This information is current as
of June 14, 2017.
Cutting Edge: Combined Treatment of TNFα and IFN-γ Causes Redistribution of
Junctional Adhesion Molecule in Human
Endothelial Cells
Harunobu Ozaki, Kenji Ishii, Hisanori Horiuchi, Hidenori
Arai, Takahiro Kawamoto, Katsuya Okawa, Akihiro
Iwamatsu and Toru Kita
J Immunol 1999; 163:553-557; ;
http://www.jimmunol.org/content/163/2/553
Subscription
Permissions
Email Alerts
This article cites 18 articles, 10 of which you can access for free at:
http://www.jimmunol.org/content/163/2/553.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 1999 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
References
●
Cutting Edge: Combined Treatment of
TNF-a and IFN-g Causes
Redistribution of Junctional Adhesion
Molecule in Human Endothelial Cells1
Harunobu Ozaki,* Kenji Ishii,2* Hisanori Horiuchi,*
Hidenori Arai,* Takahiro Kawamoto,*
Katsuya Okawa,† Akihiro Iwamatsu,† and Toru Kita*
(PECAM-1) from intercellular junctions. PECAM-1 is a member
of the Ig superfamily and is required for TEM (5– 6). Therefore,
the reduction of adhesion molecules also might play important
roles in TEM of leukocytes.
Recently, the junctional adhesion molecule (JAM), a novel
member of the Ig gene superfamily, was identified and shown to be
constitutively expressed at intercellular junctions of ECs (7). Padura et al. suggested that JAM might play a role in monocyte
transmigration because anti-JAM mAb inhibited monocyte TEM
in vitro and monocyte infiltration by chemokine in vivo. However,
the effects of proinflammatory cytokines on JAM remain
unknown.
In this study, we cloned human and bovine homologues of JAM
independently from Padura et al. and investigated the effects of
TNF-a and IFN-g on JAM in human ECs. We demonstrate that the
treatment with TNF-a plus IFN-g induces redistribution of JAM
on the cell surface. This redistribution might play an important role
in regulating TEM of leukocytes in inflammation.
Materials and Methods
roinflammatory cytokines, such as TNF-a and IFN-g increase the expression of cell adhesion molecules, such as
ICAM-1 and VCAM-1, in endothelial cells (ECs)3 and
promote the transendothelial migration (TEM) of leukocytes (1–3).
However, when those two cytokines were added in combination,
TEM paradoxically decreased (4). This phenomenon was accompanied by the disappearance of platelet EC adhesion molecule-1
P
*Department of Geriatric Medicine, Graduate School of Medicine, Faculty of Medicine, Kyoto University, Kyoto, Japan; and †Central Laboratories for Key Technology, Kirin Brewery, Yokohama, Japan
Received for publication March 11, 1999. Accepted for publication April 26, 1999.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This study was supported by the Ministry of Education, Science, Sports, and Culture, Research Grants 09281104 and 09044293, the Takeda Medical Research Foundation (1998, 1999), and the HMG-CoA Reductase Research Foundation.
2
Address correspondence and reprint requests to Dr. Kenji Ishii, Department of Geriatric Medicine, Graduate School of Medicine, Faculty of Medicine, Kyoto University, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. E-mail address:
[email protected]
Cell culture and preparation
HUVECs were isolated, cultured, and used at passage 2 to eliminate detachment or retraction as described (4). Bovine arterial ECs were prepared
as described previously (8).
Cloning of human, bovine, and murine JAM cDNAs
During purifying a novel membrane-associated protease in bovine aortic
ECs, we purified a 40-kDa protein as a by-product, and the amino acid
sequence was determined (9). One of the peptide sequences matched genes
in expression sequence tag (EST) data banks (Fig. 1). An oligonucleotide
primer (gtcccatacccattccgtgcctc) was designed based on the human EST
clone AA152150, and RT-PCR was performed using the human placental
cDNA library (Marathon-Ready cDNA; Clontech, Palo Alto, CA). A single
clone was obtained and subjected to nucleotide sequence analysis. A human colon EC line cDNA library (Stratagene, La Jolla, CA) was screened
with the human cDNA fragment, and the positive clones were sequenced.
