© 7995 Oxford University Press
Human Molecular Genetics, 1995, Vol. 4, No. 2
269-273
Missense mutation (G480C) in the CFTR gene
associated with protein mislocalization but normal
chloride channel activity
Lisa S.Smtt*, Theresa V.Strong, Daniel J.Wilkinson1, Milan Macek Jr2, Monique K.Mansoura3, Deborah L.Wood,
Jeffery L.Cole, Garry R.Cuttlng2, Jonathan A.Cohn4, David C.Dawson1 and Francis S.Colllns+
Departments of Human Genetics and 'Physiology, University of Michigan, Ann Arbor, Ml 48109, 2Center for Medical Genetics, Johns Hopkins
University, Baltimore, MD 21287-3914, 3Bioengineenng Program, University of Michigan, Ann Arbor, Ml 48109 and 4Duke University, Durham,
NC 27710, USA
Received September 22, 1994, Revised and Accepted November 18, 1994
INTRODUCTION
Cystic fibrosis (CF) is a common autosomal recessive genetic
disease, primarily affecting the lungs, pancreas, intestine, and
sweat glands. The gene that is mutated in CF patients encodes
the cystic fibrosis transmembrane conductance regulator
(CFTR), a membrane protein that functions as a cAMP
activated Cl" channel. Over 400 mutations have been detected
in the gene encoding CFTR, including the most common
mutation, a 3 bp deletion that results in the loss of phenylalanine
508 (AF508) (1; Cystic Fibrosis Genetic Analysis Consortium,
personal communication). Mutations can be classified according to their effect on the CFTR protein (2). One class of
mutations, exemplified by AF508, results in failure of the
encoded protein to traffic to the cell membrane. Such mutants
were first identified because they are not fully glycosylated
(3-5), consistent with the retention of the protein in the
endoplasmic reticulum (ER). The AF508 mutation was subsequently demonstrated to be retained in the ER (5), resulting
in a severe reduction or absence of CFTR at the plasma
membrane (6-8). Presumably, this is true for other missense
mutations that result in proteins that are not fully glycosylated.
Thus, glycosylation can serve as a marker for the progress of
CFTR through the biosynthetic pathway. Based on experimental evidence for CFTR (5) and for other proteins (9), it is
likely that this class of CF mutations disrupts folding of CFTR
so that the abnormal protein is detected by cellular quality
control mechanisms and degraded. Mutant CFTR proteins in
this class can be rescued, in part, by shifting the cells to a
lower temperature (23-30°C; 6,10). In this environment some
of the mutant protein becomes fully glycosylated and is
properly trafficked to the cell membrane.
Some CFTR mutations also result in proteins that are
defective in Cl" channel activity. Some NBF missense
mutations are associated with a decreased sensitivity to activation by experimental maneuvers which raise the intracellular
cAMP levels (11,12) or decreased sensitivity to cytosolic ATP
(13). Other missense mutations in the transmembrane domains
are associated with a reduced single channel conductance (14).
Some CFTR variants, such as G551D, are purely functional
mutants while others, such as AF508, not only exhibit a
processing defect but also possess a demonstrated functional
defect when assayed under temperature conditions which allow
the protein to reach the plasma membrane. However, no mutant
has been previously reported in which the defect lies solely
in misfolding and mislocalization of an otherwise normally
functioning protein.
