Biochem. J. (2013) 450, 497–509 (Printed in Great Britain)
497
doi:10.1042/BJ20120793
Signal transfer in the plant plasma membrane: phospholipase
A2 is regulated via an inhibitory Gα protein and a cyclophilin
Michael HEINZE*, Madeleine HERRE*, Carolin MASSALSKI*, Isabella HERMANN†, Udo CONRAD† and Werner ROOS*1
*Martin-Luther-University Halle-Wittenberg, Institute of Pharmacy, Department of Molecular Cell Biology, Kurt-Mothes-Str. 3, 06120 Halle, Germany, and †Leibniz-Institute of Plant
Genetics and Crop Plant Research Corrensstrasse 3, D-06466 Gatersleben, Germany
The plasma membrane of the California poppy is known to
harbour a PLA2 (phospholipase A2 ) that is associated with the
Gα protein which facilitates its activation by a yeast glycoprotein,
thereby eliciting the biosynthesis of phytoalexins. To understand
the functional architecture of the protein complex, we titrated
purified plasma membranes with the Gα protein (native or recombinant) and found that critical amounts of this subunit keep PLA2
in a low-activity state from which it is released either by elicitor
plus GTP or by raising the Gα concentration, which probably
causes oligomerization of Gα , as supported by FRET (fluorescence resonance energy transfer)-orientated fluorescence imaging
and a semiquantitative split-ubiquitin assay. All effects of Gα were
blocked by specific antibodies. A low-Gα mutant showed elevated
PLA2 activity and lacked the GTP-dependent stimulation by
INTRODUCTION
Heterotrimeric G-proteins are conserved modules of signal transfer in all eukaryotic organisms. Although their peptide sequences
and three-dimensional structures display some basic similarities
between evolutionarily recent animal and plant cells [1], the mode
of interaction with their targets obviously differs between the
kingdoms. In animal cells, signal perception causes one or more
out of several task-specific heterotrimers to release their subunits
for interaction with target proteins, which is best documented for
the large subunit Gα and its various isoforms [2–4]. A plant cell,
which typically contains only one Gα , one Gβ and two Gγ subunits
[5] (a third atypical Gγ was found in Arabidopsis and rice [6,7]),
obeys different strategies to allow a similar diversity of G-protein
functions in the signal transfer [8–11]. A recent example that
underlines the variability of plant G-protein signalling is the loss
of the Gα -activating protein RGS in the evolution of eudicots and
the acquisition of receptor-based activation mechanisms [12]. One
important clue arises from the fact that a significant part of Gα or
the complete heterotrimer is embedded in large protein complexes
at the plasma membrane [11,13,14], and some of these aggregates
are known to contain target proteins [11,15]. This promoted the
idea that task-specific combinations of G-proteins and their target
enzymes might form a framework for the multitude of G-proteintriggered signal pathways in plants [11].
The inventory and architecture of such complexes are far
from being understood, as is the mode of intrinsic interaction
elicitor, but regained this capability after pre-incubation with Gα .
The inhibition by Gα and the GTP-dependent stimulation of PLA2
were diminished by inhibitors of peptidylprolyl cis–trans isomerases. A cyclophilin was identified by sequence in the plasma
membrane and in immunoprecipitates with anti-Gα antibodies.
We conclude that soluble and target-associated Gα interact at the
plasma membrane to build complexes of varying architecture and
signal amplification. Protein-folding activity is probably required
to convey conformational transitions from Gα to its target PLA2 .
Key words: California poppy (Eschscholzia californica),
cyclophilin, phospholipase A2 , plant G-proteins, plant plasma
membrane, plant signalling, protein–protein interaction.
between Gα , other subunits and target enzymes. As an example,
conformational changes triggered by GTP or GTPγ S (guanosine
5 -[γ -thio]triphosphate; GTP[S]) are reported to cause the total
dissociation of Gα -containing protein complexes in rice [13]. In
contrast, in Arabidopsis and Eschscholzia, no or very limited
liberation of Gα was found upon activation [11,14,16], implying
that GTP-triggered conformational transitions are conveyed to the
target without dissociation of the protein complex.
Actually, an increasing number of potential Gα -binding plant
proteins has been deduced from the interaction of the recombinant
proteins expressed in yeast or plant protoplasts, or from
co-immunoprecipitation experiments [17,18]. Confronting and
complementing such studies with biochemical analyses of Gprotein-containing complexes might allow new insights into the
functional specificity of the signal process. Among the problems
to be addressed is the stoichiometry of interaction, e.g. the
number of G-protein subunits per target molecule required for
regulatory impacts, and the structural and functional plasticity of
such complexes, e.g. the ability of membrane-associated Gα to
exchange or interact with the soluble protein components faced
in its cytosolic environment [19].
In the last few years, the plasma membrane of Eschscholzia
californica, the California poppy, has been established as
an in vitro model system to study the control exerted by
Gα over the target enzyme PLA2 (phospholipase A2 ; EC
3.1.1.4). The highest and most reproducible levels of PLA2
activity and its stimulation by GTP were obtained after
Abbreviations used: BP, bandpass filter; BPC, bis -BODIPY® -FL-C11 phosphatidylcholine; CFP, cyan fluorescent protein; Cub, C-terminal part of
ubiquitin; eGFP, enhanced green fluorescent protein; ER, endoplasmic reticulum; FRET, fluorescence resonance energy transfer; fwt, fresh weight;
GDPβS, guanosine 5 -[β-thio]diphosphate; GFP, green fluorescent protein; GPCR, G-protein-coupled receptor; GTPγS, guanosine 5 -[γ-thio]triphosphate;
IPTG, isopropyl β-D-thiogalactopyranoside; LB, Luria–Bertani; mbSUS, mating-based split-ubiquitin system; MS/MS, tandem MS; Nub, N-terminal part of
ubiquitin; ORF, open reading frame; PLA, phospholipase A; PPIase, peptidylprolyl cis –trans isomerase; RT, reverse transcription; YFP, yellow fluorescent
protein; X-Gal, 5-bromo-4-chloroindol-3-yl β-D-galactopyranoside.
1
To whom correspondence should be addressed (email [email protected]).
The nucleotide sequence data of the Eschscholzia cyclophilin reported will appear in GenBank® , EMBL, DDBJ and GSDB Nucleotide Sequence
Databases under the accession number JQ886493.
c The Authors Journal compilation c 2013 Biochemical Society
498
M. Heinze and others
solubilization of the plasma membrane with cholate. Among the
solubilized proteins, co-immunoprecipitation and non-denaturing
electrophoresis detected large detergent-resistant complexes that
contain PLA2 together with Gα . The in vitro activity of the
enzyme increased upon contact with yeast elicitor plus GTP, thus
reflecting its Gα -dependent control [11]. In intact cells, the same
elicitor activates PLA2 at the plasma membrane [20,21], and a
product of this enzyme, lysophosphatidylcholine, acts as a second
messenger for the induction of alkaloid biosynthesis [22,23].
Thus Gα -controlled PLA2 initiates a signal chain that induces
the overproduction of phytoalexins [24]. This antimicrobial
response is triggered very selectively, i.e. it is independent of the
ubiquitous jasmonate-dependent hypersensitive cell death. The
latter can be triggered in addition by exposing our strains to
high elicitor concentrations [21,24]. Although the hypersensitive
response might involve other PLA enzymes [25], there are no
indications of their G-protein-dependent control [11,25]. The Gα dependent elicitor-responsive PLA2 of Eschscholzia has now been
cloned, sequenced and deposited in GenBank® (accession number
JQ886492).
In the present study, we use recombinant Gα of Eschscholzia to
mimic the impact of soluble Gα at the target enzyme PLA2 of the
isolated plasma membrane.
EXPERIMENTAL
Plant material
Cell suspensions of Eschscholzia californica Cham. were
originally derived from hypocotyl discs via callus cultures
[26]. For experiments, cultures were maintained in a 9–10 day
growth cycle in Linsmaier–Skoog medium supported with
the hormones 2,4-D (2,4-dichlorophenoxyacetic acid) and αnaphthalene acetic acid (1 μM each). Cultivation was carried out
on a gyrotary shaker (100 rev./min) at 24 ◦ C under continuous
light (∼ 7 μmol·m − 2 ·s − 1 ). Cells were used for experiments after
6 or 7 days of growth as described previously [22].
C11 phosphatidylcholine) (Molecular Probes) as described in
[11,29]. A typical assay contained per well of a 96-well microtitre
plate (Microfluor II; Greiner) 170 μl of substrate solution (0.4 μM
BPC) followed by 30 μl of effectors (see below). After 10 min
of equilibration (mild shaking at room temperature, 22 ◦ C),
20 μl of solubilized plasma membrane preparation (containing
10 μg of protein) were added and the fluorescence was recorded
at λex 485 nm/λem 528 nm over 10 or 60 s (dependent on the rate of
fluorescence development) in a FLX800 microplate fluorescence
reader (BioTek). To eliminate non-enzymatic generation of
fluorescence, a control experiment was performed with the
enzyme preparation replaced by TENC buffer. Initial rates
of hydrolysis were converted into enzyme activities by using
calibration assays with bee venom PLA2 and a series of substrate
concentrations.
The final concentrations of effectors in the 220 μl reaction
mixture were as follows: Gα , 45–1350 nM as indicated;
cyclosporin A, 1 μM; GTP, 5 μM; yeast elicitor, 1 μg/ml
(see below); and antibodies (IgG or scFv), 68 nM. These
concentrations were optimized for each compound or antibody
in a test series and yielded either saturating or optimum effects.
In short-time incubations as used in the present study, GTP and
GTPγ S displayed similar effects on PLA2 . Yeast elicitor is a
glycoprotein fraction prepared from baker’s yeast according to
[30] and further purified by ultrafiltration (30 kDa molecular
mass cut-off), FPLC (anion exchange and size exclusion) and
SDS/PAGE. The active fraction comprises glycoproteins of 30–
42 kDa that contain approximately 40 % mannose [20]. Dosage
refers to the dry weight of the crude preparation.
Preparation of recombinant Gα and Gγ proteins
Eschscholzia or Arabidopsis cell suspensions (80 g) were filtered,
frozen in liquid nitrogen and fractionated as described previously
[27]. The microsomal pellet was obtained after centrifugation at
100 000 g for 1 h (4 ◦ C; Beckman LE-80K, TI-70 angle rotor,
37 000 rev./min) and used to purify the plasma membrane by
liquid two-phase partioning [28]. Soluble and membrane fractions
were also analysed by SDS/PAGE and subsequent Western
blotting with IgG fractions purified from the polyclonal rabbit
anti-Gα antiserum at a dilution of 1:500 in TBS [Tris-buffered
saline; 25 mM Tris/HCl (pH 7.5), 150 mM NaCl and 3 mM KCl].
