From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
IMMUNOBIOLOGY
Transforming growth factor-␤2 is involved in quantitative genetic variation
in thymic involution
Ritu Kumar, Jessica C. Langer, and Hans-Willem Snoeck
The mechanisms regulating thymic involution are unclear. In inbred mouse strains
the rate of thymic involution and the
function of the hematopoietic stem cell
(HSC) compartment are subject to quantitative genetic variation. We have shown
previously that transforming growth factor-␤2 (TGF-␤2) is a genetically determined positive regulator of HSCs. Here,
we demonstrate that genetic variation in
the rate of thymic involution correlates
with genetic variation in the responsive-
ness of hematopoietic stem and progenitor cells to TGF-␤2. Corroborating these
correlations, thymic cellularity and peripheral naive T-cell frequency were higher in
old Tgfb2 ⴙ/ⴚ mice than in wild-type littermates. The frequency of early T-cell precursors was increased in Tgfb2 ⴙ/ⴚ mice,
suggesting that TGF-␤2 affects the earliest stages of T-cell development in old
mice. Reciprocal transplantation experiments indicated that TGF-␤2 expressed
both in the (micro)environment and in the
hematopoietic system can accelerate thymic involution; however, the age of the
stem cells appeared irrelevant. Thus, although thymic involution is largely determined by the aged environment, TGF-␤2
plays a major modulatory role that is
subject to genetic variation and is possibly mediated through its regulatory effects on early hematopoiesis. (Blood.
2006;107:1974-1979)
© 2006 by The American Society of Hematology
Introduction
The development of T cells occurs in the thymus from hematopoietic
cells that seed this organ from the liver during fetal life and from the
bone marrow after birth.1 With age, the thymus involutes, leading to a
progressive decline in the production of naive T cells.2-4 The mechanism
and purpose of thymic involution remain a mystery. The timing of the
onset of this process, just before and during adolescence, as well as some
experimental evidence suggest that endocrine hormones may be involved.4-6 Age-related changes in the thymic microenvironment, especially a decreased production of interleukin 7 (IL-7) have also been
proposed to play a role,7,8 although overexpression of IL-7 within the
thymus did not restore thymic function in aged mice.9 IL-12 is involved
in partially maintaining thymic function in aged animals by enhancing
the response of thymocytes to IL-2 and IL-7.10 A differentiation block
between the CD4⫺CD8⫺CD44⫹CD25⫺ (double-negative 1, DN1) and
CD4⫺CD8⫺CD44⫹CD25⫹ (double-negative 2, DN2) stages of the
early intrathymic T-cell development has been observed and was
believed to be critical for the decline in T-cell production in the
involuting thymus.11 However, early T-cell precursors (ETPs), a lineage
negative (lin⫺) CD25⫺c-kit⫹IL7R␣⫺/lo population that has recently
been shown to contain the earliest intrathymic T-cell precursors,12 do not
accumulate with age.13 Because ETPs make up only a small fraction of
the heterogeneous DN1 population,14 the nature of the accumulating
DN1 cells in the involuting thymus is unclear. A role for hematopoietic
stem cells (HSCs) and age-related changes in the function of these cells,
particularly in their capacity to differentiate into the lymphoid lineage,15-18 is controversial,2-4 because transplantation with HSCs from
young mice does not rejuvenate the thymus.19
Extensive mouse strain-dependent variation has been demonstrated in the rate of thymic involution, and suggestive quantitative
trait loci (QTLs) for this multigenic trait have been mapped to
regions on chromosomes 9 and 10.20 Quantitative genetic variation
also exists in the hematopoietic stem and progenitor cell compartment.21 The frequency of hematopoietic stem and progenitor cells,
as determined by the lin⫺Sca1⫹⫹c-kit⫹ (LSK) phenotype,22 shows
wide mouse strain-dependent variation and is regulated in part by
genetic variation in the signaling of one particular transforming
growth factor-␤ (TGF-␤) isoform, TGF-␤2.23-25 In contrast to the
presumed inhibitory role of other TGF-␤ isoforms, TGF-␤2 is a
positive regulator of HSC number and function in vivo.25
Here, we demonstrate that genetic variation in the rate of thymic
involution, as determined by Hsu et al,20 correlates with genetic
variation in the responsiveness of hematopoietic stem and progenitor
cells to TGF-␤2, as previously reported by us.25 Further studies revealed
that, although thymic involution is to a large extent determined by the
aging environment, TGF-␤2 accelerates thymic involution in a genetically determined fashion, an effect that is potentially mediated through
its regulatory role on early hematopoiesis.
From the Department of Cell and Gene Medicine, Mount Sinai School of
Medicine, New York, NY.
involution studies in aged mice; and H.-W.S. designed the experiments and
wrote the manuscript.
Submitted April 12, 2005; accepted October 12, 2005. Prepublished online as Blood
First Edition Paper, November 10, 2005; DOI 10.1182/blood-2005-04-1495.
Reprints: Hans-Willem Snoeck, Department of Cell and Gene Medicine,
Mount Sinai School of Medicine, Box 1496, Gustave L. Levy Pl, New York, NY
10029; e-mail: [email protected].
Supported by National Institutes of Health grants RO1 AG16327 and R01
HL073760 (H.-W.S.).
