National Environmental Research Institute
Ministry of the Environment . Denmark
Molecular and ecological
factors affecting survival and
activities of the biocontrol agent
Pseudomonas fluorescens CHA0
PhD thesis
Kirsten Bang Lejbølle
The Royal Veterinary and Agricultural University, Denmark
(Blank page)
National Environmental Research Institute
Ministry of the Environment . Denmark
Molecular and ecological
factors affecting survival and
activities of the biocontrol agent
Pseudomonas fluorescens CHA0
PhD thesis
2004
Kirsten Bang Lejbølle
The Royal Veterinary and Agricultural University, Denmark
Data sheet
Title:
Subtitle:
Molecular and ecological factors affecting survival and activities of the biocontrol
agent Pseudomonas fluorescens CHA0
PhD thesis
Author:
Department:
Kirsten Bang Lejbølle
Environmental Chemistry and Microbiology
National Environmental Research Institute
University:
The Royal Veterinary and Agricultural University, Denmark
Publisher:
URL:
National Environmental Research Institute 
Ministry of the Environment
http://www.dmu.dk
Date of publication:
December 2004
Referee:
Svend J. Binnerup, National Environmental Research Institute, Department of Environmental Chemistry and Microbiology
Financial support:
‘Centre for Bioethics and Risk Assessment’ funded by the Danish Research Councils.
Swiss Federal Office of Education and Science.
Please cite as:
Lejbølle, K.B. 2004: Molecular and ecological factors affecting survival and activities
of the biocontrol agent Pseudomonas fluorescens CHA0. PhD thesis. The Royal Veterinary and Agricultural University, Denmark and National Environmental
Research Institute, Department of Environmental Chemistry and Microbiology.
22 pp. National Environmental
Research Institute http:/afhandlinger.dmu.dk
Reproduction is permitted, provided the source is explicitly acknowledged.
Abstract:
Biological control is a potential alternative to chemically based disease control.
Among bacteria especially pseudomonas have been found to be prospective candidates for biological control against root pathogenic fungi. However, the environment
in which the protection must take place is complex, and a major problem for practical
application of pseudomonad biocontrol agents is variable biocontrol activity and
poor survival after addition to soil due to variable biotic and abiotic factors. The aim
of this thesis is to investigate factors and mechanisms controlling the activity and viability of pseudomonas intended for biological control of plant pathogenic fungi. The
well-characterized soil bacterium Pseudomonas fluorescens CHA0 was used as model
strain throughout the work.
Keywords:
Biological control, Pseudomonas fluorescens CHA0, Rhizosphere colonization, survival
during stress, sigma factors, host plant cultivar, exopolysaccharide production
Cover photo:
KMB agar plate with mucoid and non-mucoid P. fluorescens CHA0 derivatives, Microcosm set-up with beet seedlings, gfp-tagged P. fluorescens cells on the surface of a
wheat root.
ISBN:
87-7772-874-2
Number of pages:
22
Internet-version:
The report is only available in electronic format from NERI’s homepage
http://www2.dmu.dk/1_viden/2_Publikationer/3_Ovrige/rapporter/phd_kbl.pdf
Preface
This PhD thesis constitutes a partial fulfillment of the requirements
for the Doctor of Philosophy degree at the Royal Veterinary and Agricultural University (KVL), Frederiksberg, Denmark. The thesis
comprises a literature review and five manuscripts.
The experimental work was done at Laboratoire de Biologie Microbienne, Bâtiment de Biologie, Université de Lausanne (UNIL),
Lausanne, Switzerland during the first 1½ year of my thesis, and then
at Department of Environmental Chemistry and Microbiology, National Environmental Research Institute (NERI), Roskilde Denmark
and at the Section of Genetics and Microbiology, Department of Ecology, The Royal Veterinary and Agricultural University (KVL),
Frederiksberg, Denmark.
The work was supported by the Swiss Federal Office of Education
and Science (project C99.0032, European COST action 830) and by
‘Centre for Bioethics and Risk Assessment’ funded by the Danish
Research Councils.
I greatly acknowledge my supervisors Svend J. Binnerup (NERI),
Christoph Keel (UNIL), and Jan Sørensen (KVL) for support and inspiring discussions during my thesis. Thanks to collegues at NERI
and UNIL who´s company I have really appreciated. A special thank
to Margit Møller Fernquist, Bente Rose Hansen, Anne-Grethe HolmJensen, Thina Thane, and Lillian Frydelund Larsen for your help in
the lab. Thanks to Jens Efsen Johansen for good talks, help and advices. And last but not least: thanks to my family for help, support,
and patience.
Roskilde, 13/12 2004
Kirsten Bang Lejbølle
i
ii
Summery
Biological control is a potential alternative to chemically based disease control. Among bacteria especially pseudomonads have been
found to be prospective candidates for biocontrol against root pathogenic fungi. However, the environment in which the protection must
take place is complex, and a major problem for practical application
of pseudomonad biocontrol agents is variable biocontrol activity and
poor survival after addition to soil due to variable biotic and abiotic
factors.
The aim of this PhD Thesis is to investigate factors and mechanisms
controlling the activity and viability of pseudomonads intended for
biological control of plant pathogenic fungi. The well-characterized
soil bacterium Pseudomonas fluorescens CHA0 was used as model
strain throughout the work.
The thesis comprises a review of literature and five manuscripts. The
literature review goes through the interactions taking place during
root colonization and establishment of the biocontrol agent, starting
with a description of the rhizosphere – the environment in which
biocontrol of soil pathogenic fungi takes place.