The plasma membrane fraction was finally solubilized by
mild shaking (2 h, 8 ◦ C) in TENC buffer (20 mM Tris/HCl,
pH 7.5, 1 mM EDTA, 50 mM NaCl and 0.5 % sodium cholate).
This detergent proved to be superior to a number of
other compounds tested (including lubrol and n-dodecyl-β-Dmaltoside) with respect to the yield of solubilized PLA2 activity
and its stimulation by GTPγ S. The supernatant obtained by
centrifugation (100 000 g, 40 min, 4 ◦ C; Beckman LE-80K, TI70 angle rotor, 37 000 rev./min) was adjusted to a protein content
of 500 μg/ml and used in all experiments.
The ORF (open reading frame) of EcGPA1 (GenBank® accession
number HQ830348) encoding the Gα protein was amplified from
a cDNA library of Eschscholzia [23] and expressed in the pET23( + ) vector. Similiarly, the Gγ 1 coding gene from Arabidopsis
thaliana (AT3G63420.1) was cloned into the same vector.
Expression was performed using standard procedures. Briefly,
competent cells of Escherichia coli BL21(DE3) were transformed
with these plasmids by the heat-shock procedure (42 ◦ C) and
grown on ampicillin selection agar. Colonies were transformed to
liquid LB (Luria–Bertani) medium, grown for 24 h at 35 ◦ C and
1 mM IPTG (isopropyl β-D-thiogalactopyranoside) was added to
stimulate protein production. After 3 h the bacterial pellet was
harvested by centrifugation (20 min, 4 ◦ C; Sorvall GSA rotor,
4000 rev./min) and lysed using lysozyme and ultrasonic treatment.
In the 30 000 g supernatant, the C-terminally His6 -tagged protein
was trapped on 50 % Ni-NTA (Ni2 + -nitrilotriacetate)–agarose
(Ni SepharoseTM High Performance, GE Healthcare), purified
by FPLC (ÄKTA, GE Healthcare) and finally eluted with buffer
containing 250 mM imidazole.
The recombinant Gα protein contained <1 % impurities, most
probably from the bacteria used for cloning, as determined by
SDS/PAGE. To confirm that the bacterial impurities did not
mimic or change the observed effects of Gα , test experiments
were performed in the absence of Gα but with the contaminating
proteins, obtained by the same expression and purification
procedure using an empty pET-23( + ) vector. Addition of this test
extract together with Gα did not significantly change its effects on
PLA2 .
Assay of PLA2 activity
Preparation of native Gα by immunoabsorption
PLA2 activity was quantified by monitoring the fluorescence
emission from the artificial substrate BPC (bis-BODIPY® -FL-
Gα was isolated from the soluble Eschscholzia proteins (100 000 g
supernatant, obtained according to [27]). An immunomatrix was
Cell fractionation and preparation of plasma membrane
c The Authors Journal compilation c 2013 Biochemical Society
Gα and cyclophilin regulate a plant phospholipase A2
prepared by binding and crosslinking the IgGs from the polyclonal
anti-Gα antiserum (see above) to Protein A–Sepharose 4 Fast
Flow (GE Healthcare). After incubation with the Gα -containing
protein fraction, the bound Gα was eluted at alkaline pH. The
whole procedure followed essentially a protocol published by I.J.
Delgado (http://www.ivaan.com/protocols/126.html).
The Gα was further purified by SDS/PAGE, the 42 kDa band
was excised from the gel and the protein was renatured in the
presence of 5 mM CaCl2, 5 M cysteine and 50 mM ammonium
acetate, pH 7.0, according to [31]. Gel extraction was facilitated
by a freeze–thaw cycle, followed by dialysis and ultrafiltration,
as detailed in [11].
Antibodies
To raise antisera against recombinant Gα , two rabbits were each
immunized with 1 mg of Gα and Freund’s complete adjuvant
and boostered with 500 μg of Gα and Freund’s incomplete
adjuvant after 4 weeks, 5 weeks and 6 weeks respectively. The
anti-Gα sera were affinity-purified via Gα –Sepharose columns
made from CNBr-activated Sepharose by loading Gα following
the manufacturer’s protocol (GE Healthcare). The resulting IgG
fraction was used in PLA2 assays.
Isolation of specifc scFv against Gα was performed as
described previously [32]. Briefly, the phage display libraries
Tomlinson A and B [33] were screened against Gα produced in
pET-23a [23]. After four rounds of selection one monoclonal
scFv (anti-Gα scFv2) was isolated and characterized by
sequencing and indirect ELISA as described previously
[32]. Briefly, antigens were adsorbed to Maxisorb plates at
neutral pH overnight, the wells blocked and specific scFv,
anti-c-Myc antibody and anti-mouse alkaline phosphatase
conjugate were added sequentially after washing between
steps. Alkaline phosphatase activity was measured using pnitrophenylphosphate. A selectivity test of anti-Gα scFv2 is exemplified in Supplementary Figure S1 at http://www.biochemj.org/
bj/450/bj4500497add.htm by showing an indirect ELISA
experiment with Gα , Gγ 1 and Gγ 2 as antigens. Anti-Gα scFv2
binds to Gα with a dissociation constant of 1.3×10 − 7 M as
determined by competitive ELISA (results not shown).
Anti-cyclophilin antibodies, raised against human cyclophilin
A, were purchased from NovusBio, NB300-553. The recombinant
human cyclophilin A used to raise this IgG fraction shows 71 %
sequence identity with the cyclophilin isolated from Eschscholzia
(see Figure 10B).
All animal work was performed according to national
guidelines described in the German Animal Welfare Act AWA
(Deutsches Tierschutzgesetz). Immunization studies were carried
out by an authorized employee under licence according to Section
8b from the district veterinary office Aschersleben-Stassfurt.
499
half respectively of the ubiquitin gene and expressed in yeast
strains of different mating type. During mating, interactions
between the membrane-bound fusion proteins are expected to
create a ubiquitin-like structure by interacting the N-terminal part
of ubiquitin (Nub) with the C-terminal part of ubiquitin (Cub) that
harbours the PLV transcription factor (Cub-PLV). This structure
activates ubiquitin-specific proteases, thus causing the release
of PLV, which can be quantified by the expression of the yeast
reporter genes lacZ, HIS3 and ADE2.
In our experiments, the ORF of Gα from E. californica was
fused by in vivo recombination cloning to the C-terminal part of
ubiquitin (Gα -Cub) followed by PLV. In the same way, this ORF
was also fused to the N-terminal part of the ubiquitin-13 mutant
(NubG).
The haploid yeast strains THY.AP4 (harbouring the Cub-fused
Gα proteins) and THY.AP5 (harbouring the the Nub-fused test
protein) were mated and allowed to generate diploid yeast cells
on medium lacking histidine and adenine. Growth of diploids
in SC medium and in addition the expression of LacZ and βgalactosidase [assayed with X-Gal (5-bromo-4-chloroindol-3-yl
β-D-galactopyranoside)], was taken as an indicator of interaction
between the Nub- and Cub-fused proteins [34]. In order to detect
false-positive effects of test proteins, which may not arise from
an interaction with the bait, e.g. direct influences at the yeast
reporter genes and growth (if any), negative control experiments
were performed by mating the THY.AP5 strain (with the Nubfused test protein) to a THY.AP4 strain that did not contain the
Gα gene in the Cub-vector. No colony growth was detectable in
such experiments.
The expression of Gα encoded in the Cub-PLV vector can
be controlled via a methionine-sensitive promoter and thus the
Gα available for binding can be reduced to definable levels.
In our hands, methionine concentrations between 0.15 mM and
5 mM caused the Gα content in the diploid clones to decrease
from approximately 90 % to 15 % [18]. This feature was used
to favour the formation and growth of clones with higher
affinity interactors and thus to rank the interactors by their
binding strength. To measure growth rates at different methionine
concentrations, diploid clones obtained after mating on solid
medium were picked and each subcultured in liquid medium with
no methionine. After another 2 days of growth, all cell suspensions
were adjusted to an attenuance of 0.1 and 3 μl aliquots were
spotted on to solid medium with the same nutrient composition
but different methionine concentration. After 7 days of incubation
at 30 ◦ C digital images of the colonies were recorded. The
increase in colony size was compared between cultures at the
specified methionine concentration and without methionine, and
normalized to the increase displayed by the same clone on a
methionine-free agar plate.
Purification, MS-based sequencing and PCR-based cloning of
cyclophilin
Co-immunoprecipitation of plasma membrane proteins
IgG fractions from antisera raised in rabbits against Gα (see
above), or against human cyclophilin A were immobilized
on a Protein A–Sepharose immunomatrix (Fast Flow 4; GE
Healthcare) and incubated with the solubilized plasma membrane
as described in [11].
The mating-based split-ubiquitin assay
The assay was performed in principle as described previously
[34]. Briefly, the gene encoding Gα and the gene of a potential
interactor protein were fused to the C-terminal or the N-terminal
The immunoprecipitate obtained from the solubilized plasma
membrane with the anti-Gα antibody (see above) was separated
by SDS/PAGE. The cyclophilin band (approximately 19 kDa)
was identified by comparison with a Western blot detected
with the anti-cyclophilin antibody. The band was excised from
the gel, digested with trypsin and the fragments identified
by MS/MS (tandem MS)-based sequencing, as detailed with
Gα in [11]. On the basis of two peptide sequences, a forward primer (5 -AAAGTTTTCTTCGATATGACTGTTGGTGG3 ) and an antisense reverse primer (5 -ATGTTTACCATCAGGCCATGAAGTTTT-3 ) were synthesized based on Eschscholzia
codon usage (http://www.kazusa.or.jp), which amplified a 390 bp
c The Authors Journal compilation c 2013 Biochemical Society
500
Table 1
M. Heinze and others
Primers for RT–PCR of Gα -fused fluorescent proteins
The DNA sequence data of Gα refer to the ORF in Eschscholzia (GenBank® accession number
HQ830348), Gα 1 contains a Bsa1 restriction site upstream of the 5 end. for, forward; rev,
reverse.