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
R.K. performed studies on naive T cells, histology, flow cytometry and analyzed
transplantations; J.C.L. set up transplantations and performed initial thymic
1974
Materials and methods
Mice
Eight-week-old C57BL/6J, DBA/2J, BXD recombinant inbred (RI) and
heterozygous tgfb2tm1doe mice (Tgfb2⫺/⫺ mice die at birth26) were purchased
© 2006 by The American Society of Hematology
BLOOD, 1 MARCH 2006 䡠 VOLUME 107, NUMBER 5
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 MARCH 2006 䡠 VOLUME 107, NUMBER 5
TGF-␤2 AND THYMIC INVOLUTION
1975
from Jackson Laboratories (Bar Harbor, ME). C57BL/6.SJL-PtprcaPep3b/BoyJ
mice were purchased from the National Cancer Institute (Bethesda, MD).
Animals were kept in a specific pathogen-free facility. Experiments and animal
care were performed in accordance with the Mount Sinai Institutional Animal
Care and Use Committee (IACUC).
samples was used in the transplantation experiments. All results are
expressed as mean plus or minus standard error of the mean (SEM). P value
below .05 was considered indicative of a statistically significant difference.
Antibodies and flow cytometry
Results
Unlabeled CD2, CD3, CD8␣, CD4, B220, Ly6G/Gr1, Mac1, FITCconjugated CD45.1, CD8␣, CD4, B220, Gr1, Mac1, CD45.2, and goat
anti–rat immunoglobulin, and PE-conjugated CD45RB were purchased
from Southern Biotechnologies (Birmingham, AL). Unconjugated Ter119,
FITC-conjugated CD8␤, anti–T-cell receptor ␥␦ (anti-TCR␥␦, and CD25,
PE-conjugated anti-ILR␣, CD25 and Sca1, APC-conjugated CD44 and
anti–c-kit, biotinylated anti–c-kit, and APC-Cy7–conjugated CD8, CD19,
and streptavidin were purchased from Pharmingen (San Diego, CA).
FITC-conjugated anti-TCR␤, CD3⑀, Ter119, and NK1.1 were obtained
from eBiosciences (San Diego, CA).
Thymus
Thymi were dissected from humanely killed mice, weighed, and minced
through a nylon mesh. Mononuclear cells were counted using a
hemocytometer after gradient centrifugation using lymphocyte separation medium. More than 98% of the cells were Thy1⫹. Thymocytes were
labeled with various combinations of antibodies and analyzed on an
LSR II multilaser flow cytometer with Diva software (Becton Dickinson, Mountain View, CA).
Bone marrow transplantation
In reciprocal transplantation experiments 2 ⫻ 106 bone marrow cells from
CD45.2⫹CD45.1⫹ heterozygous C57BL/6.SJL-PtprcaPep3b/BoyJTgfb2⫹/⫺ or
C57BL/6.SJL-PtprcaPep3b/BoyJ wild-type (wt) F1 mice were injected into
lethally (950 cG) irradiated C57BL/6 mice (CD45.2⫹) or vice versa.
Peripheral blood, bone marrow, spleen, and thymus were harvested after 12
months and analyzed for the expression of CD45.1 and CD45.2 to evaluate
the level of donor-derived reconstitution. Reconstitution was more than
90% in myeloid, B, and T lineages in all mice (not shown). The thymi were
processed as described (see “Thymus”).
Real-time PCR
Total RNA was isolated from thymi using TRIzol reagent (Gibco, Grand
Island, NY) according to the manufacturer’s instructions and treated with
DNaseI. RNA was reverse transcribed using Superscript III (Gibco), for
1 hour at 42°C using oligo(dT) primers. Primers for IL-7 were TGCTTTTTCCAGCCACGTGA (sense) and CAAGAAGGCATGGCTACCAC (antisense). Real-time polymerase chain reaction (PCR) was performed by the
Mount Sinai Real-Time PCR Shared Resource on a TaqMan with detection
using SYBR Green. Standards were ␤-actin, rps11, and ␣-tubulin. Each
sample was run in triplicate. Relative amounts of mRNA were assessed by
comparing the crossing threshold for IL-7 with the corrected median value
of the 3 housekeeping genes.
Histology
Fixed (phosphate-buffered formalin, pH 7.0) thymi were embedded in
paraffin, and 4-␮m sections were stained with hematoxylin and eosin.
Surface areas of cortex and medulla were calculated using ImageJ
(available at http://rsb.info.nih.gov/ij/download.html) after manual demarcation on TIF files generated using a Leica MZFL 3 stereo dissecting
microscope equipped with a Plan Apo objective lens and a 12.5:1 zoom
magnification changer, which was used at an approximate magnification
of 1 to 1.5 (Leica, Wetzlar, Germany). Images were acquired using an
Optronics Magnafire camera and Magnafire software version 2.0
(Optronics, Goleta, CA).
