Source Journal of Immunology Short Communication Open Access Evidence of Fc Receptor Gene In an Invertebrate Michel Leclerc1* and Nicolas Kresdorn2 1 556 rue Isabelle Romée, Sandillon, France 2 GenXPro, Frankfurt, Germany *Corresponding author: Michel Leclerc, 556 rue Isabelle Romée, Sandillon, France, Tel: 02 38 41 02 09; E-mail: [email protected] Abstract Ig Kappa genes and complement genes were found in the sea star in the past. Recently, we discovered a "sea star IgKappa gene". More recently, we found an Ig epsilon Fc receptor gene, a Fab gene, when compared to mouse genome, in immunized and non-immunized sea stars to HRP.The aim of this paper is to come back on the existence of a primitive antibody in sea star: a primitive Ig antibody in invertebrates. Keywords: Invertebrate; Sea star; Fc receptor; Immunoglobulin; Primitive antibody Received: September 27, 2016 Accepted: November 11, 2016 Published: November 18, 2016 © 2016 Michel Leclerc et al; licensee Source Journals This is an open access article is properly cited and distributed under the terms and conditions of creative commons attribution license which permits unrestricted use, distribution and reproduction in any medium. Introduction Material and Methods Sea stars were obtained from the Biology Institute In 2011, it was striking to discover Kappa genes [1] in the transcriptome of Asterias rubens, when compared to mouse genome. Two years later we found complement genes [2] from C1 to C9. At last, we cloned a gene, with a SMART kit PCR cDNA synthesis (Clontech) [3] : the" sea star Igkappa gene" with two Ig sites, which lead to the synthesis of a primitive antibody: an anti-HRP antibody, by the use of a E.coli plasmid [4]. To date we find all these elements in immunized and nonimmunized sea stars to HRP (Horse- radish Peroxydase) and the emergence of low affinity Immunoglobulin epsilon Fc receptor, next to Fab gene [5], we describe (Gothenburgh University). Immunizations, genomic studies were already described [1]. After ligation of adapters for Illumina's GSII sequencing system, the cDNA was sequenced on the Illumina GSII platform sequencing. 1.100 bp from one side of the approximatey 200 bp fragments sequences were assembled using Velvet [6]. Results Low affinity Immunoglobulin epsilon Fc receptor appear in immunized and non-mmunized sea star genomes.Result with non-mmunized animals is given: now. One contig (Contig10847) could be annotated via Volume 1│Issue 1│2016 Page 1 of 3 © 2016 Michel Leclerc et al; licensee Source Journals. This is an open access article is properly cited and distributed under the terms and conditions of creative commons attribution license which permits unrestricted use, distribution and reproduction in any medium. BLASTX to Mus musculus "Isoform 3 of Low affinity GGGTCAGCTCATCTTCTTCAAACAGTACGTGGT immunoglobulin epsilon Fc receptor" CAACCACAGTACTGCCTAAACAACGGCCATCTC from the Swissprot database (FCER2_MOUSE), with an e-value TTCCGTGATGAATGCTTCTGGATTCCAGACGAT of 1.49e-11. On an aligned region of 118 amino acids, GTAGCACGCTGGGTCGATGCTGAACAGAAGTG 63 positive and 40 identical amino acids were found. CACTAAATACGAAGGCGCTAGGCTGGTCGCCA 5'TCCATTAGGGCAATGAGTGGGACTGCGCGGC TCACTGACCAAGAAATTAATGATTTTCTTACCG TTGGCACAGATCATCCCTTTTCTATCACGACAC