A mouse 7-day embryo cDNA library (Clontech) was screened with EST
clone AA561790, and a bovine aortic EC cDNA library (Stratagene) was
screened with murine cDNA. Nucleotide sequencing was performed by
dideoxy method (Prism 310, Applied Biosystems, Foster City, CA).
Abs
3
Abbreviations used in this paper: ECs, endothelial cells; ECD, extracellular domain;
EST, expression sequence tag; JAM, junctional adhesion molecule; PECAM-1, platelet endothelial cell adhesion molecule-1; TEM, transendothelial migration; CHO, Chinese hamster ovary.
Copyright © 1999 by The American Association of Immunologists
●
Rabbit Ab against the human JAM extracellular domain (ECD) (JAM
(ECD)) was generated by immunizing rabbits with bacterial fusion protein
0022-1767/99/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Proinflammatory cytokines such as TNF-a and IFN-g induce
cell adhesion molecules in endothelial cells and promote transmigration of leukocytes across endothelial cells. However,
when those two were administered together, leukocyte transmigration paradoxically decreased. We cloned a human and
bovine homologue of the junctional adhesion molecule (JAM),
a novel molecule at the tight junction, and examined the effects
of proinflammatory cytokines on JAM in HUVECs. The combined treatment of TNF-a plus IFN-g caused a disappearance
of JAM from intercellular junctions. However, flow cytometry,
cell ELISA, and subcellular fractionation analysis demonstrated that the amount of JAM was not reduced. This suggested that JAM changed its distribution in response to proinflammatory cytokines. This redistribution of JAM might be
involved in a decrease in transendothelial migration of leukocytes at inflammatory sites. The Journal of Immunology,
1999, 163: 553–557.
554
CUTTING EDGE
Cell ELISA
HUVECs fixed with 4% paraformaldehyde were incubated with antiVCAM-1 mAb (10C9), anti-JAM (3D8), or each isotype-matched control
IgG followed by HRP-conjugated anti mouse Ab (Amersham-Pharmacia,
Piscataway, NJ). The HRP activity was detected by development with tetramethylbenzidine (Dako, Carpinteria, CA). OD was measured at A450 nm.
Fractionation of cell-surface proteins
Cell-surface proteins were biotin labeled with 1 mg/ml NHS-sulfo-biotin
(Pierce, Rockford, IL) as described by Yip et al. (11). For fractionation of
biotinylated cell-surface proteins from intracellular proteins, postnuclear
supernatants were bound to streptavidin-agarose (Sigma, St. Louis, MO).
The bound proteins were washed with Triton lysis buffer (20 mM Tris, pH
7.4, 10 mM EDTA, 1% Triton X-100, and protease inhibitors), and eluted
into SDS sample buffer. The same amount of proteins (v/v) from the initial
total-cell lysate, the eluate from streptavidin-beads (biotinylated surface
proteins), and the flow through (unbiotinylated proteins) were then subjected to Western blot analysis. Protein concentration was determined by
the Bradford method.
Cloning of human, bovine, and murine JAM
FIGURE 1. Deduced amino acid sequences of cDNA clones encoding
the human, bovine, and murine JAM. Conserved cysteine residues are
boxed. Putative N-glycosylation sites are printed by boldface type and are
indicated by a triangle. The amino acid sequence that was detected in the
EST clone was underlined. Putative phosphorylation sites are printed by
boldface type and are indicated by an asterisk. The transmembrane domain
is indicated by vertical blankets. Dashes indicate insertions to maximize
homology. (GenBank accession number of human JAM, AF111713; bovine JAM, AF111714)
GST-JAM (ECD). Rabbit Ab against the human JAM cytoplasmic domain
was generated by immunizing rabbits with a synthetic peptide, CSQPSAR
SEGEFKQ. These Abs recognized JAM transiently expressed in Chinese
hamster ovary (CHO) cells by Western blot and immunofluorescence microscopy. Mouse mAb against the human JAM (ECD), designated 3D8,
was raised against JAM (ECD):IgG1 hinge fusion protein (10) and
screened by cell ELISA against the stable CHO cell line that expresses
human JAM.
Other Abs were obtained from Santa Cruz Biotechnology (Santa Cruz,
CA) if not described.