Statistics
The 2-tailed Student t test for paired samples was used in all comparisons of
Tgfb2⫹/⫺ mice and wt littermates. The 2-tailed Student t test for unpaired
Recombinant inbred (RI) mouse strains are a powerful tool to
investigate quantitative genetic variation in the mouse and to map
QTLs. BXD RI strains are commercially available and were
generated by repeated inbreeding of F2 mice derived from the
inbred progenitor strains, C57BL/6 and DBA/2. The genome of RI
strains is composed of a patchwork of homozygous chromosome
segments derived from either progenitor strain, with each of the RI
lines having a unique combination of “patches” from the progenitors. As a consequence of the homozygous “reshuffling” of
C57BL/6 and DBA/2 alleles, RI strains will show a continuous
range of values for complex or multigenic traits, with some BXD
RI mice having more extreme phenotypes than the 2 progenitor
strains, a phenomenon called transgression.27
Among BXD RI strains, the rate of thymic involution shows
wide variation, although it is similar in the progenitors, C57BL/6
and DBA/2.20 Several traits related to the hematopoietic stem and
progenitor cell compartment are also subject to mouse strain–
dependent genetic variation.21,23-25 We have previously shown that
one mechanism underlying this genetic variation is TGF-␤2
signaling.25 In vitro, the TGF-␤2 dose response on the proliferation
of LSK cells is biphasic. It is composed of a serum-dependent
stimulatory component at low concentrations that is subject to
genetic variation and a serum-independent inhibitory component at
higher concentrations that is not subject to genetic variation.25,28
This biphasic dose response is specific for LSK cells and for
TGF-␤2, as other TGF-␤ isoforms are only inhibitors of LSK cell
proliferation.25 Mouse strain-dependent variation in the TGF-␤2
dose response maps to a QTL on chromosome 4, overlapping with
a QTL contributing to LSK cell frequency. Adult heterozygous
⫹/⫺
Tgfb2 mice have an HSC defect compared with wt littermates.
These findings demonstrate that TGF-␤2 is a genetically determined positive regulator of HSCs and suggest that the stimulatory
effect on LSK cell proliferation at low concentrations of this factor
is relevant in vivo.25 We found that among the 16 BXD RI strains
for which all data were available, the effect of TGF-␤2 at
0.1 ng/mL on the proliferation of LSK cells from 8-week-old
mice supported by early-acting cytokines25 correlated significantly
with the rate of thymic involution (Hsu et al20 and http://www.
webQTL.org; Figure 1A). The rationale for using TGF-␤2 at 0.1
ng/mL was that at this concentration, where the net effect on LSK
proliferation is, in fact, inhibitory, the mouse strain–dependent
variation in the TGF-␤2 dose response was the most pronounced.25
These data suggest a role for TGF-␤2 in the regulation of thymic
involution and indicate that approximately 25% of the genetically
determined variation in the rate of thymic involution may be
explained by quantitative variation in the TGF-␤2 responsiveness
of LSK cells. That no overlapping QTLs were identified for these 2
traits may be explained by the fact that all QTLs were suggestive
and by the relatively small number (18) of BXD RI strains included
in the analysis of Hsu et al,20 increasing the probability of false map
locations.27 LSK cell frequency in BXD RI mice also correlated
with thymic involution (Figure 1B,C). This is not unexpected
because TGF-␤2 regulates the frequency of LSK cells in vivo.25
The correlation between the rate of thymic involution and the
frequency of LSK cells may also suggest that thymic involution
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
1976
KUMAR et al
Figure 1. Correlations between hematopoietic traits and thymic involution. (A)
Correlation between the rate of thymic involution (from Hsu et al20 and available on
http://www.webQTL.org) and the proliferative response of LSK cells to TGF-␤2
(0.1 ng/mL) in liquid cultures supported by kit ligand, flt3 ligand, and thrombopoietin,
expressed as a percent of control cultures without TGF-␤2 (from Langer et al25). Note
that at this concentration in the biphasic TGF-␤2 dose response, the net effect is in
fact inhibitory (Langer et al25). The difference in the effect of TGF-␤2 among BXD
mice was largest at that concentration, however. (B) Correlation between the rate of
thymic involution and the frequency of LSK cells in the bone marrow (from
Henckaerts et al24). (C) Sort windows used for the analysis of the frequency of LSK
cells in the bone marrow of BXD RI mouse strains. (D) Frequency of LSK cells in bone
marrow 5 months after neonatal (day 7) thymectomy in C57BL/6 mice (n ⫽ 5).
per se increases the frequency of LSK cells, however. To investigate this possibility, LSK cell frequency was measured 5 months
after neonatal thymectomy. Neonatal thymectomy did not affect the
frequency of LSK cells (Figure 1D). Although the consequences of
neonatal thymectomy are not necessarily the same as those of
thymic involution, it is unlikely that loss of functional thymic tissue
regulates LSK cell frequency.
Because the correlation data in BXD RI strains suggested a role
for TGF-␤2 in thymic involution, we analyzed thymic involution in
Tgfb2⫹/⫺ mice (Tgfb2⫺/⫺ mice die perinatally26). Tgfb2⫹/⫺ mice
were backcrossed onto the C57BL/6 background for 11 generations. No difference was observed between young (⬍ 12 months)
⫹/⫺
Tgfb2 and wt mice. However, in older mice the involution curves
began to diverge, and older than age 12 months, thymus weight was
significantly higher in Tgfb2⫹/⫺ mice than in wt mice (Figure 2).