Manuskript I describes how plants at the cultivar level differ in ability to support bacteria. Four related cultivars of beet, among which
one was genetically modified to be herbicide resistant, were examined in soil/plant microcosms for their ability to support root colonization by 1) the indigenous population of fluorescent pseudomonads,
2) a biocontrol inoculant Pseudomonas fluorescens CHA0, and 3) a mutant derivative of P. fluorescens CHA0, CHA212, showing reduced
survival compared to the wildtype, when exposed to certain stress
conditions. It was demonstrated that one of the beet cultivars did not
support proliferation of the biocontrol bacterium P.fluorescens strain
CHA0 and its mutant derivative, whereas the three other cultivars,
including the herbicide resistant, did.
In Manuscript II non-target effects by P. fluorescens CHA0 on a collection of rhizosphere bacteria was studied. The majority (65-92%) of
the isolates were sensitive to CHA0. In particular Cytophaga-like bacteria (CLB) were sensitive to CHA0. One CLB strain was selected for
further studies in rhizosphere microcosm experiments. No dramatic
effect was observed on the survival of this CLB strain in the presence
of CHA0 and its antibiotic- and exopolysaccharide overproducing
derivatives during a 23-day study with two dry stress periods introduced. The lack of interaction is suggested to be caused by different
niche occupancy in the barley rhizosphere.
Manuscript III presents a study on how hyperproduction of extracellular polysaccharides (EPS) influence on the capacity of fluorescent
pseudomonads to suppress plant diseases caused by soil-borne
pathogens. Among a collection of fluorescent Pseudomonas, 20% were
found to have a highly mucoid phenotype. It was furthermore found
that 2-3 times less mucoid than non-mucoid isolates exhibited bioiii
control activity against root diseases caused by Pythium and Fusarium. This phenomenon was further investigated using P. fluorescens
CHA0 and two EPS-overproducing derivatives as model strains in
both in vitro assays and gnotobiotic microcosm studies. The findings
suggest that EPS overproduction is not advantageous for biocontrol
activity in P. fluorescens, since the EPS matrix surrounding the mucoid
derivatives seems to hinder diffusion of certain antifungal compound, and moreover, the mucoid derivatives were restricted in root
colonization and had diminished surface motility.
Manuscript IV addresses the role of the sigma factor AlgU and the
anti-sigma factor MucA in stress adaptation of P. fluorescens CHA0. A
genomic region comprising the algU-mucA-mucB gene cluster was
identified. It was found that AlgU, along with MucA, tightly controls
EPS biosynthesis and tolerance towards desiccation and osmotic
stress in this bacterium. Overexpression of algU, however, did not
improve tolerance towards these stress factors.
Manuscript V addresses the role of the sigma factor RpoN in regulation of stress adaptation, antibiotic production and biocontrol activity
in P. fluorescens CHA0. The rpoN locus from CHA0 was cloned and
sequenced, and it was shown that an rpoN in-frame-deletion mutant
had reduced motility, was sensitive to osmotic stress, and was defective in the utilization of several nitrogen and carbon sources. Moreover, the rpoN mutant showed enhanced production of the antibiotic
2,4-diacetylphloroglucinol (DAPG), but lowered pyolyteorin (PLT)
production. In natural soil microcosms, the rpoN mutant was less
effective in protecting cucumber from root rot caused by Pythium
ultimum than the wild type CHA0.
iv
Sammendrag
Biologisk bekæmpelse er et potentielt alternativ til kemiske bekæmpelsesmidler. Blandt bakterier er specielt pseudomonaderne af interesse for biologisk kontrol af rod-patogene svampe. Det miljø hvori
den biologiske kontrol skal finde sted, er dog meget komplekst, og
variabel biokontrol-aktivitet og ringe overlevelse i jorden, pga. variable biotiske og abiotiske faktorer, hindrer den praktiske anvendelse af
pseudomonader til biologisk bekæmpelse.
Formålet med dette Ph.D.-projekt er at undersøge faktorer og mekanismer, der er af betydning for aktivitet og levedygtighed af pseudomonader til brug i biologisk bekæmpelse af plante-patogene
svampe. Den vel-karakteriserede jord-bakterie Pseudomonas fluorescens CHA0 er blevet brugt som model-organisme gennem disse studier.
Ph.D.-afhandlingen består af en litteraturgennemgang og fem manuskripter. Litteraturgennemgangen giver en præsentation af de interaktioner, der finder sted under rod-kolonisering og etablering af biokontrol-bakterien, og starter med en beskrivelse af rhizosfæren – det
miljø hvori biokontrol af jord-patogene svampe finder sted.
Manuskript I beskriver hvordan planter på sorts-niveau adskiller sig
fra hinanden i evnen til at understøtte bakterier. Fire beslægtede roesorter, hvoraf en var genetisk modificeret til herbicid-resistens, blev i
jord/plante mikrokosmer undersøgt for deres evne til at understøtte
rod-kolonisering af 1) den naturligt forekommende population af
fluorescerende pseudomonader, 2) biokontrol-inokulanten P. fluorescens CHA0, og 3) en mutant af P. fluorescens CHA0, CHA212, som
udviser reduceret overlevelse i forhold til vildtypen, når den udsættes for visse former for stress. Det blev demonstreret, at den ene af de
fire roe-sorter, modsat de tre andre, ikke understøttede kolonisering
af biokontrol-bakterien P. fluorescens CHA0 og mutanten af denne.
