Eosinophil-Derived Cationic Proteins
Activate the Synthesis of Remodeling Factors
by Airway Epithelial Cells
This information is current as
of June 14, 2017.
Sophie Pégorier, Lori A. Wagner, Gerald J. Gleich and
Marina Pretolani
J Immunol 2006; 177:4861-4869; ;
doi: 10.4049/jimmunol.177.7.4861
http://www.jimmunol.org/content/177/7/4861
Subscription
Permissions
Email Alerts
This article cites 70 articles, 15 of which you can access for free at:
http://www.jimmunol.org/content/177/7/4861.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2006 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
References
The Journal of Immunology
Eosinophil-Derived Cationic Proteins Activate the Synthesis of
Remodeling Factors by Airway Epithelial Cells1
Sophie Pégorier,* Lori A. Wagner,† Gerald J. Gleich,†‡ and Marina Pretolani2*
E
osinophil accumulation and activation in target tissues are
associated with numerous diseases including infection
with helminthic parasites, bronchial asthma, atopic allergy, and a number of malignant disorders (1– 4). Increased numbers of eosinophils are found in blood, bronchial tissue, bronchoalveolar lavage fluid, and induced sputum from asthmatic patients
(3–5) and the extent of their activation correlates with disease severity (4). By releasing cytokines, lipid mediators, reactive oxygen
species, and highly charged cytotoxic granular proteins, activated
eosinophils contribute to airway inflammation and cause damage
of the bronchial mucosa (3, 4). Increasing evidence indicates that
eosinophils are also important effector cells involved in airway
remodeling (6), a phenomenon characterized by subepithelial fibrosis, with fibroblast and myofibroblast accumulation beneath the
subepithelial basement membrane, increased TGF-␤1 expression,
and excessive extracellular matrix (ECM)3 protein and metalloproteinase (MMP) deposition in the stroma underlying the bronchial epithelium (7, 8). Thus, in vivo maneuvers aimed at remov*Institut National de la Santé et de la Recherche Médicale, Unité 700, Université Paris
7, Faculté de Médecine Denis Diderot, Site Xavier Bichat, Paris, France; and †Department of Dermatology and ‡Department of Medicine, University of Utah, Salt
Lake City, UT 84132
Received for publication January 27, 2006. Accepted for publication July 17, 2006.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported in part by the “Agence Nationale de la Recherche” (Grant
Number 0012405), by the Chancellerie des Universités de Paris en Sorbonne (fellowship to S.P.), Paris, France, and by the U.S. National Institutes of Health (Grant
AI09728).
2
Address correspondence and reprint requests to Dr. Marina Pretolani, Institut National de la Santé et de la Recherche Médicale, Unité 700, Université Paris 7, Faculté
de Médecine Denis Diderot, Site Xavier Bichat, 16 rue Henri Huchard, 75018 Paris,
France. E-mail address: [email protected]
3
Abbreviations used in this paper: ECM, extracellular matrix; MMP, metalloproteinase; MBP, major basic protein; EPO, eosinophil peroxidase; NHBE, normal human
bronchial epithelial cell; LDH, lactate dehydrogenase; Ct, cycle threshold; EGF, epidermal growth factor; PDGF, platelet-derived growth factor; ET-1, endothelin-1.
Copyright © 2006 by The American Association of Immunologists, Inc.
ing eosinophils from blood and tissues prevented TGF-␤1 release
and ECM protein accumulation in the airways (9 –14). Other features of airway remodeling seen in asthma include an increase in
smooth muscle mass, goblet cell hyperplasia, and new blood vessel
formation (7, 8). The end result is increased thickness of the bronchial wall, leading to a reduction in the airway caliber, an exaggerated airway narrowing, and a progressive decline of respiratory
function (7, 8, 15).
The primary target of eosinophils is the bronchial epithelium
whose functions and integrity are profoundly altered by eosinophil-secreted products, particularly cationic proteins, including
major basic protein (MBP), eosinophil peroxidase (EPO), eosinophil cationic protein, and eosinophil-derived neurotoxin (16, 17).
Most of the effects of these proteins on airway epithelium are mediated by cytotoxic mechanisms, or involve their cationic charge
and high arginine content (17–21). Thus, synthetic cationic
polypeptides, such as poly-L-arginine, mimic many of the effects of
MBP, including bronchial hyperreactivity, mast cell and basophil
activation, and increase in epithelial permeability (20 –23). It is
noteworthy, however, that the cationic nature of eosinophil granule
proteins may not fully explain their biological functions and, accordingly, the direct transcriptional or posttranscriptional effects of
subcytotoxic concentrations of MBP have been described in various cell types, including basophils and lung fibroblasts (24, 25)
The respiratory epithelium is believed to orchestrate airway remodeling through aberrant production of ECM components, fibrogenic cytokines and chemokines, growth factors and MMPs, responsible for the proliferation, migration, and activation of airway
smooth muscle cells and fibroblasts and for the differentiation of
fibroblasts into myofibroblasts (26, 27). Although several stimuli
generated in the asthmatic airways may potentially activate the
respiratory epithelium, the possibility that eosinophil granule cationic proteins may directly promote the synthesis of remodeling
factors has not received attention.
In this study, we provide evidence for the first time that the
eosinophil granule proteins, MBP and EPO, directly up-regulate
0022-1767/06/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Eosinophil cationic proteins influence several biological functions of the respiratory epithelium, yet their direct contribution to
airway remodeling has not been established. We show that incubation of the human bronchial epithelial cell line, BEAS-2B, or
primary cultured human bronchial epithelial cells, normal human bronchial epithelial cells, with subcytotoxic concentrations (0.1,
0.3, and 1 ␮M) of major basic protein (MBP), or eosinophil peroxidase (EPO), augmented the transcripts of endothelin-1, TGF-␣,
TGF-␤1, platelet-derived growth factor (PDGF)-␤, epidermal growth factor receptor, metalloproteinase (MMP)-9, fibronectin,
and tenascin. A down-regulation of MMP-1 gene expression was observed exclusively in BEAS-2B cells. Cationic protein-induced
transcriptional effects were followed by the release of endothelin-1, PDGF-AB in the supernatants by ELISA, and by a down- and
up-regulation, respectively, in the levels of MMP-1 and MMP-9 in cell lysates, by Western blot. Cell stimulation with the synthetic
polycation, poly-L-arginine, reproduced some but not all effects of MBP and EPO. Finally, simultaneous cell incubation with the
polyanion molecules, poly-L-glutamic acid or heparin, restored MMP-1 gene expression but incompletely inhibited MBP- and
EPO-induced transcriptional effects as well as endothelin-1 and PDGF-AB release, suggesting that cationic proteins act partially
through their cationic charge. We conclude that eosinophil-derived cationic proteins are able to stimulate bronchial epithelium to
synthesize factors that influence the number and behavior of structural cells and modify extracellular matrix composition and
turnover. The Journal of Immunology, 2006, 177: 4861– 4869.
4862
EOSINOPHIL CATIONIC PROTEINS AND AIRWAY REMODELING
remodeling factor gene expression and protein release in cultured
human airway epithelial cells and that these effects involve partly
their cationic nature. Collectively, these findings establish a tangible link between eosinophil degranulation and airway remodeling, and identify a novel therapeutic target for eosinophil-mediated
diseases.
24, and 48 h. Cells were harvested by a 15-min incubation in cell dissociation buffer (Invitrogen Life Technologies) at 37°C and pelleted by centrifugation (150 ⫻ g, 5 min, 4°C). Supernatants were further centrifuged
before use. Three independent experiments were conducted. Results were
calculated as a percentage of LDH activity from supernatants, in relation to
cell pellets. The plates were then read on a Microplate reader photometer
(Multiskan Ascent; Thermo) at 570-nm wavelength.