Similar data were obtained when the ratio of thymus weight to
body weight was calculated (not shown). Thymus cellularity
paralleled thymus weight, and was 29% ⫾ 11% higher in aged
⫹/⫺
Tgfb2
mice than in wt mice, although variability was larger
(P ⫽ .05, not shown). More than 98% of the low-density cells were
Thy1⫹. Taking into account that Thy1 is not expressed in the
earliest phases of T-cell development, virtually all low density cells
used in the cell counts were thymocytes. The larger size and
cellularity of the thymus in aged Tgfb2⫹/⫺ mice were therefore
mainly due to increased numbers of thymocytes. No difference was
observed in the body weight of Tgfb2⫹/⫺ and wt mice at any age
BLOOD, 1 MARCH 2006 䡠 VOLUME 107, NUMBER 5
(not shown, n ⫽ 44 for Tgfb2⫹/⫺ mice and n ⫽ 63 for wt littermates); hence, differences in body weight cannot explain the
observed difference in size and cellularity of the thymus. Thus, the
lower rate of thymic involution in Tgfb2⫹/⫺ mice demonstrates that
TGF-␤2 contributes to thymic involution, corroborating the correlation data shown in Figure 1.
Thymic involution is accompanied by a decrease in the ratio of
cortical to medullary surface area or thickness.2-4,20 Histologic
analysis revealed that the age-related decrease in the ratio of
cortical to medullary surface area was similar in wt and Tgfb2⫹/⫺
thymi (Figure 3A). Somewhat surprisingly, the corticomedullary
ratio appeared lower at any age in Tgfb2⫹/⫺ than in wt mice,
although the difference just failed to reach statistical significance
(Figure 3A,B). However, when data for old and young mice were
pooled, the difference was statistically significant (P ⫽ .04). Thus,
TGF-␤2 deficiency slightly decreased the ratio of cortical to
medullary surface area, but did not affect the age-related changes in
this parameter.
Because thymic involution has been attributed to an age-related
decrease in the production of IL-7,7 we measured IL-7 mRNA
levels in thymi of aged Tgfb2⫹/⫺ mice and wt littermates by
real-time PCR. No difference in IL-7 mRNA expression was
observed (not shown), indicating that TGF-␤2 does not affect IL-7
production in the thymus. We next analyzed the thymi of Tgfb2⫹/⫺
mice and wt littermates by flow cytometry. Staining for CD4 and
CD8 revealed similar proportions of single-positive, doublepositive, and double-negative cells in aged Tgfb2⫹/⫺ and wt mice
(Figure 3C). Analysis of early thymopoiesis, as measured by the
expression of CD25 and CD44 on triple-negative (TN) cells,29
defined as cells negative for CD3, CD4, CD8␣, CD8␤, and
non–T-lineage antigens (NK1.1, B220, Ter119, Gr-1, Mac1),
showed similar frequencies of TN1, TN2, TN3, and TN4 cells in
aged Tgfb2⫹/⫺ and wt mice (Figure 3C). However, the frequency of
ETPs, defined as lin⫺CD25⫺c-kit⫹ILR7␣⫺/lo cells12 (lineage markers were CD3, CD8␣, CD8␤, TCR␣␤, TCR␥␦, NK1.1, CD19,
Ter119, B220, Mac1, Gr1), was higher in the thymi of aged
⫹/⫺
Tgfb2 mice than of aged wt mice. In contrast, ETP frequency was
similar in young Tgfb2⫹/⫺ and wt mice (Figure 3D). Taken together,
our data show that in the thymi of aged Tgfb2⫹/⫺ mice, except for
the earliest detectable T-cell precursors, all thymocyte populations
appeared to be increased proportionally compared with wt thymi.
Thus, the larger thymi of aged Tgfb2⫹/⫺ mice cannot be attributed
to a specific or malignant subpopulation. Rather, TGF-␤2 appeared
to affect the earliest stage of T-cell development in old mice.
Figure 2. Thymic involution in Tgfb2 ⴙ/ⴚ mice. Thymus weight in Tgfb2⫹/⫺ mice
and wt littermates at various ages. Each pair of data points represents the average of
2 to 4 Tgfb2⫹/⫺ and wt members of a litter.
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 MARCH 2006 䡠 VOLUME 107, NUMBER 5
TGF-␤2 AND THYMIC INVOLUTION
1977
Figure 3. Analysis of the involuting thymus in Tgfb2 ⴙ/ⴚ
and wt mice. (A) Ratio of cortical to medullary surface
area in Tgfb2⫹/⫺ (het) and wt mice (n ⫽ 12 sections from
3 thymi; young are 8 weeks old, old are 14-16 months
old). (B) Representative example of hematoxylin and
eosin-stained thymi from 16-month-old wt and Tgfb2⫹/⫺
mice (original magnification, ⫻ 10). (C) Representative
example of staining of thymi from wt and Tgfb2⫹/⫺ mice
for CD4 and CD8 (top panels) and for CD25 and CD44
(bottom panels, gated on cells negative for CD3, CD4,
CD8␣, CD8␤, B220, Ter119, NK1.1, Gr-1, Mac1). (D) Representative example of the detection of ETPs (lin⫺
CD25⫺c-kit⫹IL7R␣⫺/lo, plots gated on cells that were
negative for CD25, CD3, CD8␣, CD8␤, TCR␣␤, TCR␥␦,
NK1.1, CD19, Mac1, GR1, B220 and Ter119) in wt and
⫹/⫺
Tgfb2
thymi (top panels), and frequency of ETPs in
thymi from young (2-6 months) and old (14-16 months)
⫹/⫺
Tgfb2
mice and wt littermates (n ⫽ 4 litters in young
mice and 5 litters in old mice; 2 mice from each genotype
and each litter were pooled for each analysis).