Primer name
Sequence (5 →3 )
Gα 1 for (5 -end − 22)
Gα 2 for (970–997)
CFP rev (3 -end)
YFP rev (3 -end)
eGFP rev (3 -end)
TTTGGTCTCCAATGGGCTCACTCTGCAGCAGAC
GCGTATGAGTTTGTAAAGAAGAAATTCG
TTTGGTCTCAAAGCTCACTTCCACTTGTACAGCTCATCC
TTTGGTCTCAAAGCTTACTTGTACAGCTCGTCCA
TTTGGTCTCAAAGCTTACTTGTACAGCTCGTCCA
fragment from a cDNA template of Eschscholzia californica. PCR
conditions were: 5 min at 94 ◦ C followed by 35 cycles with 20 s
at 94 ◦ C, 1 min at 50 ◦ C and 1 min at 72 ◦ C, finalized by one
cycle at 72 ◦ C for 10 min. The full-length ORF was completed
from the above fragment by genome walking (Genome WalkerTM
Universal Kit; Clontech) according to the manufacturer’s
protocol. Genomic DNA as required for genome walking was
isolated from the Eschscholzia cell culture, digested with EcoRV
and adaptor-ligated. The gene-specific primers were as follows:
forward, 5 -GTCAAGGTGGAGATTTCACAGCCGGAAACG3 ; and antisense reverse, 5 -AGATCCATTTGTGCCTGGACCGCGGTTAGC-3 . Two overlapping fragments were obtained,
from which the full-length cDNA was obtained by PCR (see
above) with primers from non-coding regions, 5 (upstream) 5 CCCCGATATAACCCCTATCCAGAAA-3 and 3 (downstream)
5 -GAGGGAGAGATAGGGTGAATTGGGGATGT-3 . The ORF
of the cyclophilin gene was cloned into the pDRIVE vector
(Qiagen) and expressed in E. coli.
Construction of vectors for plant transformation
The 3 -end of the ORF of Gα of Eschscholzia (GenBank®
accession number HQ830348) was fused to the 5 -end of the
ORFs of eGFP [enhanced GFP (green fluorescent protein)], CFP
(cyan fluorescent protein) or YFP (yellow fluorescent protein). A
spacer of three alanine triplets (5 -GCTGCCGCG-3 ) was placed
between the two genes. ORFs encoding eGFP, CFP or YFP were
used as references.
The plasmid DNAs were amplified by PCR with gene-specific
primers, which introduced flanking BsaI restriction sites and were
finally cloned into the binary vector pICH56022 (Icon Genetics)
using similar restriction sites. The desired vectors were produced
in a one-step ligation/digestion reaction [35,36]. They were used
for the heat-shock transformation of competent DH10B E. coli
cells. Transformed colonies were selected on LB-Amp50 plates
containing X-Gal and IPTG as selection markers for intact βgalactosidase. Successfully transformed bacteria were selected
by colony PCR using the same Gα - and fluorophor-specific
primers (Table 1) and the presence of the amplified vectors was
confirmed by DNA sequencing. For each transformation vector,
three individual DNA clones were isolated by alkaline-lysis-based
minipreparation (Gene Jet Kit; Thermo Fisher Scientific).
Biolistic gene transfer
Transient gene expression in Eschscholzia cell suspensions was
achieved by bombardment with DNA-coated gold particles.
Plasmid DNA of each vector was precipitated on to gold particles
by adding 60 μl of water containing 5 μg of DNA to 2.5 mg of
gold particles (1.0 μm diameter, Bio-Rad Laboratories), prepared
c The Authors Journal compilation c 2013 Biochemical Society
according to the manufacturer’s protocol. After addition of 0.1 M
spermidine (20 μl) and 2.5 M CaCl2 (50 μl) and intensive vortexmixing for 3 min, the suspension was kept on ice for 3 min
and precipitated by centrifugation for 1 min at 11 000 g. The
gold pellet was resuspended in 200 μl of 96 % (v/v) ethanol,
centrifuged again (1 min at 11 000 g) and finally resuspended in
85 μl of 96 % (v/v) ethanol and used for biolistic gene transfer.
Eschscholzia cell suspensions (6 days old, approximately
50 mg of wet weight) were filtered on to sterile paper discs
and placed on to Petri dishes containing 1.5 % agar with M21
medium. The biolistic bombardment with the cell-suspensioncontaining filter pieces was done with a PDS1000/He Biolistic
Particle Delivery System (Bio-Rad Laboratories) following the
manufacturer’s instructions. After bombardment, the cells on
the filter were transferred to a new Petri dish with the same
medium containing 50 μM paramomycin, 5 μM benomyl and
5 μM nystatin. After 2 h, the cells were transfered to 1.5 ml of
M21 liquid medium with supplements as mentioned above. These
samples were incubated on a horizontal shaker at 120 rev./min at
25 ◦ C.
The biolistic bombardment resulted in a mixture of
paromomycin-resistant (i.e. stably transformed) and -sensitive
cells. The former initiated regenerative growth 2–4 days after
bombardment and often generated multicellular aggregates. The
latter included cells that clearly suffered under the influence of the
antibiotic treatment as indicated by the expression of fluorescent
CFP and/or YFP but irregular cell shapes. The microscopic
analysis was done with newly formed cells that were clearly
distinguishable from the detrimental cells.
Verification of transformation by RT (reverse transcription)–PCR
At 2 days after biolistic treatment, 100 mg [fwt (fresh weight)]
samples of the transformed cultures were harvested by vacuum
filtration and stored at − 80 ◦ C. RNA was isolated by the
NucleoSpin RNA Plant isolation kit (Macherey-Nagel). cDNA
synthesis was performed with the Qiagen RevertAidTM H Minus
First Strand cDNA Synthesis kit using an oligo(dT)18 primer,
according to the manufacturer’s instructions. An aliquot (2 μl) of
the resulting cDNA mixture was used as a template for PCR,
which was performed in an Eppendorf Mastercycler gradient
PCR machine: 2 min at 94 ◦ C; 1 min at 55 ◦ C, 1 min at 72 ◦ C,
30 s at 94 ◦ C (35 repeats); and 10 min at 72 ◦ C. The primers
used are listed in Table 1. The resulting PCR products were
separated (Supplementary Figure S2 at http://www.biochemj.org/
bj/450/bj4500497add.htm) and identified by DNA sequencing.
Confocal laser-scanning microscopy
Confocal microscopy was done with the LEICA TCS SP laserscanning unit mounted on a DCM RE fluorescence microscope
equipped with a 63-fold apochromate objective. Fluorescence was
excited at 488 nm (Argon-Ion laser) and detected in the range
between 496 and 530 nm. The detection pinhole was set at 1.0.
In parallel with the laser-excited fluorescence emission, a (nonconfocal) transmission image of each specimen was scanned. All
images are averaged from six subsequently scanned frames of
1025 pixels×1025 pixels or 512 pixels×512 pixels. Intensities
were visualized by a standard lookup table consisting of different
shades of green (dark at low and bright at high intensity).
The red fluorescence of benzophenanthridine alkaloids, which
is partially emitted in the transformed cells, was detected in a
parallel precautionary scan at 570–670 nm. Cells with detectable
fluorescence in this wavelength area were discarded from analysis.
Gα and cyclophilin regulate a plant phospholipase A2
501
Fluorescence microscopy and image-processing for FRET
(fluorescence resonance energy transfer) analysis
Transformed cell suspensions were examined with a Nikon
Optiphot fluorescence microscope equipped with a Sony 3-chip
CCD (charge-coupled-device) camera. Images were obtained
successively by using three fluorescence filters: For YFP
FRET, λex = 380–425 nm, λem = 520 nm BP (bandpass filter); for
CFP, λex = 380–425 nm, λem = 50 nm BP; and for the YFP
reference, λex = 482–500 nm, λem = 520–560 nm, followed by a
transmitted light image. The digitalized images were converted
into greyscale and ratioed with the Optimas 6.2 software: (i) the
acceptor image (obtained via the YFP-FRET filter) was divided
by the donor image (obtained via the CFP filter) and amplified by 100; (ii) the resulting quotient image was again divided
by the donor image and amplified by 100; and (iii) the new image
was divided by the YFP reference image (obtained via the YFP
reference filter) and amplified by 30. The final ratio image was
processed with Adobe Photoshop CS5, firstly by color coding with
a spectral lookup table and secondly aligned with the transmitted
light image. The procedure is exemplified in Figure 5. Apart
from the linear amplifications, the final ratio image contains the
original image informations converted as: donor/acceptor2 per
YFP (reference).
When fluorescence intensities were to be compared between
different channels (e.g. in Figure 4), the emission in the FRETYFP channel was corrected for the ‘spillover’ of CFP-derived
emission. For this purpose, a correction factor was established
by dividing the fluorescence intensities in the FRET-YFP channel
(λex = 380–425 nm, λem = 520 nm BP) of cells transformed with
Gα –CFP alone with cells that expressed both fusion proteins. A
total of 12 areas of cytoplasmic regions (31 pixels×31 pixels)
with maximum intensity were averaged in each cell strain. When
measured under identical conditions, the greyscale images in Gα –
CFP cells displayed a mean intensity of 36 % compared with
Gα –CFP + Gα –YFP cells. This value was used as an average for
the CFP-derived ‘spillover’.
Figure 1 Detection of soluble and membrane-bound Gα in Eschscholzia
and Arabidopsis
After cell fractionation, the Gα content in the soluble fraction, the microsomal membranes and
the plasma membrane was compared by SDS/PAGE and Western blotting. The anti-Gα -IgG
antibodies were generated and used as explained in the Experimental section. Lanes 1–3:
samples from Eschscholzia . Lanes 4–6: samples from Arabidopsis . Lanes 1 and 4: 100 000 g
supernatant, representing 25 mg fwt. Lanes 2 and 5: microsomal fraction, representing 400 mg
fwt. Lanes 3 and 6: plasma membrane fraction, representing 1 g fwt. The experiment was repeated
several times and yielded similar results.
Figure 2
cells
RESULTS
Intracellular distribution of Gα
The isolated plasma membrane preparation of Eschscholzia used
in our previous and current studies contains approximately
12 μg (286 pmol) of Gα per mg of protein. This amount
represents only approximately 0.5 % of the total cellular Gα (cell
homogenate excluding mitochondria), of which >50 % is not
membrane-bound, i.e. detectable in the 100 000 g supernatant.
