2244–2250 Nucleic Acids Research, 2002, Vol. 30, No. 10
© 2002 Oxford University Press
M-DNA is stabilised in G•C tracts or by incorporation of
5-fluorouracil
David O. Wood, Michael J. Dinsmore, Grant A. Bare and Jeremy S. Lee*
Department of Biochemistry, College of Medicine, University of Saskatchewan, Saskatoon, Saskatchewan
S7N 5E5, Canada
Received November 21, 2001; Revised and Accepted March 21, 2002
ABSTRACT
M-DNA is a complex between the divalent metal ions
Zn2+, Ni2+ and Co2+ and duplex DNA which forms at a pH
of ∼8.5. The stability and formation of M-DNA was monitored with an ethidium fluorescence assay in order to
assess the relationship between pH, metal ion concentration, DNA concentration and the base composition.
The dismutation of calf thymus DNA exhibits hysteresis
with the formation of M-DNA occurring at a higher pH
than the reconversion of M-DNA back to B-DNA.
Hysteresis is most prominent with the Ni form of
M-DNA where complete reconversion to B-DNA takes
several hours even in the presence of EDTA. Increasing
the DNA concentration leads to an increase in the metal
ion concentration required for M-DNA formation. Both
poly(dG)•poly(dC) and poly(dA)•poly(dT) formed
M-DNA more readily than the corresponding mixed
sequence DNAs. For poly(dG)•(poly(dC) M-DNA
formation was observed at pH 7.4 with 0.5 mM ZnCl2.
Modified bases were incorporated into a 500 bp fragment of phage λ DNA by polymerase chain reaction.
DNAs in which guanine was replaced with hypoxanthine or thymine with 5-fluorouracil formed M-DNA
at pHs below 8 whereas substitutions such as 2-aminoadenine and 5-methylcytosine had little effect.
Poly[d(A5FU)] also formed a very stable M-DNA duplex
as judged from Tm measurements. It is evident that the
lower the pKa of the imino proton of the base, the lower
the pH at which M-DNA will form; a finding that is
consistent with the replacement of the imino proton
with the metal ion.
INTRODUCTION
The Watson and Crick model of duplex DNA has been the
foundation of molecular biology for nearly 50 years. Small
variations in the standard B-DNA structure have been well
documented (1,2). For example, the A-conformation tends to
form at higher ionic strength and is also the conformation
favoured by RNA duplexes and mixed RNA/DNA duplexes
(3). Z-DNA forms a left-handed rather than right-handed helix
but the base pairing is still of the Watson–Crick form. The
Z-conformation is favoured by alternating pyrimidine/purine
sequences, the replacement of cytosine with 5-methylcytosine
(m5C) and the addition of multivalent cations (4). Normal
B-DNA has antiparallel strands but it is possible by the use of
sequence constraints to force a parallel-stranded structure (5).
However, even in this case, Watson–Crick base pairing is
maintained. On the other hand, several structures have been
reported that contain other types of base pairing.
Three-stranded or triplex structures have attracted considerable interest recently because they may be involved in long
range DNA/DNA interactions and also form the basis of antigene therapies (6–8). Triplexes are based on a standard
Watson–Crick duplex with the third strand being added with
Hoogsteen hydrogen bonding (6). In general, the underlying
duplex must be pyrimidine•purine and the third strand either all
pyrimidine or all purine. The resulting pyrimidine•purine•pyrimidine triplex is stabilised by low pH and the presence of m5C
while the pyrimidine•purine•purine triplex requires multivalent cations for formation (9,10). Both types of triplex are
inhibited by the incorporation of 7-deazapurines which interfere with Hoogsteen hydrogen bonds (6,11). Four-stranded
helices have also been described based on the guanine quartet
motif (12). An interesting aspect of the tetraplex is the
dramatic stabilisation by ions such as K+ and Ba2+ which are
bound inside the helix to the 6-keto groups of the guanines (13).
Another metal complex, called M-DNA, can be formed
between duplex DNA and Zn2+, Ni2+ or Co2+ at pHs above 8.5
(14). The complex can be converted back to B-DNA by either
lowering the pH or adding EDTA to remove the metal ion (14).
However, as with other dismutations of DNA, hysteresis
occurs (4,15–17); that is, once M-DNA is formed it will remain
in this conformation under conditions where B-DNA will not
convert to M-DNA. Several lines of evidence suggest that the
metal ion is replacing the imino protons of G and T (Fig. 1A).