Thymic involution leads to a decreased production of naive T
cells and a concomitant expansion of memory T cells.2-4,30,31 We
therefore compared the fraction of naive (CD44lowCD45RBhigh)32
CD4 and CD8 cells in the peripheral blood and in the spleen of
8-week-old and 12-month-old Tgfb2⫹/⫺ and wt mice. In 8-weekold mice, the frequency of naive cells (expressed as a fraction of the
total CD4 or CD8 population) was similar in Tgfb2⫹/⫺ and wt mice
(Figure 4A). In contrast, 12-month-old wt mice had significantly
lower frequencies of naive CD4 and CD8 cells in the spleen (not
shown) and the peripheral blood (Figure 4B) than Tgfb2⫹/⫺ mice.
These data strongly suggest that the difference in the size of the
thymus between old Tgfb2⫹/⫺ mice and wt littermates is biologically significant.
The unique positive regulatory effect of TGF-␤2 on HSC
number and function is at least in part cell autonomous, because
even in a wt environment, Tgfb2⫹/⫺ HSCs cycle more slowly than
wt HSCs.25 To examine the contribution to thymic involution of
TGF-␤2 expressed within the hematopoietic system as opposed to
outside the hematopoietic system, we performed transplantations in
8-week-old wt and Tgfb2⫹/⫺ mice, which have a similar thymus
size at that age, with 2 ⫻ 106 wt or Tgfb2⫹/⫺ bone marrow cells
Figure 4. Naive T cells in Tgfb2 ⴙ/ⴚ mice. Fraction of naive (CD44lowCD45RB⫹)
cells of the CD4 and CD8 populations in the peripheral blood of 8-week-old (A) and
12-month-old (B) Tgfb2⫹/⫺ mice and wt littermates. Each connected pair of data
points represents the average of 2 to 4 Tgfb2⫹/⫺ and wt members of a litter.
from 8-week-old donors, and measured thymus size after 12 to 14
months. In all mice, more than 90% of cells in hematopoietic
organs were donor-derived at the time of analysis (not shown).
Thymus size was measured as the number of thymic mononuclear
cells, because dissection of thymi from irradiated animals was
technically more challenging, making assessment of thymic
weight less reliable. The highest thymic cellularity was observed in
Tgfb2⫹/⫺ recipients of Tgfb2⫹/⫺ bone marrow (het3het; Figure 5A). Compared with het3het mice, thymic cellularity was
decreased to the same extent in wt3wt, wt3het, and het3wt mice
(Figure 5A). These data suggest that an increased expression level
of TGF-␤2 either within the hematopoietic system or in nonhematopoietic tissues was sufficient to accelerate thymic involution in
⫹/⫺
Tgfb2 mice to the level of wt mice. The frequency of naive T
cells in the peripheral blood correlated with thymic cellularity
(Figure 5B). These data again strongly suggest that variation in
thymic involution in mice given transplants has a repercussion on
the composition of the peripheral T-cell pool.
Tgfb2⫹/⫺ HSCs cycle more slowly in vivo.25 It is possible that
the lower cycling activity of Tgfb2⫹/⫺ HSCs delays age-related
changes in HSCs, which contribute to thymic involution. Therefore, we examined whether thymic involution would be accelerated
Figure 5. Effect of HSC genotype and age on thymic involution. (A) Thymic
cellularity 12 months after reciprocal transplants between wt and Tgfb2⫹/⫺ (het) mice
(mean ⫾ SEM, n ⫽ 3-5 mice from 3 separate transplantation experiments; *significantly different from het3het transplants). (B) Correlation between the fraction of
naive (CD44lowCD45RB⫹) CD4 cells in the peripheral blood and thymic cellularity in
the transplant recipients of panel A for which data were available (n ⫽ 18). (C) Effect
of the age of reconstituting bone marrow cells on thymic cellularity 12 months after
transplantation (mean ⫾ SEM; n ⫽ 10 for recipients of bone marrow of aged mice;
n ⫽ 7 for recipients of bone marrow from young mice).
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
1978
KUMAR et al
after reconstitution with aged as compared with young bone
marrow cells. The 8-week-old CD45.2⫹ C57BL/6 mice were
reconstituted with bone marrow cells from either 8-week-old or
18-month-old CD45.1⫹ C57BL/6 mice. Thymic cellularity was
examined after 12 months. Mice reconstituted with bone marrow
cells from young mice had a slightly higher thymic cellularity than
mice reconstituted with bone marrow cells from old mice, but the
difference was not significant (P ⫽ .5; Figure 5C). Furthermore,
there was no difference in the frequency of naive T cells between
mice reconstituted with old or young bone marrow cells (not
shown). These data indicate that the aged environment in the
recipient plays an important role in thymic involution.
