2011 and 2012 were
included in the study. The sample collection and laboratory investigations were performed as outlined in Fig. 1.
Finger-prick blood samples were collected in heparinized
vials or on filter paper as dried blood spot and stored at 4°C
until further use.
Ethics statement
The study was approved by the Institutional Ethics
Committee of NIMR, New Delhi (Approval No.ECR/
NIMR/EC/2011/40). Written informed consent was obtained from each individual or parent/guardian (in cases
of minors) before enrolment in the study.
Fig. 1:Schematic representation of sample collection from suspected malaria patients and various laboratory investigations
performed on samples.
56
J Vector Borne Dis 54, March 2017
Microscopy
Thick blood smears were examined under 1000X
magnification by microscopists with extensive experience in the identification of malaria parasites. The number of parasites per 200 white blood cells (WBCs) were
counted and the parasite density was calculated assuming
a leukocyte count of 8000/ml.
DNA extraction
The DNA was extracted using Qiagen DNA isolation
kit according to manufacturer’s instructions from dried
filter paper spot or 0.1 ml blood .
18 S rRNA n-PCR assay
For n-PCR, the species-specific nucleotide sequences of the 18S rRNA genes of P. falciparum and P. vivax
were amplified as described previously8-9, 30 with slight
modifications. Nest 1 PCR amplification was performed
in a 20 μl reaction mixture containing 10 pmoles of each
primer (rPLU 1 TCAAAGAATAAGCCATGCAAGTGA
and rPLU 2 TAACCCTGTTGTTGCCTTAAACTCC), 4
mM MgCl2, PCR buffer (50 mM, KCl, 10 mMTris-HCl),
200 mM of each deoxynucleoside triphosphate, and 1.25
units of TaqDNA polymerase and 5 μl of sample DNA.
For Nest 2 assay 1 µl of Nest 1 PCR product was used with
10 pmoles of respective species-specific primers: P. vivax
VIV F 5′-CGCTTCTAGCTTAAT CCACATAACTGATAC-3′; VIV R 5′-ACTTCCAAGCCGAAGCAAAG
AAAGTCCTTA-3′ and P. falciparum FAL F 5′-TTA-
AACTGGTTTGGGAAAACCAAATATATT-3′; FALR
ACACAATGAACTCAATCATGACTACCCG TC. The
amplified products were visualized in 2% agarose gels
stained with ethidium bromide.
LAMP assay and analysis of LAMP products
The genus and species-specific LAMP primer sets
designed on the basis of the genus and the nucleotide
sequences of the 18S rRNA genes of P. falciparum and
P. vivax as described previously were used in the study21
(Table 1). The reaction mixture (25 µl), containing 1.6
to 2.4 mM of each primers FIP and BIP, 0.2 mM of each
primers F3 and B3c, 0.8 mM of each primers LPF and
LPB, 2 X reaction buffer (12.5 µl), Bst DNA polymerase
(1 µl), and 5 µl of DNA sample, was incubated at 60°C
for 100 min and then the enzyme was inactivated at 80°C
for 2 min.
To visualize and confirm the results fluorescent dye
SYBR Green I was added to the completed reaction that
gives fluorescent green colour in the positive reaction as
it gets intercalated in the nucleic acid while the negative
reaction remained orange indicating no amplification.
The two individuals scored the LAMP results and the consensus of the results was considered for further analysis.