This distribution contrasts with analogous data obtained
from Arabidopsis cell cultures: as seen in Figure 1, the Gα of
Arabidopsis is located almost completely in the microsomal pellet
and in the isolated plasma membrane, whereas only a small
percentage is detectable in the soluble fraction. This finding is
in line with earlier cell fractionation studies in meristematic cells
of Arabidopsis and cauliflower, where Weiss et al. [37] found
most, if not all, Gα associated with the plasma membrane and
ER (endoplasmic reticulum) membranes. Binding of Gα to the
plasma membrane and the ER has now been confirmed by
the visualization of Gα –GFP hybrids in protoplasts (e.g. [16]) or
by electron microscopy studies in immunogold-labelled tissues
[38]. In order to substantiate the apparent species difference, a
localization study of Gα was performed in Eschscholzia cells by
confocal microscopy. As seen in Figure 2, a Gα –eGFP hybrid
protein spreads over all detectable cytoplasmic areas and does not
report a substantial accumulation at the plasma membrane.
Confocal mapping of a Gα –eGFP hybrid protein in Eschscholzia
Confocal images were scanned as described in the Experimental section 3 days after biolistic
transformation of cell cultures with a vector encoding the Gα –eGFP fusion protein. The images
align the confocal plane, coded in green, with the transmission image (non-confocal) of the same
specimen. The bars represent 50 μm (A and B) or 10 μm (C and D). Vacuolar (v), cytoplasmic
(c) and nuclear (n) regions are marked. (A and B) Rapidly growing cells (A) or aggregates (B)
which in this stage have no dominant vacuoles. (C and D) Adult cells with the typical large
central vacuole. Note that the fluorescence of the fusion protein fills all cytoplasmic regions,
including the plasma strands connecting to the nuclear region. No distinct accumulation of
Gα –eGFP at the cellular surface was detectable.
This result is in line with the data of the cell fractionation study
described above. It appears therefore that substantial amounts
of soluble Gα are present together with the membrane-bound
species, at least in some plants. For instance, in growing wheat
tissue cultures the larger part of Gα was recovered in a 120 000 g
supernatant and is thus considered a soluble protein [39], similar to
our experience with Eschscholzia. More comparative experiments
are justified to reveal whether the localization of Gα changed
during species evolution (actually, the monocot wheat and the
early eudicot Eschscholzia most probably share a pattern that
differs from the late eudicots Arabidopsis and Brassica) or
whether the reported differences represent expression profiles of
different cell types and growth stages.
The present study is based on the assumption that a small
fraction of Gα tightly bound to the plasma membrane faces an
excess of soluble or weakly bound Gα at the cytoplasmic surface.
We address the question whether and how the interplay of both
c The Authors Journal compilation c 2013 Biochemical Society
502
M. Heinze and others
Figure 3 Effect of recombinant and native Gα on the PLA2 activity of the
plasma membrane
The activity of PLA2 was measured in the presence of the indicated concentrations of Gα , which
was added 10 min prior to the solubilization of the plasma membrane (see the Experimental
section). Where indicated, antibodies were added together with Gα . Numbers next to Gα are
final concentrations in nM. The results are means +
− S.D. of five independent measurements,
normalized to the PLA2 activity of the untreated plasma membrane (5 pkat/mg of protein) which is
set to 100 %. The experiment was repeated with seven different plasma membrane preparations,
which all yielded similar results. Data labelled with * are significantly different (95 %) from the
untreated plasma membrane (first column). Data with ** are significantly different (95 %) from
rGα 45. asGα , IgG fraction of anti-Gα antiserum; eli, elicitor; gGα , native (genuine) Gα ; PM,
plasma membrane; rGα , recombinant Gα ; scGα , anti-Gα scFv antibody.
fractions can influence the impact of this subunit at its target
protein(s).
Interaction with Gα is inhibitory to PLA2
In the isolated and solubilized plasma membrane of Eschscholzia
the activity of PLA2 was assayed as the rate of hydrolysis of a
fluorigenic substrate, BPC, according to an optimized protocol
[11,20,23,29]. Recombinant Gα , encoded by Eschscholzia cDNA
and produced in E. coli, inhibits PLA2 activity if added in
concentrations between 20 and 100 nM (Figure 3, columns
2–4). Typically, 45 nM Gα caused a reduction in activity
of approximately 66 %. This inhibition disappeared if the
concentration of recombinant Gα was raised, and above a
saturating level (approximately 900 nM), the enzyme activity was
even stimulated (140–145 %, Figure 3, columns 6–8). Neither
the inhibition nor the activation caused by recombinant Gα was
due to its His6 -tag or potential bacterial contaminants, as in
test experiments native Gα , isolated from the soluble proteins
of Eschscholzia cell cultures (see the Experimental section),
displayed the same effect as the recombinant protein (see columns
2/3 and 6/7 in Figure 3). Furthermore, the effects of native Gα on
PLA2 activity did not change if it was added together with extracts
prepared in a similar manner from untransformed bacteria or from
those transformed with the empty vector (results not shown).
The concentration-dependence in Figure 3 suggests that the
mode of interaction between PLA2 and external Gα changes
above a critical concentration of this protein. Gα molecules might
then either access additional activating binding site(s) at the
enzyme or lose their affinity by self-interaction, thus competing
with the target. As the latter idea appears more plausible, we
tested the ability of Gα to dimerize or oligomerize by two
alternative procedures: (i) by fluorescence microscopy to search
for FRET-like interactions between different Gα –GFP hybrids in
the Eschscholzia cell; or (ii) by the mating-based split-ubiquitin
assay with the Gα of Eschscholzia expressed in yeast cells.
c The Authors Journal compilation c 2013 Biochemical Society
Figure 4 Fluorescence emission of cells containing the Gα –YFP fusion
protein alone or together with Gα –CFP
Cells transformed with Gα –YFP alone (top row) or Gα –YFP plus Gα –CFP (bottom row) were
excited through the YFP filter (left-hand panels, λex = 482–500 nm, λem = 520 nm BP) or the
FRET filter (right-hand panels, λex = 380–425, λem = 520 nm BP). Greyscale images were
obtained as described in the Experimental section. The emission in the FRET channel from
cells with both fusion proteins was corrected for the CFP-derived fluorescence by reducing
the image intensity to 64 % (see the Experimental section). The fluorescence intensity of each
image was then quantified in a cytoplasmic area with maximum fluorescence (averaged over 11
pixels×11 pixels) and intensity ratios F FRET channel /F YFP channel were calculated. To ease the visual
comparison, images were normalized to the maximum intensity emitted in the YFP channel
(left-hand panels), which was set to 100 of 255 intensity units. The images and ratios given in
the Figure are a typical result taken from series with at least ten different microscopic specimens.
The measured ratios were in the following ranges: Gα –YFP strain, 1.05–1.20; Gα –YFP plus
Gα –CFP strain, 1.42–1.66. Note that under the conditions used CFP is excited only by the FRET
filter combination (right-hand panels), but not by the YFP combination (left-hand panels). Thus
the difference in ratios is caused by the different excitation wavelengths and, after correction,
indicate an influence of Gα –CFP on Gα –YFP.
FRET caused by interaction of fluorescently labelled Gα molecules
in Eschscholzia cells
In this approach, cultured cells were biolistically transformed
with two DNA vectors, each encoding a fusion protein of Gα with
either CFP or YFP. Control cell lines were established similiarly
by transferring the CFP or the YFP gene alone, or a mixture
of both. After 2–4 days of regeneration, the transformed
cultures expressed the desired mRNAs (Supplementary Figure
S1) and most cells emitted fluorescence typical of YFP and
CFP.
In cells expressing both Gα –CFP and Gα –YFP, the excitation
of CFP with a wavelength of ∼ 400 nm caused a substantial
increase in fluorescence in the YFP channel, i.e. at >520 nm. This
effect persisted after correcting for the average ‘spillover’ of CFP
(donor) fluorescence into the YFP (acceptor) channel, and was
not found in cells that expressed Gα –YFP alone (Figure 4). This
finding was taken as a first hint for energy transfer between Gα –
CFP and Gα –YFP, but could not easily be quantified in individual
cells as the proportions between CFP- and YFP-fusion proteins
appeared to differ significantly from cell to cell, which would
require extensive individual correction measurements.
We thus established an alternative procedure to visualize
potential interactions between the Gα -moieties by comparing
fluorescence properties between cells that expressed both hybrid
proteins (Gα –CFP plus Gα –YFP) and others that contained the pair
of unsubstituted CFP plus YFP. Three images from each cell were
obtained and processed by ratioing acceptor emission (F YFP-FRET )
to donor emission (F CFP ). The resulting map (F YFP-FRET /F CFP ) was
Gα and cyclophilin regulate a plant phospholipase A2
Figure 5
503
An example of the work flow towards FRET ratio images
(A, B and C) Fluorescent images obtained by the YFP-FRET, CFP and YFP filter respectively. (D) The transmitted light image showing the cell shape. (E) The ratio map, obtained by dividing the
YFP-FRET image by the CFP image (twice) and the result divided by the YFP image, as described in the Experimental section. The colour code is shown in Figure 6. The map is overlayed by the cell
shape. (F) The same fluorescence images processed according to the FRET algorithm of Gordon et al. [40] by the Zeiss AxioVision SE64 software. This procedure uses a lookup table with different
colours. For comparison, average ratio values are notified for selected encircled areas. In our hands, the ratios obtained by the described procedure emphasized the differences between central and
periperal regions somewhat more than the Gordon method, most probably because we used a more thorough correction for different cellular amounts of the acceptor (YFP or Gα –YFP).
Figure 6
Comparison of ratio images between cells expressing CFP plus YFP unmodified or fused to Gα
Cell cultures transformed with Gα –CFP plus Gα –YFP (top panel) or with CFP plus YFP (bottom panel) were examined by fluorescence microscopy (see the Experimental section). As exemplified
in Figure 5, images obtained through the FRET filter, the CFP filter or the YFP filter were related to give ratios of acceptor/donor that were further related to the amount of YFP in each cell. The ratio
images were colour-coded and compared on a scale from 1–100. Note that significant differences between the two cell strains exist in the peripheral cytoplasmic regions. The maximum ratios in
+
these areas, averaged over a 31 pixel×31 pixel square are as follows: top panel (Gα –CFP plus Gα –YFP strain), 62.6 +
− 7; bottom panel (CFP plus YFP strain), 37 − 8.
divided by an image of the specific YFP emission in order to
correct for different concentrations of the acceptor in individual
cells (Figure 5 and see the Experimental section). The ratio maps
obtained by this procedure are comparable with those produced
by the FRET algorithm of Gordon et al. [40] and a commercial
software (Zeiss AxioVision SE64), but in our hands yielded more
intracellular details (Figure 5).