RNA isolation and reverse transcription
Materials and Methods
Eosinophil-derived cationic protein purification
Eosinophils from patients with marked blood eosinophilia (up to 84%)
were collected by cytapheresis and eosinophil granules and granule proteins were purified, as previously described (28 –30). Briefly, after cell lysis
and granule isolation, granules were solubilized in 0.01 M/L HCl (pH 2.0)
by vigorous suspension with a Pasteur pipette. After centrifugation
(13,600 ⫻ g, 5 min), the supernatant was fractionated on a Sephadex G-50
column equilibrated with 0.025 M/L sodium acetate, 0.15 M/L NaCl (pH
4.3). Individual protein peaks were pooled, and protein concentrations were
determined by absorbance at 280 nm with the following extinction coefficients at 280 nM: E1% 1 cm, 14.5 for EPO (29) and 36.7 for MBP (30). All
eosinophil granule protein preparations were pure as assessed by Coomassie blue staining after SDS-PAGE.
The human bronchial epithelial cell line, BEAS-2B (American Type Culture Collection-LGC Promochem) (31) and primary cultured normal human bronchial epithelial cells (NHBE; Cambrex BioScience) were seeded
in 6-well plastic plates (TPP-AG) previously coated with 2.5 mg/ml collagen type I (Sigma-Aldrich) in 0.016 mM acetic acid. Cells were grown at
37°C in a humidified 5% CO2 atmosphere in bronchial epithelium growth
medium (Cambrex) supplemented with 0.5 ng/ml recombinant human epidermal growth factor (EGF), 500 ng/ml hydrocortisone, 0.005 mg/ml insulin, 0.035 mg/ml bovine pituitary extract, 500 nM ethanolamin, 500 nM
phosphoethanolamin, 0.01 mg/ml transferrin, 6.5 ng/ml 3,3⬘,5-triiodothyronine, 500 ng/ml adrenaline, and 0.1 ng/ml retinoic acid.
Once they reached ⬃80% confluence, epithelial cells were stimulated
for 1, 3, 6, 24, and 48 h with 0.1, 0.3, and 1 ␮M MBP, or EPO, or with their
vehicle, i.e., 0.025 M sodium acetate buffer with 0.15 M NaCl (pH 4.3).
The addition of the acetate buffer failed to alter appreciably the pH of the
culture medium. In the experiments aimed at determining whether the cationic charge of cationic proteins plays a role in the production of remodeling factors, cells were stimulated at selected time points with 1 ␮M MBP
or EPO in the presence of 1 ␮M poly-L-glutamic acid (molecular mass
3,000 –15,000; Sigma-Aldrich), or of 100 U/ml heparin (Grade IA, porcine
intestinal mucosa; Sigma-Aldrich), or they were incubated with 1 ␮M of
the synthetic polycation, poly-L-arginine (molecular mass 5,000 –15,000;
Sigma-Aldrich) instead of cationic proteins.
Assessment of epithelial cell viability
The effect of cationic proteins on epithelial cell viability was determined by
quantifying lactate dehydrogenase (LDH) activity using a commercially
available kit (Cytotoxicity Detection kit, LDH; Roche) according to the
manufacturer’s instructions. Epithelial cells were seeded in 24-well plates
(TPP) and stimulated with 1 ␮M MBP, EPO, or poly-L-arginine for 1, 3, 6,
Real-time quantitative PCR
Real-time quantitative PCR was performed using the SYBRGreen JumpStart Taq Ready Mix detection kit (Sigma-Aldrich). In all assays, cDNA
was amplified using a standardized program (2 min JumpStart Taq Polymerase activation step at 94°C; 40 cycles of 30 s at 94°C and 1 min at
60°C). All assays were performed in a volume of 20 ␮l, and primers were
used at a final concentration of 0.33 ␮M. Reactions were conducted using
the PCR ABI 7700 apparatus (Applied Biosystems). Transcripts showing
cycle threshold (Ct) values ⬎35 were considered to have minimal expression and were excluded from further analyses. For a more accurate and
reliable normalization of the results, the intensity of gene expression was
calculated using Ct ⬍35 and it was normalized to the geometrical mean of
the levels of transcripts encoding the most stable 3 housekeeping genes
hypoxanthine-guanine-phosphoribosyl transferase 1 (HPRT1), succinate
dehydrogenase (SDHA), and ribosomal protein 13a (RPL13a; Ref. 32).
Normalization and calculation were assessed using GenNorm Software
(Microsoft Excel, 2001 version). Primers were designed using Primer Express 2 Software (Applied Biosystems) and were synthesized by Invitrogen
Life Technologies. Primer sequences and basal gene expression in vehiclestimulated BEAS-2B and NHBE cells are described in Table I.
Determination of platelet-derived growth factor (PDGF)-AB and
endothelin-1 (ET-1) in cell supernatant
The levels of PDGF-AB and ET-1 were assessed in supernatants from
epithelial cells stimulated for 6, 24, and 48 h with 1 ␮M MBP, EPO, or
poly-L-arginine, in the absence or presence of 1 ␮M poly-L-glutamic acid
or 100 U/ml heparin by ELISAs (human PDGF-AB Quantikine Immunoassay and human ET-1 QuantiGlo Immunoassay all obtained from R&D
Systems Europe), respectively. The threshold of sensitivities was 31.2
pg/ml for PDGF-AB and 0.32 pg/ml for ET-1.
Assessment of MMP-1 and MMP-9 in cell lysates
Unstimulated and MBP-, EPO-, and poly-L-arginine (1 ␮M)-stimulated
epithelial cells, in the absence or presence of 1 ␮M poly-L-glutamic acid or
Table I. Real-time primer sequences and basal levels of transcript expression in human bronchial epithelial cellsa
Basal Ctb (mean ⫾ SEM)
GenBank Identifier
NM_001955
NM_003236
NM_000660
NM_005228
X02811
NM_002421
NM_004994
X02761
X56160
NM_000194
NM_012423
NM_004168
Gene
ET-1
TGF-␣
TGF-␤1
EGFR
PDGF-␤
MMP-1
MMP-9
Fibronectin
Tenascin
HPRT1
RPL13A
SDHA
Forward Primer
TGGGATCAGAGCAGGAGCAT
GACAGCAGCCAACCCTGATC
ACTCATTCAGTCACCATAGCAACACT
GGGCCGACAGCTATGAGATG
AGCCAAAACGCCCCAAAC
CATGCGCACAAATCCCTTCTA
CGAACTTTGACAGCGACAAG
TGGACCAGAGATCTTGGATGTTC
GGTCCACACCTGGGCATTT
TGGCCATCTGCTTAGTAGAGCTTT
CCTGGAGGAGAAGAGGAAAGAGA
TGTGTCCATGTCATAACTGTCTTCATA
Reverse Primer
AGATGAAAGAAGAGACCAAAGCAGTTAC
AAGCACAAATTCTCCTCCCTTACC
CGCCTGGCCTGAACTACTACTTT
CCGGCAGGATGTGGAGATC
AAATAACCCTGCCCACACACTCT
TGTCCCTGAACAGCCCAGTACT
TTCAGGGCGAGGACCATAGA
CGCCTAAAACCATGTTCCTCAA
TTGCTGAATCAAACAACAAAACAGA
TTAAACAACAATCCGCCCAAA
TTGAGGACCTCTGTGTATTTGTCAA
AAGAATGAAGCAAGGGACAAAGG
BEAS-2B
NHBE
24.1 ⫾ 0.1
26.0 ⫾ 0.2
25.5 ⫾ 0.6
21.8 ⫾ 0.4
23.8 ⫾ 0.5
30.0 ⫾ 0.5
27.1 ⫾ 0.7
17.9 ⫾ 0.5
22.9 ⫾ 0.2
21.2 ⫾ 0.3
16.1 ⫾ 0.1
17.4 ⫾ 0.3
25.9 ⫾ 0.4
23.0 ⫾ 0.4
30.0 ⫾ 0.4
20.0 ⫾ 1.1
26.6 ⫾ 0.4
20.9 ⫾ 0.2
30.4 ⫾ 0.2
24.7 ⫾ 0.5
21.7 ⫾ 0.1
24.9 ⫾ 0.2
16.8 ⫾ 0.6
23.4 ⫾ 0.5
a
EGFR, epidermal growth factor receptor; TGF, transforming growth factor; HPRT, guanine-phosphoribosyl transferase; RPL13a, ribosomal protein 13a; SDHA, succinate
deshydrogenase.
b
Basal Ct corresponds to the Ct measured in vehicle (sodium acetate buffer)-treated cells.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Epithelial cell culture and stimulation
Confluent epithelial cells that had been cultured for 1– 48 h in medium
supplemented with 0.1, 0.3, and 1 ␮M MBP, or with 1 ␮M EPO, or polyL-arginine, in the absence or the presence of 1 ␮M poly-L-glutamic acid or
100 U/ml heparin, were recovered in RA1 buffer contained in the NucleoSpin RNA II kit (Macherey-Nagel) supplemented with 3.5 ␮l of 2-ME
(Sigma-Aldrich) and then stored at ⫺80°C. Total RNAs were isolated using this same kit according to manufacturer’s instructions and quantified by
measuring the OD at 260 nm. Reverse transcription was performed for 2 h
at 37°C using Moloney murine leukemia virus reverse transcriptase (Invitrogen Life Technologies) and 2.5 ␮g/50 ␮l total RNA were used.