Discussion
Mechanistic insight into the process of thymic involution is largely
lacking.2-4 Here, we identify TGF-␤2 as a factor contributing to the
late stages of thymic involution and show that genetic variation in
isoform-specific TGF-␤2 signaling plays a major role in the
quantitative genetic variation in the rate of thymic involution in
inbred mice.
It is unclear whether TGF-␤2 acts on the thymic microenvironment or on the hematopoietic system to regulate thymic involution.
TGF-␤2 may, in fact, have multiple and opposing effects on thymic
function. The lower ratio between cortical and medullary surface
area in Tgfb2⫹/⫺mice, generally considered a sign of architectural
disintegration accompanying aging,2,3,20 may suggest that higher
levels of TGF-␤2 expression are beneficial for the integrity of the
thymic microenvironment. The significance of this finding is
unclear, however, because, although mutual trophic interactions
between thymic microenvironment and developing thymocytes
exist,33 this variation was not accompanied by obvious differences
in major thymocyte subpopulations. Furthermore, the age-related
decrease in this ratio was similar in Tgfb2⫹/⫺and wt mice. It is
therefore unlikely that this phenotype would explain any differences in thymic involution. Finally, thymic involution overall
proceeds more slowly in Tgfb2⫹/⫺ mice. Our reciprocal transplantation experiments between wt and Tgfb2⫹/⫺ mice indicate that
increased expression of TGF-␤2 within the hematopoietic system
is sufficient to accelerate thymic involution in Tgfb2⫹/⫺mice.
Because TGF-␤2 can act on HSCs in a cell autonomous fashion,
this finding may suggest that the accelerating effect of TGF-␤2 on
thymic involution is mediated by its action on HSCs or their direct
progeny. Further support for this contention is provided by the fact
that the biphasic TGF-␤2 dose response on the proliferation of LSK
cells in vitro is specific for LSK cells. In other cell types, including
NIH 3T3 cells, PHA-stimulated T cells, a variety of leukemic and
nonleukemic cell lines, and LSK cells immortalized with an Lhx2
expressing retroviral vector,35 TGF-␤2, like TGF-␤1 and TGF-␤3,
was an inhibitor of proliferation (J.C.L., S. Pal, and H.-W.S.,
unpublished data, December 2004). Furthermore, the particular
biphasic dose response of TGF-␤2 on the proliferation of LSK cells
requires a serum factor. In serum-free conditions, the TGF-␤2 dose
response is entirely inhibitory and is not subject to quantitative
genetic variation.28 It is therefore the LSK cell–specific, serumdependent, positive regulatory effect of TGF-␤2 that is subject to
genetically determined variation and correlates with the rate of
thymic involution. It cannot be excluded, however, that TGF-␤2
has similar signaling characteristics in yet untested hematopoietic
cell types, or that paracrine secretion of TGF-␤2 by hematopoietic
BLOOD, 1 MARCH 2006 䡠 VOLUME 107, NUMBER 5
cells targets a nonhematopoietic cell that is critical for thymic
involution. A final argument in favor of an effect of TGF-␤2 on the
early stage of hematopoietic differentiation is that ETP frequencies
are higher in aged Tgfb2⫹/⫺ mice. Thus, our findings lend support
to, but do not prove, the controversial idea that functional
characteristics of HSCs or their progeny may directly contribute to
thymic involution.
If the role of TGF-␤2 in thymic involution is mediated through
its genetically determined, positive regulatory effect on the initial
stages of hematopoiesis in vivo, how could TGF-␤2 deficiency
then decrease the rate of thymic involution? Tgfb2⫹/⫺ HSCs cycle
more slowly than wt HSCs.25 It is attractive to speculate that a
lower level of cycling in the HSC compartment may delay the
age-related loss of lymphoid potential,15-18 a process likely intrinsic
to HSCs,34 and therefore decrease the rate of thymic involution.
However, the absence of a statistically significant effect of the age
of donor bone marrow cells on thymic involution in recipients
suggests that, the genotype of repopulating HSC being equal,
thymic involution is to a large extent determined by the aged
environment. There are 2 ways these data can be reconciled with a
role for TGF-␤2 in thymic involution through its effect on the HSC
compartment. One explanation is that in the reciprocal transplantation experiments, the reconstituting HSC are 14 months old in the
aged recipients of young bone marrow, and 30 months old in the
aged recipients of aged bone marrow. It is possible that any effect
of aged HSCs may have been difficult to discern at that stage
because the thymic involution curve levels off in aged mice. A
second explanation is that not the age of HSCs, but other aspects of
the function of HSCs, which do not change significantly with age
but become biologically relevant only at a relatively old age, can
affect the rate of thymic involution. Tgfb2⫹/⫺ HSCs or ETPs may,
for example, have a homing, growth, or differentiation advantage
compared with wt cells in the microenvironment present in an aged
thymus, but not in a young thymus.