The results collected in Figure 6 suggest that the simultaneous
presence of both fusion proteins (Gα –CFP plus Gα –YFP) causes
higher acceptor/donor ratios than the unsubstituted fluorescent
proteins (CFP plus YFP) in a substantial majority of cells. The
ratio maps differ mainly in the peripheral cytoplasmic areas,
whereas central regions including the nucleus display lower
ratios and more similarities between Gα -containing and Gα -free
fluorescent cell lines.
Taken together, the fluorescence imaging data support a FRETlike energy transfer between the Gα -coupled fusion proteins that
is probably caused by interaction of Gα -moieties.
c The Authors Journal compilation c 2013 Biochemical Society
504
M. Heinze and others
promoter [18]), it could be shown that the self-interaction between
two Gα molecules is in the same order as the well-known
interaction between Gα and Gβ [1,14], whereas the binding in the
Gα –Gγ couple was much weaker. Figure 7(B) shows the influence
of increased methionine concentrations that cause a decrease in
available Gα . The assay does not discriminate between dimers and
higher oligomers, and therefore it cannot be excluded that higher
oligomers might be formed as well.
Thus the split-ubiquitin studies support the findings of a tight
interaction between two Gα molecules obtained from the abovementioned FRET experiments. This is especially interesting as it
suggests that the dimerization of Gα molecules occurs not only
in the cells of their origin but also in the heterologous yeast
cell system. Currently, the self-interaction of Gα appears the
most likely reason why its inhibitory power is lost at increasing
concentrations. The stimulation of PLA2 by saturating amounts
of Gα might reflect the involvement in the dimerization process of
the inhibitory Gα present in the original plasma membrane
preparation.
The functional specificity of the interaction and stimulation
between Gα and PLA2
Figure 7 Interaction of G-protein subunits with Gα demonstrated by the
split-ubiquitin assay
The cDNAs of Gα , Gβ and Gγ were expressed in haploid yeast as fusion proteins with N-terminal
or C-terminal ubiquitin (Nub13 or Cub respectively). The interaction of each protein with Gα
(Eschscholzia ) was forced by mating the haploid strains and quantified via the growth of the
diploid colonies on SC medium (see the Experimental section). (A) Diploid colonies obtained
by the interaction of Nub-fusion proteins containing Gα , Gγ or Gβ with Cub-fusion proteins
containing Gα of either Eschscholzia or Arabidopsis (for comparison). No culture was obtained
in the absence of Nub-fused test proteins (first row). (B) Influence of methionine on the growth
rates. The results are growth rates averaged between cultures at 2 mM and 5 mM methionine,
normalized to the maximum growth rate of the same clone, observed at 0 mM methionine, and
set to 100 %. Colonies growing with 2 mM or 5 mM methionine contain approximately 34 % or
16 % respectively of the Gα content of those growing without added methionine [18]. The ‘control’
column shows the growth of diploids obtained with haploid strains that carry a non-mutated
Nub instead of Nub13 and thus do not require fused proteins to force their assembly with Cub.
Note that diploids expressing Gα plus Gβ or Gα plus Gα show similar growth rates that are not
severely depressed (less than 20 %) by increasing methionine concentrations, indicating the
ability to interact even at low Gα concentrations. The interactors At4G02600 (an MLO1 protein)
and At1G66410 (a calmodulin) provide examples of a strong and a weakly interacting protein
respectively found under similar conditions. The experiment was repeated twice and always
yielded the same ranking of interactors. A.t., Arabidopsis thaliana ; E.c., E. californica .
Gα -interaction studies with the split-ubiquitin system
The mbSUS (mating-based split-ubiquitin system) was
established to detect plant membrane protein interactions [34].
This and similar two-hybrid assays proved successful in the
characterization of protein complexes with a variety of membraneintegral and membrane-associated proteins [41–44]. For the
present study, we expressed Gα of Eschscholzia as a part of
hybrid proteins with ubiquitin moieties in yeast cells and studied
its interaction with itself and with other G subunits. The results
presented in Figure 7(A) indicate that two Gα molecules can form
dimers with high affinity. As the mbSUS allows the ranking of
interactions by their binding strength (via a methionine-controlled
c The Authors Journal compilation c 2013 Biochemical Society
The observed impacts on PLA2 activity involved immunologically
targetable sites at the Gα protein, as shown by the effects of
antibodies raised against the Gα protein of Eschscholzia. As seen
in Figure 3 (columns 10, 11, 13 and 14), both the inhibition by
low and the stimulation by high Gα concentrations are relieved
by polyclonal antisera or monoclonal single-chain (scFv)
antibodies. Both types of antibodies did not affect the activity
of PLA2 if added in the absence of external Gα . Further data
support their selective binding to Gα : (i) the polyclonal antiserum
detected only the expected 43 kDa band among the plasma
membrane proteins separated by SDS/PAGE; and (ii) the anti-Gα
scFv antibody preparation was pre-selected by a four-step process
of repeated panning and screening for Gα -binding molecules in
a relevant phage-display library (see the Experimental section)
and did not detect the His6 -tag of the recombinant protein
(Supplementary Figure S1). Thus it appears that binding of
antibody to the Gα protein impedes both its interaction with PLA2
and its self-interaction.
It is known that the association of Gα and PLA2 allows
activation of the enzyme by yeast glycoprotein elicitor in the
presence of GTP/GTPγ S, but not GDP/GDPβS (guanosine 5 [β-thio]diphosphate) [11]. In the present study, this stimulation
attained the same level irrespective of whether inhibitory
concentrations of external Gα were present or not (Figure 8,
columns 1–3 and 8–10). Although GTP and GTPγ S act similarly,
GDβS had no stimulatory effects under any of the conditions
tested (Figure 8, columns 1, 5 and 6). It is thus likely that elicitor
plus GTP act at the Gα molecules bound (or are accessible) to
PLA2 , thus releasing the enzyme from an inhibited state. Two
further experiments support this conclusion.
First, the increase caused by elicitor plus GTP is significantly
smaller if Gα is present at high stimulating concentrations
(Figure 8, compare columns 1–3 with 11–13, the high conversion
rates proved not to be limited by substrate supply). This is
consistent with the tendency of Gα to undergo dimerization, as
this would shift the binding equilibrium away from the PLA2 associated form of the Gα protein, which confers the stimulation
by GTP plus elicitor.
Second, in the antisense-Gα strain TG11, whose plasma
membrane contains only approximately 15 % of the wild-type
Gα content [23], the specific activity of PLA2 at the outset was
Gα and cyclophilin regulate a plant phospholipase A2
505
Figure 8 Influence of low-molecular-mass effectors and antibodies on the
interaction of Gα and PLA2
Figure 9 Effect of external Gα , GTP and elicitor on the activity of PLA2 in
the mutant TG11
The activity of PLA2 was measured in the solubilized plasma membrane (see the Experimental
section). The indicated effectors were added 10 min prior to the membrane preparation. Numbers
next to Gα are final concentrations in nM. Final concentrations of the effectors GTP, GTPγ S
or GDPβS, 5 μM; yeast elicitor, 1 μg/ml; cyclosporin A, 1 μM. Antibodies, if indicated,
were present at 68 nM. Results are means +
− S.D. of five independent experiments, normalized
to the PLA2 activity of the untreated plasma membrane (5.0 pkat/mg of protein) which is set to
100 %. Data marked by * significantly differ (95 %) from the first column of each box. Data
with ** significantly differ (95 %) from GTP plus elicitor. The experiment was repeated with five
different plasma membrane preparations which yielded similar results. eli, elicitor; PM, plasma
membrane; rGα , recombinant Gα . In previous test experiments, the anti-Gα -IgG fraction, the
antiGα -scFv antibodies and the anti-cyclophilin IgG fraction showed no intrinsic PLA2 activity
at the concentration used (results not shown).
In an experiment comparable with that shown in Figure 3, the activity of PLA2 was measured in
the solubilized plasma membrane of the mutant TG11. The Gα content of this preparation is
15 % compared with the wild-type [23]. Numbers next to Gα indicate the final concentration in
nM. Data with * are significantly different (95 %) from the untreated plasma membrane (first
column). The results are means +
− S.D. of five independent measurements, normalized to the
PLA2 activity of the wild-type plasma membrane, which is set to 100 %. In comparison, the PLA2
activity of TG11 is approximately 120 %. eli, yeast elicitor; PM_TG11, mutant plasma membrane;
rGα , recombinant Gα ; gGα , native Gα . The experiment was repeated with four different plasma
membrane preparations, which all yielded similar results.
significantly higher than in the wild-type (120 %, Figure 9). In the
same plasma membrane, titration with Gα causes the same effects
as in the wild-type (Figure 9, columns 2 and 4–7). Importantly, in
the mutant plasma membrane, PLA2 was not stimulated by yeast
elicitor plus GTP, but regained such stimulation after addition
of 45 nM Gα , which alone caused strong inhibition (Figure 9,
columns 2, 3 and 8–10). These findings indicate that the PLA2 inhibiting fraction of Gα is identical with the GTP-stimulated
fraction and thus the addition of Gα restores the regulatory features
of the TG11 mutant to those of the wild-type.
the low-Gα mutant (Figure 11, columns 7 and 8). Secondly, the
stimulation exerted by elicitor plus GTP was completely blocked
(Figure 8, column 7). Thirdly, the inhibitory effects of low Gα
concentrations were less severe in the presence of cyclosporin A
or of the anti-cyclophilin antibody (Figure 11, columns 1, 3 and
4). Finally, the stimulation by high Gα concentrations was reduced
to an extent comparable with the non-treated plasma membrane
(Figure 11, columns 5 and 6).
These results are the first indications that a cyclophilin is required for Gα to exert its inhibitory effect on PLA2 . Although low
and high Gα concentrations shift the enzyme activity into different
directions, both effects were attenuated by cyclosporin A.