I Manuskript II blev non-target effekter af P. fluorescens CHA0 på en
samling af rhizosfære-bakterier undersøgt. De fleste af isolaterne (6592%) var sensitive overfor CHA0, og specielt de Cytophaga-lignende
bakterier (CLB) var sensitive overfor CHA0. En CLB stamme blev
yderligere undersøgt i rhizosfære mikrokosmos eksperimenter.
Overlevelsen af denne stamme blev ikke dramatisk påvirket ved tilstedeværelsen af CHA0 og dennes antibiotika- og exopolysakkaridoverproducerende mutanter i løbet af en periode på 23 dage med to
tørke-stress-perioder. Forklaringen kunne være, at de undersøgte
bakterier koloniserer hver deres nicher, eller at CHA0 ikke producerede antibiotika.
Manuskript III præsenterer et studie af hvordan hyper-produktion
af exopolysakkarid (EPS) influerer på fluorescerende pseudomonaders evne til at bekæmpe plante-sygdommme forårsaget af pathogener i jorden. Ud af en samling af fluorescerende pseudomonader
havde 20% af isolaterne en meget slimet fænotype. Ydermere udviste
2-3 gange færre slimede end ikke-slimede isolater biokontrol aktivitet
v
mod rod-sygdomme forårsaget af Pythium og Fusarium. Dette fænomen blev yderligere undersøgt i både in vitro forsøg og gnotobiotiske
mikrokosmos eksperimenter med P. fluorescens CHA0 og to EPSoverproducerende mutanter af CHA0 som model-stammer. Disse
forsøg antydede at EPS-overproduktion ikke er en fordel for biokontrol aktivitet hos P. fluorescens CHA0, eftersom EPS-laget omkring de
slimede mutanter tilsyneladende forhindrede diffusion af visse antibiotika. De slimede mutanter var også begrænsede i deres rodkolonisering og havde formindsket overflade-motilitet.
I Manuskript IV undersøgtes sigma faktoren AlgU´s og anti-sigma
faktoren MucA´s rolle i forhold til stress-tilpasningsevne hos P. fluorescens CHA0. En genomisk region bestående af generne algU-muvAmucB blev identificeret. Det blev vist at AlgU, sammen med MucA,
kontrollerer EPS biosyntesen og tolerancen overfor udtørring og osmotisk stress i denne bakterie. Overekspression af algU, forøgede dog
ikke tolerancen overfor disse stress-faktorer.
I Manuskript V undersøgtes sigma faktoren RpoN´s rolle i forhold til
stress-tilpasningsevne, antibiotika-produktion og biokontrol-aktivitet
hos P. fluorescens CHA0. rpoN locus fra CHA0 blev klonet og sekventeret, og det blev vist, at en rpoN–mutant havde reduceret mobilitet,
var sensitiv overfor osmotisk stress og havde en reduceret evne til at
udnytte forskellige nitrogen- og carbon-kilder. Derudover havde
rpoN-mutanten en forøget produktion af antibiotikumet 2,4diacetylphloroglucinol (DAPG), men en formindsket pyoluteorinproduktion. I jord-mikrokosmer var rpoN-mutanten ikke så effektiv
som vildtypen til at beskytte agurk mod rod-råd forårsaget af Pythium ultimum.
vi
Table of contents
Preface
i
Summery
iii
Sammendrag
v
Table of contents
vii
1
Introduction
1
2
The rhizosphere
2
2.1 Rhizodeposition and the stimulation of microorganisms 2
2.2 The influence of plant genetic variation on
microorganisms in the rhizosphere
4
3
Establishment and survival of the biocontrol
agent in the rhizosphere
4
6
3.1 Root colonization
3.2 Antagonistic strategies in the rhizosphere
3.3 Survival – with special focus on implication of sigma
factors in stress response
6
8
10
Conclusion and future directions
13
References 14
Manuscripts
Manuscript I
Lejbølle, K.B., Sørensen, J., and Binnerup, S.J.,
Differential root colonization of four beet cultivars
by the biocontrol agent Pseudomonas fluorescens
CHA0
In preparation
Manuscript II
Johansen, J.E., Binnerup, S.J., Lejbølle, K.B.,
Mascher, F., Sørensen, J., and Keel, C.
Impact of biocontrol strain Pseudomonas fluorescens
CHA0 on rhizosphere bacteria isolated from barley
(Hordeum vulgare L.) with special reference to Cytophaga-like bacteria
Journal of Applied Microbiology 2002, 93, 1065-1074
vii
Manuscript III Lejbølle, K.B., Péchy-Tarr, M., Baehler, E.,
Schnider-Keel, U., Zala, M., Binnerup, S.J., and
Keel, C.
Enhanced exopolysaccharide production is no advantage for biocontrol activity of Pseudomonas fluorescens CHA0
In preparation
Manuscript IV Schnider-Keel, U., Lejbølle, K.B., Baehler, E., Haas,
D., and Keel, C.
The sigma factor AlgU (AlgT) controls exopolysacharide production and tolerance towards desiccation and osmotic stress in the biocontrol agent Pseudomonas fluorescens CHA0
Applied and Environmental Microbiology 2001, 67,
5683-5693
Manuscript V
viii
Péchy-Tarr, M., Bottiglieri, M., Mathys, S., Lejbølle, K.B., Schnider-Keel, U., Maurhofer, M., and
Keel, C.