Immunofluorescence microscopy
Cultured cells were fixed with 4% paraformaldehyde in PBS and blocked
with 2% goat serum and 0.1% BSA in PBS. For staining in a nonpermeabilized condition, fixed cells were incubated with anti-JAM (ECD), antiPECAM-1 mAb (158-2B3; Neo Markers, Union City, CA), anti-VCAM-1
mAb (10C9; PharMingen, San Diego, CA) followed by Alexa 488-conjugated secondary Abs (Molecular Probes, Eugene, OR). For staining in permeabilized conditions, paraformaldehyde-fixed cells were permeabilized
with 0.1% Triton X-100 in PBS and then incubated with anti-JAM (3D8)
followed by Alexa 488-conjugated secondary Ab and phalloidin-rhodamine (Molecular Probes).
Flow cytometry
HUVECs were dispersed by PBS with 1 mM EDTA, washed with PBS
containing 1% BSA, and stained with rabbit anti-JAM (ECD), antiPECAM-1 mAb 158-2B3, anti-VCAM-1 mAb 10C9, or anti-JAM (3D8)
for 1 h at 4°C followed by incubating with Alexa 488-labeled secondary
Abs. Flow cytometry was performed by using FACS (FACS Vantage; Becton Dickinson, Mountain View, CA).
Microsequensing analysis of a 40-kDa protein from bovine aortic
ECs revealed an amino acid sequence of five peptides. We
searched EST banks for cDNA homology deduced from the peptides and found three sequences (AA564790, AA152150, and
AA304161) that were homologous to one of the sequences. Based
on these sequences, we cloned human, bovine, and murine fulllength cDNAs as described in Materials and Methods.
The degrees of identity at the amino acid level among human
and the corresponding bovine or murine clones were 75% and
68%, respectively (Fig. 1). The amino acid sequence of the murine
clone was identical with that of a recently identified murine adhesion molecule, JAM, except one amino acid (268 Thr3 Arg) (7).
Therefore, we concluded that the cDNAs were human and bovine
homologues of murine JAM.
JAM disappears from intercellular junctions of HUVECs treated
with TNF-a plus IFN-g in combination
We examined the localization of JAM and the effects of inflammatory cytokines on the distribution of JAM in HUVECs. HUVECs were treated with 100 U/ml TNF-a and 200 U/ml IFN-g,
separately or in combination (4, 12–13), and the localization of
JAM was examined by immunofluorescence microscopy with antiJAM (ECD). In untreated HUVECs, most of the JAM was expressed at intercellular junctions (Fig. 2Aa). In contrast, in TNFa-treated HUVECs, JAM was stained less intensively at
intercellular junctions (Fig. 2Ab). IFN-g also slightly reduced the
JAM expression (Fig. 2Ac). In a sharp contrast, after treatment
with TNF-a plus IFN-g in combination, JAM was almost completely disappeared from intercellular junctions, which was accompanied with elongated morphology of ECs (12) (Fig. 2Ad). The
disappearance of JAM occurred as early as 8 h after cytokine treatment (data not shown). We also found that this phenomenon is
reversible 48 h after replacement of the medium (data not shown).
The same combination of cytokine treatment also markedly reduced PECAM-1 expression from intercellular junctions (Fig. 2A,
e and f) (4, 14). In contrast, VCAM-1 expression was markedly
induced by the same treatment of HUVECs (Fig. 2A, g and h) (3).
These results indicated that JAM disappeared from intercellular
junctions by the treatment with the combination of TNF-a plus
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Results
The Journal of Immunology
555
FIGURE 2. Localization of JAM in HUVEC treated with inflammatory
cytokines. A, HUVECs were either untreated (a, e, g) or treated with 100
U/ml TNF-a for 24 h (b), 200 U/ml IFN-g for 24 h (c), or 100 U/ml TNF-a
plus 200 U/ml IFN-g for 24 h (d, f, h). HUVECs were fixed and stained in
a nonpermeabilized condition for JAM (a, b, c, d) with anti-JAM (ECD)
and PECAM-1 (e, f) with mAb 158-2B3 and VCAM-1 (g, h) with 51-10C9
and followed by Alexa 488-cojugated secondary Ab against rabbit or
mouse IgG. B, HUVECs were either untreated (a, b) or treated with 100
U/ml TNF-a plus 200 U/ml IFN-g for 24 h (c, d). Fixed HUVECs were
permeabilized and stained for JAM with anti-JAM mAb 3D8 followed by
Alexa 488-cojugated secondary Ab and for F-actin with rhodamine-conjugated phalloidin. Fluorescence for JAM (a, c) and F-actin (b, d) was
detected. Note that the intensity of the immunofluorescence signal of JAM
and PECAM-1 always seemed more intensive in overlapped areas of elongated HUVECs than in nonoverlapped areas (original magnification,
3400).