The Journal of Immunology
100 U/ml heparin were harvested by a 15-min incubation in cell dissociation buffer at 37°C, then lysed and sonicated with a buffer containing NaCl
(150 mM), HEPES (10 mM, pH 8), saccharose (500 mM), Na2 EDTA (1
mM), Nonidet P40 (40%, Igepal; Sigma-Aldrich). Protein contents in clarified supernatants were determined by comparison with an OVA standard
curve (ICN Biomedical), using the Bio-Rad protein assay.
The expression of MMP-1 and of MMP-9 were assessed by Western
blot after protein fractionation (50 ␮g) by 10% SDS-PAGE, transfer to
polyvinylidene difluoride membranes (Bio-Rad) and sequential reaction
with a chicken anti-human MMP-1 Ab (clone 3.4.24.7, 1/2000 dilution;
Interchim), or with a goat anti-human MMP-9 Ab (clone AB911, 1/1000
dilution; R&D Systems) and with a mouse anti-␤-actin mAb (clone AC-74,
1/4000 dilution; Sigma-Aldrich). Immunoblots were then incubated with
peroxidase-conjugated goat anti-chicken, donkey anti-goat, or donkey antimouse Abs at a 1/3000 dilution and developed using the ECL Western
blotting detection system (all from Amersham). The intensities of the expression of MMP-1, MMP-9, and ␤-actin were quantified using a densitometer (CCD-COHU) and Gel Analyst software (Claravision). Results are
expressed as a ratio, defined as the OD values of the MMP-1 or MMP-9
bands/OD values of the corresponding ␤-actin bands.
Statistical analysis
Results
Effect of cationic proteins on epithelial cell viability
Changes in the viability of BEAS-2B and NHBE cells upon 1– 48
h of stimulation with the highest concentration of cationic proteins
and poly-L-arginine i.e., 1 ␮M, were determined by assessing LDH
release. MBP, EPO, and poly-L-arginine failed to induce the release of amounts of LDH above those detected in vehicle-treated
cells (between 15 and 20% release, differences not statistically
significant, data not shown).
Effect of cationic proteins and poly-L-arginine on the expression
of transcripts encoding remodeling factors
The ability of MBP and EPO and of the surrogate cationic molecule, poly-L-arginine, to influence the expression of factors in-
volved in airway remodeling was investigated by real-time quantitative PCR (Figs. 1-4 and Table II). We found detectable levels
of the transcripts encoding ET-1, TGF-␣, TGF-␤1, EGFR,
PDGF-␤, MMP-1, MMP-9, fibronectin, and tenascin in vehicle
(acetate buffer)-stimulated human BEAS-2B cells and in NHBE
cells isolated from three distinct healthy donors (Ct ⬍ 35, Table I).
The highest expressed transcripts in both cell types were those
encoding EGFR and the two ECM proteins, fibronectin and tenascin (Table I). However, the basal expression level of MMP-1
mRNA was higher in NHBE, as compared with BEAS-2B cells
(mean Ct values of 20.9 and 30.0, respectively, Table I).
Incubation of BEAS-2B cells over 3–24 h in the presence of 0.1,
0.3, and 1 ␮M MBP significantly up-regulated the expression of
mRNA for ET-1, TGF-␣, EGFR, TGF-␤1, PDGF-␤, MMP-9, tenascin, and fibronectin (Figs. 1 and 2, B–D). Under these conditions, MMP-1 transcripts were significantly reduced (Fig. 2A). No
changes in the levels of any of the transcripts examined were noted
after 1 h of stimulation (data not shown). Similar induction of
ET-1, TGF-␣, TGF-␤1, EGFR, PDGF-␤, and tenascin gene expression and down-regulation of MMP-1 transcription was observed in EPO (1 ␮M)-stimulated cells (Fig. 3 and Fig. 4, A and
C), but contrary to MBP, this cationic protein failed to alter
MMP-9 and fibronectin mRNA levels (Fig. 4, B and D).
Cell stimulation with 1 ␮M poly-L-arginine up-regulated the
levels of the transcripts encoding ET-1, TGF-␣, EGFR, and
PDGF-␤ to a similar extent as MBP (Fig. 1, A–C and E). However,
poly-L-arginine failed to augment TGF-␤1, MMP-9, tenascin, and
fibronectin gene expression (Figs. 1D and 2, B–D) and, contrary to
MBP and EPO, it augmented the levels of the transcripts encoding
MMP-1 (Fig. 2A).
Most of the above findings were confirmed in NHBE cells,
where 1 ␮M MBP and EPO augmented ET-1, TGF-␣, TGF-␤1,
EGFR, PDGF-␤, MMP-9, and fibronectin mRNA, without altering
the levels of MMP-1 transcripts (Table II). In addition, MBP, but
not EPO, increased significantly tenascin gene expression, as compared with vehicle-treated cells. Under these conditions, cell stimulation with 1 ␮M poly-L-arginine up-regulated exclusively ET-1,
TGF-␤1, EGFR, and MMP-9 mRNAs (Table II).
FIGURE 1. MBP and poly-L-arginine modulate the levels of mRNA encoding remodeling factors in the human bronchial epithelial cell line, BEAS-2B.
BEAS-2B cells were stimulated for 3, 6, and 24 h with 0.1, 0.3, and 1 ␮M MBP, with 1 ␮M poly-L-arginine, or with the vehicle of MBP, i.e., sodium acetate
buffer. Cells were harvested, RNA was extracted, reverse transcribed, and a real-time quantitative PCR for ET-1 (A), TGF-␣ (B), EGFR (C), TGF-␤1 (D),
and PDGF-␤ (E) was performed. Results are expressed as the ratio of each transcript relative to the geometrical average of mRNA expression of the
housekeeping genes HPRT1, SDHA, and RPL13a. Data are means ⫾ SEM of five independent experiments. ⴱ, p ⬍ 0.05, as compared with vehicle-treated
cells.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Data were analyzed statistically using the StatView SE⫹Graphics program
for Macintosh (Abacus Concepts). Comparability between the means was
assessed by Wilcoxon test for the MBP dose-response experiments, and
ANOVA test for the experiments with MBP, EPO, and poly-L-arginine in
the absence or the presence of heparin or poly-L-glutamic acid. The results
are expressed as means ⫾ SEM for the indicated number of experiments.