Diagnostic accuracy analysis
Specificity, sensitivity, positive and negative predictive values and diagnostic accuracy of various tests were
calculated using free online diagnostic accuracy calcu-
Table 1. Primer sequences used for genus and species-specific amplification of Plasmodium parasite
Genus/species
Primer
Sequences (5′-3′)
Plasmodium genus
PLU F3
GTATCAATCGAGTTTCTGACC
PLU B3
CTTGTCACTACCTCTCTTCT
PLU FIP
TCGAACTCTAATTCCCCGTTACCTATCAGCTTTTGATGTTAGGGT
PLU BIP
CGGAGAGGGAGCCTGAGAAATAGAATTGGGTAATTTACGCG
PLU LPF
CGTCATAGCCATGTTAGGCC
P. falciparum
P. vivax
PLU LPB
AGCTACCACATCTAAGGAAGGCAG
PfF3
TGTAATTGGAATGATAGGAATTTA
PfB3c
GAAAACCTTATTTTGAACAAAGC
PfFIP
AGCTGGAATTACCGCGGCTGGGTTCCTAGAGAAACAATTGG
PfBIP
TGTTGCAGTTAAAACGTTCGTAGCCCAAACCAGTTTAAATGAAAC
PfLPF
GCACCAGACTTGCCCT
PfLPB
TTGAATATTAAAGAA
PvF3
GGAATGATGGGAATTTAAAACCT
PvB3c
ACGAAGTATCAGTTATGTGGAT
PvFIP
CTATTGGAGCTGGAATTACCGCTCCCAAAACTCAATTGGAGG
PvBIP
AATTGTTGCAGTTAAAACGCTCGTAAGCTAGAAGCGTTGCT
PvLPF
GCTGCTGGCACCAGACTT
PvLPB
AGTTGAATTTCAAAGAATCG
57
Singh et al: Rapid molecular diagnosis of malaria
lator (http://www.hutchon.net/Diagnostic-test.htm). The
kappa (k) statistics was applied to calculate the agreement
between the results observed by LAMP and microscopy
vs n-PCR assay.
RESULTS
Patient profile and microscopy results
In total, 317 blood samples from febrile individuals;
220 (69.5%) males and 97 (29.5%) females were screened
for Plasmodium infection by microscopy, 18S-PCR and
LAMP (genus and species-specific) assays. The age range
was 1 to 80 yr. The microscopic examination revealed
malaria parasites in the blood smears of 257 (81%) patients. Of these, 124 (39.1%) were found positive for P.
vivax (320–61,600 parasites/µl) and 133 (41.9%) were
positive for P. falciparum (200–4,96,000 parasites/µl) infection, while 60 patients were microscopically negative
for the parasite.
Diagnostic performance of molecular assays (18S nPCR and LAMP assay for species-specific diagnosis) vs
microscopy
The results of microscopy, n-PCR and genus and species-specific LAMP assay for 317 investigated patients
are detailed in Tables 2 and 3. The microscopic examination detected 257 patients with Plasmodium infection; of
these 124 were diagnosed with P. vivax and 133 were P.
falciparum cases. In aggregate, 113 samples were positive for P. vivax and 127 for P. falciparum and 58 cases
were negative for Plasmodium infection by all the three
molecular assays (Table 2); rest of the samples exhibited
discordant results. The discordant results (5.6%) were
mainly P. vivax cases and mixed infections. The microscopic slides of samples exhibiting discordant results and
an equal number of randomly selected slides from samples with concordant results were re-examined blindly by
two independent microscopists.
The 18S n-PCR assay detected Plasmodium in all 257
(100%) microscopically positive samples. Of these, 120
were P. vivax infection and 127 were P. falciparum infection, while 10 patients were found positive for both P.
vivax and P. falciparum indicating mixed infection. Genus-specific LAMP assay detected 246/257 microscopically positive samples. The test was found 96.8% sensitive
and 96.67% specific for detection of Plasmodium spp. in
blood samples. It failed to detect the 11/124 microscopically confirmed P. vivax infections including two cases of
mixed infection detected by n-PCR. PvLAMP detected
118 samples to be infected with P. vivax while 133 samples were found positive for P. falciparum by PfLAMP assay and five samples were mixed infections. All the three
molecular assays detected two cases of P. vivax from 60
microscopically negative patient samples.
Sensitivity and specificity of molecular assays (LAMP
and n-PCR) for identifying mixed infection of Plasmodium spp.