A cyclophilin is involved in the elicitor-triggered activation of PLA2
DISCUSSION
The plasma membrane preparation contains a PPIase
(peptidylprolyl cis–trans isomerase) of the cyclophilin type
(E.C. 5.2.1.8). Its 18 kDa polypeptide was found as a common
constituent of immunoprecipitates obtained either with an anticyclophilin IgG or with the anti-Gα antibody raised against the
recombinant Gα . It was partially sequenced by MS/MS. On
the basis of three tryptic peptides, it was possible to clone the
complete ORF (Figure 10A). The deduced complete peptide
sequence indicates a protein of high similarity with other plant
cyclophilins, notably an ABH-type cyclophilin of Digitalis lanata
[45] (Figure 10B). A significant degree of sequence identity
(71 %) even with human cyclophilins (Figure 10B, last line)
prompted us to test a commercially available antibody raised
against the human homologue. This antibody caused a significant
inhibition of PLA2 activity (Figure 11, column 9), which further
supported an association of cyclophilin and Gα in the plasma
membrane. Pharmacological data obtained with cylosporin A, a
specific inhibitor of PPIases of the cyclophilin type [46], suggest
that the protein-folding activity of cyclophilin is required for the
interaction of Gα and PLA2 : first, cyclosporin A depressed the
PLA2 activity in the non-treated plasma membrane by 40–45 %
(Figure 11, column 10) but exerted no significant inhibition in
The relevance of our experimental data for the understanding of
the PLA2 –Gα complex rests on the assumption that the added Gα
protein is functionally intact and equivalent to the native protein
associated with the plasma membrane of Eschscholzia cells. This
is supported by the following facts: first, the recombinant Gα
and the native Gα are products of the same gene, but produced
by entirely different procedures (a bacterial His6 -tagged product,
purified by Ni2 + -affinity chromatography, or a soluble protein of
the plant cell homogenate, purified by immune absorption) and
are thus unlikely to contain similar contaminants. Nonetheless,
either protein caused the same inhibitory or stimulatory effects
on PLA2 if added to the plasma membrane. Secondly, either
protein reconstitutes the low-Gα mutant TG11 with respect to the
GTP-dependent activation of PLA2 . Thirdly, potential bacterial
contaminants of the recombinant Gα preparation had no influence
on PLA2 activity and the impact of Gα , as tested with extracts
from non-Gα -expressing bacteria.
The most plausible interpretation of our results leads to the
following five conclusions. They are followed by the main results
supporting them. Figure 12 summarizes our interpretation of the
flexible architecture and PLA2 activities of protein complexes in
the form of a hypothetical model.
c The Authors Journal compilation c 2013 Biochemical Society
506
M. Heinze and others
Figure 10 The DNA sequence coding for the cyclophilin identified in the plasma membrane of Eschscholzia and sequence alignment of selected plant
cyclophilins (NCBI BLASTp)
(A) The gene was identified by 3 and 5 genome walking using genomic DNA. The primer sequences (see the Experimental section) and the start and stop codon (ATG and TGA) are underlined.
Shadowed sequences mark the primers used for PCR, which amplified the ORF that was cloned in E. coli (see the Experimental section). The sequence data of the Eschscholzia cyclophilin have been
deposited in GenBank® under the accession number JQ886493. (B) The amino acid similarity or identity between the plant sequences is >90 % or >70 %, and 79 % or 71 % between human and
Eschscholzia . Non-identical amino acids are shadowed.
Soluble Gα interacts with the plasma membrane complex of PLA2
and Gα at the cytoplasmic side, thereby changing its structure and
functionality
Gα is a soluble protein of the cytoplasm in Eschscholzia as
shown by cell fractionation and confocal imaging of a Gα –
c The Authors Journal compilation c 2013 Biochemical Society
GFP hybrid protein (Figures 1 and 2). Addition of increasing
amounts of Gα , recombinant or native, changed the PLA2
activity of the solubilized plasma membrane in an unique
manner (Figure 3). The Gα -deprived mutant TG11 reacted to
the addition of Gα much like the wild-type, indicating that
Gα and cyclophilin regulate a plant phospholipase A2
507
low-Gα mutant TG11 displayed a higher specific activity of PLA2
than the wild-type (Figure 9). The loss of Gα (85 %) is stronger
than the gain of enzyme activity (20 %), which is consistent with
earlier findings that not all Gα molecules of the plasma membrane
are part of the complex [11] and could also reflect a different
architecture of the mutant plasma membrane complex.
The activation of PLA2 by elicitor in the presence of GTP [11]
probably reflects the relief of the enzyme from a pre-existing
inhibited state
Figure 11 Influence of cyclosporin A and anti-cyclophilin antibodies on
PLA2 activity
The activity of PLA2 was measured in the isolated and solubilized plasma membrane in the
presence and absence of 45 nM Gα . Inhibitors were present at 1 μM. The results are the
means +
− S.D. of five independent measurements, normalized to the PLA2 activity of the untreated
plasma membrane (5 pkat/mg of protein) which is set to 100 %. The experiment was repeated
with seven different plasma membrane preparations which yielded similar results. Data marked
with * significantly differ (95 %) from non-treated wild-type plasma membrane preparation
(first column). Data with ** significantly differ (95 %) from rGα 900. The results of TG11 are
not significantly different from TG11 + CsA. as cyp, IgG fraction of anti-human-cyclophilin
antiserum; CsA, cyclosporin A; PM, plasma membrane; rGα , recombinant Gα ; TG11, plasma
membrane of low-Gα mutant.
GTP (or GTPγ S) plus elicitor evoked the same increase in
enzyme activity in the absence of Gα as in the presence of
inhibitory concentrations (Figure 8). Replacement of GTP by
GDP or GDPβS prevented any stimulation. The Gα -deprived
mutant TG11 lacked the stimulation by elicitor plus GTP but
regained this property after addition of Gα (Figure 9). This also
supports the ability of added Gα to functionally replace the
originally bound Gα .
With increasing Gα concentrations, this protein undergoes
self-interaction, thereby competing with its binding to PLA2
Both the FRET-based analysis and the yeast split-ubiquitin
assay indicated a high affinity of Gα for di- or oligo-merization
(Figures 4, 6 and 7). Although the actual outputs of both assays
are only qualitative or semiquantitative in nature, it is remarkable
that products of the same Gα gene display the same tendency in
the Eschscholzia cell and in yeast. The di- or oligo-merization
at increasing concentrations most likely explains why the effect
of added Gα changes from inhibition to stimulation of PLA2
(Figure 3). The stimulation of PLA2 by elicitor plus GTP was
higher at 45 nM Gα than at 900 nM Gα , which is consistent
with the loss of PLA2 -bound Gα at high concentrations. The
latter conditions allow the highest specific activity of PLA2 to
be measured in the solubilized plasma membrane (approximately
190 %, Figure 8). Under such conditions, most of the inhibitory
Gα molecules are expected to be inaccessible to the enzyme due to
di- or oligo-merization, with the remainder maximally stimulated
by elicitor plus GTP.
The interaction between PLA2 and Gα involves the catalytic activity
of a cyclophilin
Figure 12
Hypothetical scheme of the complex interaction of Gα and PLA2
The scheme presents the most plausible interpretation of present and previous data [11,27,41]
obtained with E. californica plasma membrane. The top half shows the low-activity states of
PLA2 , modulated by the endogenous Gα of the plasma membrane preparation (centre) or by
added Gα (left- and right-hand sides). The bottom half represents activated states that arise
from conformational transfer via GTP plus elicitor, which requires cyclophilin (Cp). Numbers
are representative PLA2 activities, attributed to the presumptive complexes, as taken from
Figure 3 (low-activity states) and Figure 8 (GTP-activated states). The PLA2 activity noted at the
low-activity states is not influenced by added GDP (Figure 8). It remains open as to whether
these complexes contain bound GDP.
the recombinant protein compensates for the lack of native Gα
(Figure 9).
The impact of Gα on PLA2 is inhibitory in nature
Low Gα concentrations inhibited the enzyme activity under a variety of conditions (Figures 3 and 8). In the absence of extra Gα , the
A plant-type PPIase co-precipitated with Gα and the cognate gene
could be cloned (Figure 10). Also, an anti-cyclophilin antibody
caused a significant inhibition of PLA2 activity (Figure 11). The
basal level of PLA2 activity, its increase caused by elicitor plus
GTP, the inhibitory effect of low Gα and the stimulation caused
by high Gα concentrations were all attenuated by cyclosporin A
(Figures 8 and 11).
The effect of cyclosporin A is related to the endogeneous Gα
content: the low-Gα mutant is less strongly inhibited than the
untreated wild-type (Figure 11, TG11). Taken together, our data
show that PLA2 is regulated by Gα via controlled inhibition.
In the absence of elicitor, the Gα contained in the plasma
membrane complex keeps the enzyme in a low activity state.
This inhibition can be intensified by increasing the native Gα
content (approximately 20 nM under assay conditions) up to 3fold, i.e. through addition of approximately 45 nM of the native
or recombinant protein.
The tight binding to PLA2 of low (native) Gα concentrations
is well documented, e.g. by various immunoprecipitations and
native protein electrophoresis that revealed detergent-resistant
c The Authors Journal compilation c 2013 Biochemical Society
508
M. Heinze and others
complexes of approximately 130 and 170 kDa which did not
dissociate upon addition of GTP plus elicitor [11]. The elicitor
signal causes a release from inhibition, most probably via
the known conformational activation of Gα that requires GTP.
Although not the focus of the present study, we assume that
this elicitor effect is mediated via a GPCR (G-protein-coupled
receptor), as a seven-transmembrane protein (subfamily MLO1)
was found among the interactors of Gα in the split-ubiquitin assay
(Figure 7B and C. Massalski and W. Roos, unpublished work).
Classically, plant G-proteins are thought to be coupled to seventransmembrane receptors [47] that share limited homology with
animal GPCRs [48] and homologues of this type are present in an
actual interactome of Gα of Arabidopsis [17].
A novel mechanism that tends to shift Gα away from the
PLA2 -inhibiting state is the self-interaction of this protein at
high local concentrations. The competition of oligomerization
with the binding to PLA2 probably gives rise to complexes of
different Gα /PLA2 stoichiometry. Such complexes would also
display different influences of GTP at the enzyme activity level. As
a consequence, a broad range of PLA2 activities can be expected,
each depending on the actual Gα content and GTP level. Not
only would their basal PLA2 activity be different, but also the
final amplification of the elicitor signal would differ significantly
(Figure 12).
From the biological point of view, the results of the present
study support the idea that soluble Gα in the neighbouring
cytoplasm can modulate the activity of the target PLA2 at the
plasma membrane via exchange and equilibration with the bound
G-protein. Although, in the cell culture used in the present study,
the cellular content of Gα did not undergo dramatic changes (M.
Heinze and W. Roos, unpublished work), differences in the Gα
levels associated with growth and cellular development [49,50]
are worthwhile for investigation in future studies. In either case,
local imbalances in soluble Gα probably influence the architecture
and effectivity of the PLA2 -containing complex(es).
Cyclophilins, which have not yet been reported as components
of the Gα -containing complexes, may now be considered as
intrinsic catalysts or mediators of the interaction between Gα and
its neighbouring targets. The involvement of these chaperonelike proteins, as suggested from the results of the present study,
could motivate new experiments that aim at understanding the
conformation-based signal transfer within a Gα -target complex.