4863
4864
EOSINOPHIL CATIONIC PROTEINS AND AIRWAY REMODELING
Table II. Effect of poly-L-arginine, MBP, and EPO on the levels of the transcripts encoding remodeling factors in primary cultured human bronchial
epithelial cells (NHBE) and modulation by poly-L-glutamic acid
Cell Treatmenta
Transcript
Vehicle
Relative
Expressionb
ET-1
TGF-␣
TGF-␤1
EGF R
PDGF-␤
MMP-1
MMP-9
Fibronectin
Tenascin
0.36 ⫾ 0.02
0.88 ⫾ 0.36
0.83 ⫾ 0.15
0.80 ⫾ 0.26
0.49 ⫾ 0.17
1.10 ⫾ 0.19
0.54 ⫾ 0.39
0.61 ⫾ 0.36
0.67 ⫾ 0.40
poly-L-glu
poly-L-arg
poly-L-arg ⫹
poly-L-glu
MBP
MBP ⫹
poly-L-glu
EPO
EPO ⫹
poly-L-glu
8.5c,d
10.2c,d
5.4c,d
2.6c,d
5.8c,d
1.0
3.3c
3.8c,d
0.8d
1.9c,d,e
3.7c,d,e
3.4c,d,e
1.8c,e
3.4c,e
2.4
1.2d,e
2.5c,d
0.7d
Fold increase over vehicle-treated cells
1.0
1.4
1.1
0.8
1.8
0.9
1.6
0.8
1.3
c,d
5.3
1.3e
1.9c
1.7c,d,e
1.6
0.8
3.6c
0.6
1.8
1.4e
1.2
0.8e
1.0
0.8
0.7
0.6e
0.6
0.9e
4.3c,d
3.2c,d
4.9c,d
2.2c
7.0c,d
1.0
6.2c,d
5.9c,d
4.9c,d
2.4c,d,e
1.7c,d
1.5c,d
1.8c
4.1c,d
1.5
4.5c,d,e
1.3c,d,e
1.4c,e
Poly-L-glutamic acid and heparin partially reverse cationic
protein-induced effects
To further establish whether the cationic charge of MBP and EPO
was involved in their modulatory activities, we examined the effect
of 1 ␮M poly-L-glutamic acid and of 100 U/ml heparin on MBPand EPO- (1 ␮M) induced changes in the expression of the different transcripts. For these experiments, we selected the time
points corresponding to the highest MBP- and EPO-mediated stimulation or inhibition of gene expression, i.e., 3 h for ET-1, TGF-␤1,
and tenascin and 24 h for TGF-␣, EGFR, PDGF-␤, MMP-1,
MMP-9, and fibronectin (Figs. 1 and 2) in BEAS-2B cells, and 3 h
for ET-1, 6 h for TGF-␤1 and 24 h for TGF-␣, EGFR, PDGF-␤,
MMP-1, MMP-9, fibronectin, and tenascin in NHBE cells (Table
II). Simultaneous incubation of poly-L-glutamic acid with MBP or
EPO reduced significantly the levels of the transcripts encoding
ET-1, TGF-␣, TGF-␤1, EGFR, PDGF-␤, fibronectin, tenascin, and
FIGURE 2. MBP and poly-L-arginine
induce changes in the levels of mRNA encoding MMPs and extracellular matrix
proteins in BEAS-2B cells. BEAS-2B
cells were stimulated for 3, 6, and 24 h
with 0.1, 0.3, and 1 ␮M MBP, with 1 ␮M
poly-L-arginine, or with the vehicle of
MBP, i.e., sodium acetate buffer, and the
expression of mRNA for MMP-1 (A),
MMP-9 (B), tenascin (C), and fibronectin
(D) was assessed by real-time quantitative
PCR and results are expressed as described in the legend of Fig. 1. Data are
means ⫾ SEM of five independent experiments. ⴱ, p ⬍ 0.05, as compared with vehicle-treated cells.
MMP-9 in BEAS-2B and NHBE cells (Fig. 3 and Table II). In
addition, poly-L-glutamic acid partially reversed MBP- and EPOinduced decrease in MMP-1 mRNA in BEAS-2B cells (Fig. 4).
Poly-L-glutamic acid by itself, significantly down-regulated
MMP-1 gene expression in BEAS-2B cells (Fig. 4A), without altering the basal levels of the other transcripts analyzed. Similar
results were obtained using 100 U/ml heparin instead of poly-Lglutamic acid (data not shown).
Eosinophil-derived cationic proteins and poly-L-arginine
generate remodeling factors
To determine whether the transcriptional effects of cationic proteins and of poly-L-arginine resulted in proportionate changes in
the elaboration of the corresponding proteins, we measured the
levels of selected factors in the supernatants of MBP-, EPO-, and
poly-L-arginine (1 ␮⌴) stimulated BEAS-2B and NHBE cells by
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
a
NHBE cells were stimulated over 3 h (for ET-1), 6 h (for TGF-␤1), and 24 h (for TGF-␣, EGFR, PDGF-␤, MMP-1, MMP-9, tenascin, and fibronectin) with 1 ␮M
poly-L-arginine (poly-L-arg), MBP, or EPO, or its vehicle, i.e., sodium acetate buffer, or with 1 ␮M poly-L-glutamic acid (poly-L-glu) alone, or in association with 1 ␮M
poly-L-arginine or MBP.
b
The expression of the indicated genes was assessed by real-time quantitative PCR, as described in the legend of Fig. 1. Data (means ⫾ SEM of three independent experiments
performed with cells from three distinct donors) are expressed as the ratio of mRNA expression of each transcript relative to the geometrical average of mRNA expression of
the three housekeeping genes, RPL13a, HPRT, and SDHA.
c
p ⬍ 0.05, as compared to vehicle-treated cells.
d
p ⬍ 0.05, as compared to poly-L-glutamic acid-treated cells.
e
p ⬍ 0.05, as compared to MBP- or poly-L-arginine-stimulated cells.
The Journal of Immunology
4865
FIGURE 3. Poly-L-glutamic acid modulates MBPand EPO-induced changes in the levels of transcripts
encoding remodeling factors in BEAS-2B cells.
BEAS-2B cells were stimulated with 1 ␮M MBP, EPO,
or their vehicle, i.e., sodium acetate buffer, or with 1
␮M poly-L-glutamic acid (poly-L-glu) alone, or in association with cationic proteins. Cells were collected at
3 h, for ET-1 (A) and TGF-␤1 (D), or at 24 h, for
TGF-␣ (B), EGFR (C), and PDGF-␤ (E) and real-time
quantitative PCR for these factors was performed, as
described in the legend of Fig. 1. Data are means ⫾
SEM of three independent experiments. ⴱ, p ⬍ 0.05, as
compared with vehicle-treated cells; †, p ⬍ 0.05, as
compared with poly-L-glutamic acid-treated cells; and
‡, p ⬍ 0.05, as compared with MBP- or EPO-stimulated cells.
cantly poly-L-arginine-, MBP- and EPO-induced PDGF-AB and
ET-1 release.
Poly-L-glutamic acid also prevented MBP- and EPO-induced
decrease in the levels of MMP-1, without altering MMP-9 expression in both types of epithelial cells (Fig. 5, C and D, and Fig. 6C).
Finally, poly-L-glutamic acid suppressed poly-L-arginine-induced
MMP-1 expression in NHBE cells (Fig. 6C). Similar modulation
of the effects of MBP and EPO on protein generation was observed
upon the addition of heparin to the culture medium instead of
poly-L-glutamic acid (data not shown).
Discussion
The possibility that eosinophil-derived cationic proteins directly
stimulate the respiratory epithelium to generate factors involved in
the onset and progression of airway remodeling has not been investigated. To test this hypothesis, we characterized the effects of
two different native purified human cationic proteins, i.e., MBP
and EPO, on the synthesis and production of mesenchymal and
airway smooth muscle growth factors, MMPs and ECM proteins,
in the human cell line, BEAS-2B, which was originally established
from healthy bronchial epithelium (33), and confirmed the most
relevant results in primary human NHBE cells. We conducted
these experiments using concentrations of cationic proteins (0.1,
FIGURE 4. Poly-L-glutamic acid modulates
MBP- and EPO-induced changes in the levels of
transcripts encoding MMPs and ECM proteins in
BEAS-2B cells. BEAS-2B cells were stimulated
as described in the legend of Fig. 3 and real-time
quantitative PCR was assessed at 3 h, for tenascin
(C), and at 24 h, for MMP-1 (A), MMP-9 (B), and
fibronectin (D). Data are means ⫾ SEM of three
independent experiments. ⴱ, p ⬍ 0.05, as compared with vehicle-treated cells; †, p ⬍ 0.05, as
compared with poly-L-glutamic acid-treated
cells, and ‡, p ⬍ 0.05, as compared with MBP- or
EPO-stimulated cells.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
ELISA (Figs. 5, A and B, and 6, A and B), or in whole cell protein
extracts, by Western blot (Figs. 5, C and D, and 6C). By ELISA,
we established that MBP and poly-L-arginine generated amounts
of ET-1 and PDGF-AB above those measured in vehicle-treated
BEAS-2B and NHBE cells, whereas EPO augmented exclusively
PDGF-AB levels (Figs. 5, A and B, and 6, A and B). In parallel,
Western blot analysis revealed lower expression of MMP-1 in
MBP- and EPO- as compared with vehicle-stimulated cells (Figs.