First, one proton is released per metal ion per base pair upon
formation of M-DNA (18). Secondly, the imino protons disappear
from the proton NMR spectrum on addition of the metal ion
(14). As well, the intercalating drug, ethidium bromide, will
not bind to M-DNA presumably because the metal ion repels
the positively charged drug molecule (14,18). The lack of
ethidium binding forms the basis of a rapid fluorescence assay;
briefly, if B-DNA is added to a pH 8.3 buffer containg ethidium
and 0.2 mM Zn2+ the ethidium will bind and the fluorescence will
be enhanced. If M-DNA is added to the same buffer the
conversion to B-DNA is very slow, ethidium does not bind and
there is no enhancement of fluorescence (14). By addition of
EDTA, the M-DNA is converted back to B-DNA and the
*To whom correspondence should be addressed. Tel: +1 306 966 4371; Fax: +1 306 966 4390; Email: [email protected]
Nucleic Acids Research, 2002, Vol. 30, No. 10 2245
than the usual bases which is consistent with the requirement
of replacing the imino protons of the bases with the metal ion
during the formation of M-DNA.
MATERIALS AND METHODS
Nucleic acids
Figure 1. (A) Proposed structure of the base pairs of M-DNA. (B) Structure of
the modified nucleosides with the corresponding abbreviations for the bases.
fluorescence is restored. The addition of EDTA also serves to
distinguish between M-DNA and denatured DNA since the
latter does not bind ethidium with or without EDTA.
The circular dichroism, UV spectra and electrophoretic
behaviour of M-DNA are all similar to that of B-DNA (14,18).
On the other hand, M-DNA has the remarkable property of
allowing electron transfer through the DNA helix. Direct
measurements have demonstrated that B-DNA is a semiconductor with a wide band gap whereas M-DNA shows metallic
conduction (19). Similarly, electron transfer can be shown to
occur between donor and acceptor fluorophores at opposite ends
of M-DNA duplexes (18). In the presence of a DNA-binding
protein the electron transfer is blocked. Therefore, M-DNA
may be useful as a building block in nanoelectronics or as a
biosensor for DNA-binding molecules.
However, studies on M-DNA are complicated by the very
narrow range of conditions under which it will form. If the pH
is too high the DNA can be denatured or the metal ion can
precipitate, and if the pH is too low then M-DNA will not form.
Therefore, it would be advantageous to find methods to stabilise
M-DNA at lower pH. Since the sequence of the DNA or the
incorporation of unusual bases can have a dramatic effect on
the preferred conformation of nucleic acids, we have prepared
repeating sequence DNAs and DNA duplexes containing
several modified bases and assessed their ability to stabilise
M-DNA. The structures of the nucleosides and the abbreviations
for the bases are shown in Figure 1B. Here we report that
poly(dG)•poly(dC) forms M-DNA at pHs within the physiological range. As well, the incorporation of hypoxanthine in
place of guanine or 5-fluorouracil (5FU) in place of thymine
gives rise to more stable forms of M-DNA at lower pH
whereas m5C and 7-deazaadenine (z7A) have little effect or are
destabilising. Both hypoxanthine and 5FU have lower pKas
The synthetic DNAs poly(dG)•poly(dC), poly[d(GC)],
poly[d(GGCC)], poly(dA)•poly(dT), poly[d(AT)] and
poly[d(A5FU)] were synthesised with Escherichia coli DNA
polymerase as described previously (16,17). Poly[r(AU)] was
transcribed from poly[d(AT)] with E.coli RNA polymerase
(20). Calf thymus DNA (CT-DNA) was purchased from
Sigma. All other DNAs were synthesised by means of the
polymerase chain reaction (PCR). Template DNA for PCR was
either λ phage DNA (Amersham Pharmacia Biotech) or a
plasmid, 0.54 src-cat, containing the human c-src proto-oncogene
(gift from Dr K. Bonham, Saskatoon Cancer Center). Primers
for both templates were purchased from the Calgary Regional
DNA Synthesis Laboratory. Primers for the λ genome amplified
between bases 13 and 509; 496 bp total with a GC content of
54%. The sequences of primers were as follows: λ-13,
d(GCGGGTTTTCGCTATTATG); λ-509, d(CAGCGGAGTCTCTGGCATTC).
Primers for the 0.54 src-cat plasmid amplified a 73% GC
516 bp region between bases –793 and –277 of the upstream
non-coding sequence of the c-src gene. The sequences of the
primers were as follows: C-src-(–793), d(TGAGCAGCTTAGCATGGCGC); C-src-(–277), d(GCAGACGGACGCACGGGAGG).
