96
Exp Oncol 2005
27, 2, 96-101
Experimental Oncology 27, 96-101, 2005 (June)
ORIGINAL CONTRIBUTIONS
EPSTEIN — BARR VIRUS LMP1 INITIATES CELL PROLIFERATION
AND APOPTOSIS INHIBITION VIA REGULATING EXPRESSION
OF SURVIVIN IN NASOPHARYNGEAL CARCINOMA
1
Tang Faqing1,2, Hu Zhi2, Yin Liqun2, Tang Min2, Gu Huanhua2, Deng Xiyun2, Cao Ya2,*
Clinic Laboratory, Xiangya Hospital, Central South University, Changsha 410008, Hunan, China
2
Cancer Research Institute, Xiangya School of Medicine, Central South University, Changsha
410078, Hunan, China
Pathways controling cell proliferation and cell survival require flexible adaptation to environmental stress. Our
previous studies showed that latent membrane protein1 (LMP1) encoded by Epstein—Barr virus (EBV) could
trigger the expression of Survivin, an apoptosis inhibitor and essential regulator of mitosis. The aim of the work
was to analyze the role of Survivin signal pathway in mediating effects triggered by LMP1. Methods: Tet-on LMP1
HNE2, a tetracycline-regulated LMP1-expression nasopharyngeal carcinoma cell line, was used as cell model. The
subcellular location of Survivin was detected by indirect immunofluorescence and Western-blotting assay. Using
Ab-knock-out and gene transfection, we introduced anti-sense PS-ODN-Survivin and anti-body to Survivin into
the Tet-on LMP1 HNE2, and then the apoptosis and the proliferation of cells were analyzed by flow cytometry, cell
colony formation and detection of caspase-3. The results show that upon induction of LMP1 expression, the
expression of Survivin in nucleus, level of phosphorylated retinoblastoma gene (Rb), the number of cells in S stage
of cell cycle, and the cell colony formation rate were higher than those without LMP1 induction; if the expression
of Survivin and the nucleus translocation of Survivin were knocked by introduction of anti-sense PS-ODN-Survivin
and anti-Survivin-antibodies respectively, apoptosis rates and the activity of caspase-3 increased. Conclusion:
LMP1 could trigger the nucleus translocation of Survivin, which led to the shift of S stage and cell proliferation.
LMP1 may promote cell proliferation and inhibits apoptosis via Survivin signal pathway.
Key Words: Epstein—Barr virus, latent membrane protein1, Survivin, proliferation, apoptosis, nasopharyngeal carcinoma.
Epstein—Barr virus (EBV) is an environmental factor closely related to many cancers [1–3]. Meanwhile,
latent membrane protein1 (LMP1) encoded by EBV
BNLF-1 open reading frame is an important oncoprotein [1], and has classical oncogene properties, which
can transform rodent fibroblast cell as assayed by tumorigenicity in nude mice and foci formation [4, 5]. LMP1
could activate both nucleus factor kB (NFkB) and activator protein (AP-1) transcription via carboxyterminal
activating region 1 (CTAR1) and carboxyterminal activating region 2 (CTAR2), which are the key modulators
of cell growth and might also be relevant to the role of
EBV in some malignant tumors. It has been proved that
LMP1 could induce the growth of Burkitt’s lymphoma
cells. LMP1 up-regulates the expression of bcl-2 proto-oncogene, which may be associated with the inhibition of p53-triggered apoptosis [6].
LMP1 can play the dual role in apoptosis and cell proliferation, but the exact mechanisms are not elucidated.
Received: July 19, 2004.
*Correspondence:
Fax: 086-731-4460589
E-mail: [email protected]
Abbreviations used: AP-1 — activator protein; BIR — baculovirus
inhibitor of apoptosis repeat; CTAR1 — carboxyterminal activating
region 1; CTAR2 — carboxyterminal activating region 2; Dox —
doxycycline; EBV — Epstein—Barr virus; IAP — inhibitor of apoptosis protein; LMP1 — latent membrane protein1; NFkB — nucleus factor kB: NPC — nasopharyngeal carcinoma; Rb — retinoblastoma gene; TRAD — TNF associated death domain; TRAF2 —
tumor necrosis factor receptor-associated factor.