In this report we describe a glycine to cysteine substitution
at amino acid 480 (G480C), which is associated with a
mislocalized protein in mammalian cells cultured at 37°C but
*To whom correspondence should be addressed at present address: Department of Physiology, University of Michigan, Ann Arbor, MI 48109-0622, USA
+
To whom reprint requests should be addressed at present address: National Center for Human Genome Research, National Institutes of Health, Building 38A,
Room 605, Bethesda, MD 20892, USA
Downloaded from http://hmg.oxfordjournals.org/ at Pennsylvania State University on September 19, 2016
We have identified a novel CFTR missense mutation
associated with a protein trafficking defect in mammalian cells but normal chloride channel properties in a
Xenopus oocyte assay. The mutation, a cystelne for
glycine substitution at residue 480 (G480C), was
detected in a pancreatic insufficient, African-American, cystic fibrosis (CF) patient. G480C was found
on one additional CF chromosome and on none of 220
normal chromosomes, including 160 chromosomes
from normal African-American individuals. Western
blot analysis and immunofluorescence studies
revealed that, in 293T cells, the encoded mutant
protein was not fully glycosylated and failed to reach
the plasma membrane, suggesting that the G480C
protein was subject to defective Intracellular processing. However, in Xenopus oocytes, a system
in which mutant CFTR proteins are less likely to
experience an intracellular processing/trafficking
deficit, expression of G480C CFTR was associated
with a chloride conductance that exhibited a sensitivity to activation by forskolin and 3-isobutyl-1-methylxanthine (IBMX) that was similar to that of wild-type
CFTR. This appears to be the first Identification of a
CFTR mutant with a single amino acid substitution
in which the sole basis for disease Is mislocalization
of the protein.
270
Human Molecular Genetics, 1995, Vol. 4, No. 2
exhibits sensitivity to activation by cAMP in Xenopus ooyctes
at 19°C similar to that of wild-type CFTR.
RESULTS
Immunoblot analysis and localization of G480C CFTR
The effect of the G480C mutation on the processing of the
CFTR protein was investigated by means of Western blot
analysis and immunofluorescence. 293T cells, which lack
detectable endogenous CFTR (15), were transfected with wildtype, AF508 or G480C CFTR cDNA expression vectors. When
Functional analysis of G480C in Xenopus oocytes
Membrane currents were recorded from Xenopus oocytes
injected with RNA transcribed from either wild-type or G480C
constructs. Oocytes were exposed to 10 |iM forskolin and
increasing concentrations of the phosphodiesterase inhibitor,
3-isobutyl-l-methylxanthine (IBMX), ranging from 0.02 to
5 mM. Dose-dependent activation of Cl~ conductance by
increasing concentrations of IB MX in the presence of forskolin
was previously demonstrated in Xenopus oocytes expressing
wild-type and mutant CFTRs (11,12). For the G551D mutant
that is processed normally in mammalian cells the severe
cytstic fibrosis in patients was correlated with a substantially
increased value of K\Q for activation by IBMX. In contrast,
in oocytes injected with RNA coding for G480C CFTR the
Ki/2 for activation of Cl" conductance was identical to that for
wild-type CFTR (Fig. 4). In addition, macroscopic conduction
properties as reflected in the I - V relation recorded at the peak
of activation, did not differ from wild-type (data not shown).
DISCUSSION
1
2
3
A
c
G
T
The identification of G480C in three CF chromosomes, including two apparently independent, unrelated African-American
CF chromosomes, but not in any normal chromosomes (includ-
Sllbp
205-
—2»lbp
unglycosylated
116-
Figure 1. Detection of G480C by chemical mismatch cleavage and DNA
sequence analysis. (A) Lanes 1-3, hetenxiuplexes between radiolabeled wildtype probe and amplified DNA from three patients with CF were modified
with hydroxylamine and cleaved with piperidine. Lanes 1 and 2 show DNA
from patients with no mutations in exon 10 and lane 3 shows DNA from a
patient with the G480C mutation. (B) Nucleotide sequence of a portion of
exon 10 from the patient bearing the G480C mutation. The G-to-T change at
base pair 1570 is shown by the arrow.
Figure 2. Western blot analysis of transfected 293T cell lysates compared
with T84 cell lysates. 100 u.g of protein was loaded in each lane. Lane 1,
mock transfected; lane 2, wild-type transfected; lane 3, AF508 transfected;
lane 4, G480C transfected; lane 5, T84. The blot was probed with anti-CFTR
antisera, a-1468 (21). The arrows indicate the location of the fully glycosylated,
mature CFTR and the incompletely glycosylated CFTR.
Downloaded from http://hmg.oxfordjournals.org/ at Pennsylvania State University on September 19, 2016
Mutation detection
DNA from a pancreatic insufficient African-American CF
patient was analyzed by chemical mismatch cleavage. An exon
10 cleavage product was observed, indicative of a mutation in
the patient's DNA (Fig. 1A). To confirm the presence of a
mutation, DNA from the patient was cloned and sequenced.