Microscopic examination of slides did not identify
any mixed infections. The n-PCR assay identified 10 cases of mixed infection of P. falciparum and P. vivax among
317 blood samples tested. Out of these 10, six cases were
microscopically diagnosed as P. falciparum and remaining four as P. vivax. On the other hand, LAMP assay identified five cases of mixed infection.
Considering n-PCR as reference, the sensitivity and
specificity of microscopy in identifying P. falciparum infections were 100% (k=0.974); for P. vivax infections it
was 98.4 and 100%, respectively (k=0.948) and nil for
mixed infection (k=0) (Table 3). The sensitivity and
specificity of LAMP assay for P. falciparum identification
were 100% (k=0.961), whereas for P. vivax identification
it was 95.25 and 100%, respectively (k=1). The n-PCR
assay based parasite detection revealed higher number
of mixed infections identification compared to LAMP
assay (3 vs 1.5%; k=0.658) (Table 3). The data indicates
Table 2. Detailed comparison of microscopy, n-PCR, species-specific and genus specific LAMP for malaria parasite detection methods
Microscopy
Nested PCR
Species-specific LAMP
(Pf/PvLAMP)
Genus-specific LAMP (Pan LAMP)
P. falciparum (133)
P. falciparum (133)
P. vivax (6)
P. falciparum (133)
P. vivax (4)
Plasmodium spp. (133)
Negative (0)
P. vivax (124)
P. vivax (124)
P. falciparum (4)
P. vivax (118)
P. falciparum (1)
Plasmodium spp. (113)
Negative (11)
Negative (60)
Negative (58)
P. vivax (2)
Negative (58)
P. vivax (2)
Negative (58)
Plasmodium spp. (2)
Figures in parentheses indicate number of samples.
58
J Vector Borne Dis 54, March 2017
Table 3. Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and agreement
(Kappa statistics) of microscopy and LAMP assay vs nested PCR assay (18S n-PCR)
as the reference standard for diagnosis of malaria in blood samples (n=317)
Species
Sensitivity
(95% CI)
Specificity
(95% CI)
P. vivax
P. falciparum
Pv+Pf
98.41(94.37– 99.76)
100 (97.24– 100)
0
100 (93.78– 100)
100 (93.78– 100)
0
P. vivax
P. falciparum
Pv+Pf
95.24 (89.92– 98.22) 100 (93.78–100)
100 ( 97.24– 100)
100 (93.98– 100)
50
98.4
PPV
(95% CI)
Microscopy
100 (97.04–100)
100 (97.24– 100)
0
LAMP assay
100 (96.94– 100)
100 (97.24– 100)
NPV
(95% CI)
Agreement with n–PCR
Cohen’s Kappa
coefficient (k)
96.67 (88.45– 99.50)
100 (93.98 –100)
0
0.948
0.974
0
90.62 (80.69– 96.46)
100 (93.98 –100)
0.961
1
0.658
Pv+Pf—Mixed infection.
that molecular tests have better sensitivity to detect lowdensity parasitaemia of the Plasmodium species that often
remains masked by the high density parasitaemia of another Plasmodium species in mixed infection.
DISCUSSION
Rapid, reliable and species-specific diagnostic tools
are indispensable for effective control of malaria. Light
microscopy-based diagnosis to date is the most effective
method; however, it demands technical expertise and suffers low detection limits in field conditions. This study
was performed to compare the diagnostic performance of
Plasmodium genus-specific, P. falciparum and P. vivax
specific LAMP assays in a visual format and standard
species-specific n-PCR assay with the microscopic examination for P. falciparum and P. vivax specific diagnosis
of malaria infection.
Genus-specific LAMP assay accurately identified P.
falciparum cases, however, it failed to diagnose 11 confirmed cases of P. vivax (<5000 parasites/µl) infection.