Survivin is an important inhibitor of apoptosis protein
(IAP), which is characterized by a unique structure with
a single, baculovirus IAP repeat and no zinc-binding domain known as Ring finger. Survivin has been found to
be crucial for mitosis and cell cycle progression [7], being expressed maximally in the G2/M phase of the cell
cycle, being physically associated with mitotic spindle
microtubules and controlling progression through mitosis [8]. Survivin can counteract apoptosis induced by a
variety of stimuli, and can inhibit the proteolytic activity
in vitro by acting directly on cysteine proteinases termed
caspases and mainly suppress the ñaspase-3 and
ñaspase-7 [9–11], which can be activated by diverse
stimuli and play a central role in apoptosis as execuctors of cell death. They are present as pro-enzymes in
viable cells and proteolytically processed to generate
active forms in apoptotic cells. Survivin is expressed in
human cancer cells but not in normal tissues. Its expression is associated with increased aggressiveness
and decreased patient survival [12]. Survivin is an important molecule connecting cell death and cell proliferation [13].
Our previous studies have shown that LMP1 triggered Survivin expression via NFkB and AP-1 signaling pathways in nasopharyngeal carcinoma cells [14].
Nevertheless, it is still unknown whether LMP1 exerts
dual effects inhibiting apoptosis and promoting proliferation via Survivin. In this study, we investigated the
role of Survivin signal pathway in mediating effects triggered by LMP1.
Experimental Oncology 27, 96-101, 2005 (June)
MATERIALS AND METHODS
Antibodies and reagents. In the study, antibodies (Ab)
to Survivin and Ab to phosphorylated Rb (Santa Cruz Co,
USA), Ab to LMP1 (Dako Co, USA), Ab to goat with FITC
(Sigma, USA), ApoAlertTM CPP32/CASPASE3 Assay kit
(Clontech Laboratories Inc, Canada), lipofectamine (GIBCO
BRL), nocodazole and Hoechst 33258 (Sigma, USA), BCA
Assay Reagent (Pierce Chemical Inc, UK) were used.
Oligodeoxynucleotides. Anti-sense PS-ODN-Survivin described in [15] is complementary to Survivin
mRNA 232-251 and its sequence is as follows:
5¢CCCAGCCTTTCCAGCACCTTG3¢. Phosphothiolate
oligodeoxynucleotide was synthesized using an Applied
Biosystems 3900 DNA synthesizer (Shenggong Co.,
Shanghai, China). After the synthesis, anti-sense PSODN-Survivin was purified by high-pressure liquid chromatography, dissolved in PBS, and frozen in aliquots at
–20 °C until use.
Cell lines and constructs. HNE2, which is EBV-negative poorly differentiated nasopharyngeal carcinoma
(NPC) cell line, was established in Cancer Research
Institute, Hunan Medical University (China) [16]. Teton-LMP1-HNE2 is the dual-stable LMP1 integrated
NPC cell line. The expression of LMP1 could be turned
on by tetracycline and its derivative doxycycline [17].
Cell culture. Cell lines were incubated in RPMI-1640
medium and 10% inactivated calf serum. Penicillin and
streptomycin were added to a final concentration of
100 mg/ml. The cells were passaged every 3 to 5 days
upon treatment by 0.25% pancreatic enzyme and 0.02%
EDTA. Cells in the logarithmic proliferation stage were
studied.
Transfection. 1 ´ 105 cells were seeded on culture
dishes for 24 h. Transfections were performed by lipofectamine according to the manufacture’s instruction. For
each transfection, 10 mg of plasmid DNA was diluted with
200 ml of serum-free medium and 10 ml of lipofectamine
into 200 ml of serum-free medium. The two solutions were
combined, mixed gently and incubated at room temperature for 30 min. 400 ml of the mixture and 600 ml of serumfree medium were added into 50 ml culture bottle. The
cells were incubated at 37 °C for 5 h and then the transfection media were replaced by fresh growth media.
Electroporation and detection of antibody. The
cells were harvested at 70% confluency and washed
twice with PBS. Alternatively, mitotic cells were prepared
by treatment with 40 mmol/L nocodazole for 18–20 h
and subsequent removal of rounded cells by agitation.