The fraction of naive T cells was higher in aged Tgfb2⫹/⫺
mice than in aged wt mice, indicating that the lower rate of
thymic involution in Tgfb2⫹/⫺ mice is biologically significant. It
cannot be excluded that the difference in naive T cells’
frequencies between aged Tgfb2⫹/⫺ and wt mice, and among
recipients of reciprocal transplants are caused by a direct effect
of TGF-␤2 on naive-memory ratios independent from the
thymus. However, within each group of recipients in the
reciprocal transplantation experiments, the correlation coefficient between thymic cellularity, which showed relatively large
variation, and naive T-cell frequency was similar, independent
of whether donor, recipient or both were wt or Tgfb2⫹/⫺
(r ⫽ 0.789 for het3wt and wt3het, r ⫽ 0.655 for wt3wt, and
r ⫽ 0.831 for het3het transplants). This finding argues against
the contention that TGF-␤2 directly affects naive-memory
ratios. Hence, the frequency of naive T cells is very strongly
associated with thymic cellularity and therefore likely a reflection of thymic function.
Wherever we observed variation in thymic involution in our
study, correlating changes were found in the fraction of naive T
cells. A higher frequency of naive CD4 cells and a reciprocally
lower frequency of memory CD4 cells in the peripheral blood of
aged mice have been shown to be associated with longer lifespan.36
In this context, it is interesting to note that we have previously
demonstrated that QTLs regulating hematopoiesis, including those
contributing to LSK cell frequency and responsiveness to TGF-␤2,
and QTLs contributing to genetic variation in lifespan are closely
linked at multiple loci. These observations suggest that the HSC
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
BLOOD, 1 MARCH 2006 䡠 VOLUME 107, NUMBER 5
TGF-␤2 AND THYMIC INVOLUTION
compartment may play a role in organismal aging.24 Although
thymic involution in younger individuals may be developmentally
regulated and is likely under evolutionary selection, further thymic
involution in older individuals may be detrimental to health, and
perhaps, to longevity.2,3,31,37 The aged immune system is characterized by impaired immune responses and a decreased pool of naive
T cells, limiting the capacity of aged individuals to mount immune
responses to neoantigens.2-4,31,36 Through peripheral expansion,
memory cells fill the void in the T-cell pool caused by the decreased
production of naive T cells. Senescent memory cells may contrib-
1979
ute to the general state of low level inflammation that characterizes
aging (“inflammaging”) in humans.31,37 Thus, our data raise the
hypothesis that HSCs may affect lifespan through their effect on
thymic involution and the concomitant depletion of naive T cells
and expansion of memory T cells.
In conclusion, TGF-␤2 accelerates thymic involution. Thymic
involution is to a large extent determined by the aged environment,
but TGF-␤2 plays a major modulatory role that is subject to genetic
variation and is possibly mediated through its regulatory effects on
early hematopoiesis.
References
1. Shortman K, Wu L. Early T lymphocyte progenitors. Annu Rev Immunol. 1996;14:29-47.
15. Tyan ML. Age-related decrease in mouse T progenitors. J Immunol. 1977;118:846-851.
2. Aspinall R, Andrew D, Pido-Lopez J. Age-associated
changes in thymopoiesis. Springer Semin Immunopathol. 2002;24:87-101.
16. Muller-Sieburg CE, Cho RH, Thoman M, Adkins
B, Sieburg HB. Deterministic regulation of hematopoietic stem cell self-renewal and differentiation. Blood. 2002;100:1302-1309.
3. Shanker A. Is the thymus redundant after adulthood? Immunol Lett. 2004;91:79-86.
4. Linton PJ, Dorshkind K. Age-related changes in
lymphocyte development and function. Nat Immunol. 2004:5:133-139.
5. Utsuyama M, Hirokawa K. Hypertrophy of the thymus and restoration of immune functions in mice
and rats by gonadectomy. Mech Ageing Dev.
1989;47:175-185.
6. Kincade PW, Medina KL, Smithson G. Sex hormones as negative regulators of lymphopoiesis.
Immunol Rev. 1994;137:119-134.
17. Muller-Sieburg CE, Cho RH, Karlsson L, Huang
JF, Sieburg HB. Myeloid-biased hematopoietic
stem cells have extensive self-renewal capacity
but generate diminished lymphoid progeny with
impaired IL-7 responsiveness. Blood. 2004;103:
4111-4118.
18. Sudo K, Ema H, Morita Y, Nakauchi H. Ageassociated characteristics of murine hematopoietic stem cells. J Exp Med. 2000;192:1273-1280.
27.
28.
29.
7. Aspinall R, Andrew D. Age-associated thymic atrophy is linked to a decline in IL-7 production. Exp
Gerontol. 2002;37:455-463.
19. Mackall CL, Punt JA, Morgan P, Farr AG, Gress
RE. Thymic function in young/old chimeras: substantial thymic T cell regenerative capacity despite irreversible age-associated thymic involution. Eur J Immunol. 1998;28;1886-1893.
8. Bhatia SK, Tygrett LT, Grabstein KH, Waldschmidt TJ. The effect of in vivo IL-7 deprivation
on T cell maturation. J Exp Med. 1995;181;13991409.
20. Hsu HC, Zhang HC, Li L, et al. Age-related thymic
involution in C57BL/6J ⫻ DBA/2J recombinantinbred mice maps to mouse chromosomes 9 and
10. Genes Immun. 2003;4:402-410.
30.