Standard deoxyribonucleic acid triphosphates (dNTPs) and
Taq DNA polymerase were purchased from Amersham Pharmacia Biotech. Tth DNA polymerase was purchased from
Roche. Vent DNA polymerase was purchased from New
England Biolabs. 5-Methyl-2′-deoxycytidine-5′-triphosphate,
2′-dexoxyuridine-5′-triphosphate and 2′-deoxyinosine-5′triphosphate were purchased from P-L Biochemicals. 2Amino-2′-deoxyadenosine-5′-triphosphate,
5-fluoro-2′deoxyuridine-5′-triphosphate, 5-bromo-2′-deoxyuridine5′-triphosphate and 7-deaza-2′-deoxyadenosine-5′-triphosphate were purchased from Trilink Biotechnologies.
Substitution of 5-methyl-2′-deoxycytidine-5′-triphosphate
for 2′-deoxycytidine-5′-triphosphate was performed with Vent
DNA polymerase. Substitution of 2-amino-2′-deoxyadenosine-5′triphosphate for 2′-deoxyadenosine-5′-triphosphate required Tth
DNA polymerase. All other substitutions were performed with
Taq DNA polymerase. All PCRs contained 0.25 mM of each
dNTP, 15 µM (in phosphates) of template DNA and 9.6 µM of
each primer. The appropriate buffer (as suggested by the
supplier) was used for each polymerase, and Mg2+ concentrations were optimised separately for each different PCR.
Cycling conditions were 30 s each at 94, 45 and 72°C for Taq
and Vent DNA polymerase. PCRs with Tth DNA polymerase
were cycled at 94°C for 2 min, then 10 cycles of 94°C for 30 s,
followed by 50°C for 30 s, followed by 72°C for 45 s. Twenty
more cycles followed, with each successive 72°C step being
elongated by 5 s and a final 72°C step of 2 min.
All DNAs were purified using the Concert Rapid PCR purification system (Gibco BRL).
2246 Nucleic Acids Research, 2002, Vol. 30, No. 10
Ethidium fluorescence assays
The basic assay has been described previously; B-DNA binds
ethidium bromide and fluoresces, M-DNA does not. Addition
of EDTA chelates the metal ion and converts any M-DNA
back to B-DNA.
Effect of substituted bases
Aliquots of 100 µl of 15 µM DNA (in bases) in 4 mM 2-[Ncyclohexylamino]ethanesulfonic acid, pH 9.0 (CHES; Sigma)
with 10 mM NaCl were converted to M-DNA by addition of
0.2 mM ZnCl2 and incubation for 2 h. Following M-DNA
formation, 2 ml of ethidium fluorescence buffer (EFB) was
added to each sample, as well as to samples of B-DNA, giving
a final DNA concentration of 0.71 µM. The EFB contained
10 mM buffer, 0.2 mM ZnCl2 and 0.5 µg/ml ethidium bromide.
Control experiments demonstrated that the ethidium did not
increase the pHm by more than 0.2 pH units (see Results and
Discussion). Six pHs of EFB were used; pH 6.0 with 2-[Nmorpholino]ethanesulfonic acid (MES) buffer, pH 7.5, 7.75,
8.0, 8.3 and 8.6 with Tris–HCl buffer. The aliquots were incubated in the EFB for 30 min then the emission at 600 nm was
read following excitation at 525 nm in a Hitachi F-2500 fluorescence spectrophotometer. EDTA was added to a final
concentration of 1.0 mM following each measurement, and the
fluorescence was remeasured. All values are reported as
percentage B-DNA normalised against the pH 6.0 reading
which is taken as 100% B-DNA.
Comparison of metal ions
Aliquots of 100 µl of 15 µM λ 496mer in 4 mM CHES pH 9
with 10 mM NaCl were converted to M-DNA by addition of
0.2 mM ZnCl2, 0.3 mM NiCl2 or 0.5 mM CoCl2. The aliquots
were incubated for 2 h with and without metal ion added.
Following M-DNA formation, 100 µl of 25 mM buffer with
10 mM NaCl was added to the incubation, giving a final DNA
concentration of 7.5 µM and the metal ion concentration was
adjusted to 0.25 mM in all cases. The pH values of the buffers
added were 5.0, 5.5 (sodium acetate), 6.0, 6.5 (MES buffer),
7.0 (N-[2-hydroxyethyl]piperazine-N′-[2-ethanesulfonic acid]
[HEPES]), 7.5, 8.2, 8.5 (Tris buffer), and 9.0 (CHES buffer).
The mixture was allowed to incubate for 10 min, then assayed
immediately in EFB, pH 8.3, before and after EDTA addition.
Measurement of reversion of Ni- and Co-M-DNA to
B-DNA over time
A 75 µM solution of CT-DNA in 20 mM CHES pH 9.0 with
10 mM NaCl was incubated in the presence of 0.5 mM NiCl2
or CoCl2 for 2 h to form M-DNA. Following this, EDTA was
added at concentrations from 0.1 to 1.0 mM. Aliquots (20 µl)
were taken over a period of 22 h and the fluorescence read
immediately in the EFB, pH 8.3.