Cell pellet were suspended in cold PBS at a density of
2–4 ´ 107 cells/ml. 50 ml of this suspension (1–2 ´ 106
cells) was thoroughly mixed with purified immunoglobulin or with purified monoclonal antibody to Survivin at a
final immunoglobulin concentration of 2 mg/ml. The suspensions were transferred into an electroporation cuvette (Bio-Rad; 0.4 cm electrode distance) and carefully
spread across the bottom of the cuvette in order to touch
both electrodes. After 10 min of incubation on ice, the
electric pulse was delivered from a Gene Pulser (BioRad). Immediately after the pulse, 1 ml of pre-warmed
RPMI 1640 was added, and then the cells were recov-
97
ered from the cuvette by gentle aspiration and then plated into glass cover slides or culture flasks [18]. After a
recovery period of 12–24 h, the cover slides were removed from the dishes and fixed in cold methanol/acetone (1 : 1) for 10 min. The fixed cells were re-hydrated
in PBS and incubated with FITC labeled rabbit antimouse antibody at a dilution of 1 : 30 for 30 min at room
temperature. The cover slides were extensively washed
with PBS and stained by incubation for 5 min in PBS
containing Hoechst 33258 at a final concentration of
5 mg/ml. Immunofluoresence was analyzed using a photomicroscope III equipment from Zeiss.
Immunofluorescence analysis. Tet-on LMP1
HNE2 cells and HNE2 cells treated with doxycycline
(Dox) (0.6 mg/ml) and mAb to Survivin or nontreated,
analyzed by fluorescence microscopy. The expression
of Survivin in nucleus and cytoplasm was observed at
´ 400 magnification in at least five fields.
Analysis of cell cycle and apoptosis and detection of caspase-3 activity. 48 h after transfection with
the anti-sense PS-ODN-Survivin and treatment with
Dox, cell cycle distribution and apoptosis were determined by flow cytometry. Briefly, the cells were collected, digested and washed twice in PBS, and the cells
were centrifuged, fixed with 70% ice-cold ethanol for
24 h, stained with PI, and examined by flow cytometry.
For detection of caspase-3 activity, the cells were
washed with PBS, lysed in the lysis buffer, incubated on
ice for 10 min. The lysates were centrifuged for 5 min at
14 000 rpm. Caspase-3 activity in the suspension was
measured using ApoAlertTM CPP32/CASPASE3 Assay
kit according to the manufacture’s instruction.
Preparation of fractionated proteins. The preparation of nuclear and cytoplasmic proteins was described elsewhere [19]. Briefly, cells were collected and
washed with ice cold PBS, and then suspended in buffer 1 (2 mM EDTA, 10 m M Tris-HCl, pH 7.5). After incubation on ice for 10 min, an equal volume of buffer II
(0.5 M sucrose, 0.5 M KCl, 10 mM MgCl2, 2 mM CaCl2,
2 mM EDTA, 10 mM Tris-HCl, pH 7.5) was added. The
nucleus rich fraction was pelleted by centrifugation
(2700 rpm, 10 min). The supernatant was removed to
a separate tube and again centrifuged (43 000 rpm
90 min). The second supernatant was collected as the
cytosol-rich fraction, and the pellet was dissolved in
buffer III (8 mM CHAPS, 150 mM NaCl, 0.1 M sucrose,
2 mM EDTA, 10 mM Tris-HCl, pH 7.5) and incubated
at 4 °C for 2 h, served as nuclear fraction.
Western blotting. Western blot was used to determine the expression of Survivin and phosphorylated
Rb. The proteins were prepared essentially as described previously. After treatment with Dox and transfection, the cells were washed with ice-cold PBS and
ruptured with lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM
EDTA, 20% SDS, 5 mM DTT, 10 mM PMSF). The protein concentration of cells was measured with BCA
Assay Reagent Kit. The protein concentration was unified with PBS. In order to denature protein, the samples and middle molecular marker were heated to
100 °C for 5 min. The protein, after being separated
98
Experimental Oncology 27, 96-101, 2005 (June)
with SDS-PAGE electrophoresis, was transferred to a
piece of nitrocellulose membrane with moisture transfer technique at 100 V for 2 h. The membranes were
stained with Ponceau-S to confirm whether the protein
transfer was successful. Five percent of fat-free milk
powder-PBS solution was used to block the unspecific
antibody binding site for 1 h. Then the membranes were
triply washed in PBS-T solution for 15 min. MAb solution (0.4 mg/l) of mouse anti-human Survivin and Rb
were incubated with the membrane for 1 h respectively. Again, each piece of membrane was triply washed
in PBS-T solution for 15 min. Then, all the membranes
were incubated with rabbit anti-mouse IgG solution
(0.2 mg/l) for 1 h, washed triply in PBS-T solution for
15 min and incubated with chemofluorescent agent for
5 min, and exposed to X-ray films in a dark room.
a-tubulin expression served as the control.