The sequence revealed a G to T transversion at nucleotide
1570 (Fig. IB), creating a glycine to cysteine missense mutation
at residue 480 (G480C). The patient was determined to be
heterozygous with the use of oligonucleotides specific to the
mutant and normal sequence. The mutation on the other
chromosome is unknown. The G480C mutation was detected
in a second African-American CF patient by denaturing gradient gel electrophoresis and confirmed by sequencing. This
patient carries AF508 on his other chromosome and is pancreatic insufficient. Allele-specific oligonucleotides were used to
screen additional CF and normal chromosomes for the mutation. G480C was detected in one additional non-AF508 CF
chromosome of 378 tested. This additional G480C patient has
a Caucasian father and an African-American mother. It could
not be determined which parent carries the G480C mutation,
as parental DNA was not available. The three patients bearing
the G480C mutation were not known to be related. The
mutation was not found in over 700 AF508 chromosomes, nor
in 220 normal chromosomes, including 160 African-American
chromosomes.
lysates from wild-type transfected 293T cells were analyzed
by Western blot, two species of CFTR were observed: a larger
species which co-migrates with the fully glycosylated CFTR
observed in T84 cells and the smaller, presumably incompletely
glycosylated form (Fig. 2). Only the incompletely glycosylated
form of CFTR was observed in cells transfected with AF5O8
or G480C cDNA. Even upon longer exposures, there was no
detectable signal for mature CFTR in the AF508 and G480C
lysates. This suggests that G480C CFTR, like AF508, is not
processed to the mature, fully glycosylated form of CFTR in
the cell.
Recombinant CFTR in transfected 293T cells was localized
by immunofluorescence. Wild-type CFTR exhibited predominant staining of the cell membrane (Fig. 3A). Both AF508, a
known trafficking mutant (Fig. 3B) and G480C (Fig. 3C)
CFTR were associated with staining that was restricted to the
cytoplasm, consistent with the classification of G480C as a
trafficking mutation.
Human Molecular Genetics, 1995, Vol. 4, No. 2 271
cells at a permissive temperature, previous studies have shown
that mutant CFTR proteins are less likely to be subject to
intracellular trafficking problems when expressed in oocytes
(11,12). For example, the AF508 variant, which is misprocessed
in mammalian cells at 37°C, nevertheless gives rise to robust
expression of cAMP-activated chloride current in Xenopus
oocytes. When expressed in Xenopus oocytes CFTRs bearing
mutations like G551D or AF508 that are associated with severe
disease give rise to Cl~ conductance characterized by markedly
reduced sensitivity to activating conditions (11). In contrast,
dose-dependent activation of G480C in oocytes indicates that
in this system, G480C CFTR functions identically to wild
type. It is possible that the single channel conductance associated with the mutant protein is abnormal but this seems
unlikely. G480C is not located in a region of the protein
expected to form the conducting pore, rather it is located in
the first NBF where other mutations have not proven to affect
single channel conductance (13).
If indeed G480C is associated with functional properties
that are identical to wild-type CFTR at temperatures permissive
for normal trafficking, it is the first example of a CF missense
Figure 3. Localization of wild-type, AF508, and G480C CFTR by fluorescence miscroscopy. Immunofluorescence staining with a-1468 (1:1000) detected with
fluorescein isothiocyanate-conjugated goat antirabbit antibody (1:300) in 293T cells transfected with (A) wild-type, (B) AF508, (C) O480C CFTR or (D) mock
transfected.
Downloaded from http://hmg.oxfordjournals.org/ at Pennsylvania State University on September 19, 2016
ing 160 African-American normal chromosomes) is consistent
with the classification of G480C as a disease causing mutation,
rather than a neutral polymorphism. In addition, glycine 480
is well conserved in CFTR in other species (16) as well as in
other homologous traffic ATPases (17,18). The high degree of
conservation suggests the possibility of functional importance
of glycine 480 that would be consistent with a substitution at
this amino acid causing disease. The identification of G480C
mutation in at least two African-American CF chromosomes
suggests that G480C may represent a common CF mutation
in the African-American population.