The species-specific PfLAMP assay evaluated in this
study displayed high sensitivity and specificity of 100%
same as in n-PCR assay using blood samples, however,
low detection rate was observed for P. vivax infection
by PvLAMP assay compared to that with n-PCR. The nPCR assay is a two-step assay and displays detection limit
of 1 parasite/µl compared to LAMP assay with a detection limit of 40 parasite/µl for P. vivax. High sensitivity
(100%) of LAMP for P. falciparum was observed in this
study as well as in others14, 21, whereas for P. vivax detection variable sensitivity of LAMP assay ranging from 36 to
100% have been reported by researchers21, 29. Researchers
have suggested the use of other targets like mitochondrial
genes and consensus sequence repeats to achieve high
sensitivity and specificity for Plasmodium detection. This
study adopted the visual detection method that does not
have a defined cut-off limit and therefore, it is likely that
six P. vivax cases with low parasitaemia though positive
(< 1000 parasites/µl, n=3; <3000 parasites/µl, n=3) have
been read as false negative compared to n-PCR assay.
Using microscopy as the reference assay, standard
18S n-PCR assay detected Plasmodium in all 257 (100%)
microscopically positive samples. Of these 120 were P.
vivax infection and 127 were P. falciparum infection,
while 10 patients were found positive for both P. vivax
and P. falciparum (mixed infection). Similarly, PvLAMP
detected 117 samples to be infected with P. vivax while
PfLAMP detected 129 samples as P. falciparum and remaining five samples were mixed infections. Giemsa microscopy remains the gold standard for malaria diagnosis
in resource-limited environments; however, its sensitivity
and specificity compared to molecular assays is limited
in identifying mixed infection. Hence, novel, rapid and
simplified molecular techniques like LAMP assay should
be widely used for species-specific diagnosis of malaria
in endemic areas.
CONCLUSION
The LAMP assay could be made applicable to a resource-limited setting as a point of care diagnostic test.
However, to develop it as a point of care test it needs to be
simplified further by eliminating the DNA isolation step.
In this study, it was observed that Plasmodium genusspecific LAMP assay failed to diagnose 11(3.2%) cases
of vivax malaria confirmed by n-PCR. Screening of clinical samples first by Plasmodium genus-specific LAMP
assay and further confirmation by a species-specific assay
based on endemicity of species in the area is proposed for
epidemiological surveillance. However, in areas where
two or more species are co-existing, screening for clini-
Singh et al: Rapid molecular diagnosis of malaria
cal diagnosis is debatable and such situations demand a
simplified assay capable of simultaneously detecting two
or more Plasmodium spp.
Conflict of interest: None to declare.
ACKNOWLEDGEMENTS
The study was supported by a grant under Vector
Borne Diseases Science Forum (5/8-7(231)2011-ECDII) from the Indian Council of Medical Research,
New Delhi, India. The technical support of Mrs. Alka
Kapoor is gratefully acknowledged. The authors are
grateful to Prof. A.P. Dash and Dr S.K. Subbarao for constant encouragement and critical suggestions during the
study.
REFERENCES
1.Malaria. World Malaria Report 2013. Geneva: World Health
Organization 2013; p. 1–286.
2. Malaria. National Vector Borne Disease Control Programme
2016. Available from: www.nvbdcpgov.in (Accessed on May 3,
2016).
3. McMorrow ML, Aidoo M, Kachur SP. Malaria rapid diagnostic
tests in elimination settings—Can they find the last parasite?
Clin Microbiol Infect 2011; 17(11): 1624–31.
4. Kumar N, Pande V, Bhatt RM, Shah NK, Mishra N, Srivastava
B, et al. Genetic deletion of HRP2 and HRP3 in Indian Plasmodium falciparum population and false negative malaria rapid
diagnostic test. Acta Trop 2013; 125(1): 119–21.