Cell colony formation. Cells transfected with antisense PS-ODN-Survivin and ssDNA (as the control) were
treated with 0.25% trypsin and 0.02% EDTA. Cell suspension (1 ´ 103 cells) was placed in 6 well plates, and
incubated for 14 days. The plates were washed with PBS
and stained. Cell colony number was counted.
Statistical analysis. SPSS statistic soft package
was used to undergo single factor Chi Square analysis
and t-test. p < 0.05 was considered as significant.
RESULTS
It is reported that Survivin exerts its biological functions by translocation into nucleus [7]. Our previous work
showed that LMP1 triggered the expression of Survivin
via nucleus factor kB (NFkB) and AP-1 [14]. In the present
study, we further investigated the biological effects of
Survivin triggered by LMP1. We observed sub-cellular
location of Survivin under various conditions using an
immunocytochemical approach. An antibody specific to
Survivin was used to detect immunoreactivity in the cytoplasm and nuclei. After treatment with Dox (0.6 mg/ml),
most of Survivin was found in the nucleus (Fig. 1), whilst
without induction of LMP1 expression, Survivin was located in cytoplasm. The fractionated proteins in cytoplasm and nucleus were separated, and the expression
a
b
c
d
Fig. 1. Survivin distribution in cytoplasm and nuclei. Tet-on LMP1
HNE2 cells were treated with Dox: a — Tet-on LMP1 HNE2 +
Dox 0.6 mg/ml; b — HNE2 + Dox 0.6 mg/ml; c — Tet-on LMP1
HNE2 + Dox 0; d — Tet-on LMP1 HNE2 counterstained with PI
of Survivin in cytoplasm and nucleus was analyzed by
Western blotting. We showed that LMP1 triggers the
translocation of Survivin into the nucleus (Fig. 2).
Fig. 2. Western blotting analysis of the expression of Survivin in
nucleus and cytoplasm of Tet-on LMP1 HNE2 cells treated by
Dox. 1 — Dox(-), nucleus; 2 — Dox(-), cytoplasm; 3 — Dox
0.6 mg/ml, nucleus; 4 — Dox 0.6 mg/ml, cytoplasm. a-tubulin expression served as the control
The level of phosphorylated Rb was analyzed using
Western blotting. The level of phosphorylated Rb in LMP1
expressing group was higher than that without LMP1
expression. After introducing anti-sense PS-ODN-Survivin to block the transcription of Survivin, the level of
phosphorylated Rb was shown to be decreased (Fig. 3),
pointing that LMP1 promotes Rb phosphorylation through
Survivin signal pathway.
Fig. 3. The expression of phosphorylated Rb in Tet-on LMP1
HNE2 treated by transfection with anti-sense PS-ODN-Survivin
and ssDNA. 1 — HNE2 + Dox 0; 2 — Tet-on LMP1 HNE2 +
ssDNA; 3 — Tet-on LMP1 HNE2 + ssDNA + Dox 0.6 mg/ml; 4 —
Tet-on LMP1 HNE2 + anti-sense + Dox 0.6 mg/ml, a-tubulin expression served as the control
After the cells being synchronized by nocodazole,
antibody to Survivin was introduced by electroporation to
block nuclear translocation of Survivin. The result showed
that Survivin still retains in cytoplasm (Fig. 4). Next, cell
cycle distribution was determined by flow cytometry. From
the same mitotic stage, the number of cells in S phase of
cell cycle (17%) was lower than that of the control with
LMP1 and without anti-sense (67%) (p < 0.05), thus pointing that LMP1 influences the cell cycle via triggering the
expression and nuclei translocation of Survivin.
After anti-sense of Survivin was introduced to inhibit
transcription of Survivin for 48 h, the cell cycle of Tet-on
LMP1 HNE2 was analyzed by flow cytometry; the number of cells on S stage in cell cycle (29.37%) was lower
than that of the control (47.76%) (Fig. 5). To probe whether LMP1 initiates cell proliferation via Survivin, colony
formation was analyzed. The number of cell colonies
(536 ± 30.9/2000) was lower than that of control (964 ±
88.9/2000) (p < 0.05), indicating that LMP1 promotes
the cells proliferation by Survivin expression.