contrast, VCAM-1 expression was clearly increased by TNF-a
and/or IFN-g. Furthermore, prolonged treatment with TNF-a plus
IFN-g for up to 48 h did not change the cell-surface JAM expression (data not shown). FACS analysis using anti-JAM mAb (3D8)
showed a comparable result with that using anti-JAM (ECD) (data
not shown). The results of Figs. 2 and 3 suggested that the cytokine
treatment might have changed the structure of intercellular junctions so that Abs could not reach. Therefore, to determine whether
JAM is still present at intercellular junctions or changed its distribution to cell surface, JAM on the cell surface was determined by
cell ELISA (Fig. 4). The expression of JAM in HUVECs after the
treatment was almost equal to that in untreated cells (Fig. 4A). In
contrast, VCAM-1 expression was clearly increased by the same
treatment (Fig. 4B).
IFN-g. Double staining with anti-JAM mAb (3D8) and rhodamineconjugated phalloidin demonstrated that a rearrangement of actin
fibers was also induced by TNF-a plus IFN-g (Fig. 2B) (12). This
result also indicated that a change in fluorescence staining is not
because of any loss or change in the endothelial monolayer.
TNF-a and/or IFN-g treatment did not change the amount of
JAM on the cell surface of HUVECs
Next, to examine whether the amount of JAM on the cell surface
is reduced in response to the cytokine treatment, we performed
FACS analysis (Fig. 3). Unexpectedly, the expression of JAM and
PECAM-1 was not decreased after the same cytokine treatment. In
FIGURE 4. Cell ELISA of cytokines-treated HUVECs. Cell-surface expression of JAM (A) and VCAM-1 (B) on HUVECs under a baseline condition or after the treatment with 100 U/ml TNF-a and 200 U/ml IFN-g for
24 h were assessed by cell ELISA. Each experiment was performed in
triplicate.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 3. FACS of cytokines-treated HUVECs. Cell-surface expression of JAM, PECAM-1, and VECAM-1 on HUVECs under a baseline
condition or treated with 100 U/ml TNF-a, 200 U/ml IFN-g, and 100 U/ml
TNF-a plus 200 U/ml IFN-g were assessed by FACS.
556
Neither subcellular localization nor total amount of JAM was
affected by TNF-a and/or IFN-g treatment
The results of immunofluorescence microscopy, FACS, and cell
ELISA indicated that JAM loses localization at intercellular junctions and redistributes on the cell surface by proinflammatory cytokines similarly to PECAM-1 (14). Therefore, to confirm this, we
examined the change in the amount of JAM in the cell surface and
intracellular fractions by cell-surface biotinylation and separating
them from intracellular proteins with avidin-agarose (Fig. 5A).
Western blotting revealed that JAM was predominantly distributed
in the cell-surface fraction of unstimulated ECs. In contrast,
extracellular signal-regulated kinase was exclusively localized in
the intracellular fraction (15) and PECAM-1 was detected in both
fractions (16).
Next, to examine whether subcellular localization of JAM was
changed by the cytokine treatment, the same numbers of surfacebiotinylated HUVECs with or without the combined cytokine
treatment were subjected to subcellular fractionation (Fig. 5B).
The amount of JAM and PECAM-1 on the cell surface was not
changed, whereas VCAM-1 was markedly increased in both fractions after the treatment.
Discussion
In this study, we cloned human and bovine JAM and demonstrated
that the combined treatment of TNF-a plus IFN-g caused redistribution of JAM as well as PECAM-1. JAM disappeared from
intercellular junctions of HUVECs by immunofluorescence microscopy (Fig. 2). However, flow cytometry, cell ELISA, and subcellular fractionation analysis showed that the amount of JAM on
the cell surface was not changed by the treatment (Figs. 3–5).
Therefore, we concluded that JAM changed its distribution on the
cell surface by the treatment, and we suggest that the redistribution
of JAM might play a role in decreasing TEM of leukocytes.