It also remains an aim of further experiments to determine
whether or not the control of PLA2 at the plasma membrane
involves the Gβ γ complex or its components. In vitro studies
compatible with that shown in the present study are hampered by
the lack of supply of Gβ , as the recombinant overproduction of
this plant plasma membrane-associated protein has not yet proved
successful (U. Conrad, unpublished work). The Gγ subunit of
Arabidopsis is available via recombinant expression in bacteria,
and preliminary data show a significant influence of this protein on
the interaction between Gα and PLA2 (Supplementary Figure S3 at
http://www.biochemj.org/bj/450/bj4500497add.htm). This might
serve as a first indication that Gγ , whose interaction with Gα is
weak but still detectable (Figure 7B), can modulate the interaction
between Gα and its target. However, to obtain biologically relevant
data, experiments that include the simultaneous presence of the Gβ
and Gγ subunit of Eschscholzia are indispensable. Thus, although
the regulatory effect of the Gα subunit clearly dominates the
PLA2 -dependent signal path in Eschscholzia (the present study
and [23]), modulating influences of the other subunits cannot be
excluded. In Arabidopsis, the use of mutants either lacking or with
reduced amounts of a distinct G-subunit, has yielded evidence
that distinct signal paths only require Gα , whereas others require
the Gβγ complex or the heterotrimer [8,10,51,52]. To date, the
c The Authors Journal compilation c 2013 Biochemical Society
interaction of Gα and PLA2 as documented by the present study is
not reflected in genome-wide interactome studies in Arabidopsis:
one of the published sequences in [17] shows detectable, but very
low, similarity to the PLA2 of Eschscholzia. Such discrepancies
might be resolved in the near future by completing the coverage
of this and related genomes and performing a more thorough
comparison with other species. Although in Arabidopsis Gα is
almost completely located at the plasma membrane and ER (see
above), the co-existence of monomeric and complex-bound Gα
has been reported [14].
Thus the present data may open new research avenues to
understand the diversity of available and new Gα interactors.
The interplay of bound and soluble Gα can create membraneassociated complexes of varying architecture and efficiency. They
constitute a hitherto underestimated level of tuning in G-proteincontrolled signalling which contributes much to its flexibility and
adaptability.
AUTHOR CONTRIBUTION
Michael Heinze did the assays of PLA2 activity, plasma membrane preparations, and
established and characterized all of the transgenic Eschscholzia strains. Madeleine Herre,
supervised by Michael Heinze and Werner Roos, contributed with PLA2 assays in the Gprotein-treated plasma membrane. Werner Roos and Michael Heinze did the FRET analysis
of Gα -interaction. Carolin Massalski did all the mbSUS approach experiments and supplied
plasma membrane samples of Arabidopsis . Udo Conrad and Isabella Herrmann produced
and characterized recombinant Gα and Gγ , and anti-Gα scFv antibodies and antisera.
Werner Roos co-ordinated the study and wrote the paper.
ACKNOWLEDGEMENTS
We thank Dr Angelika Schierhorn (Max Planck – Forschungsstelle für Enzymologie der
Proteinfaltung, Halle, Germany) for MS/MS protein sequencing, Gabriele Danders and
Beate Schöne for engaged technical assistance, and Professor Gary Sawers for expert
linguistic help. The yeast strains THY.AP4 and THY.AP5 as well as the pSUgate vectors
pMetYCgate, pNubWtXgate, pNXgate32-3HA, pXNgate21-3HA and pNX32-DEST were
provided by Wolf Frommer (Department of Plant Biology, Carnegie Institution for Science,
Washington DC, U.S.A.) and Klaus Harter (Plant Science Center, University of Tübingen,
Tübingen, Germany). The cloning vectors vectors pICH 56022 and pICH49100 (with eGFP
insert) were supplied by Icon Genetics; we thank Dr Sylvestre Marillonnet and Dr Carola
Engler for expert help with the cloning of Gα –eGFP vectors. The microscopic imaging
software AxioVision SE64 (release 4.8.3.0) was made available by Carl Zeiss Microscopy.
FUNDING
This work was supported by the German Research Council (DFG) [grant number RO
889/12 (to W.R.)], the Graduate College “Plant protein complexes” (to C.M.) and the
Martin-Luckner Foundation, Halle (to M.H.).
REFERENCES
1 Temple, B. R. S. and Jones, A. M. (2007) The plant heterotrimeric G-protein complex.
Annu. Rev. Plant. Biol. 58, 249–266
2 Marinissen, M. J. and Gutkind, J. S. (2001) G-protein-coupled receptors and signaling
networks: emerging paradigms. Trends Pharmacol. Sci. 22, 368–376
3 Oldham, W. M. and Hamm, H. E. (2008) Heterotrimeric G protein activation by
G-protein-coupled receptors. Nature 9, 60–71
4 Ho, M. K. C., Su, Y., Yeung, W. W. S. and Wong, Y. H. (2009) Regulation of transcription
factors by heterotrimeric G proteins. Curr. Mol. Pharm. 2, 19–31
5 Jones, A. M. (2002) G-protein-coupled signaling in Arabidopsis . Curr. Opin. Plant Biol.
5, 402–407
6 Chakravorty, D., Trusov, Y., Zhang, W., Acharya, B. R., Sheahan, M. B., McCurdy, D. W.,
Assmann, S. M. and Botella, J. R. (2011) An atypical heterotrimeric G-protein γ -subunit
is involved in guard cell K + -channel regulation and morphological development in
Arabidopsis thaliana . Plant J. 67, 840–851
7 Li, S., Liu, Y., Zheng, L., Chen, L., Li, N., Corke, F., Lu, Y., Fu, X., Zhu, Z., Bevan, M. W.
and Li, Y. (2012) The plant-specific G protein γ subunit AGG3 influences organ size and
shape in Arabidopsis thaliana . New Phytol. 194, 690–703
8 Assmann, S. M. (2005) G proteins go green. A plant G protein signaling FAQ sheet.
Science 130, 71–73
Gα and cyclophilin regulate a plant phospholipase A2
9 Chen, J. G. (2008) Heterotrimeric G-proteins in plant development. Front. Biosci. 13,
3321–3333
10 Delgado-Cerezo, M., Sanchez-Rodriguez, C., Escudero, V., Miedes, E., Fernandez, P. V.,
Jorda, L., Hernandez-Blanco, C., Sanchez-Vallet, A., Bednarek, P., Schulze-Lefert, P. et al.
(2012) Arabidopsis heterotrimeric G-protein regulates cell wall defense and resistance to
necrotrophic fungi. Mol. Plant 5, 98–114
11 Heinze, M., Steighardt, J., Gesell, A., Schwartze, W. and Roos, W. (2007) Regulatory
interaction of the G protein with phospholipase A2 in the plasma membrane of
Eschscholzia californica . Plant J. 52, 1041–1051
12 Urano, D., Jones, J. C., Wang, H., Matthews, M., Bradford, W., Bennetzen, J. L. and
Jones, A. M. (2012) G protein activation without a GEF in the plant kingdom. PLoS Genet.
8, e1002756
13 Kato, C., Mizutani, T., Tamaki, H., Kumagai, H., Kamiya, T., Hirobe, A., Fujisawa, Y., Kato,
H. and Iwasaki, Y. (2004) Characterization of heterotrimeric G protein complexes in rice
plasma membrane. Plant J. 38, 320–331
14 Wang, S., Assmann, S. M. and Fedoroff, N. V. (2008) Characterization of the Arabidopsis
heterotrimeric G protein. J. Biol. Chem. 283, 13913–13922
15 Warpeha, K. M., Lateef, S. S., Lapik, Y., Anderson, M., Lee, B. S. and Kaufman, L. S.
(2006) G-protein-coupled receptor 1, G-protein α-subunit 1, and prephenate dehydratase
1 are required for blue light-induced production of phenylalanine in etiolated
Arabidopsis . Plant Pathol. 140, 844–855
16 Adjobo-Hermans, M. J. W., Goedhart, J. and Gadella, T. W. J. (2006) Plant G protein
heterotrimers require dual lipidation motifs of Gα and Gγ and do not dissociate upon
activation. J. Cell Sci. 119, 5087–5097
17 Klopffleisch, K., Phan, N., Augustin, K., Bayne, R. S., Booker, K. S., Botella, J. R., Carpita,
N. C., Carr, T., Chen, J. G., Cooke, T. R. et al. (2011) Arabidopsis G-protein interactome
reveals connections to cell wall carbohydrates and morphogenesis. Mol. Syst. Biol.
7, 532
18 Wolf, C. (2011) Die Auffindung Neuer Bindepartner Pflanzlicher G-Proteine Durch
Genetische, Zellbiologische und Biochemische Methoden., Ph.D. Thesis, Martin Luther
University, Halle-Wittenberg, Germany
19 Millner, P. A. (2001) Heterotrimeric G-proteins in plant cell signaling. New Phytol. 151,
165–174
20 Roos, W., Evers, S., Tschöpe, M. and Schumann, B. (1998) Shifts of the intracellular pH
distribution as a part of the signal mechanism leading to the elicitation of
benzophenanthridine alkaloids. Plant Physiol. 118, 349–364
21 Schwartze, W. and Roos, W. (2008) The signal molecule lysophosphatidylcholine in
Eschscholzia californica is rapidly metabolized by reacylation. Planta 229,
183–191
22 Viehweger, K., Dordschbal, B. and Roos, W. (2002) Elicitor-activated phospholipase A2
generates lysophosphatidylcholines that mobilize the vacuolar H + pool for pH signaling
via the activation of Na + -dependent proton fluxes. Plant Cell 14, 1509–1525
23 Viehweger, K., Schwartze, W., Schumann, B., Lein, W. and Roos, W. (2006) The G protein
controls a pH-dependent signal path to the induction of phytoalexin biosynthesis in
Eschscholzia californica . Plant Cell 18, 1510–1523
24 Roos, W., Viehweger, K., Dordschbal, B., Schumann, B., Evers, S., Steighardt, J. and
Schwartze, W. (2006) Intracellular pH signals in the induction of secondary pathways –
the case of Eschscholzia californica . J. Plant Physiol. 163, 369–381
25 Scherer, G., Ryu, S. B., Wang, X., Matos, A. R. and Heitz, T. (2010) Patatin-related
phospholipase A: nomenclature, subfamilies and functions in plants. Trends Plant Sci.