After introduction of anti-sense PS-ODN-Survivin for
48 h, the apoptosis rate was estimated by flow cytometry. The results showed that the apoptosis rate (19.04%)
of cells in the anti-sense group was higher than that of
control (1.45 %). At the same time, the caspase-3 activity was measured using ApoAlertTM CPP32/CASPASE 3
Assay Kit. The caspase-3 activity in the anti-sense group
of cells (5.99 ± 0.23 nmol/106) was higher than that of
the blank control (1.68 ± 0.13 nmol) and the negative
control (1.71 ± 0.19 nmol), showing that LMP1 inhibits
apoptosis by Survivin.
Experimental Oncology 27, 96-101, 2005 (June)
99
a
b
Fig. 4. Subcellular localization of survivin in Tet-on LMP1 HNE2
cells treated by electroporation of antibody to Survivin. a — antigoat IgG served as blank control; b — anti-Survivin antibodies
Fig. 5. Cell cycle distribution of Tet-on LMP1 HNE2 cells after
gene transfection for 48 h
DISCUSSION
An exploration of the tight connection between the
environment factors, signal transduction, carcinogenesis is an important field of research. Among the most
important environmental factors are viruses. Viral-encoded oncoproteins affect cellular signal transduction
pathways, causing increased proliferation of the infected
cells and inhibition of apoptosis.
EBV infection is linked to Burkitt’s lymphoma, Hodking’s disease, undifferentiated nasopharyngeal carcinoma, gastric carcinoma, lung cancer [3, 20]. EBV’s oncoprotein LMP1 has been reported to transform rodent fibroblasts in vitro and being tumorigenic in vivo [21–23].
LMP1 activates the signaling pathway via phosphorylation and degradation of IkB. LMP1 triggers another signaling cascade via CTAR2 binding TNF associated death
domain (TRAD)/tumor necrosis factor receptor-associ-
ated factor (TRAF2) signaling molecule, activates the
JNK phosphorylation and up-regulates the AP-1 activity [24–27]. Our previous studies showed that LMP1 regulates the expression of Survivin at the level of RNA and
protein, triggering the expression of Survivin via NFkB
and AP-1 signal pathways [14].
Survivin, a dimeric baculovirus inhibitor of apoptosis repeat motif protein, is a newly discovered IAP, which
plays an important role in both cell cycle regulation and
inhibition of apoptosis. Survivin can counteract apoptosis by inhibiting the activation of caspase-3 and
caspase-7 [9–11]. Survivin is expressed in the G2/M
phase of the cell cycle in a cycle-dependent manner
[8]. Its expression promotes cell proliferation of malignant cells [28]. The inhibition of expression of Survivin
causes inhibition of tumor growth, increased apoptosis
and reduces proliferation of melanoma cells in vivo [29].
Survivin is an important molecule connecting cell death
and proliferation [13].
In our work, the sub-cellular location of Survivin was
investigated using immunocytochemical and Western
blot approaches. The results showed that the expression of Surivivin in nucleus was higher in the case of
LMP1 expression. LMP1 might trigger the translocation
of Survivin into the nucleus. The level of phosphorylated
Rb in LMP1 expressing group was higher than that without LMP1 expression, and could be decreased by introduction of the anti-sense PS-ODN-Survivin. Finally, introduction of anti-Survivin antibody results in neutralization of Survivin, blocking its nuclear translocation and
the decrease of number of cells in S phase. It is reported
that nuclear translocation of Survivin via interaction with
the cell cycle regulator Cdk4 triggers Rb phosphorylation, and promotes S stage to progress [7]. LMP1 might
promote cell proliferation through triggering nuclear translocation of Survivin and Rb phosphorylation.
Survivin can counteract apoptosis induced by a variety of stimuli by binding to caspase-3 and caspase-7
and inhibiting their proteolytic activity [30]. Our data
showed that the apoptosis rate in the anti-sense group
was higher than that of control, demonstrating that Survivin regulated by LMP1 may inhibit apoptosis. Furthermore, the caspase-3 activity in the anti-sense group
cell was higher and the number of cell colonies was
lower than that in the control cells, showing that LMP1
inhibits apoptosis by Survivin.