Inflammatory cytokines are known to play pivotal roles in TEM
of leukocytes by inducing several cell adhesion molecules in ECs.
For example, Bradley et al. reported that prolonged treatment of
HUVECs with TNF-a causes induction of VCAM-1, ICAM-1 and
-2, b1 and b3 integrins, and redistribution of them from the apical
surface to intercellular junctions (17). The authors speculated that
the expression of cell adhesion molecules on the apical surface
might first facilitate attachment to ECs and subsequently redistribution to cell junctions might enhance transmigration. Interestingly, however, when ECs were treated with TNF-a plus IFN-g in
combination, this increase in TEM of leukocytes was almost nullified (Ref. 4 and our unpublished observation). The authors have
shown that this phenomenon correlates with a decrease of PECAM-1 at intercellular junctions. The mechanisms of a decrease of
PECAM-1 at intercellular junctions by TNF-a plus IFN-g have
been controversial. Rival et al. has reported that this decrease is
due to the inhibition of synthesis (4), while Romer et al. has shown
that PECAM-1 redistributed from the junction to the cell surface
(14). Our results of flow cytometry, cell ELISA, and cell-surface
fractionation gave evidence to support the latter report.
Here, we demonstrated that a new member of the Ig gene superfamily, JAM, is also regulated by inflammatory cytokines.
TNF-a or IFN-g alone caused slight redistribution of JAM in HUVECs (Figs. 2 and 3), and combination of those two markedly
induced the redistribution of JAM as well as PECAM-1. Given that
JAM is localized at intercellular junctions and involved in TEM, it
is conceivable that the redistribution of JAM also contributes to
negative regulation of transmigration of leukocytes in addition to
PECAM-1. Based on our study, we propose a novel family of cell
adhesion molecule consisting of JAM and PECAM-1 that are involved in negative regulation of leukocyte TEM. Both molecules
are predominantly expressed at intercellular junctions of ECs (6, 7)
and redistribute in response to proinflamatory cytokines. However,
different sublocalization in intercellular junctions, JAM at an apical side (7) and PECAM-1 at a basolateral side (18), suggests their
different roles in TEM. Further study will help to reveal the physiological significance of JAM in vivo.
Acknowledgments
We thank Dr. Brian Seed for the plasmid pCd5lneg1 that was used to
generate JAM (ECD):IgG1 hinge fusion protein, Dr. Noriaki Kume for
helpful discussion, and Xiaoming Hu and Yukio Ohshima for excellent
technical assistance.
References
1. Bevilacqua, M. P., J. S. Pober, D. L. Mendrick, R. S. Cotran, and
M. A. Gimbrone, Jr. 1987. Identification of an inducible endothelial-leukocyte
adhesion molecule. Proc. Natl. Acad. Sci. USA 84:9238.
2. Dustin, M. L., R. Rothlein, A. K. Bhan, C. A. Dinarello, and T. A. Springer. 1986.
Induction by IL 1 and interferon-g: tissue distribution, biochemistry, and function
of a natural adherence molecule (ICAM-1). J. Immunol. 137:245.
3. Osborn, L., C. Hession, R. Tizard, C. Vassallo, S. Luhowskyj, G. Chi-Rosso, and
R. Lobb. 1989. Direct expression cloning of vascular cell adhesion molecule 1,
a cytokine-induced endothelial protein that binds to lymphocytes. Cell 59:1203.
4. Rival, Y., A. Del Maschio, M. J. Rabiet, E. Dejana, and A. Duperray. 1996.
Inhibition of platelet endothelial cell adhesion molecule-1 synthesis and leukocyte transmigration in endothelial cells by the combined action of TNF-a and
IFN-g. J. Immunol. 157:1233.
5. Newman, P. J., M. C. Berndt, J. Gorski, G. C. D. White, S. Lyman, C. Paddock,
and W. A. Muller. 1990. PECAM-1 (CD31) cloning and relation to adhesion
molecules of the immunoglobulin gene superfamily. Science 247:1219.