54
RpoN (σ ) controls production of antifungal compounds and biocontrol activity in Pseudomonas fluorescens CHA0
Molecular Plant-Microbe Interactions 2005, 18, 260272
1 Introduction
Still more and more traditional pesticides have given rise to
concern because of risks of environmental pollution, deleterious effects on non-target organisms, and pesticide resistance. Encouraged
by this increasing awareness of the problems associated with the
chemically based disease control, biological control has received considerable attention during the last 40 years as a potential alternative
(Cook and Baker, 1983). Biocontrol agents are able to protect plants
from infection by phyto-pathogenic organisms. Among bacteria especially pseudomonads have been found to be prospective candidates
for biocontrol against pathogenic fungi because of their effective root
colonization (Lugtenberg and Dekkers, 1999), production of a wide
range of extracellular antifungal compounds (Haas and Keel, 2003;
Keel and Défago, 1997; Thomashow, 1996; Dowling and O´Gara,
1994), and induction of systemic resistance (van Loon et al., 1998),
which are all important traits in biological control. Moreover, strains
of pseudomonads are easy to grow in vitro and readily amenable to
genetic manipulation (Haas and Keel, 2003). The manifestation of
biological control is a result of complex interactions between the
plant, the pathogen, the biocontrol agent, the microbial community,
and the physical environment. Due to these numerous and variable
biotic and abiotic factors, a major problem for practical application of
beneficial pseudomonads to control soil-borne plant diseases is inconsistent biocontrol activity and poor survival of these nonsporulating bacteria after addition to soil.
In the face of these complex and poorly understood ecological
interactions, better understanding of basic ecology on the host plant
root and of the mechanisms of adaptation of these bacteria to environmental stress, could help getting closer to solving the problems of
application of biocontrol agents.
The aim of the present thesis is to expand the knowledge of
factors and molecular mechanisms controlling the activity and viability of pseudomonads intended for biocontrol of plant pathogenic
fungi. In order to do so, the experimental work has been performed
using the strain Pseudomonas fluorescens CHA0 as a model organism.
CHA0 is a well-studied soil bacterium with a broad-spectrum biocontrol activity against several pathogenic fungi causing root diseases. The following chapters of the thesis will go through some of
the current knowledge of interactions taking place in connection to
biocontrol of pathogens – again with a special focus on strain CHA0.
This theoretical part will begin with a short description of the environment in which they take place, the rhizosphere.
1
2 The rhizosphere
In 1904, Hiltner used the term rhizosphere principally for the
area of bacterial growth around legume roots (Hiltner, 1904). In following decades the rhizosphere became generally known as the soil
region under immediate influence of living roots including the root
surface itself. A high microbial activity is associated with the rhizosphere.
2.1 Rhizodeposition
microorganisms
and
the
stimulation
of
During plant growth various materials are deposited by roots
into the rhizosphere, a phenomenon referred to as rhizodeposition
(Whipps and Lynch, 1985). The deposited materials can be divided
roughly into two main groups. The first group comprises a wide variety of water-soluble compounds including sugars, amino acids, organic acids, fatty acids, vitamins and enzymes. These exudates serve
as a source of carbon substrate stimulating microbial growth (Dakora
and Phillips, 2002). The second group comprises materials such as
sloughed-off root cap cells and other debris and mucilage (polysaccharide) originating from the root cap or from lysates released during
autolysis (Figure 1). The mucilage act as a lubricant while the roots
penetrate through the soil. Moreover, it is utilized as nutrient source
for microorganisms and is involved in attachment of microorganisms
to the root surface. Finally, the mucilage protects both roots and microorganisms against desiccation by forming a matrix for absorption
and transport of water between epidermal cells and soil particles
(Figure 1)(Knee et al., 2001; Sørensen, 1997; Campbell and Greaves,
1990). The combination of mucilage and gelatinous compounds produced by bacteria (such as capsules and slimes) has been termed mucigel (Jenny and Grossenbacher, 1963). The mucigel is important for
soil aggregation since it binds together clay particles, other minerals,
organic matter, individual bacteria and microcolonies into a layer
around the root epidermis or the remains of dead cell layers
Figure 1 The plant root region (from Lynch 1983)
2
Figure 2 Confocal scanning laser micrographs showing gfp-tagged Pseudomonas fluorescens cells on the surface of a wheat (Triticum aestivum) root,
detected by confocal scanning microscopy. Bacterial colonization is observed
to occur at the edges of the root epidermal cells as single cells (A) and in
microcolonies (B). Bar represents 10µm. (Unpublished results)
(Sørensen, 1997; Smith et al., 1993; Campbell and Greaves, 1990).
Lynch and Whipps (1991) estimated that as much as 40% of the
plant´s primary carbon production may be lost through rhizodeposition, depending on plant species, plant age, and environmental conditions. This leak of photosynthetic products into the soil environment may seem wasteful and even harmful if the activity of pathogens is stimulated. On the other hand the nutrient-rich environment
also allows microorganisms to mineralize organic matter from the
soil so that important elements become available to the plant
(Scumann, 1991).
Because of the continuous flow of organic substrate, intense
microbial activity is associated with the rhizosphere compared to the
activity in root-free (bulk) soil, a phenomenon referred to as the
“rhizosphere effect” (Bowen and Rovira, 1991). A 2- to 20-fold increase in total bacterial counts is normally found in the rhizosphere
compared to the bulk soil, but over a 100-fold increase have been recorded (Curl and Truelove, 1986). Accordingly, shorter generation
times are also observed in the rhizosphere compared to bulk soil. As
example, the generation time of Pseudomonas spp. in the rhizosphere
were found to be 5-14 hours, whereas it was found to be 77 hours in
the bulk soil (Bowen and Rovira, 1973).