In conclusion, LMP1 triggers the expression of Survivin via NFkB and AP-1 signal pathways, and the expression of Survivin triggered by LMP1 can promote
cell proliferation and inhibit apoptosis. Introduction of
anti-sense PS-ODN-Survivin can inhibit cell proliferation and induce cell apoptosis allowing to consider Survivin as a potential target for cancer therapy.
ACKNOWLEDGEMENTS
This project was supported by State Key Basic Research Program Fundamental Investigation on Human
Carcinogenesis (No: G1998051201), Natural Science
Fund for Distinguished Young Scholar (3952502), Natural Science Foundation of China (No 30000007,
100
30171174), Science Fund of Central South University
for Distinguished Young Scholar.
REFERENCES
1. Kawa K. Epstein—Barr virus-associated diseases in
humans. Int J Hematol 2000; 71: 108–17.
2. Hoshikawa Y, Satoh Y, Murakami M, Maeta M,
Kaibara N, Ito H, Kurata T, Sairenji T. Evidence of lytic
infection of Epstein—Barr virus (EBV) in EBV-positive
gastric carcinoma. J Med Virol 2002; 66: 351–9.
3. Grinstein S, Preciado MV, Gattuso P, Chabay PA,
Warren WH, De Matteo E, Gould VE. Demonstration
of Epstein—Barr virus in carcinomas of various sites. Cancer Res 2002; 62: 4876–8.
4. Moorthy RK, Thorley DA. All three domain of the
Epstein-Barr virus encoded latent membrane-protein LMP1
are required for transformation of Rat-1 fibroblasts. J Virol 1993; 67: 1638–48.
5. Fahraeus R, Rymo L, Rhim JS. Morphological transformation of human keratinocytes expressing the LMP1
gene of Epstein-Barr virus. Nature 1990; 345: 447–9.
6. Paul JF. Signal transduction from the Epstein—Barr
virus LMP1 transformation protein. Trends Microbiol 1998;
175: 1731–42.
7. Suzuki A, Hayashida M, Ito T, Kawano H, Nakano T, Miura M, Akahane K, Shiraki K. Survivin initiates cell cycle entry by the competitive interaction with
Cdk4/p16 (INK4a) and Cdk2/cyclin E complex activation. Oncogene 2000; 19: 3225–34.
8. Li FZ, Ambrosin G, Chu EY. Control at apoptosis
and mitotic spindle checkpoint by Survivin. Nature 1998;
396: 580–3.
9. Eric C, LaCase, Baird S, Korneluk RG. The inhibitors of apoptosis protein (IAPs) and their emerging role
in cancer. Oncogene 1998; 17: 3247–59.
10. Lu CD, Altieri DC, Tarigaw N. Expression of a
novel anti-apoptosis gene, Survivin, correlation with tumor cell apoptosis and P53 accumulation in gastric carcinoma. Cancer Res 1998; 58: 1080–2.
11. Shin S, Sung BJ, Cho YS, Kim HJ, Ha NC,
Hwang JI, Chung CW, Jung YK, Oh BH. Anti-apoptotic
protein human Survivin is direct inhibitor of caspase-3
and –7. Biochemistry 2001; 40: 1117–23.
12. Ambrosini G, Adida C, Altieri DC. A novel antiapoptosis gene, Survivin, expressed in cancer and lymphoma. Nature 1997; 3: 917–21.
13. Altieri DC, Marchisio PC, Marchisio C. Survivin
apoptosis: an interloper between cell death and cell proliferation in cancer. Lab Invest 1999; 79: 1327–33.
14. Tang FQ, Wang H, Yin L, Tang M, Gu HH, Deng XY,
Cao Y. Epstein—Barr virus triggers expression of apoptosis protein Survivin via NFkB and AP-1 signaling pathway in nasopharyngeal carcinoma. Exp Oncol 2003; 25: 28–32.
15. Chen J, Wu W, Tahir SK, Kroeger PE, Rosenberg SH, Cowsert LM, Bennett F, Krajewski S, Krajewska M, Welsh K, Reed JC, Ng SC. Down-regulation
of Survivin by antisense oligonucleotides increases apoptosis, inhibits cytokines and anchorage-independent growth.
Neoplasia 2000; 30: 235–41.
16. Zhu HC, Yao KT, Li GY, Cao Y. The establishment
and biological characteristic of four nasopharyngal carcinoma
cell lines. Bull Hunan Med Univ 1992; 17: 103–7.