6. Newman, P. J. 1997. The biology of PECAM-1. J. Clin. Invest. 99:3.
7. Martin-Padura, I., S. Lostaglio, M. Schneemann, L. Williams, M. Romano,
P. Fruscella, C. Panzeri, A. Stoppacciaro, L. Ruco, A. Villa, D. Simmons, and
E. Dejana. 1998. Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates
monocyte transmigration. J. Cell Biol. 142:117.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 5. A, Separation of cell-surface and intracellular proteins. HUVECs were biotinylated, and the postnuclear extracts were adsorbed with
streptavidin-agarose. The same amount of proteins (v/v) from the initial
total cell lysate (T), the eluate from streptavidin-beads (cell-surface proteins; CS), and the flow through (intracellular proteins; IC) were then subjected to Western blot with anti-JAM (ECD) (lanes 1–3), anti-PECAM-1
(lanes 4 and 5), and anti-ERK Abs (lanes 6 and 7). As rabbit anti-ERK1 Ab
cross-reacts with ERK2, two bands were recognized (arrowheads: upper,
ERK1; lower, ERK2). B, TNF-a plus IFN-g did not change the subcellular
localization of JAM. HUVECs with or without treatment of TNF-a plus
IFN-g were subjected to cell-surface biotinylation followed by fractionation with avidin-agarose as described in A. The equal amount of protein
(v/v) was analyzed by Western blot with a rabbit Ab against human JAM
cytoplasmic domain (lanes 1– 4), anti-PECAM-1 Ab (lanes 5– 8), and antiVCAM-1 Ab (lanes 9 –12).
CUTTING EDGE
The Journal of Immunology
8. Ozaki, H., K. Ishii, H. Arai, N. Kume, and T. Kita. 1999. Lysophosphatidylcholine activates mitogen-activated protein kinases by a tyrosine kinase-dependent
pathway in bovine aortic endothelial cells. Atherosclerosis 143:261.
9. Welch, M. D., A. Iwamatsu, and T. J. Mitchison. 1997. Actin polymerization is
induced by Arp2/3 protein complex at the surface of Listeria monocytogenes.
Nature 385:265.
10. Zettlmeissl, G., J.-P. Gregersen, J. M. Duport, S. Mehdi, G. Reiner, and B. Seed.
1990. Expression and characterization of human CD4: immunoglobulin fusion
proteins. DNA Cell Biol. 9:347.
11. Yip, J. W., W. H. Ko, G. Viberti, R. L. Huganir, M. Donowitz, and C. M. Tse.
1997. Regulation of the epithelial brush border Na1/H1 exchanger isoform 3
stably expressed in fibroblasts by fibroblast growth factor and phorbol esters is
not through changes in phosphorylation of the exchanger. J. Biol. Chem. 272:
18473.
12. Stolpen, A. H., E. C. Guinan, W. Fiers, and J. S. Pober. 1986. Recombinant tumor
necrosis factor and immune interferon act singly and in combination to reorganize
human vascular endothelial cell monolayers. Am. J. Pathol. 123:16.
557
13. Saegusa, Y., M. Ziff, L. Welkovich, and D. Cavender. 1990. Effect of inflammatory cytokines on human endothelial cell proliferation. J. Cell. Physiol. 142:
488.
14. Romer, L. H., N. V. McLean, H. C. Yan, M. Daise, J. Sun, and H. M. DeLisser.
1995. IFN-g and TNF-a induce redistribution of PECAM-1 (CD31) on human
endothelial cells. J. Immunol. 154:6582.
15. Gonzalez, F. A., A. Seth, D. L. Raden, D. S. Bowman, F. S. Fay, and R. J. Davis.
1993. Serum-induced translocation of mitogen-activated protein kinase to the cell
surface ruffling membrane and the nucleus. J. Cell Biol. 122:1089.
16. Goldberger, A., K. A. Middleton, J. A. Oliver, C. Paddock, H. C. Yan,
H. M. DeLisser, S. M. Albelda, and P. J. Newman. 1994. Biosynthesis and processing of the cell adhesion molecule PECAM-1 includes production of a soluble
form. J. Biol. Chem. 269:17183.
17. Bradley, J. R., and J. S. Pober. 1996. Prolonged cytokine exposure causes a
dynamic redistribution of endothelial cell adhesion molecules to intercellular
junctions. Lab. Invest. 75:463.
18. Ayalon, O., H. Sabanai, M. G. Lampugnani, E. Dejana, and B. Geiger. 1994.
Spatial and temporal relationships between cadherins and PECAM-1 in cell-cell
junctions of human endothelial cells. J. Cell Biol. 126:247.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017