15, 693–700
26 Angelova, Z., Buchheim, M., Frowitter, D., Schierhorn, A. and Roos, W. (2010)
Overproduction of alkaloid phytoalexins in california poppy cells is associated with the
co-expression of biosynthetic and stress-protective enzymes. Mol. Plant 3,
927–939
27 Roos, W., Dordschbal, B., Steighardt, J., Hieke, M., Weiss, D. and Saalbach, G. (1999) A
redox-dependent, G-protein-coupled phospholipase A of the plasma membrane is
involved in the elicitation of alkaloid biosynthesis in Eschscholtzia californica . Biochim.
Biophys. Acta 1448, 390–402
28 Larsson, C., Sommarin, M. and Widell, S. (1994) Isolation of highly-purified plant
plasma membranes and separation of inside-out and right-side-out vesicles. Methods
Enzymol. 228, 451–469
29 Heinze, M. and Roos, W. (2013) Assay of phospholipase A activity. Methods Mol. Biol.,
in the press
30 Schumacher, H. M., Gundlach, H., Fiedler, F. and Zenk, M. H. (1987) Elicitation of
benzophenanthridine alkaloid synthesis in Eschscholtzia cell cultures. Plant Cell Rep. 6,
410–413
509
31 Kelley, M. J., Crowl, R. M. and Dennis, E. A. (1992) Renaturation of cobra venom
phospholipase A2 from a synthetic gene in Escherichia coli . Biochim. Biophys. Acta
1118, 107–115
32 Gahrtz, M. and Conrad, U. (2009) Immunomodulation of plant function by in vitro
selected single-chain Fv intrabodies. Methods Mol. Biol. 483, 289–312
33 de Wildt, R. M. T., Mundy, C. R., Gorick, B. D. and Tomlinson, I. M. (2000) Antibody
arrays for high-throughput screening of antibody-antigen interactions. Nat. Biotechnol.
18, 989–994
34 Obrdlik, P., El-Bakkoury, M., Hamacher, T., Cappellaro, C., Vilarino, C., Fleischer, C.,
Ellerbrok, H., Kamuzinzi, R., Ledent, V., Blaudez, D. et al. (2004) K + channel interactions
detected by a genetic system optimized for systematic studies of membrane protein
interactions. Proc. Natl. Acad. Sci. U.S.A. 101, 12242–12247
35 Engler, C., Kandzia, R. and Marillonnet, S. (2008) A one pot, one step, precision cloning
method with high throughput capability. PLoS ONE 3, e3647
36 Weber, E., Engler, C., Gruetzner, R., Werner, S. and Marillonnet, S. (2011) A modular
cloning system for standardized assembly of multigene constructs. PLoS ONE 6, e16765
37 Weiss, C. A., White, E., Huang, H. and Ma, H. (1997) The G protein α subunit (GP α1) is
associated with the ER and the plasma membrane in meristematic cells of Arabidopsis
and cauliflower. FEBS Lett. 407, 361–367
38 Kaydamov, C., Tewes, A., Adler, K. and Manteuffel, R. (2000) Molecular characterization of
cDNAs encoding G protein α and β subunits and study of their temporal and spatial
expression patterns in Nicotiana plumbaginifolia Viv. Biochim. Biophys. Acta 1491,
143–160
39 Nato, A., Mirshahi, A., Tichtinsky, G., Mirshahi, M., Faure, J. P., Lavergne, D., De Buyser,
J., Jean, C., Ducreux, G. and Henry, Y. (1997) Immunological detection of potential
signal-transduction proteins expressed during wheat somatic tissue culture. Plant
Physiol. 113, 801–807
40 Gordon, G. W., Berry, G., Liang, X. H., Lewine, B. and Herman, B. (1998) Quantitative
fluorescence resonance energy transfer measurements using fluorescence microscopy.
Biophys. J. 74, 2702–2713
41 Chen, J., Lalonde, S., Obrdlik, P., Vatani, A. N., Parsa, S. A., Vilarino, C., Revuelta, J. L.,
Frommer, W. B. and Rhee, S. Y. (2012) Uncovering Arabidopsis membrane protein
interactome enriched in transporters using mating-based split-ubiquitin assays and
classification models. Front. Plant Sci. 3, 124
42 Graff, L., Obrdlik, P., Yuan, L., Loque, D., Frommer, W. B. and von Wiren, N. (2011)
N-terminal cysteines affect oligomer stability of the allosterically regulated ammonium
transporter LeAMT1;1. J. Exp. Bot. 62, 1361–1373
43 Kittanakom, S., Chuk, M., Wong, V., Snyder, J., Edmons, D., Lydakis, A., Zhan, Z.,
Auerbach, D. and Stagljar, I. (2009) Analysis of membrane protein complexes using the
split-ubiqutin membrane yeast-two-hybrid (MYTH) system. Methods Mol. Biol. 548,
247–271
44 Petschnigg, J., Wong, V., Snyder, J. and Stagljar, I. (2012) Investigation of membrane
protein interactions using the split-ubiquitin membrane yeast-two-hybrid system.
Methods Mol. Biol. 812, 225–244
45 Scholze, C., Peterson, A., Diettrich, B. and Luckner, M. (1999) Cyclophilin isoforms from
Digitalis lanata . Sequences and expression during embryogenesis and stress. J. Plant
Physiol. 155, 212–219
46 He, Z., Li, L. and Luan, S. (2004) Immunophilins and parvulins. Superfamily of
peptidyl-prolyl-isomerases in Arabidopsis . Plant Physiol. 134, 1248–1267
47 Gookin, T. E., Kim, J. and Assmann, S. M. (2008) Whole proteome identification of plant
candidate G-protein coupled receptors in Arabidopsis , rice, and poplar: computational
prediction and in-vivo protein coupling. Genome Biol. 9, R120.1
48 Chen, J. G., Willard, F. S., Huang, J., Liang, J. S., Chasse, S. A., Jones, A. M. and
Siderovski, D. P. (2003) A seven-transmembrane RGS protein that modulates plant cell
proliferation. Science 302, 1728–1731
49 Bisht, N. C., Jez, J. M. and Pandey, S. (2010) An elaborate heterotrimeric G-protein family
from soybean expands the diversity of plant G-protein networks. New Phytol. 190, 35–48
50 Izawa, Y., Takayanagi, Y., Inaba, N., Abe, Y., Minami, M., Fujisawa, H. K., Kato, H., Ohki,
S., Kitano, H. and Iwasaki, Y. (2010) Function and expression pattern of the α-subunit of
the heterotrimeric G protein in rice. Plant Cell Physiol. 51, 271–281
51 Ullah, H., Chen, J. G., Temple, B., Boyes, D. C., Alonso, J. M., Davis, K. R., Ecker, J. R.
and Jones, A. M. (2003) The β-subunit of the Arabidopsis G protein negatively regulates
auxin-induced cell division and affects multiple developmental processes. Plant Cell 15,
393–409
52 Joo, J. H., Wang, S., Chen, J. G., Jones, A. M. and Fedoroff, N. V. (2005) Different
signaling and cell death roles of heterotrimeric G protein α and β subunits in the
Arabidopsis oxidative stress response to ozone. Plant Cell 17, 957–970
Received 11 May 2012/12 December 2012; accepted 19 December 2012
Published as BJ Immediate Publication 19 December 2012, doi:10.1042/BJ20120793
c The Authors Journal compilation c 2013 Biochemical Society
Biochem. J. (2013) 450, 497–509 (Printed in Great Britain)
doi:10.1042/BJ20120793
SUPPLEMENTARY ONLINE DATA
Signal transfer in the plant plasma membrane: phospholipase
A2 is regulated via an inhibitory Gα protein and a cyclophilin
Michael HEINZE*, Madeleine HERRE*, Carolin MASSALSKI*, Isabella HERMANN†, Udo CONRAD† and Werner ROOS*1
*Martin-Luther-University Halle-Wittenberg, Institute of Pharmacy, Department of Molecular Cell Biology, Kurt-Mothes-Str. 3, 06120 Halle, Germany, and †Leibniz-Institute of Plant
Genetics and Crop Plant Research Corrensstrasse 3, D-06466 Gatersleben, Germany
Figure S1
Specific binding of anti-Gα scFv2 to Gα
The graph shows the activities of alkaline phosphatase (means +
− S.D., n = 3) obtained using the
indirect ELISA assay (see the Experimental section of the main text). Background binding to BSA
was subtracted. The three antigens were produced in bacteria using the same vector (pET23a).
Thus the Gγ protein preparations contain the same tags and the same bacterial impurities (if
any) as Gα . Note that these non-Gα epitopes (including Gγ ) are not detected by the used scFv.
Figure S2 Expression of genes encoding Gα –CFP, Gα –YFP and Gα –eGFP
fusion proteins in Eschscholzia cells
RT–PCR was performed with mRNA extracted from transformed cells 4 days after biolistic gene
transfer. Samples were transcribed into cDNA and used as templates for PCR with specific
primers as indicated. The expression of the Gα –CFP and Gα –YFP fusion genes was tested
by amplifying the full-length ORF and a shorter sequence, which contains the 3 -part of the
gene encoding Gα plus a fluorophore gene. Lane 1, DNA molecular markers with values in bp
(Fermentas SM1331). All samples except four contained template mRNA from cells transformed
with Gα –CFP plus Gα –YFP. Lane 2, primers Gα 1 for/CFP rev; lane 3, primers Gα 1 for/YFP
rev; lane 5, primers Gα 2 for/CFP rev; lane 6, primers Gα 2 for/YFP rev. Lane 4, mRNA of
cells transformed with Gα –eGFP, primers Gα 1 for/eGFP rev. Each band shown in the Figure
corresponded to the calculated product size. Primers are given in Table 1 of the main text.
Figure S3
Received 11 May 2012/12 December 2012; accepted 19 December 2012
Published as BJ Immediate Publication 19 December 2012, doi:10.1042/BJ20120793
A Gγ protein attenuates the inhibitory effect of Gα at PLA2
Using the same experimental design as in Figure 3 of the main text, 900 nM of recombinant
Gγ 1 from Arabidopsis was added to the plasma membrane either alone or together with
inhibitory concentrations of Gα and the resulting PLA2 activity was measured as described in
the Experimental section of the main text. Data are means +
− S.D., n = 3. In a parallel experiment,
Gγ 2 displayed similar effects (results not shown). rGα, recombinant Gα ; PM, plasma membrane.
1
To whom correspondence should be addressed (email [email protected]).
The nucleotide sequence data of the Eschscholzia cyclophilin reported will appear in GenBank® , EMBL, DDBJ and GSDB Nucleotide Sequence
Databases under the accession number JQ886493.
c The Authors Journal compilation c 2013 Biochemical Society