Experimental Oncology 27, 96-101, 2005 (June)
17. Liao W, Yi H, Li X Y, Cao Y. Doxycycline dependent expression of Epstein—Barr virus latent membrane
protein 1 with Tet regulating system in nasopharyngeal
carcinoma cell line. Acta Biochem Biophys Sina 1998;
31: 309–12.
18. Chakrbarti R. Electroporation of antibodies into
mammalian cells. In: Cell Biology: a Laboratory Handbook. Acad Press, 1994.
19. Suzuki A, Hayashida M, Ito T, Kawano H, Nakano
T, Miura M, Akahane K, Shiraki K. Survivin initiates cell
cycle by the competitive interaction with Cdk4/p16IKK49 and
Cdk2/Cycline E complex activation. Oncogene 2000;
19: 3225–34.
20 Rickinson AB, Kieff E. Epstein—Barr virus. In:
Fields virology. 3rd ed Field BN, Knipe DM, Howley PM,
eds. Philadelphia: Lippincott-Rowen Publishers, 1996;
2397–446.
21. Kaye KM, Izumi KM, Li H, Johannsen E, Davidson D, Longnecker R, Kieff E. An Epstein-Barr virus
that expresses only the first 231 LMP1 amino acid efficiently initiates primary B-lymphocyte growth transformation. J Virol 1999; 73: 10525–30.
22. Tsao SW, Tramoutanis G, Dawson CW, Lo AK,
Huang DP. The significance of LMP1 expression in nasopharyngeal carcinoma. Semin Cancer Biol 2002; 12: 473–87.
23. Dawson CW, Eliopoulos AG, Blake SM, Barker R,
Young LS. Identification of functional differences between
prototype Epstein—Barr virus-encoded LMP1 and a nasopharyngeal carcinoma-derived LMP1 in human epithelial cells. Virology 2000; 272: 204–17.
24. Sylla BS, Hung SC, Davidson DM, Hatzivassiliou
E, Malinin NL, Wallach D, Gilmore TD, Kieff E, Mosialos
G. Epstein—Barr virus-transforming protein latent infection
membrane protein 1 activates transcription factor NFkB
through a pathway that includes the NF-kappa B-inducing
kinase and the I-kappa B kinases IKK alpha and IKK beta.
Proc Natl Acad Sci USA 1998, 95: 10106–11.
25. Luftig M, Yasui T, Soni V, Kang MS, Jacobson N,
Cahir-McFarland E, Seed B, Kieff E. Epstein—Barr virus
latent infection membrane protein 1 TRAF-binding site induces NIK/IKK alpha-dependent noncanonical NF-kappa B
activation. Proc Natl Acad Sci USA 2004; 101: 141–6.
26. Eliopoulos AG, Waites ER, Blake SM, Davies C,
Murray P, Young LS. TRAF1 is a critical regulator of
JNK signaling by the TRAF-binding domain of the Epstein—Barr virus-encoded latent infection membrane protein 1 but not CD40. J Virol 2003; 77: 1316–28.
27. Hatzivassiliou E, Mosialos G. Cellular signaling
pathways engaged by the Epstein—Barr virus transforming protein LMP1. Front Biosci 2002; 7: d319–29.
28. Ito T, Shiraki K, Sugimoto K, Yamanaka T,
Fujikawa K, Ito M. Survivin promotes cell proliferation
in human hepatocellular carcinoma. Hepatology 2000;
31: 1080–5.
29. Yang JH, Zhang YC, Qian HQ. Survivin antisense oligodeoxynucleotide inhibits growth of gastric cancer cells. World J Gastroenterol 2004; 8: 1121–4.
30. Tamm I, Wang Y, Sausville E, Scudiero DA,
Vigna N, Oltersdorf T, Reed JC. IAP-family protein Survivin inhibits caspase activity and apoptosis induced by Fas
(CD95), Bax, Caspases, and anticancer drugs. Cancer Res
1998; 58: 5315–20.