5C and 6C). Poly-L-arginine significantly augmented MMP-1 levels in BEAS-2B cells (Fig. 5C), whereas it down-regulated the
levels of MMP-1 in NHBE cells (Fig. 6C). A comparable increase
in the expression of MMP-9 in response to poly-L-arginine-, MBPand EPO- was observed in BEAS-2B and NHBE cells (Figs. 5D
and 6C).
To establish whether the cationic charge of MBP and EPO accounted for these modulatory effects, experiments were conducted
in the absence or presence of 1 ␮M poly-L-glutamic acid. Poly-Lglutamic acid, by itself, slightly but significantly increased spontaneous PDGF-AB generation at 48 h in both BEAS-2B and
NHBE cells (Figs. 5A and 6A), but it failed to modify MBP-,
EPO-, and poly-L-arginine-induced PDGF-AB and ET-1 release at
any time point in BEAS-2B cells (Fig. 5, A and B). This contrasts
with NHBE cells, where poly-L-glutamic acid inhibited signifi-
4866
EOSINOPHIL CATIONIC PROTEINS AND AIRWAY REMODELING
0.3, and 1 ␮M) that had been used in other studies of their effector
functions and that failed to induce epithelial cell cytotoxicity (34 –
37). Importantly, these concentrations of cationic proteins were
even lower that those measured in peripheral blood of atopic individuals and in the airways of asthmatics (38, 39).
We found that both MBP and EPO increased the levels of the
transcripts encoding ET-1, TGF-␣, TGF-␤1, EGFR, PDGF-␤, and
tenascin in both BEAS-2B and NHBE cells. Under these conditions, cationic proteins down-regulated MMP-1 gene expression in
BEAS-2B cells, without altering its levels in NHBE cells. In addition, MBP, but not EPO, up-regulated MMP-9 and fibronectin
mRNAs in BEAS-2B cells, whereas both MBP and EPO increased
these genes in NHBE cells.
To establish whether cationic protein-induced remodeling factor
gene expression was associated with proportionate changes in the
synthesis of the corresponding proteins, we measured the concentrations of ET-1 and PDGF-AB in the cell supernatants by specific
ELISAs and the expression of cell-associated MMP-1 and MMP-9
by Western blot. Cell stimulation with MBP promoted both ET-1
and PDGF-AB release, whereas EPO increased the levels of
PDGF-AB, but not of ET-1. In addition, Western blot analyses
demonstrated lower amounts of MMP-1 and higher levels of
MMP-9 in whole protein extracts from MBP- and EPO- as compared with vehicle-stimulated cells. Collectively, these results indicate that the transcriptional effects of MBP and EPO result in
proportionate changes in the synthesis of some, but not all proteins
and that these two cationic proteins do not necessarily share all
activity-related effects, suggesting that they may use different pathways to activate gene transcription and protein synthesis in airway
epithelial cells.
The expression of most of the remodeling factors that we have
analyzed was increased in asthmatic airways, including in association with the bronchial epithelium, and it was frequently correlated with disease severity (6, 7, 40 – 47). These factors modulate
several aspects of airway remodeling, as suggested by in vitro
studies. Thus, EGFR is likely to play an important role in bronchial
epithelial repair in asthma, and its excessive expression and abnormal function contribute to subepithelial fibrosis (26, 40).
TGF-␣, one of the ligands of EGFR that regulates lung remodeling
and morphogenesis (47), is induced in patients with chronic inflammatory lung diseases characterized by tissue remodeling, including asthma (46). TGF-␤1 elicits differentiation of fibroblasts
into myofibroblasts, which, in turn, secrete interstitial collagen and
other fibrogenic growth factors (48). PDGF-␤ regulates airway
smooth muscle cell proliferation, chemotaxis, and activation (49 –
51), and contributes to lung fibroblast growth (52). ET-1 is a 21-aa
peptide that plays an important role in the pathogenesis of airway
remodeling by inducing collagen secretion by lung fibroblasts and
fibronectin synthesis by bronchial epithelial cells, and by amplifying EGF-induced airway smooth muscle cell proliferation (53–
55). Finally, MMPs govern ECM turnover and degradation, and
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 5. Poly-L-glutamic acid modulates MBP-, EPO-, and poly-L-arginine-induced production of remodeling factors by BEAS-2B cells. BEAS-2B
cells were stimulated for 6, 24, and/or 48 h with 1 ␮M MBP, EPO, poly-L-arginine (poly-L-arg), or with the vehicle of cationic proteins, i.e., sodium acetate
buffer, or with 1 ␮M poly-L-glutamic acid (poly-L-glu), alone, or in association with cationic proteins. The concentrations of PDGF-AB (A) and ET-1 (B)
were measured in the cell-free supernatants by specific ELISAs. The levels of cell-associated MMP-1 (C) and MMP-9 (D) were assessed by immunoblot
in protein extracts from BEAS-2B cells stimulated for 24 h. The intensity of the expression of MMP-1 (54 kDa) and MMP-9 (67 kDa) were quantified by
densitometry. Values are expressed as a ratio, defined as the OD values MMP-1 or MMP-9 bands/OD value of the corresponding ␤-actin bands. A
representative Western blot profile of MMP-1 and of MMP-9 expression is shown under the corresponding graph. Results are the means ⫾ SEM of three
distinct experiments. ⴱ, p ⬍ 0.05, as compared with vehicle-treated cells; †, p ⬍ 0.05, as compared with poly-L-glutamic acid-treated cells, and ‡, p ⬍ 0.05,
as compared with MBP-, EPO-, or poly-L-arginine-stimulated cells.
The Journal of Immunology
4867
regulate inflammation and repair processes (56). Increased or misregulated levels of MMP-9 are believed to contribute to chronic
airway inflammation and remodeling in asthma (45).
Among the remodeling factors examined, MMP-1 was unique in
showing a marked down-regulation in response to cationic proteins. MMP-1 degrades fibrillary collagen (56) and temporal and
spatial expression studies revealed its early increase in migrating
corneal epithelial and stromal cells at the wound edge (57). In
addition, recent data demonstrated that defective wound closure
resulting from the exposure of human bronchial epithelial cells to
diesel exhaust particles was accompanied by a selective decrease
in MMP-1 expression (58), indicating that MMP-1 plays an important role in the early phases of epithelial cell migration and
repair (59). Together, these findings and our present observations
suggest that, by inhibiting MMP-1 synthesis, eosinophil granule
proteins may contribute to collagen accumulation on the one hand,
and delay epithelial regeneration after damage, on the other.
Many of the in vitro and in vivo biological properties of MBP
and EPO are mediated by their cationic charge, as determined by
the inhibitory activity of anionic molecules, such as heparin and
polyanions (18 –20, 25, 60). Here we demonstrated that mixing
MBP or EPO with poly-L-glutamic acid or with heparin downregulated ET-1, TGF-␣, EGFR, TGF-␤1, PDGF-␤, MMP-9, tenascin, and fibronectin gene expression and restored the levels of
MMP-1 mRNA, suggesting that the charge of these cationic proteins plays an important role in their stimulatory potential. However, poly-L-glutamic acid, by itself, reduced the levels of MMP-1
mRNA (but not the expression of the corresponding protein) and
promoted PDGF-AB release. These observations underline the difficulty to firmly conclude that the effects of poly-L-glutamic acid or
of heparin on the synthesis and release of remodeling factors in
response to MBP and EPO that we presently describe, are exclusively the result of the contrasting charge of these molecules. Nevertheless, we showed that the surrogate cationic molecule, poly-Larginine, reproduced most of the effects of MBP and EPO in both
BEAS-2B and NHBE cells. These include the increase in the levels
of ET-1, TGF-␤1, EGFR, and MMP-9 mRNAs, the release of ET-1
and PDGF-AB in cell supernatants and the production of cellassociated MMP-9. Overall, these observations support a dominant
role for the cationic charge in mediating some, but not all transcriptional and posttranscriptional effects of MBP and EPO on
airway epithelial cells. Several hypotheses may explain the disparity in the effects observed between poly-L-arginine, MBP and EPO.