Although microbial growth is stimulated in the rhizosphere,
the root surface is not covered with a continuous layer of microorganisms. Electron and direct light microscopy show that only 4-10%
of the root surface is colonized by microorganisms (Rovira et al.,
1974). Most colonization occurs in the areas of maximum root exudation such as the elongation zone behind the root tip, junctions between epidermal cells, on root hairs, and at sites of lateral root emergence (Stephensen Lübeck et al., 2000; Normander et al., 1999; ChinA-Woeng et al., 1997; Hansen et al., 1997) (Figure 2).
Rather than being static, the rhizosphere environment is typified by rapid changes in time and space, and following succession of
different groups of organisms and their functions (Sørensen, 1997;
Handelsman and Stabb, 1996). Early colonization of the young
rhizosphere is dominated by bacteria and especially pseudomonads
proliferate in response to the simple carbohydrate exudates from the
young plant roots (Sørensen 1997).
3
2.2 The influence of plant genetic variation on
microorganisms in the rhizosphere
Plants vary in their ability to support and respond to beneficial soil bacteria. This ability varies among plant species (Marschner
et al., 1997; Latour et al., 1996; Lemanceau et al., 1995), but also
among cultivars within species (Okubara et al., 2004; Simon et al.,
2001; Smith and Goodman, 1999; Miller et al., 1989; Weller,
1986)(Manuscript I). The main reason to the variation is most likely
differences in the amounts and composition of compounds exuded
into the rhizosphere by the host plant (Hawes et al., 2003; Rengel,
2002). Such variations in exudates could influence on bacterial root
colonization, proliferation, and/or metabolism (Åström and Gerhardson, 1988).
Several studies describe plant cultivar specific differences in
rhizosphere colonization by indigenous or inoculated pseudomonads. As example, Miller et al. (1989) found significant differences in
the indigenous rhizosphere population of fluorescent pseudomonads
among cultivars of maize, wheat, and grass. Okubara et al. (2004)
tested the ability of 27 wheat cultivars to support two beneficial P.
fluorescens strains that differed in ability of root colonization. It was
demonstrated, that the cultivars differed in the support of both bacterial strains individually. When the two strains were compared with
one another, seven cultivars supported significantly higher rhizosphere populations of the effective root colonization strain than the
less effective strain within 14 days after inoculation. The rest of the
cultivars were equally colonized by both strains, but differences in
the population density of the strains were found among the cultivars.
Weller (1986) found significant differences among 11 wheat cultivars
in their ability to support a take-all suppressive strain of P.fluorescens.
The hypothesis to the differences observed between the cultivars in
the examples mentioned above, were differing exudation of nutrients
or differing production of biochemical attractants and other signals.
We found that, among four different cultivars of beet supporting the
total population of indigenous fluorescent pseudomonads to the
same level, one cultivar did not support the proliferation of P. fluorescens CHA0 (Manuscript I). The four beet cultivars studied in our experiment, among which one was genetically modified to be herbicide
resistant, differed in their genetic relationship to sugar and fodder
beet, and the CHA0 non-supportive cultivar carried the lowest proportion of genes originating from sugar beet. Therefore, we hypothesized that differences in levels of sugar content in the root exudates
could be of importance in supporting certain strains of fluorescent
pseudomonads.
Variation among cultivars for disease suppression has also
been described. King and Parke (1993) found differential effects of
biocontrol by Pseudomonas cepacia AMMD in pea cultivars, hypothesized that the effects were related to the degree of susceptibility of
each cultivar to Pythium and Apanomyces. Liu et al. (1995) demonstrated that Pseudomonas putida significantly induced resistance
against anthracnose in three susceptible cucumber cultivars, but not
in a resistant cultivar included in their experiment. Finally, it has also
been shown that maize cultivars differently affect the expression of
the
antimicrobial
metabolite
2,4-diacetylphloroglucinol
in
4
P.fluorescens CHA0 (Notz et al., 2001). This result supports the hypothesis stating that the plant cultivar affects not only population size
and composition, but also specific mechanisms important in biocontrol.
As can be concluded from the above-mentioned examples, the
influence of plant cultivar variation on rhizosphere microorganisms
has mostly been studied from the view of the bacterial behaviour,
whereas there is an obvious lack of equivalent data concerning the
plant.
5
3 Establishment and survival of the
biocontrol agent in the rhizosphere
Nutritional “hot spots” on the root surface, are potential
points of entry of pathogens. Therefore, to exhibit effective biological
control, early distribution along the root at these sites, multiplication,
and survival for several weeks is of great importance for biocontrol
agents. However, during the establishment and growth of a biocontrol inoculant in the rhizosphere, continually interactions among the
biocontrol agent, the pathogen, the indigenous microbial community,
and the physical environment take place.