Experimental Oncology 27, 96-101, 2005 (June)
101
ÈÍÈÖÈÀÖÈß ÏÐÎËÈÔÅÐÀÖÈÈ È ÈÍÃÈÁÈÐÎÂÀÍÈÅ ÀÏÎÏÒÎÇÀ
 ÊËÅÒÊÀÕ ÊÀÐÖÈÍÎÌÛ ÍÎÑÎÃËÎÒÊÈ ×ÅËÎÂÅÊÀ ÁÅËÊÎÌ
LMP1, ÊÎÄÈÐÓÅÌÛÌ ÂÈÐÓÑÎÌ ÝÏØÒÅÉÍÀ — ÁÀÐÐ,
ÎÏÎÑÐÅÄÓÞÒÑß ÑÓÐÂÈÂÈÍÎÌ
 íàøèõ ïðåäûäóùèõ èññëåäîâàíèÿõ áûëî ïîêàçàíî, ÷òî ëàòåíòíûé ìåìáðàííûé áåëîê LMP1, êîäèðóåìûé
âèðóñîì Ýïøòåéíà—Áàðð, ìîæåò èíèöèèðîâàòü ýêñïðåññèþ ñóðâèâèíà, êîòîðûé ÿâëÿåòñÿ èíãèáèòîðîì àïîïòîçà è ðåãóëÿòîðîì ìèòîçà. Öåëü: ïðîàíàëèçèðîâàòü ìåõàíèçìû, ñ ïîìîùüþ êîòîðûõ óêàçàííûå ýôôåêòû,
èíäóöèðóåìûå áåëêîì LMP1, îïîñðåäóþòñÿ ñèãíàëüíûìè êàñêàäàìè ñ ó÷àñòèåì ñóðâèâèíà. Ìåòîäû: â êà÷åñòâå ìîäåëè èñïîëüçîâàëè ëèíèþ êëåòîê êàðöèíîìû íîñîãëîòêè ÷åëîâåêà Tet-on LMP1 HNE2, ýêñïðåññèÿ LMP1
â êîòîðîé çàïóñêàåòñÿ ñ ïîìîùüþ òåòðàöèêëèíà. Ëîêàëèçàöèþ ñóðâèâèíà â êëåòêàõ îïðåäåëÿëè ìåòîäîì íåïðÿìîé èììóíîôëóîðåñöåíöèè è ìåòîäîì Âåñòåðí-áëîòòèíãà. Àïîïòîç è ïðîëèôåðàöèþ â êëåòêàõ ïîñëå ââåäåíèÿ â íèõ àíòèñìûñëîâûõ îëèãîíóêëåîòèäîâ, êîìïëåìåíòàðíûõ ïîñëåäîâàòåëüíîñòÿì ñóðâèâèíà, è àíòèòåë ê
ñóðâèâèíó, àíàëèçèðîâàëè ñ ïîìîùüþ ïðîòî÷íîé öèòîôëóîðîìåòðèè.  êëåòêàõ îïðåäåëÿëè òàêæå àêòèâíîñòü
êàñïàçû-3. Ðåçóëüòàòû: ïðè èíäóêöèè ýêñïðåññèè LMP1 â êëåòêàõ îáíàðóæèâàåòñÿ ïåðåìåùåíèå ñóðâèâèíà â
ÿäðî, ïîâûøàåòñÿ óðîâåíü ôîñôîðèëèðîâàíèÿ Rb, óâåëè÷èâàåòñÿ êîëè÷åñòâî êëåòîê, íàõîäÿùèõñÿ â S-ôàçå
öèêëà. Âûêëþ÷åíèå ñóðâèâèíà ñ ïîìîùüþ àíòèñìûñëîâûõ ïîñëåäîâàòåëüíîñòåé èëè àíòèòåë ïðèâîäèò ê óâåëè÷åíèþ êîëè÷åñòâà àïîïòîòè÷åñêèõ êëåòîê è àêòèâíîñòè êàñïàçû-3. Âûâîäû: LMP1 çàïóñêàåò ïåðåìåùåíèå
ñóðâèâèíà â ÿäðî êëåòîê, ÷òî âåäåò ê èíãèáèðîâàíèþ àïîïòîçà è ñòèìóëÿöèè ïðîëèôåðàöèè êëåòîê. Ýòè ýôôåêòû, çàïóñêàåìûå áåëêîì LMP1, îïîñðåäóþòñÿ ñèãíàëüíûìè êàñêàäàìè ñ ó÷àñòèåì ñóðâèâèíà.
Êëþ÷åâûå ñëîâà: âèðóñ Ýïøòåéíà—Áàðð, ëàòåíòíûé ìåìáðàííûé áåëîê LMP1, ñóðâèâèí, ïðîëèôåðàöèÿ, àïîïòîç,
êëåòêè êàðöèíîìû íîñîãëîòêè.
Copyright © Experimental Oncology, 2005