These include, for example, their marked differences in tertiary
conformation and in the proportion of arginine and other amino
acid residues, which may influence their charge and interactions
with cell environment (61, 62). In addition and contrary to MBP,
EPO belongs to the peroxidase superfamily, which possesses catalytic properties that confer a wide panel of potential activations (62,
63). Finally, Fuchs et al. (64) demonstrated that arginine residues of
poly-L-arginine facilitate its transduction in endocytic vesicles of living cells, whereas MBP has a poor solubility and a tendency to polymerize with itself and with other proteins. In contrast, although remaining as a monomeric molecule, EPO may interact with other
molecules of its environment, leading to altered biological activities (64).
To our knowledge, few reports have investigated links between
eosinophil-derived cationic proteins and airway remodeling in
vitro. An early study demonstrated that eosinophil-cationic protein
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 6. Poly-L-glutamic acid modulates MBP-, EPO-, and poly-L-arginine-induced production of remodeling factors by primary cultured NHBE.
Cells were stimulated for 6, 24, and/or 48 h with 1 ␮M MBP, EPO, poly-L-arginine (poly-L-arg), or with the vehicle of cationic proteins, i.e., sodium acetate
buffer, or with 1 ␮M poly-L-glutamic acid (poly-L-glu), alone, or in association with cationic proteins. The concentrations of PDGF-AB (A) and ET-1 (B)
were measured in the cell-free supernatants by specific ELISAs. The levels of cell-associated MMP-1 and MMP-9 (C) were assessed by immunoblot in
protein extracts from NHBE cells stimulated for 24 h. The intensity of the expression of MMP-1 (25 kDa) and MMP-9 (67 kDa) were quantified by
densitometry as explained in the legend of Fig. 5. Results are the means ⫾ SEM of three independent experiments performed with cells from three distinct
donors. ⴱ, p ⬍ 0.05, as compared with vehicle-treated cells; †, p ⬍ 0.05, as compared with poly-L-glutamic acid-treated cells, and ‡, p ⬍ 0.05, as compared
with MBP-, EPO-, or poly-L-arginine-stimulated cells.
4868
EOSINOPHIL CATIONIC PROTEINS AND AIRWAY REMODELING
Disclosures
The authors have no financial conflict of interest.
References
1. Kroegel, C., J. A. Warner, J.-C. Virchow, and H. Matthys. 1994. Pulmonary
immune cells in health and disease: the eosinophil leucocyte (part II). Eur. Respir. J. 7: 743–760.
2. Butterfield, J. H., and K. M. Leiferman. 1993. Eosinophil-associated diseases. In
The Handbook of Immunopharmacology, Immunopharmacology of Eosinophils.
H. Smith, and R. M. Cook, eds. Academic Press, London, pp. 152–192.
3. Jeffery, P. K., A. J. Wardlaw, F. C. Nelson, J. V. Collins, and A. B. Kay. 1989.
Bronchial biopsies in asthma. Am. Rev. Respir. Dis. 140: 1745–1753.
4. Bousquet, J., P. Chanez, J. Y. Lacoste, G. Barnéon, N. Ghavanian, I. Enander,
P. Venge, S. Ahlstedt, J. Simony-Lafontaine, P. Godard, et al. 1990. Eosinophilic
inflammation in asthma. N. Engl. J. Med. 323: 1033–1039.
5. Djukanovic, R., W. R. Roche, J. W. Wilson, C. R. W. Beasley, O. P. Twentyman,
and P. H. Howarth. 1990. Mucosal inflammation in asthma. Am. Rev. Respir. Dis.
142: 434 – 457.
6. Kay, A. B., S. Phipps, and D. S. Robinson. 2004. A role for eosinophils in airway
remodeling in asthma. Trends Immunol. 25: 477– 482.
7. Bousquet, J., P. Jeffery, W. W. Busse, M. Johnson, and A. M. Vignola. 2000.
Asthma: from bronchoconstriction to airways inflammation and remodeling.
Am. J. Respir. Crit. Care Med. 161: 1720 –1745.
8. Jeffery, P. K. 2001. Remodeling in asthma and chronic obstructive pulmonary
disease. Am. J. Respir. Crit. Care Med. 164: S28 –S38.
9. Trifilieff, A., Y. Fujitani, A. J. Coyle, M. Kopf, and C. Bertrand. 2001. IL-5
deficiency abolishes aspects of airway remodelling in a murine model of lung
inflammation. Clin. Exp. Allergy 31: 934 –942.
10. Cho, J. Y., M. Miller, K. J. Baek, J. W. Han, J. Nayar, S. Y. Lee, K. McElwain,
S. McElwain, S. Friedman, and D. H. Broide. 2004. Inhibition of airway remodeling in IL-5-deficient mice. J. Clin. Invest. 113: 551–560.
11. Tanaka, H., M. Komai, K. Nagao, M. Ishizaki, D. Kajiwara, K. Takatsu,
G. Delespesse, and H. Nagai. 2004. Role of interleukin-5 and eosinophils in
allergen-induced airway remodeling in mice. Am. J. Respir. Cell Mol. Biol. 31:
62– 68.
12. Humbles, A. A., C. M. Lloyd, S. J. McMillan, D. S. Friend, G. Xanthou,
E. E. McKenna, S. Ghiran, N. P. Gerard, C. Yu, S. H. Orkin, et al. 2004. A critical
role for eosinophils in allergic airway remodeling. Science 305: 1776 –1779.
13. Lee, J. J., D. Dimina, M. P. Macias, S. I. Ochkur, M. P. McGarry, K. R. O’Neill,
C. Protheroe, R. Pero, T. Nguyen, S. A. Cormier, et al. 2004. Defining a link with
asthma in mice congenitally deficient in eosinophils. Science 305: 1773–1776.
14. Flood-Page, P., A. Menzies-Gow, S. Phipps, S. Ying, A. Wangoo, M. S. Ludwig,
N. Barnes, D. Robinson, and A. B. Kay. 2003. Anti-IL-5 treatment reduces deposition of ECM proteins in the bronchial basement membrane of mild atopic
asthmatics. J. Clin. Invest. 112: 1029 –1036.
15. Lange, P., J. Parner, J. Vestbo, P. Schnohr, and G. Jensen. 1998. A 15-year
follow-up study of ventilatory function in adults with asthma. N. Engl. J. Med.
339: 1194 –1200.
16. Gleich, G. J., E. Frigas, D. A. Loegering, D. L. Wassom, and D. Steinmuller.
1979. Cytotoxic properties of the eosinophil major basic protein. J. Immunol.
123: 2925–2927.
17. Hamann, K. J., R. L. Barker, R. M. Ten, and G. J. Gleich. 1991. The molecular
biology of eosinophil granule proteins. Int. Arch. Allergy Appl. Immunol. 94:
202–209.
18. Barker, R. L., R. H. Gundel, G. J. Gleich, J. L. Checkel, D. A. Loegering,
L. R. Pease, and K. J. Hamann. 1991. Acidic polyamino acids inhibit human
eosinophil granule major basic protein toxicity: evidence of a functional role for
ProMBP. J. Clin. Invest. 88: 798 – 805.
19. Gundel, R. H., L. G. Letts, and G. J. Gleich. 1991. Human eosinophil major basic
protein induces airway constriction and airway hyperresponsiveness in primates.
J. Clin. Invest. 87: 1470 –1473.
20. Coyle, A. J., S. J. Ackerman, and C. G. Irvin. 1993. Cationic proteins induce
airway hyperresponsiveness dependent on charge interactions. Am. Rev. Respir.
Dis. 147: 896 –900.