9. Phillips JA, Brondstetter TI, English CA, Lee HE,
Virts EL, Thoman ML. IL-7 gene therapy in aging
restores early thymopoiesis without reversing involution. J Immunol. 2004;173:4867-4874.
21. Van Zant G. Stem cells and genetics in the study
of development, aging, and longevity. Results
Probl Cell Differ. 2000;29;203-235.
31.
10. Li L, Hsu HC, Stockard CR, et al. IL-12 inhibits
thymic involution by enhancing IL-7- and IL-2induced thymocyte proliferation. J Immunol.
2004;172:2909-2916.
11. Thoman ML. The pattern of T lymphocyte differentiation is altered during thymic involution. Mech
Ageing Dev. 1995;82:155-170.
12. Allman D, Sambandam A, Kim S, et al. Thymopoiesis independent of common lymphoid progenitors. Nat Immunol. 2003;4:168-174.
13. Min H, Montecino-Rodriguez E, Dorshkind K. Reduction in the developmental potential of intrathymic cell progenitors with age. J Immunol. 2004;
173:245-250.
14. Porritt HE, Rumfelt LL, Tabrizifard S, Schmitt TM,
Zuniga-Pflucker JC, Petrie HT. Heterogeneity
among DN1 prothymocytes reveals multiple progenitors with different capacities to generate T
cell and non-T cell lineages. Immunity. 2004;20:
735-745.
22. Kondo M, Wagers AJ, Manz MG, et al. Biology of
hematopoietic stem cells and progenitors: implications for clinical application. Annu Rev Immunol. 2003;21:759-806.
23. Henckaerts E, Geiger H, Langer JC, Rebollo P,
Van Zant G, Snoeck HW. Genetically determined
variation in the number of phenotypically defined
hematopoietic progenitor and stem cells and in
their response to early-acting cytokines. Blood.
2002;99:3947-3954.
24. Henckaerts E, Langer JC, Snoeck HW. Quantitative genetic variation in the hematopoietic stem
and progenitor cell compartment and in life span
are closely linked at multiple loci. Blood. 2004;
104:384-394.
25. Langer LC, Henckaerts E, Orenstein J, Snoeck
HW. Quantitative trait analysis reveals transforming growth factor-beta2 as a positive regulator of
hematopoietic progenitor and stem cells. J Exp
Med. 2004;199:5-14.
26. Sanford LP, Ormsby I, Gittenberger-de Groot AC,
32.
33.
34.
35.
36.
37.
et al. TGFbeta2 knockout mice have multiple developmental defects that are non-overlapping
with other TGFbeta knockout phenotypes. Development. 1997;124:2659-2670.
Moore KJ, Nagle DL. Complex trait analysis in the
mouse: the strengths, the limitations and the
promises yet to come. Annu Rev Genet. 2000;34:
653-686.
Henckaerts E, Langer JC, Orenstein J, Snoeck
HW. The response of primitive progenitor and
stem cells to the positive regulatory effect of
transforming growth factor-beta2 is dependent on
serum factors and subject to age-related quantitative genetic variation. J Immunol. 2004;176:
2486-2493.
Godfrey DI, Kennedy J, Suda T, Zlotnik A. A developmental pathway involving four phenotypically and
functionally distinct subsets of CD3⫺CD4⫺CD8⫺
triple-negative adult mouse thymocytes defined by
CD44 and CD25 expression. J Immunol. 1993;150:
4244-4252.
Lerner A, Yamada T, Miller RA. Pgp-1hi T lymphocytes accumulate with age in mice and respond
poorly to concanavalin A. Eur J Immunol. 1989;
19:977-982.
Franceschi C, Bonafe M, Valensin S. Human immunosenescence: the prevailing of innate immunity, the failing of clonotypic immunity, and the
filling of immunological space. Vaccine. 2000;18:
1717-1720.
Gray D. Immunological memory. Annu Rev Immunol. 1993;11;49-77.
Anderson G, Jenkinson EJ. Lymphostromal interactions in thymic development and function. Nat
Rev Immunol. 2001;1:31-40.
Rossi DJ, Bryder D, Zahn JM, et al. Cell intrinsic
alterations underlie hematopoietic stem cell aging. Proc Natl Acad Sci U S A. 2005;102:91949199.
Pinto do O P, Richter K, Carlsson L. Hematopoietic progenitor/stem cells immortalized by Lhx2
generate functional hematopoietic cells in vivo.
Blood. 2002;99:3939-3946.
Miller RA, Chrisp C, Galecki A. CD4 memory T
cell levels predict life span in genetically heterogeneous mice. FASEB J. 1997;11:775-783.
Franceschi C, Bonafe M. Centenarians as a
model for healthy aging. Biochem Soc Trans.
2003;31:457-461.
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
2006 107: 1974-1979
doi:10.1182/blood-2005-04-1495 originally published online
November 10, 2005
Transforming growth factor-β2 is involved in quantitative genetic
variation in thymic involution
Ritu Kumar, Jessica C. Langer and Hans-Willem Snoeck
Updated information and services can be found at:
http://www.bloodjournal.org/content/107/5/1974.full.html
Articles on similar topics can be found in the following Blood collections
Hematopoiesis and Stem Cells (3430 articles)
Immunobiology (5489 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.