Defective CFTR processing and intracellular transport has
been described as the basis of CF caused by AF5O8 and several
other mutations (3-8). The mutant proteins, recognized as
abnormal, are presumably targeted for degradation and do not
reach the cell membrane. The results described here suggest
that G480C CFTR, like AF508 CFTR, is misprocessed in
the cell.
The functional properties of G480C CFTR were examined
in Xenopus oocytes. While expression of G480C CFTR in
Xenopus oocytes is not equivalent to expression in mammalian
272
Human Molecular Genetics, 1995, Vol. 4, No. 2
too
x
o
o>
*
s_x
T
O
A
performed according to the Altered Sites manual (Promega) with the following
oligo: 5'GGAGCCTTCAGAATGCAAAATTAAGCA3'. The presence of the
mutation was verified by sequencing. The mutated Sacl—Sphl fragments were
subcloned into a Bluescript based full length CFTR cDNA construct, pBQ4.7
(23), using standard methods to create pBQG48OC. pBQAF508 was made in
a similar manner. The full length constructs contain a methionine for valine
substitution at amino acid 1475 (V1475M). V1475M CFTR is associated with
wild-type activity in a Xenopus cocyte assay (12). Smal—Xho\ CFTR cDNA
fragments of pBQ4.7 were subcloned into pcDNAneo (Invitrogen) at the
EcoRV and Xho\ restriction sites to create pcDNAneoWT. 3.7 kb Afll\-Xho\
fragments of pBQG480C and pBQAF508 were subcloned into 8 kb Aflll -Xho\
fragments of pcDNAneoWT to create pcDNAneoG480C
and
pcDNAneoAF508.
O w*
(12)
A 0460C ( 3)
60 +
6 0m
- •l
•a
S
40 +
Cell culture and transient transfections
.02
.03
.2
.3
Figure 4. IBMX dose-response relationships for wild-type and G480C CFTR.
Individual oocytes were exposed to 10 uM forskolin and increasing doses of
IBMX. Values for stimulated conductance (g) were calculated by subtracting
the membrane conductance measured in the absence of drugs from the
conductance measured with each dose of FBMX and each value was normalized
to the maximum stimulated conductance (gm^). Plotted values are means ±
SEM and the number of oocytes assayed is shown in parentheses.
mutation for which the sole molecular basis of disease is
mislocalization of an otherwise normally functioning CFTR
protein. These results demonstrate that mislocalization of
CFTR is sufficient to cause disease and, when considered in
the context of mutations like G551D that are functionally
deficient yet processed normally, suggest that the fidelity of
processing is not related to Cl~ channel function.
MATERIALS AND METHODS
Mutation detection
The polymerase chain reaction (PCR) was used to amplify CFTR exon 10
from genomic DNA isolated from leukocytes from CF patients and their
parents. The pnmers, specific to the flanking intron sequences with the addition
of a BamHl restriction site, are 5'ATACGGATCCGCAGATGACCTGAAACAGGA3' and 5'ATACGGATCCCATTCACAGTAGCTTACCCA3'. The
reaction mixture contained approximately 200 ng genomic DNA, 10 mM Tris,
pH 8.3, 50 mM KCI, 1.5 mM MgCI2, 0.01% gelatin, 2 mM DTT, 0.2 mM
dNTP and 1 U Taq polymerase in a total volume of 50 |J.l. The reactions were
subjected to 35 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 2.5
min, followed by 72°C for 10 min. Patient PCR products that were used for
chemical mismatch cleavage were precipitated with ethanol. Probe production
and chemical mismatch cleavage were performed as described previously
(19). Briefly, patient PCR products and radiolabeled wild-type PCR products
were annealed to allow heteroduplex formation. Heteroduplexes were treated
with osmium tetroxide (O5O4) or hydroxylamine, followed by piperidine to
cleave mismatched base pairs. Products were visualized on a 6% denaturing
acrylamide gel. Denaturing gradient gel electrophoresis was performed using
PCR primers and conditions described previously (20).
For sequencing, PCR products were purified in a 1% agarose, 1.5% Nusieve
gel, digested with BamHI and subcloned into M13mpl8 DNA. Independent
clones were isolated and sequenced by the dideoxy-chain termination method
(21,22) using Sequenase 2.0 and universal primer (United States Biochemical).