3.1 Root colonization
Rhizospere colonization is one of the first steps in the antagonism of soilborne microorganisms by bacterial biocontrol agents, and
the study of bacterial traits and genes governing root colonization has
been an active research field recently. Being one of the most effective
root-colonizing bacteria, especially Pseudomonas has been intensively
studied (Lugtenberg et al., 2001). Efficient uptake and use of nutrients
is important for successful rhizosphere colonization (Chin-A-Woeng
et al., 2003). Motility and chemotaxis may be important elements for
the uptake of nutrients; however, contradictory results on the importance of these traits in relation to colonization are found in the
literature. Howie et al. (1987) found that flagella-negative mutants of
P. fluorescens are not impaired in root colonization of wheat compared
with the flagella-positive wild type. They argued that the bacteria are
probably carried down passively as the root advances through the
soil. Using a flagella-negative mutant as well as mutants differing in
chemotactic attraction to exudates, Scher et al. (1988) found that neither motility nor chemotaxis was necessary for bean root colonization
by P. putida. Finally, we found that an rpoN mutant of P. fluorescens
CHA0, defective for flagella and consequently reduced in motility,
was not impaired in cucumber root colonization in Pythium ultimum
infested microcosm assays (Manuscript V). In contrast to these results
De Weger (1987) reported that four mutants of P. fluorescens without
flagella were impaired in their ability to colonize potato roots. Likewise, non-motile mutants of the biocontrol strain P. chlororaphis, were
at least 1000-fold impaired in competitive tomato tip colonization
compared with their wild type (Chin-A-Woeng et al., 2000). Consequently, the mutants also lost their ability to suppress disease, while
still being able to produce the same amounts of antifungal, extracellular metabolites as the wild type (Chin-A-Woeng et al., 2000). Finally, cheA mutants of P. fluorescens, that were defective in flagelladriven chemotaxis but retained motility, was as defective in competitive tomato root tip colonization as non-motile strains, indicating that
chemotaxis rather than random motility is important for root colonization (de Weert et al., 2002; Lugtenberg et al., 2001). However, in
non-competitive colonization tests none of the mutants differed from
the wild type, demonstrating that other factors are also involved in
the transportation of bacteria to the root tip. In accordance with
6
Howie et al. (1987), root growth was mentioned as possible factor for
this transportation.
Another bacterial property apparently involved in the process
of root colonization is a specific cell surface structure, the O-antigen
side chain of the outer membrane lipopolysaccharide (LPS). P. fluorescens and P. putida mutants, impaired in the synthesis of the O-antigen
side chain, have reduced ability to colonize the root of tomato
(Dekkers et al., 1998; Simons et al., 1996). Another O-antigen mutant
of P. fluorescens had a reduced ability to colonize the root interior of
tomato, whereas colonization of the root surface was not impaired
compared to the wild type (Duijff et al., 1997). In the same experiment no difference was observed in adherence to the root surface
between wild type and the O-antigen mutant (Duijff et al., 1997). The
reduced colonization by LPS-defective strains could be explained by
assuming that for optimal functioning of nutrient uptake systems an
intact outer membrane is required (Chin-A-Woeng et al., 2003).
The ability to stay attached to the root surface is also considered to be of importance for successful colonization. Agglutination
and attachment of Pseudomonas cells to plant roots is likely to occur
via pili, cell surface proteins, and polysaccharides (Chin-A-Woeng et
al., 2003). The number of pili on cells of P. fluorescens correlated with
the degree of attachment to tomato roots (Chin-A-Woeng et al., 2003).
Vesper (1987) examined a P. fluorescens strain that produced both
nonmucoid, highly piliated cells and mucoid and nearly un-piliated
cells. When comparing the two types of cells, a correlation was found
between piliation (number of piliated cells) and attachment to corn
roots dipped in a suspension of cells of the two types, respectively.
Bianciotto et al. (2001) observed that the Extracellular polysaccharide
(EPS) overproducing mucA mutant P. fluorescens CHA211 had an enhanced capacity of carrot root colonization which was characterized
by the formation of a dense patchy bacterial layer, whereas the wildtype strain CHA0 adhered rather little on the surface. In our study,
colonization patterns of mucA mutants on cress roots revealed a tendency of formation of characteristic clumps of cells that appeared to
be attached to each other within a matrix, but in contrast to the results of Bianciotto et al. (2001) this matrix seemed to restrict the distribution of cells along the root (Manuscript III). Although the mutants did possess flagella, motility of these mutants was moreover
impeded probably because of high amounts of EPS (Manuscript III).
The ability to synthesize specific vitamins and amino acids
seem also to be of importance for bacterial root colonization. In an
experiment of Simons et al. (1996) a thiamin (vitamin B1) auxotroph
mutant of P. fluorescens appeared to be a poor competitor in the tomato rhizosphere. In another work, Simons et al. (1997) found that 5
mutants of P. fluorescens auxotrophic for the amino acids leucine, arginine, histidine, isoleucine plus valine, and tryptophan, respectively,
were unable to colonize the tomato root tip, neither alone nor after
co-inoculation with the wildtype strain. Finally, Chin-A-Woeng et al.
(2000) found that a phenylalanine auxotrophic mutant of P. chlororaphis was at least 1000-fold less present on the tomato root tip when
tested in competition with the wild type in a gnotobiotic system.
When tested in unsterilized potting soil the mutant was below the
detection limit. Although the phenylalanine auxotrophic mutant was
not altered in its production of the extracellular metabolites hydrogen
7
cyanide, chitinase, protease, and phenazine-1-carboxamide, it had
lost its biocontrol ability against Fusarium oxysporum f.sp. radicislycopersici. This demonstrates that root colonization is an important
factor in disease suppression.