5. Koita OA, Doumbo OK, Ouattara A, Tall LK, Konaré A, Diakité M, et al. False-negative rapid diagnostic tests for malaria and
deletion of the histidine-rich repeat region of the hrp2 gene.
Am J Trop Med Hyg 2012; 86(2): 194–8.
6. Perandin F, Manca N, Calderaro A, Piccolo G, Galati L, Ricci
L, et al. Development of a real-time PCR assay for detection
of Plasmodium falciparum, Plasmodium vivax and Plasmodium ovale for routine clinical diagnosis. J Clin Microbiol 2004;
42(3): 1214–9.
7. Hanscheid T, Grobusch MP. How useful is PCR in the diagnosis
of malaria? Trends Parasitol 2002; 18(9): 395–8.
8. Snounou G, Viriyakosol S, Jarra W, Thaithong S, Brown KN.
Identification of the four human malaria parasite species in field
samples by the polymerase chain reaction and detection of a
high prevalence of mixed infections. Mol Biochem Parasitol
1993; 58(2): 283–92.
9. Singh B, Bobogare A, Cox-Singh J, Snounou G, Abdullah MS,
Rahman HA. A genus- and species-specific nested polymerase
chain reaction malaria detection assay for epidemiologic studies. Am J Trop Med Hyg 1999; 60(4): 687–92.
10. Singh B, Kim Sung L, Matusop A, Radhakrishnan A, Shamsul SS, Cox-Singh J, et al. A large focus of naturally acquired
Plasmodium knowlesi infections in human beings. Lancet 2004;
363(9414): 1017–24.
11. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe
K, Amino N, et al. Loop-mediated isothermal amplification of
DNA. Nucleic Acids Res 2000; 28(12): E63.
59
12. Mori Y, Nagamine K, Tomita N, Notomi T. Detection of loopmediated isothermal amplification reaction by turbidity derived
from magnesium pyrophosphate formation. Biochem Biophys
Res Commun 2001; 289(1): 150–4.
13. Ikadai H, Tanaka H, Shibahara N, Matsuu A, Uechi M, Itoh
N, et al. Molecular evidence of infections with Babesia gibsoni
parasites in Japan and evaluation of the diagnostic potential of a
loop-mediated isothermal amplification method. J Clin Microbiol 2004; 42(6): 2465–9.
14. Poon LL, Wong BW, Ma EH, Chan KH, Chow LM, Abeyewickreme W, et al. Sensitive and inexpensive molecular test for
falciparum malaria: Detecting Plasmodium falciparum DNA
directly from heat-treated blood by loop-mediated isothermal
amplification. Clin Chem 2006; 52(2): 303–6.
15. Takagi H, Itoh M, Islam MZ, Razzaque A, Ekram AR, Hashighuchi Y, et al. Sensitive, specific, and rapid detection of Leishmania donovani DNA by loop-mediated isothermal amplification. Am J Trop Med Hyg 2009; 81(4): 578–82.
16. Thekisoe OM, Inoue N, Kuboki N, Tuntasuvan D, Bunnoy W,
Borisutsuwan S, et al. Evaluation of loop-mediated isothermal
amplification (LAMP), PCR and parasitological tests for detection of Trypanosoma evansi in experimentally infected pigs. Vet
Parasitol 2005; 130 (3–4): 327–30.
17. Cordray MS, Richards-Kortum RR. Emerging nucleic acidbased tests for point-of-care detection of malaria. Am J Trop
Med Hyg 2012; 87(2): 223–30.
18. Abdul-Ghani R, Al-Mekhlafi AM, Karanis P. Loop-mediated
isothermal amplification (LAMP) for malarial parasites of humans: Would it come to clinical reality as a point-of-care test?
Acta Trop 2012; 122(3): 233–40.
19. Chen JH, Lu F, Lim CS, Kim JY, Ahn HJ, Suh IB, et al. Detection of Plasmodium vivax infection in the Republic of Korea
by loop-mediated isothermal amplification (LAMP). Acta Trop
2009; 113 (1): 61–5.