Normal, 5'CTTCTAGAGGGTAAAATT3' and mutant, 5'CTTCAGAGTGTAAAATT3' allele-specific oligonucleotides were used to screen patient
and normal DNA. Screening was performed as described previously (9) except
the hybridization and washes were done at 39°C.
Mutagenesis and plasmid constructs
A 1.7 Kb Sacl-Sphl CFTR cDNA fragment was cloned into the pSelect
vector (Promega). Oligonucleotide mediated site-directed mutagenesis was
293T cells, a transformed human embryonic kidney cell line, were grown in
Dulbecco's modified Eagle's medium (Gibco), supplemented with 10% fetal
bovine serum, 100 U/ml penicillin and 100 Hg/ml streptomycin. 293T
cells grown on glass coverslips were transfected with pcDNAneoG480C,
pcDNAneo4.7, or pcDNAneoAF508 by calcium phosphate precipitation as
described elsewhere (24) and incubated at 37°C, 3% CO2 for 12-16 h. Cells
were transferred to 37°C, 5% CO2, grown for 24 h, and harvested for Western
blots and immunofluorescence.
Western blot analysis
T84 and transfected 293T cell lysates were prepared and analyzed by Western
blot as described previously (25) using CFTR antiserum, a-1468. 100 |ig of
protein was loaded per lane.
Immunofluorescence
To perform immunofluorescence studies the cells were rinsed twice with PBS,
pH 7.4. The following incubations were performed at room temperature unless
otherwise indicated. Cells were fixed with 2% paraformaldehyde in PBS for
10 min, rinsed three times with PBS for 5 min each, treated with -20°C
methanol for 10 min and rinsed three times with PBS for 5 min each. Cells
were permeabilized in 0.25% Triton X-100 in PBS for 10 min and rinsed as
described above. Cells were blocked with 20% goat serum (Gibco) in PBS
(GS/PBS) for 30 min at 37°C and then incubated with affinity purified a1468 antibody (25), diluted 1:1000 in 2% GS/PBS. Cells were washed three
times with 2% GS/PBS for 5 min each, incubated with goat antirabbit IgGFITC (Boehringer Mannheim), diluted 1:300 in 2% GS/PBS for 30 min, and
washed again. Coverslips were mounted on slides in mounting medium
(Citiflour, UK). Immunofluorescence staining was observed using a Nikon
microphot FXA fluorescence microscope.
RNA synthesis
RNA was transcribed in vitw. Plasmid DNA (pBQG480C and pBQ4.7) was
linearized with Xho\, phenol and chloroform extracted and precipitated with
ethanol. One (ig of template DNA was incubated with 60 U T7 RNA
polymerase, 80 U RNAsin (BRL), 2 mM each ATP, UTP, CTP, GTP, 40 mM
Tris-HCI (pH 8.0), 25 mM NaCl, 8 mM MgCl2, 2 mM spermidine-(HCl)3,
5 mM DTT and 1 mM m 7 G(5' )ppp(5)G at 37°C for 90 min. RNA was extracted
with phenol and chloroform, precipitated with ethanol and resuspended in
DEPC-treated water.
Oocytes and RNA injection
Female toads (Xenopus laevis) were anesthetized by immersion in ice water
containing 2 g/1 3-amino benzoic acid ethyl ester (Sigma), and oocytes were
removed via a small abdominal incision. The follicular membranes were
removed by blunt dissection after incubating for 2-6 h in a calcium-free
solution containing 2.5 mg/ml collagenase (Gibco). Defolliculated oocytes
were injected with 15 ng of RNA in 50 nl of DEPC treated water.
Two-electrode voltage-clamp
Oocytes injected 3—6 days previously were placed in a perfusion chamber,
impaled with two electrodes, and voltage clamped (DAGAN, TEV-200). The
perfusion solution was an Amphibian Ringer's containing: 100.5 mM Na + , 2
mM K + , 1.8 mM Ca 2+ , 1 mM Mg 2+ , 105.6 mM C\~ and 5 mM HEPES.