21. O’Donnell, M. C., S. J. Ackerman, G. J. Gleich, and L. L. Thomas. 1983. Activation of basophil and mast cell histamine release by eosinophil granule major
basic protein. J. Exp. Med. 157: 1981–1991.
22. Uchida, D. A., S. J. Ackerman, A. J. Coyle, G. L. Larsen, P. F. Weller, J. Freed,
and C. G. Irvin. 1993. The effect of human eosinophil granule major basic protein
on airway responsiveness in the rat in vivo: a comparison with polycations. Am.
Rev. Respir. Dis. 147: 982–988.
23. Herbert, C. A., D. Edwards, J. R. Boot, and C. Robinson. 1991. In vitro modulation of the eosinophil-dependent enhancement of the permeability of the bronchial mucosa. Br. J. Pharmacol. 104: 391–398.
24. Thomas, L. L., H. Kubo, D. J. Loegering, K. Spillard, A. J. Weaver,
D. J. McCormick, C. Weiler, and G. J. Gleich. 2001. Peptide-based analysis of
amino acid sequences important to the biological activity of eosinophil granule
major basic protein. Immunol. Lett. 78: 175–181.
25. Rochester, C. L., S. J. Ackerman, T. Zheng, and J. A. Elias. 1996. Eosinophilfibroblast interactions: granule major basic protein interacts with IL-1 and transforming growth factor-␤ in the stimulation of lung fibroblast IL-6-type cytokine
production. J. Immunol. 156: 4449 – 4456.
26. Holgate, S. T., D. E. Davies, P. M. Lackie, S. J. Wilson, S. M. Puddicombe, and
J. L. Lordan. 2000. Epithelial-mesenchymal interactions in the pathogenesis of
asthma. J. Allergy Clin. Immunol. 105: 193–204.
27. Knight, D. A., C. L. Lane, and S. M. Stick. 2004. Does aberrant activation of the
epithelial-mesenchymal trophic unit play a key role in asthma or is it an unimportant sideshow? Curr. Opin. Pharmacol. 4: 251–256.
28. Gleich, G. J., D. A. Loegering, K. G. Mann, and J. E. Maldonado. 1976. Comparative properties of the Charcot-Leyden crystal protein and the major basic
protein from human eosinophils. J. Clin. Invest. 57: 633– 640.
29. Carlson, M. G., C. G. Peterson, and P. Venge. 1985. Human eosinophil peroxidase: purification and characterization. J. Immunol. 134: 1875–1879.
30. Plager, D. A., D. A. Loegering, D. A. Weiler, J. L. Checkel, J. M. Wagner,
N. J. Clarke, S. Naylor, S. M. Page, L. L. Thomas, I. Akerblom, et al. 1999. A
novel and highly divergent homolog of human eosinophil granule major basic
protein. J. Biol. Chem. 274: 14464 –14473.
31. Lechner, J. F., and M. A. LaVeck. 1985. A serum-free method for culturing
normal human bronchial epithelial cells at clonal density. J. Tissue Culture Methods 9: 43– 48.
32. Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe,
and F. Speleman. 2002. Accurate normalization of real-time quantitative RT-PCR
data by geometric averaging of multiple internal control genes. Gen. Biol. 3:
1–11.
33. Ke, Y., R. R. Reddel, B. I. Gerwin, M. Miyashita, M. McMenamin, J. F. Lechner,
and C. C. Harris. 1988. Human bronchial epithelial cells with integrated SV40
virus T antigen genes retain the ability to undergo squamous differentiation. Differentiation 38: 60 – 66.
34. Motojima, S., E. Frigas, D. A. Loegering, and G. J. Gleich. 1989. Toxicity of
eosinophil cationic proteins for guinea pig tracheal epithelium in vitro. Am. Rev.
Respir. Dis. 139: 801– 805.
35. Kubo, H., D. A. Loegering, Y. Tohda, J. Bankers-Fulbright, C. R. Weiler,
H. Nakajima, L. L. Thomas, C. R. Adolphson, and G. J. Gleich. 1999. Discordant
and anomalous results among cytotoxicity assays: the confounding properties of
eosinophil granule major basic protein on cell viability assays. J. Immunol. Methods 227: 1–15.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
inhibited proteoglycan degradation in human lung fibroblasts suggesting that eosinophil degranulation may participate in the generation of pulmonary fibrosis (65). More recently, Rochester et al.
(25) showed that MBP synergized with IL-1␣ and TGF-␤1 to increase IL-6-type cytokine mRNA and protein synthesis by human
lung fibroblasts, largely by acting through its cationic charge.
However, under these conditions, type I collagen production and
cell proliferation were unaffected, indicating that while MBP regulates certain biological functions in these cells, it does not increase collagen output. Finally, Zagai et al. (66) reported the ability of eosinophil-cationic protein to augment fibroblast-mediated
collagen gel contraction, supporting the hypothesis that eosinophilderived cationic proteins contribute to ECM remodeling by interacting directly with mesenchymal cells.
Persistent airway eosinophilia has been reported in severe asthmatics despite long-lasting, high-dose steroid therapy (67, 68). In
these patients, irreversible structural changes of the bronchial wall
characterized by subepithelial fibrosis, mucous gland, and airway
smooth muscle hypertrophy and/or hyperplasia have been observed (7, 8, 69). Interestingly, a recent report demonstrated that a
single allergen challenge in patients with mild asthma induced
acute airway remodeling, with activation of epithelial cells and
fibroblasts and increased ECM protein deposition within the reticular basement membrane (70). The temporal association between
these structural alterations and eosinophil accumulation in the
bronchial wall led to the hypothesis that eosinophil-derived products may contribute to a rapid onset of airway remodeling (70).
In conclusion, this study demonstrates that subcytotoxic concentrations of eosinophil cationic proteins influence the synthesis
of bioactive molecules by epithelial cells that may disturb in vivo
the function and behavior of structural cells and alter the composition of ECM. Hence, these observations argue for a causal relationship between eosinophil degranulation and airway remodeling
in asthma and suggest that interventions targeting eosinophil cationic proteins may have a promising therapeutic application.
Lastly, these findings have implications for other syndromes associated with fibrosis, such as retroperitoneal fibrosis and sclerosing cholangitis, where eosinophil infiltration and degranulation are
prominent (71).
The Journal of Immunology
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
lication of pulmonary artery fibroblasts. Am. J. Respir. Cell Mol. Biol. 7:
492– 499.
Marini, M., S. Carpi, A. Bellini, F. Patalano, and S. Mattoli. 1996. Endothelin-1
induces fibronectin expression in human bronchial epithelial cells. Biochem. Biophys. Res. Commun. 220: 896 – 899.
Panettieri, R. A., R. G. Goldie, P. J. Rigby, A. J. Eszterhas, and D. W. Hay. 1996.
Endothelin-1-induced potentiation of human airway smooth muscle proliferation:
an ETA receptor-mediated phenomenon. Br. J. Pharmacol. 118: 191–197.
Parks, W. C., C. L. Wilson, and Y. S. López-Boado. 2004. Matrix metalloproteinases as modulators of inflammation and innate immunity Nat. Rev. Immunol.
4: 617– 629.
Daniels, J. T., G. Geerling, R. A. Alexander, G. Murphy, P. T. Khaw, and
U. Saarialho-Kere. 2003. Temporal and spatial expression of matrix metalloproteinases during wound healing of human corneal tissue. Exp. Eye Res. 77:
653– 664.
Doornaert, B., V. Leblond, S. Galiacy, G. Gras, E. Planus, V. Laurent, D. Isabey,
and C. Lafuma. 2003 Negative impact of DEP exposure on human airway epithelial cell adhesion, stiffness, and repair. Am. J. Physiol. 284: L119 –L132.
Daniels, J. T., G. A. Limb, U. Saarialho-Kere, G. Murphy, and P. T. Khaw. 2003.
Human corneal epithelial cells require MMP-1 for HGF. Invest. Ophthalmol. Vis.
Sci. 44: 1048 –1055.
Fryer, A. D., and D. B. Jacoby. 1992. Function of pulmonary M2 muscarinic
receptors in antigen-challenged guinea pigs is restored by heparin and poly-Lglutamate. J. Clin. Invest. 90: 2292–2298.