20. Polley SD, Mori Y, Watson J, Perkins MD, González IJ, Notomi
T, et al. Mitochondrial DNA targets increase sensitivity of malaria detection using loop-mediated isothermal amplification. J
Clin Microbiol 2010; 48(8): 2866–71.
21. Han ET, Watanabe R, Sattabongkot J, Khuntirat B, Sirichaisinthop J, Iriko H, et al. Detection of four Plasmodium species by
genus- and species-specific loop-mediated isothermal amplification for clinical diagnosis. J Clin Microbiol 2007; 45(8):
2521–8.
22. Paris DH, Imwong M, Faiz AM, Hasan M, Yunus EB, Silamut
K, et al. Loop-mediated isothermal PCR (LAMP) for the diagnosis of falciparum malaria. Am J Trop Med Hyg 2007; 77(5):
972–6.
23. Poschl B, Waneesorn J, Thekisoe O, Chutipongvivate S, Karanis P. Comparative diagnosis of malaria infections by microscopy, nested PCR, and LAMP in northern Thailand. Am J Trop
Med Hyg 2010; 83(1): 56–60.
24. Singh R, Savargaonkar D, Bhatt R, Valecha N. Rapid detection
of Plasmodium vivax in saliva and blood using loop mediated
isothermal amplification (LAMP) assay. J Infect 2013; 67(3):
245–7.
25. Ghayour Najafabadi Z, Oormazdi H, Akhlaghi L, Meamar AR,
Nateghpour M, Farivar L, et al. Detection of Plasmodium vivax
and Plasmodium falciparum DNA in human saliva and urine:
Loop-mediated isothermal amplification for malaria diagnosis.
Acta Trop 2014; 136: 44–9.
26. Hopkins H, Gonzalez IJ, Polley SD, Angutoko P, Ategeka J,
Asiimwe C, et al. Highly sensitive detection of malaria para-
60
J Vector Borne Dis 54, March 2017
sitemia in a malaria-endemic setting: Performance of a new
loop-mediated isothermal amplification kit in a remote clinic in
Uganda. J Infect Dis 2013; 208(4): 645–52.
27. Aydin-Schmidt B, Xu W, Gonzalez IJ, Polley SD, Bell D, Shakely D, et al. Loop mediated isothermal amplification (LAMP) accurately detects malaria DNA from filter paper blood samples of
low density parasitaemias. PLoS One 2014; 9(8): e103905.
28. Surabattula R, Vejandla MP, Mallepaddi PC, Faulstich K, Polavarapu R. Simple, rapid, inexpensive platform for the diagnosis
of malaria by loop mediated isothermal amplification (LAMP).
Exp Parasitol 2013; 134(3): 333–40.
29. Patel JC, Oberstaller J, Xayavong M, Narayanan J, DeBarry JD,
Srinivasamoorthy G, et al. Real-time loop-mediated isothermal
amplification (Real Amp) for the species-specific identification
of Plasmodium vivax. PLoS One 2013; 8(1): e54986.
30. Valecha N, Pinto RG, Turner GD, Kumar A, Rodrigues S, Dubhashi NG, et al. Histopathology of fatal respiratory distress
caused by Plasmodium vivax malaria. Am J Trop Med Hyg
2009; 81(5): 758–62.
31. Drain PK, Hyle EP, Noubary F, Freedberg KA, Wilson D, Bishai
WR, et al. Diagnostic point-of-care tests in resource-limited settings. Lancet Infect Dis 2014; 14(3): 239–49.
Correspondence to: Dr Ruchi Singh, Scientist 'E', National Institute of Pathology (ICMR), Safdarjung Hospital Campus, New Delhi–110 029,
India.
E-mail: [email protected]; [email protected]
Received: 19 May 2016
Accepted in revised form: 19 December 2016