Effect of DNA concentration on M-DNA formation
CT-DNA was dissolved in 20 mM Tris–HCl pH 8.5 or 20 mM
CHES pH 9.0 with 10 mM NaCl to a concentration of 4.5, 7.5,
15, 45, 75, 150 and 450 µM. ZnCl2, NiCl2 and CoCl2 were
added to aliquots of the DNA over a concentration range of
0.1–1.0 mM and incubated for 2 h. Following incubation, aliquots
containing 1.3 nmol of DNA were added to 2 ml of EFB and
read immediately before and after addition of EDTA. The
concentration of metal ion required for 50% M-DNA formation
was estimated by interpolation.
Thymidine analogue pKas
The pKa values for 5FU and 5-bromouracil (5BrU) were
unavailable in the literature. Uridine, 5-bromouridine and
5-fluorouridine (Sigma) were dissolved to 10 mM and titrated
with 1 N NaOH. The pKa values obtained were 9.3, 8.2 and 7.8
for uridine, 5-bromouridine and 5-fluorouridine, respectively.
The value of 9.3 for uridine is in agreement with a previous
report (21).
Thermal denaturation profiles
Tm measurements were made on a Gilford 600 spectrophotometer equipped with a thermoprogrammer with a DNA
concentration of 50 µM (bases). The buffer contained 5 mM
NaCl with 10 mM HEPES (pH 7.0) or 10 mM Tris (pH 7.5, 8.0,
8.5) or 10 mM CHES pH 9.0 with 0.2 mM ZnCl2 as appropriate.
RESULTS AND DISCUSSION
The ethidium fluorescence assay was used to investigate the
effects of pH on the conversion of B- to M-DNA and that of Mto B-DNA for all three metal ions with phage λ DNA (Fig. 2).
Control experiments showed that no denaturation occurred
even at the highest pH. Incubation of B-DNA with 0.25 mM
Zn2+ for 10 mins at pH 8.2 is sufficient for partial conversion to
M-DNA and nearly complete conversion occurs at pH 8.5. In
the opposite direction (i.e. M-DNA to B-DNA) the curve is
shifted by ∼0.3 pH units to the left and thus the dismutations
show some hysteresis under these conditions. As well, even
incubation of M-DNA at pH 6 for 10 min causes the reformation
of only ∼80% of the original B-DNA. However, the addition of
EDTA at any pH (see below) (or prolonged incubation at low
pH) causes the reformation of 100% B-DNA. Therefore, none
of the DNA is being denatured and particular sequences may
be exceptionally stable in the M-DNA conformation.
In the presence of 0.25 mM Co2+ the conversion of M-DNA
to B-DNA is similar to that with Zn2+. However, Co2+ is much
less effective at converting B-DNA to M-DNA compared with
Zn2+ and complete conversion does not occur under these
conditions in 10 min even at pH 9. With Ni2+ the conversion of
M-DNA to B-DNA is intermediate between that of Zn2+ and
Co2+ but once formed the Ni complex is remarkably stable and
reconversion to B-DNA is only observed at pHs below 6.
Upon addition of EDTA the metal ion is chelated and MDNA is converted back to B-DNA as shown in Figure 3 for
CT-DNA. For the Zn form of M-DNA the conversion occurs
within seconds (data not shown). In contrast, the Ni form and
Co form require up to 2 h for the reconversion when 1 mM
EDTA is added to 0.5 mM of metal ion. As well, if only 0.5 mM
EDTA is added only partial conversion to B-DNA is observed.
As previously described, increasing the metal ion concentration
increases the conversion to M-DNA but as shown in Figure 4 the
concentration of CT-DNA also effects the dismutation. At a DNA
concentration of 15 µM (in bases) and a pH of 8.5, 50%
conversion to M-DNA occurs with 0.25 mM Zn2+ but with 150
µM DNA 0.6 mM Zn2+ is required and for 1.5 mM DNA 50%
conversion cannot be achieved at a concentration of ZnCl2
which remains soluble. The Co form of M-DNA is similar to
the Zn form but conversion of the Ni complex to M-DNA at
Nucleic Acids Research, 2002, Vol. 30, No. 10 2247
Figure 3. Conversion of CT M-DNA to B-DNA at pH 8.5 after the addition of
EDTA. Co-M-DNA with 0.5 mM EDTA (circles) and 1 mM EDTA (triangles).
Ni-M-DNA with 0.5 mM EDTA (squares) and 1 mM EDTA (diamonds).
Figure 2. Conversion of phage λ B-DNA to M-DNA (diamonds) and M-DNA
to B-DNA (squares) as a function of pH after incubation for 10 min with 0.25 mM
metal ion. (A) ZnCl2; (B) CoCl2; and (C) NiCl2. Each point is the average of at
least three independent measurements.
pH 8.5 cannot be achieved above a DNA concentration of 10 µM.