Temkin, V., H. Aingorn, L. Puxeddu, O. Goldshmidt, E. Zcharia, G. J. Gleich,
I. Vlodavsky, and F. Levi-Schaffer. 2004. Eosinophil major basic protein: first
identified natural heparanase-inhibiting protein. J. Allergy Clin. Immunol. 113:
703–709.
Thomsen, A. R., L. Sottrup-Jensen, G. J. Gleich, and C. Oxvig. 2000. The status
of half-cystine residues and locations of N-glycosylated asparagine residues in
human eosinophil peroxidase. Arch. Biochem. Biophys. 379: 147–152.
Furtmuller, P. G., M. Zederbauer, W. Jantschko, J. Helm, M. Bogner,
C. Jakopitsch, and C. Obinger. 2006. Active site structure and catalytic mechanisms of human peroxidases. Arch. Biochem. Biophys. 445: 199 –213.
Fuchs, S. M., and R. T. Raines. 2004. Pathway for polyarginine entry into mammalian cells. Biochemistry 43: 2438 –2444.
Hernnas, J., B. Sarnstrand, P. Lindroth, C. G. Peterson, P. Venge, and
A. Malmstrom, 1992. Eosinophil cationic protein alters proteoglycan metabolism
in human lung fibroblast cultures. Eur. J. Cell Biol. 59: 352–363.
Zagai, U., C. M. Skold, A. Trulson, P. Venge, and J. Lundahl. 2004. The effect
of eosinophils on collagen gel contraction and implication for tissue remodeling.
Clin. Exp. Immunol. 135: 427– 433.
Wenzel, S. E., L. B. Schwatz, E. L. Langmarck, J. L. Halliday, J. B. Trudeau,
R. L. Gibbs, and H. W. Chu. 1999. Evidence that severe asthma can be divided
pathologically into two inflammatory subtypes with distinct physiologic and clinical characteristics. Am. J. Respir. Crit. Care Med. 160: 1001–1008.
ten Brinke, A., A. H. Zwinderman, P. J. Sterk, K. F. Rabe, and E. H. Bel. 2004.
Refractory eosinophilic airway inflammation in severe asthma: effect of parenteral corticosteroids. Am. J. Respir. Crit. Care Med. 170: 601– 605.
Benayoun, L., A. Druilhe, M. C. Dombret, M. Aubier, and M. Pretolani. 2003.
Airway structural alterations selectively associated with severe asthma.
Am. J. Respir. Crit. Care Med. 167: 1360 –1368.
Phipps, S., F. Benyahia, T. T. Ou, J. Barkans, D. S. Robinson, and A. B. Kay.
2004. Acute allergen-induced airway remodeling in atopic asthma. Am. J. Respir.
Cell Mol. Biol. 31: 626 – 632.
Noguchi, H., G. M. Kephart, T. V. Colby, and G. J. Gleich. 1992. Tissue eosinophilia and eosinophil degranulation in syndromes associated with fibrosis.
Am. J. Pathol. 140: 521–528.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
36. Tagari, P., P. Chee, C. Chan, K. McKee, C. Black, D. Nicholson, and
A. W. Ford-Hutchinson. 1992. Quantitation of eosinophil major basic protein
cytotoxicity to rodent respiratory epithelium. Agents Actions 37: 171–173.
37. Barker, R. L., R. H. Gundel, G. J. Gleich, J. L. Checkel, D. A. Loegering,
L. R. Pease, and K. J. Hamann. 1991. Acidic polyamino acids inhibit human
eosinophil granule major basic protein toxicity: evidence of a functional role for
ProMBP. J. Clin. Invest. 88: 798 – 805.
38. Wassom, D. L., D. A. Loegering, G. O. Solley, S. B. Moore, R. T. Schooley,
A. S. Fauci, and G. J. Gleich. 1981. Elevated serum levels of the eosinophil
granule major basic protein in patients with eosinophilia. J. Clin. Invest. 67:
651– 661.
39. Frigas, E., D. A. Loegering, G. O. Solley, G. M. Farrow, and G. J. Gleich. 1981.
Elevated levels of the eosinophil granule major basic protein in the sputum of
patients with bronchial asthma. Mayo Clin. Proc. 56: 345–353.
40. Puddicombe, S. M., R. Polosa, A. Richter, M. T. Krishna, P. H. Howarth,
S. T. Holgate, and D. E. Davies. 2000. Involvement of the epidermal growth
factor receptor in epithelial repair in asthma. FASEB J. 14: 1362–1374.
41. Redington, A. E., D. R. Springall, Q. H. Meng, A. B. Tuck, S. T. Holgate,
J. M. Polak, and P. H. Howarth. 1997. Immunoreactive endothelin in bronchial
biopsy specimens: increased expression in asthma and modulation by corticosteroid therapy. J. Allergy Clin. Immunol. 100: 544 –552.
42. Minshall, E. M., D. Y. M. Leung, R. J. Martin, Y. L. Song, L. Cameron, P. Ernst,
and Q. Hamid. 1997. Eosinophil-associated TGF-␤1 mRNA expression and airways fibrosis in bronchial asthma. Am. J. Respir. Cell Mol. Biol. 17: 326 –333.
43. Vignola, A. M., P. Chanez, G. Chiappara, A. Merendino, E. Pace, A. Rizzo,
A. M. la Rocca, V. Bellia, G. Bonsignore, and J. Bousquet. 1997. Transforming
growth factor-␤ expression in mucosal biopsies in asthma and chronic bronchitis.
Am. J. Respir. Crit. Care Med. 156: 591–599.
44. Hoshino, M., Y. Nakamura, and J. J. Sim. 1998. Expression of growth factors and
remodelling of the airway wall in bronchial asthma. Thorax 53: 21–27.
45. Wenzel, S. E., S. Balzar, M. Cundall, and H. W. Chu. 2003. Subepithelial basement membrane immunoreactivity for metalloproteinase 9: association with
asthma severity, neutrophilic inflammation and wound repair. J. Allergy Clin.
Immunol. 111: 1345–1352.
46. Amishima, M., M. Munakata, Y. Nasuhara, A. Sato, T. Takahashi, Y. Homma,
and Y. Kawakami. 1998. Expression of epidermal growth factor and epidermal
growth factor receptor immunoreactivity in the asthmatic human airway.
Am. J. Respir. Crit. Care Med. 157: 1907–1912.
47. Bonner, J. C. 2002. The epidermal growth factor receptor at the crossroads of
airway remodeling. Am. J. Physiol. 283: L528 –L530.
48. Annes, J. P., J. S. Munger, and D. B. Rifkin. 2003. Making sense of latent TGF
␤ activation. J. Cell Sci. 116: 217–224.
49. Hirst, S. J., P. J. Barnes, and C. H. Twort. 1996. PDGF isoform-induced proliferation and receptor expression in human cultured airway smooth muscle cells.
Am. J. Physiol. 270: L415–L428.
50. Walker, T. R., S. M. Moore, M. F. Lawson, R. A. Panettieri, Jr., and
E. R. Chilvers. 1998. Platelet-derived growth factor-BB and thrombin activate
phosphoinositide 3-kinase and protein kinase B: role in mediating airway smooth
muscle proliferation. Mol. Pharmacol. 54: 1007–1015.
51. Hedges, J. C., M. A. Dechert, I. A. Yamboliev, J. L. Martin, E. Hickey,
L. A. Weber, and W. T. Gerthoffer. 1999. A role for p38MAPK/HSP27 pathway
in smooth muscle cell migration. J. Biol. Chem. 274: 24211–24219.
52. Ingram, J. L., A. B. Rice, K. Geisenhoffer, D. K. Madtes, and J. C. Bonner. 2004.
IL-13 and IL-1␤ promote lung fibroblast growth through coordinated up-regulation of PDGF-AA and PDGF-R␣. FASEB J. 18: 1132–1134.
53. Peacock, A. J., K. E. Dawes, A. Shock, A. J. Gray, J. T. Reeves, and
G. J. Laurent. 1992. Endothelin-1 and endothelin-3 induces chemotaxis and rep-
4869