The often contrasting results obtained from study to study,
when examining single genes or traits are likely to be caused by experimental diversity, since nutrient availability, physical factors (like
for example the influence of water potential when testing bacterial
mobility), ability of the bacterial strain to adapt to the environment,
and more, must be decisive in this context. In a study by de Weert et
al. (2004) it was revealed that enrichment on one or more plant roots
of P. fluorescens with a mutY mutation (a mutation in a gene which
encodes a mismatch correction glycosylase) can lead to enhanced
competitive root tip colonization. Such mutants, defective in repairing its mismatches, harbor an increased number of mutations. It was
argued that such so-called mutators, can adapt much more quickly to
a certain environment than the wild type due to an increased mutation frequency. Such a strategy, based on adaptability and including
several genes, is interesting, and could lead to the development of
derivatives of e.g. biocontrol agents that are highly adapted to the
rhizosphere of certain plant species or even plant cultivars (de Weert
et al., 2004).
3.2 Antagonistic strategies in the rhizosphere
Once situated in the rhizosphere biocontrol agents must be
able to defend its occupation of nutrient rich sites under conditions of
intense competition with indigenous microorganisms. Populations of
introduced pseudomonas strains decline more rapidly in non-sterile
soil than in sterile soils (Natsch et al., 1994; Mazzola et al., 1992),
demonstrating that this competition with indigenous organisms, but
also predation by e.g. protozoa, are important factors for the persistence of inoculated strains. As a mean to survive under these conditions, psudomonads have evolved several defensive mechanisms.
Among the most studied are: 1) production of siderophores (iron
chelators) which bind iron in such a way that it is unavailable to other
microorganisms, and 2) production of diffusible or volatile antimicrobial compounds (antibiosis). These mechanisms of antagonism are
exploited in biological control since they may inhibit plant pathogens,
and they are therefore mostly referred to as mechanisms of disease
suppression.
Through production of siderophores by fluorescent pseudomonads pathogens can be inhibited by competition for iron. The
availability of iron [III] in soil is generally low (> 10-18 M in soil solutions at neutral pH) (Handelsman and Stabb, 1996). This presents a
challenge for microorganisms, which require iron at micromolar concentrations for growth. However, some microorganisms excrete
molecules under iron-starvation conditions, so-called siderophores,
which trap traces of iron [iii] and form stable complexes. Such complexes are transported into the cells through specific membranebound receptors (Sharma and Johri, 2003). The fluorescent pseudomonads produce siderophores such as the high-affinity iron chelators, pyoverdins, and may thereby exclude harmful microorganisms
producing less potent siderophores (Duijff et al., 1994). Although
P.fluorescens CHA0 does produce siderophores, their direct involve8
ment in suppression of pathogens has not been revealed. On the contrary, Keel et al. (1989), using a non-fluorescent, pyoverdin-negative
mutant, suggested that this siderophore was not involved in the suppression of Thielaviopsis basicola.
Inhibition of pathogens through production of antimicrobial
metabolites is considered to be the primary mechanism of biocontrol
by most fluorescent pseudomonads (Raaijmakers et al., 2002; Thomashow and Weller, 1995; Harman et al., 1978). Numerous antibiotics
have been isolated from a variety of strains of fluorescent pseudomonads, and a vide range of diversity is exhibited in both type and
number of antibiotics produced (table 1). Most of the isolated antibiotics are secondary metabolites, e.g. 2,4-diacetyl-phloroglucinol
(DAPG), pyolyteirin (PLT) (both phenolic compounds), and Phenazines (heterocyclic compounds), and are, thus, synthesized when
growth of the cells is restricted, either because of nutrient limitation
or at high cell density (Haas and Keel, 2003). The cyclic lipopeptides
(CLPs), e.g. viscosinamide and tensin, however, are produced during
growth (Nielsen et al., 2000; Nielsen et al., 1999). CLPs display both
biosurfactant and antifungal properties (Nielsen et al., 2002). Inactivation of antibiotic production by mutagenesis has often been used to
demonstrate that certain antibiotics produced by Pseudomonas species
play an important role in the biocontrol of plant diseases (Chin-AWoeng et al., 1998; Keel et al., 1990; Thomashow and Weller, 1988).
However, it has also been demonstrated that in strains producing
multiple antibiotics, mutants lacking one antibiotic may not loose
suppressive ability because homeostatic regulation mechanisms
compensate for the loss of one antibiotic by overproducing another,
and thereby maintaining total antibiotic production and biocontrol
(Schnider-Keel et al., 2000). The microcolony mode of growth of
pseudomonads on the root is thought to be of importance for the effect of the antimicrobial compounds against pathogens. Séveno et al.
(2001) demonstrated that the concentration of the antibiotic, phenazine-1-carboxylic acid was one or two orders of magnitude higher
inside microcolonies of P. aureofaciens than the concentrations observed in liquid media cultures of the bacterium. According to Haas
and Keel (2003) similar concentrations can be estimated for DAPG
production by P. fluorescens CHA0. This local antibiotic concentration
is thought to be sufficient to inhibit sensitive bacteria and fungi (Haas
and Keel, 2003). Therefore, although the biocontrol bacteria occupy
only a few percent of the root surface, the microcolonies might function as antibiotic ‘shields’ at the sites of entry of pathogens into the
plant. However, the structure of the matrix surrounding the microcolony may be important for the inhibitory ability of this shield.