It is clear that higher DNA concentrations require more metal
ion than that which is required to replace the imino protons. A
possible explanation is that the negatively charged phosphates on
the DNA backbone must be saturated before the metal can
occupy sites within the helix. However, at pH 9.0 the Ni form
of M-DNA can be prepared readily at much lower concentrations of NiCl2. In addition, the slopes of the plots for NiCl2 are
different at pH 8.5 and 9.0 suggesting that the structure of the
Ni2+ aquo ion may be important for the formation of M-DNA.
The effect of base substitutions was investigated by incorporating them by PCR into a 500 bp fragment of phage λ DNA.
The interconversion of B- and M-DNA was again studied by
the ethidium fluorescence assay but the conditions were altered
in order to be able to study all the modified DNAs under identical
conditions (see Materials and Methods). Therefore, the
resulting data of Figure 5 for the Zn form is not directly
comparable with that of Figure 2A. It is useful to define a pHm
value which is the pH at which 50% M-DNA and 50% B-DNA
coexist. Figure 5A shows the conversion of B-DNA to M-DNA
for several modifications and the results are summarised in
Table 1. For unmodified DNA the pHm value is 8.4 whereas for
5BrU-modified DNA it is 8.1. Other pyrimidine substitutions
Figure 4. The metal ion concentration required for 50% conversion of CT B-DNA
to M-DNA as a function of the DNA concentration. Diamonds, ZnCl2 at pH 8.5;
triangles, CoCl2 at pH 8.5; squares, NiCl2 at pH 8.5; circles, NiCl2 at pH 9.0.
such as uracil and 5FU also reduce the pHm value whereas
incorporation of m5C has little effect (Table 1). In the case of
purine substitutions, hypoxanthine-modified DNA has a pHm
value that is decreased by ∼0.5 pH units, whereas for z7A the
pHm value is 8.2 and for n2A increases to ∼8.6. A double modification was assessed by preparing the 500 bp fragment
containing both 5BrU and hypoxanthine. (The yields from
PCR of the fragment containing 5FU and hypoxanthine were
too low to be studied by the ethidium fluorescence assay.) In
this case the pHm value dropped to ∼7.8. Table 1 also lists the
pKa for each base and it is clear that lowering the pKa of the
base lowers the pHm value of the transition. The pHm value was
also measured for the reconversion of M-DNA to B-DNA
(Fig. 5B) and in general the values are ∼0.1–0.3 pH units lower
than for B-DNA to M-DNA, again demonstrating hysteresis.
One exception is n2A-modified DNA for which the difference
in pHm value for the forward and back dismutations is ∼0.6 pH
units. A 500 bp fragment with a 73% GC content was prepared
from the c-src gene promoter region. In this case the pHm value
is ∼0.2 units lower (B- to M-DNA) and 0.4 units lower (M- to
B-DNA) than for the λ DNA fragment which is 54% GC.
Therefore, some GC rich sequences may be exceptionally stable
as M-DNA.
2248 Nucleic Acids Research, 2002, Vol. 30, No. 10
completely converted to M-DNA and at pH 7.1 the 5FU-substituted
DNA will form ∼15% M-DNA. Similarly, poly(dG)•poly(dC) is
completely converted to the M conformation at pH 7.4 with
0.5 mM ZnCl2.
The effect of incorporating 5FU was studied further by
preparing poly[d(A5FU)] and measuring thermal denaturation
profiles with and without ZnCl2 at pHs between 7 and 9. As
shown in Figure 6 at pH 8.5 the Tm value of poly[d(AT)] is
increased by 5°C upon addition of 0.2 mM ZnCl2; such an
increase is not unexpected since the ionic strength of the buffer
is increased and a similar ∆Tm is observed upon addition of
MgCl2 (22). For the modified polymer the corresponding ∆Tm
upon addition of Zn2+ is ∼15°C and the unexpectedly large
increase is attributed to the formation of M-DNA. The results
for all pHs are summarised in Figure 7. In the absence of Zn2+
the Tm of poly[d(A5FU)] decreases as the pH increases
reflecting the pKa of 7.8 for 5FU. However, the decrease is
small so that incorporation of modified bases does not lead to
denaturation of the DNA under the standard conditions. A
similar decrease in the Tm value is not observed for
poly[d(AT)] since the pKa of T is 9.9. At pH 8 the increased
stability of poly[d(A5FU)] in the presence of Zn2+ is ∼10°C
and nearly 40°C at pH 9. For poly[d(AT)] an additional
increase in the Tm value upon addition of Zn2+ is only observed
at pH 9. Therefore, for poly[d(AT)] M-DNA forms at pH 9.0
whereas for poly[d(A5FU)] it occurs 1 pH unit lower.