Membrane conductance was assayed at a holding potential of 60 mV, inside
negative, and the CFTR-mediated conductance was defined as that activated
by a stimulatory cocktail containing 10 uM forskolin and 0.02-5 mM IBMX.
Membrane currents in uninjected or water injected oocytes were unresponsive.
Downloaded from http://hmg.oxfordjournals.org/ at Pennsylvania State University on September 19, 2016
[IBMX] mM
Human Molecular Genetics, 1995, Vol. 4, No. 2 273
ACKNOWLEDGMENTS
16.
ABBREVIATIONS
20.
CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane conductance regulator;
ER, endoplasmic reticulum; IBMX, 3-isobutyl-l-methylxanthine; NBF, nucleotide binding fold.
21.
17.
18.
19.
22.
REFERENCES
1. Tsui, L-C. (1992) Mutations and sequence variations detected in the cytic
fibrosis transmembrane conductance regulator (CFTR) gene: a report
from the cystic fibrosis genetic analysis consortium. Hum. Mutat. 1,
197-203.
2. Welsh, MJ. and Smith, A.E. (1993) Molecular mechanisms of CFTR
chloride channel dysfunction in cystic fibrosis. Cell 73, 1251-1254.
3. Gregory, R.J., Rich, D.P., Cheng, S.H., Souza, D.W., Paul, S., Manalvalan,
P., Anderson, M.P., Welsh, MJ., and Smith, A.E. (1991) Maturation and
function of cystic fibrosis transmembrane conductance regulator variants
bearing mutations in putative nucleotide-binding domains 1 and 2. Mol
Cell. Biol. 11, 3886-3893.
4. Cheng, S.H., Gregory, R.J., Marshall, J., Paul, S., Souza, D.W., White,
G.A., O'Riordan, C. R., and Smith, A.E. (1990) Defective intracellular
transport and processing of CFTR is the molecular basis of most cystic
fibrosis. Cell 63, 827-834.
5. Yang, Y., Janich, S., Cohn, J.A., and Wilson, J.M. (1993) The common
variant of cystic fibrosis transmembrane conductance regulator is
recognized by hsp70 and degraded in a pre-Golgi nonlysosomal
compartment. Proc. Nail Acad. Set. USA 90, 9480-9484.
6. Yang, Y., Devor, D.C., Engelhardt, J.F., Ernst, S.A., Strong, TV, Collins,
FS., Cohn, J.A., Fnzzell, R.A., and Wilson, J.M. (1993) Molecular basis
of defective anion transport in L cells expressing recombinant forms of
CFTR. Hum. Mol. Genet. 2, 1256-1261.
7. Denning, G. M., Ostedgaard, L. S., and Welsh, M. J. (1992) Abnormal
localization of cystic fibrosis transmembrane conductance regulator in
primary cultures of cystic fibrosis airway epithelia. J. Biol. Chem. 118,
551-559.
8. Kartner, N., Augustinas, O., Jensen, T.J., Naismith, A.L., and Riordan,
J.R. (1992) Mislocalization of the AF508 CFTR in cystic fibrosis sweat
gland. Nature Genet. 1, 321-327.
9. Lodish, H.F. (1988) Transport of secretory and membrane glycoproteins
from the rough endoplasmic reticulum to the golgi. J. Biol. Chem. 263,
2107-2110.
10. Denning, G.M., Anderson, M.P., Amara, J.F., Marshall, J., Smith, A.E., and
Welsh, MJ. (1992) Processing of mutant cystic fibrosis transmembrane
conductance regulator is temperature-sensitive. Nature 358, 761-764.
11. Drumm, M.L., Wilkinson, DJ., Smit, L.S., Worrell, R.T., Strong, T V ,
Frizzell, R.A., Dawson, D.C., and Collins, F.S. (1991) Chloride
conductance expressed by AF508 and other mutant CFTRs in Xenopus
oocytes. Science 254, 1797-1799.
12. Smit, L.S., Wilkinson, DJ., Mansoura, M.K., Collins, F.S., and Dawson,
D.C. (1993) Functional roles of the nucleotide-binding folds in the
activation of the cystic fibrosis transmembrane conductance regulator.
Proc. Natl. Acad. Set. USA 90, 9963-9967.