ACCTAATTGACAGGGACGTGTGGATCGGGCTC CTCGAGTCTTTCCACTTGCCGTTGCTAATCTGTA CATGATACACACAACGAAAGCGATTGGAAATG ATGCCACACAGTTATTCTCCAATGATTCGACTC GTCAAACGATTCCCCCGTCAACTACACGAACTT CAGACAGCTCAGTTTGCTCTTCTTCGATGAAGT CATCGAAGAAGAGCAAACTGAGCTGTCTGGAG TCGTGTAGTTGACGGGGGAATCGTTTGACCATT TCGAATCATTGGAGAATAACTGTGTGGCATTAC TCCAATCGCTTTCGTTGTGTGTATCATGGAGCC AGATTAGCAACGGCAAGTGGAAAGACTCGAGG CGATCCACACGTCCCTGTCAATTAGGTCGGTAA TGTCGTGATAGAAAAGGGATGATCTGTGCCAA GAAAATCATTAATTTCTTGGTCAGTGATGGCGA GCCGCG3' CCAGCCTAGCGCCGTCGTATTTAGTGCACTTCT Discussion and Conclusion GTTCAGCATCGACCCAGCGTGCTACATCGTCTG Similar results were obtained with immunized and non- GAATCCAGAAGCATTCATCACGGAAGAGATGG immunized sea stars. In mouse, it is well-known that Fc CCGTTGTTTAGGCAGTACTGTGGTTGACCACGT receptor binds the antibody to the antigen. In this ACTGTTTGAAGAAGATGAGCTGACCCAATAAC interaction, antibody can regulate the immune response CATCATCATCACGAATGGAATCATTGTGAATTTG [7] through Fc receptor. In mouse the corresponding TTTGAGATACGTCCGATACGTCCGTCCGTAGAT antibody is an IgE. Fab gene was recently discovered GAAAAAACTGCCGAAGTCTCTCACATAATTCCA [5]. We have not found IgE gene in sea star genome but CCAGGCATTGTTGATGCCTTGCTGCTCTATGGTT exclusively Ig Kappa chains. To date all the elements GATGCTTGGTGGCAGTCCACGAAAGAATGTGC which composed an antibody are present in the sea star AGTTAGGGAAAGTCCAGCTTGTATATCTC3'' Asterias rubens and to be honnest a primitive We give now result with immunized sea star genome, invertebrate antibody. when Reference compared to mouse genome:One contig (Contig1930|m.5483) could be annotated via BLASTX to Mus musculus "Isoform 3 of Low immunoglobulin epsilon Fc receptor" affinity from the Swissprot database (FCER2_MOUSE), with an e-value of 7.98e-12. On an aligned region of 118 amino acids, 64 positive and 40 identical amino acids were found. 5'TATACAAGCTGGACTTTCCCTAACTGCACATT CTTTCGTGGACTGCCACCAAGCATCAACCATAG AGCAGCAAGGCATCAACAATGCCTGGTGGAAT TATGTGAGAGACTTCGGCAGTTTTTTCATCTAC GGACGGACGTATCGGACGTATCTCGAACAAATT CACAATGATTCCATTCGTGATGATGATGGTTATT Volume 1│Issue 1│2016 1) Leclerc M, Dupont S, Ortega-Martinez O, Hernroth B, Krezdorn N, et al. (2011) Evidence of Kappa genes in the sea-star Asterias rubens (Echinoderma). Immunol.Lett 138: 197-198. 2) Leclerc M, et al. (2013) Immunol.Lett 151: 68-70. 3) Vincent N, et al. (2014) Meta Gene 2: 320-322. 4) Leclerc M, et al. (2014) SAJ.Biotechnology 1: 104. 5) Leclerc M, et al. (2016) Clinical and Trials 2 (4): 188189. 6) Zerbino DR, et al. (2007) Gen.Res 18: 821-829. 7) Nimmerjahn F, et al. (2008) Nature Reviews Immunology 8: 34-47. Page 2 of 3 © 2016 Michel Leclerc et al; licensee Source Journals. This is an open access article is properly cited and distributed under the terms and conditions of creative commons attribution license which permits unrestricted use, distribution and reproduction in any medium. Submit your next manuscript to Source Journals and take full advantage of Convenient online submission Thorough peer review No space constraints or colour figure charges Immediate publication on acceptance Research which is freely available for redistribution Submit your manuscript at Volume 1│Issue 1│2016 http://sourcejournals.com/submit-manuscript/ (or) mail to [email protected] Page 3 of 3
© Copyright 2026 Paperzz