CONCLUSION
Figure 5. Effect of base substitutions in phage λ DNA on (A) the conversion
of B-DNA to M-DNA and (B) the conversion of M-DNA to B-DNA with
0.2 mM ZnCl2. Squares, n2A; diamonds, control; triangles, hypoxanthine; circles,
BrU; inverted triangles, BrU and hypoxanthine. (C) The conversion of B-DNA
to M-DNA for repeating sequence nucleic acids. Diamonds,
poly(dG)•poly(dC); triangles, poly[d(GGCC)]; squares, poly[d(GC)]; circles,
poly[d(AU)]; inverted triangles, poly[r(AU)].
In order to investigate the effects of the sequence in more
detail, several synthetic DNAs were evaluated (Fig. 5C and
Table 1). For the conversion of B- to M-DNA poly(dG)•poly(dC)
has a pHm value of 7.8 compared with 8.5 for poly[d(GC)] with
poly[d(GGCC)] having an intermediate value. For AT
sequences the homopolymer poly(dA)•poly(dT) also has a
lower pHm value than the alternating polymer poly[d(AT)]
(pHm values of 8.1 and 8.6, respectively). Therefore,
purine•pyrimidine tracts form M-DNA most readily, presumably because the repeating sequence with all purines on one
strand allows for better stacking interactions. Alternatively,
purine•pyrimidine tracts tend to be overwound compared with
B-DNA (1). M-DNA is also overwound relative to B-DNA so
that the increased twist of these sequences might facilitate
M-DNA formation (14). Finally, the duplex RNA poly[r(AU)]
behaves like poly[d(AT)] and poly[d(AU)] so that the
M-conformation is also available to RNA sequences.
The pHm measurements were performed with 0.2 mM metal
ion. However, at a lower pH, higher metal ion concentrations
can be used before precipitation occurs. For example, at pH 7.4
with 1 mM ZnCl2 the doubly substituted DNA (0.71 µM) is
The conditions under which M-DNA will form have been
explored in detail with an ethidium fluorescence assay. At
present this is the only convenient assay to monitor the conversion
to M-DNA because the spectroscopic properties and circular
dichroism in the UV region are so similar to B-DNA (14). In
the visible region, Zn2+ complexes are colourless and the
extinction coefficients for the Ni2+ and Co2+ forms of M-DNA
are too small to allow accurate measurements. It is clear that
M-DNA formation depends on the nature and concentration of
the metal ion as well as the pH. Somewhat suprisingly, the
DNA concentration is also important even when the metal ion
is in vast excess, and places a further and unexpected
constraint on the conditions under which M-DNA will form.
As a further complication, hysteresis occurs so that M-DNA
can remain metastable under conditions in which it will not
form. This is particularly true of the Ni form which is very
refractive to reconversion to B-DNA (Fig. 3).
The proposed structure of M-DNA (Fig. 1) requires replacement of the imino protons of G and T with the metal ion. The
present results are consistent with this model because
decreasing the pKa of the base decreases the pHm and increases
the thermal stability of the M-DNA. Conversely, modifications
to A and C result in smaller changes in the pHm because these
bases do not lose a proton. Since hypoxanthine and 5FU are
readily incorporated into DNA both chemically or by DNA
polymerases, it is now possible to form M-DNA under a wider
range of conditions particularly at lower pH. With 1 mM ZnCl2
M-DNA will form at physiological pHs. A reduction in the
pHm value of 0.5 pH units allows approximately a 10-fold
increase in the metal ion concentration that can be used before
precipitation occurs (J.S.Lee and P.Aich, unpublished data).
Therefore, structural studies by crystallography and NMR that
Nucleic Acids Research, 2002, Vol. 30, No. 10 2249
Table 1. Effect of base substitutions on the formation and stability of M-DNA with 0.2 mM ZnCl2
DNA
pKa
pHm B- to M-DNA
pHm M- to B-DNA
Control 54% GC
T = 9.9; G = 9.4
8.4
8.3
c-src 73% GC
–
8.2
7.9
2-Aminoadenine
–
8.6
8.0
7-Deazaadenine
–
8.2
8.0
5-Methylcytosine
–
8.5
8.2
Hypoxanthine
H = 8.8
8.1
7.8
Uracil
U = 9.3
8.3
8.1
5-Bromouracil
5BrU = 8.2
8.0
7.8
5-Fluorouracil
5FU = 7.8
7.9
7.7
5-Bromouracil/hypoxanthine
5BrU = 8.2/H = 8.8
7.8
7.6
Poly(dG)•Poly(dC)
–
7.8
7.6
Poly[d(GGCC)]
–
8.2
7.8
Poly[d(GC)]
–
8.5
8.3
Poly(dA)•Poly(dT)
–
8.1
7.8
Poly[d(AT)]
–
8.6
8.4
Poly[d(AU)]
U = 9.3
8.4
8.1
Poly[r(AU)]
U = 9.3
8.5
8.1
The pHm is defined as the pH at which 50% conversion occurs either for B- to M-DNA or M- to B-DNA. The pKa is for
the imino protons of T- or G-type bases.