13. Anderson, M.P. and Welsh, MJ. (1992) Regulation by ATP and ADP of
CFTR chloride channels that contain mutant nucleotide-binding domains.
Science 257, 1701-1704.
14. Sheppard, D.N., Rich, D.P., Ostedgaard, L.S., Gregory, RJ., Smith, A.E.,
and Welsh, MJ. (1993) Mutations in CFTR associated with mild-diseaseform Cl~ channels with altered pore properties. Nature 362, 160-164.
15. Chou, J-L., Rozmahel, R., and Tsui, L-C. (1991) Characterization of the
23.
24.
25.
Downloaded from http://hmg.oxfordjournals.org/ at Pennsylvania State University on September 19, 2016
We thank Dr Michael Iannuzzi for his work in collecting CF DNA samples,
Dr Lap-Chee Tsui for generously providing DNA of CF patients' parents and
Dr Mitchell Drumm for providing the pBQAF508 construct. This work was
supported by grants from the Cystic Fibrosis Foundation and the National
Institutes of Health (to G.R.C., J.A.C., D.C.D. and F.S.C.). L.S.S. was
supported by a Howard Hughes Predoctoral Fellowship, T.V.S. and DJ.W.
were supported by Cystic Fibrosis Postdoctoral Fellowships, M.MJr is
supported by the USA-Czechoslovak Science and Technology Program,
M.K.M. was supported by a National Science Foundation graduate research
fellowship and F.S.C. was previously an investigator of the Howard Hughes
Medical Institute.
promoter region of the cystic fibrosis transmembrane conductance
regulator gene. J. Biol. Chem. 266, 24471-24476.
Diamond, G., Scanlin, T.F., Zasloff, M.A., and Bevins, C.L. (1991) A
cross-species analysis of the cystic fibrosis transmembrane conductance
regulator. J. Biol. Chem. 266, 22761-22769.
Gros, P., Croop, J., and Housman, D. (1986) Mammalian multidrug
resistance gene: complete cDNA sequence. Cell 47, 371—380.
Hiles, I.D., Gallagher, M.P., Jamieson, D.H., and Higgins, CF. (1987)
Molecular characterization of the oligopepetide permease of Salmonella
typhimurium. J. MoL Biol. 195, 125-142.
Strong, TV, Smit, L.S., Turpin, S.V, Cole, J.L., Tom Hon, C , Markiewicz,
D., Petty, T.L., Craig, M.W., Rosenow III, E.C., Tsui, L-C., Iannuzzi,
M.C., Knowles, M.R., and Collins, F. S. Cystic fibrosis gene mutation in
two sisters with mild disease and normal sweat electrolyte levels. (1991)
N. Engl. J. Med. 325, 1630-1634.
Audrezet, M.P, Mercier, B., Guillermit, H., Quere, I., Veerlingue, C ,
Rault, and G. Ferec, C. (1993) Identification of 12 novel mutations in
the CFTR gene. Hum. Mol. Genet. 2, 51-54.
Sanger, F, Nicklen, S., and Coulson, A.R. (1977) DNA sequencing with
chain terminating inhibitors. Proc. Natl Acad. Sci. USA 74, 5463-5467.
Biggin, M.D., Gibson, TJ., and Hong, G.F. (1983) Buffer gradient gels
and 35S label as an aid to rapid DNA sequence determination. Proc. Natl.
Acad. Sci. USA 80, 3963-3965.
Drumm, M.L., Pope, H.A., Cliff, W.H., Rommens, J.M., Marvin, S.A.,
Tsui, L-C., Collins, F.S., Frizzell, R.A., and Wilson, J.M. (1990) Correction
of the cystic fibrosis defect in vitro by retrovirus-mediated gene transfer.
CW/62, 1227-1233.
Chen, C. and Okayama, H. (1987) High efficiency transformation of
mammalian cells by plasmid DNA. Mol. Cell. Biol. 7, 2745-2752.
Cohn, J.A., Nairn, A.C., Marino, C.R., Melhus, O., and Kole, J. (1992)
Characterization of the cystic fibrosis transmembrane conductance
regulator in a coloncyte cell line. Proc. Natl Acad. Sci. USA 89,2340-2344.