Figure 6. Thermal denaturation profiles for poly[d(AT)] and poly[d(A5FU)]
with and without 0.2 mM ZnCl2 at pH 8.5. (A), poly[d(A5FU)]; (B),
poly[d(AT)]; (C), poly[d(AT)] with 0.2 mM ZnCl2; (D), poly[d(A5FU)] with
0.2 mM ZnCl2.
have proved to be intractable in the past, may now be
attempted with greater confidence. As well, the discovery that
RNA can form a related metal complex increases the range of
applications in the areas of biosensing and DNA/RNA chips.
Does M-DNA have a biological role? Initially this seemed
unlikely because of the requirement for such a high pH but the
present results suggest that M-DNA might form under special
conditions. First, mammalian sperm contain high concentrations of zinc with an internal pH of ∼8.2 (23–25). Since
poly(dG)•poly(dC) forms M-DNA at pHs ∼7.4, then this and
perhaps other sequences may be in the M-DNA conformation.
Secondly, in most cells the concentration of Zn2+ is much
lower (26) but the M-DNA helix is more tightly wound than
B-DNA (14) so that local regions of positive supercoiling may
favour M-DNA formation particularly in G•C tracts. Finally,
Figure 7. The effect of pH on the Tm of poly[d(AT)] and poly[d(A5FU)] with
and without 0.2 mM ZnCl2. Diamonds, poly[d(AT)]; squares, poly[d(A5FU)];
triangles, poly[d(AT)] with 0.2 mM ZnCl2; circles, poly[d(A5FU)] with 0.2 mM
ZnCl2.
5FU is a common agent for cancer chemotherapy and it is
converted into nucleosides and nucleotides in vivo. Although
the drug inhibits thymidilate synthase, it is also incorporated
into RNA and DNA; and the level of incorporation into DNA
appears to correlate well with toxicity to the cell (27,28). It is
known that incorporation of 5FU alters the conformation of
DNA which contributes to its cytotoxicity (29). However,
incorporation of 5FU also favours M-DNA formation at pH 7.4
and this too may be detrimental to DNA metabolism.
ACKNOWLEDGEMENTS
This work was funded by CIHR and NSERC (Canada) by
grants to J.S.L. and by an NSERC graduate scholarship to
D.O.W.
2250 Nucleic Acids Research, 2002, Vol. 30, No. 10
REFERENCES
1. Dickerson,R.E. (1992) DNA structure from A to Z. In Lilley,D.M.J. and
Dahlberg,J.E. (eds), Methods in Enzymology. Academic Press Inc., San
Diego, Vol. 211, pp. 67–111.
2. Malinina,L., Fernandez,L.G., Huynh-Dinh,T. and Subirana,J.A. (1999)
Structure of the d(CGCCCGCGGGCG) dodecamer: a kinked A-DNA
molecule showing some B-DNA features. J. Mol. Biol., 285, 1679–1690.
3. Mooers,B.H.M., Schroth,G.P., Baxter,W.W. and Ho,P.S. (1995)
Alternating and non-alternating hexanucleotides crystallize as canonical
A-DNA. J. Mol. Biol., 249, 772–784.
4. Rich,A., Nordheim,A. and Wang,A.H.J. (1984) The chemistry and
biology of Z-DNA. Annu. Rev. Biochem., 53, 791–846.
5. van de Sande,J.H., Ramsing,N.B., Germann,M.W., Elhorst,W.,
Kalisch,B.W., Kitzing,E.V., Pon,R.T., Clegg,R.C. and Jovin,T.M. (1988)
Parallel stranded DNA. Science, 241, 551–557.
6. Soyfer,V.N. and Potaman,V.N. (1995) In vivo significance of triplestranded nucleic acid structures. In Triple-helical Nucleic Acids. Springer,
New York, pp. 220–252.
7. Chan,P.P. and Glazer,P.M. (1997) Triplex DNA: fundamentals, advances
and potential applications. J. Mol. Med., 75, 267–282.
8. Thomas,R.M., Thomas,T., Wada,M., Sigal,L.H., Shirahata,A. and
Thomas,T.J. (1999) Facilitation of the cellular uptake of a triplex-forming
oligonucleotide by novel polyamine analogues. Biochemistry, 38,
13328–13337.
9. Frank-Kamentskii,M.D. and Mirkin,S.M. (1995) Triplex DNA structures.
Annu. Rev. Biochem., 64, 65–95.
10. Plum,E.G., Pilch,D.S., Singleton,S.F. and Breslauer,K.J. (1995) Nucleic
acid hybridization: triplex stability and energetics. Annu. Rev. Biophys.
Biomol. Struct., 24, 319–350.
11. Latimer,L.J.P. and Lee,J.S. (1991) Ethidium does not fluoresce when
intercalated adjacent to 7-deazaguanine in duplex DNA. J. Biol. Chem.,
266, 13849–13851.
12. Zakian,V.A. (1995) Telomeres: beginning to understand the end. Science,
270, 1601–1607.
13. Sen,D. and Gilbert,W. (1990) A sodium–potassium switch in the
formation of four stranded G4-DNA. Nature, 344, 410–414.
14. Lee,J.S., Latimer,L.J.P. and Reid,R.S. (1993) A cooperative
conformational change in duplex DNA induced by Zn2+ and other divalent
metal ions. Biochem. Cell Biol., 71, 162–168.
15. Olivas,W.M. and Maher,L.J.,III (1995) Overcoming potassium-mediated
triplex inhibition. Nucleic Acids Res., 23, 1936–1941.
16. Hampel,K.J., Crosson,P. and Lee,J.S. (1991) Polyamines favour DNA
triplex formation at neutral pH. Biochemistry, 30, 4455–4459.
17. Lee,J.S., Woodsworth,M.L., Latimer,L.J.P. and Morgan,A.R. (1984)
Pyr.Pur DNAs containing 5-methylcytosine form stable triplexes at
neutral pH. Nucleic Acids Res., 12, 6603–6613.
18. Aich,P., Labiuk,S.L., Tari,L.W., Delbaere,L.J.T., Roesler,W.J., Falk,K.J.,
Steer,R.P. and Lee,J.S. (1999) M-DNA: a complex between divalent
metal ions and DNA which behaves as a molecular wire. J. Mol. Biol.,
294, 477–485.
19. Rakitin,A., Aich,P., Papadopoulos,C., Kobzar,Y., Vedeneev,A.S.,
Lee,J.S. and Xu,J.M. (2001) Metallic conduction through engineered
DNA: DNA nanoelectronic building blocks. Phys. Rev. Lett., 86,
3670–3673.
20. Hall,K., Cruz,P. and Chamberlin,M.J. (1985) Extensive synthesis of
poly[r(GC)] using E. coli RNA polymerase. Arch. Biochem. Biophys.,
236, 47–51.
21. Saenger,W. (1984) Physical properties of nucleotides. In Cantor,C.R.
(ed.), Principles of Nucleic Acid Structure. Springer-Verlag, New York,
pp. 110–112.
22. Eichorn,G.L. and Shin,Y.A. (1968) Interaction of metal ions with
polynucleotides and related compounds XII. J. Am. Chem. Soc., 90,
7323–7328.
23. Henkel,R., Bittner,J., Weber,R., Huther,F. and Miska,W. (1999)
Relevance of zinc in human sperm and its relation to motility.
Fertil. Steril., 71, 1138–1143.
24. Lindsay,L.L and Clark,W.H. (1992) Preloading of micromolar
intracellular Ca2+ during capitation of Syyonia ingentis sperm.
J. Exp. Zool. , 262, 219–229.
25. Harraway,C., Berger,N.G. and Dubin,N.H. (2000) Semen pH in patients
with normal versus abnormal sperm characteristics. Am. J. Obstet.
Gynecol., 182, 1045–1047.
26. Rennert,O.M. and Chan,W.Y. (1984) Genetic diseases: models for the
study of trace metals. In Metabolism of Trace Metals in Man. CRC Press,
Boca Raton, Vol. 2, pp. 133–140.
27. Chu,E., Lai,G.M., Zinn,S. and Allegra,C.J. (1990) Resistance of a human
ovarian cancer line to 5-fluorouracil associated with decreased levels of
5-fluorouracil in DNA. Mol. Pharmacol., 38, 410–417.
28. Schuetz,J.D., Wallace,H.J. and Diasio,R.B. (1984) 5-fluorouracil
incorporation into DNA of CF-1 mouse bone marrow cells as a possible
mechanism of toxicity. Cancer Res., 44, 1358–1363.
29. Kremer,A.B., Mikita,T. and Beardlsley,G.P. (1987) Chemical
consequences of the incorporation of 5-fluorouracil into DNA as studied
by NMR. Biochemistry, 26, 391–397.