Highly mucoid mutants of non-mucoid P. fluorescens CHA0 were
Table 1
strains
Examples of antibiotics produced by four Pseudomonas fluorescens
Strain
Antibiotic
Reference
CHA0
2,4-diacetylphloroglucinol, pyoluteorin,
pyrrolnitrin, phenazines, hydrogen cyanide
Voisard et al. (1994)
Pf-5
2,4-diacetylphloroglucinol, pyoluteorin,
pyrrolnitrin, hydrogen cyanide
Corbell and Loper (1995)
F113
2,4-diacetylphloroglucinol
Shanahan et al. (1992)
DR54
Viscosinamid
Nielsen et al. (1998)
9
found to exhibit significantly less inhibition towards three plant
pathogenic fungi in vitro compared to the wildtype strain CHA0,
although the mutants produced significantly higher levels of the antibiotics DAPG and PLT. The mucus of the mutants consists of extracellular polysaccharides (EPS), and we suggest that a too dense EPS
matrix surrounding the cells may hinder diffusion of some antibiotics
(Manuscript III).
Several attempts have been made to improve biocontrol efficiency by constructing antibiotic-overproducing strains, but the results have been ambiguous. Overproduction of DAPG by P. fluorescens CHA0 did not improve protection of sweet corn and cress
against Pythium damping-off, whereas it did enhance protection in
cucumber (Maurhofer et al., 1992). A DAPG overproducing strain of
P. fluorescens F113 was not more effective than the wild-type strain
against Pythium ultimum on sugar beet (Delany et al., 2001). Finally,
genes for biosynthesis of phenazine-1-carboxylic acid were introduced into P. fluorescens Q8r1-96, an aggressive root colonizer that
produces DAPG (Huang et al., 2004). The recombinant strains from
this work were no more suppressive of take-all or Pythium root rot
than the wild type, but were improved in biocontrol of Rhizoctonia
root rot. These studies indicate that improvement of disease suppression by enhancement of antibiotic production in P. fluorescens depend
on the host-pathogen system. Moreover it was suggested that some
strains already have developed optimal suppression mechanisms,
and that there might be a threshold dose of antibiotics above which
no further inhibition is derived (Huang et al., 2004). Finally, enhanced
antibiotic production was also thought to have a toxic effect on some
plants (Maurhofer et al., 1992).
3.3 Survival – with special focus on implication of
sigma factors in stress response
Capability to survive during stressful environmental conditions is obviously of importance for durable biocontrol. Microorganisms continuously sense and respond to environmental stimuli, such
as starvation, desiccation, osmotic stress, oxidative stress, and
changes in temperature (Suh et al., 1999). In many instances, an appropriate response to an environmental stimulus requires changes in
the levels of the specific gene products. Regulatory elements that
make essential contributions to bacterial survival under stress conditions include several different sigma factors. A sigma factor is a polypeptide subunit of RNA polymerase. Only when the proper sigma
factor is bound to the polymerase, this holoenzyme can recognize
specific sequences in the promotor, and initiation of transcription can
begin (Burgess et al., 1969). Most bacterial species synthesize several
different sigma factors, which direct the RNA polymerase holoenzyme to distinct classes of promoters with a different consensus sequence. This variety in sigma factors provides the bacterium with the
opportunity to maintain basal gene expression as well as regulation
of gene expression in response to specific environmental stimuli
(Wosten, 1998).
The bacterial sigma factors can be grouped into two families,
70
the σ family and the σ54 family (Wosten, 1998). Included in the σ70
family are sigma factors responsible for most “house-keeping” tran10
scription (e.g RpoD) plus alternative σ-factors that direct transcription of genes required under specialised conditions (e.g. AlgU and
RpoS)(Wosten, 1998). The σ54 (RpoN) family displays no apparent
homology to the σ70 family in either structure or mode of action
(Wosten, 1998; Merrick, 1993). Genes that are under the control of
RpoN have in common, that they are not usually essential for survival and growth under favourable conditions (Buck et al., 2000).
In pseudomonads several sigma factors are essential for survival under stress conditions. These include RpoE (σ22; also referred
to as AlgU or AlgT in fluorescent pseudomonads), RpoS (σS), and
RpoN (σ54):
AlgU responds to osmotic, oxidative, and heat stress in Pseudomonas aeruginosa and P. syringae, and positively controls the synthesis of the exopolysaccharide (EPS) alginate (Rowen and Deretic, 2000;
Fakhr et al., 1999; Keith and Bender, 1999; Martin et al., 1994). In P.
fluorescens CHA0 AlgU likewise controls EPS synthesis, and was
found to be a key determinant in osmoprotection and in tolerance to
dry stress in vitro, in a vermiculite formulation, and in natural soil
(Manuscript II and IV). However, tolerance towards osmotic stress
and disiccation was not improved in an algU-overexpressing mutant
of P. fluorescens CHA0 (Manuscript II and IV). AlgU may also be involved in the regulation of the antibiotics 2,4-diacetylphloroglucinol
(DAPG) and pyoluteorin (Manuscript IV; M. Péchy-Tarr and C. Keel,
unpublished results). Antibiotic production plays a role in competition for nutrients, and thereby also in survival.
RpoS activates the expression of numerous genes in different
Pseudomonas species required to maintain cell viability during the
stationary phase when cells are experiencing nutrient starvation
(Wosten, 1998). Activation of these genes may lead to tolerance to
exposure to hyperosmolarity, high temperatures, low pH, ethanol,
and hydrogen peroxide in P. aeruginosa (Suh et al., 1999; Jørgensen et
al., 1999). Inactivating rpoS by mutation results in increased production of a phenazine antibiotic and the siderophore pyoverdine (Suh et
al., 1999). In P.fluorescens CHA0 an rpoS mutant showed enhanced
expression of the genes coding for the antibiotic pyoluteorin, whereas
overexpression of RpoS shuts of production of the antibiotic (Haas
and Keel, 2003). The role of RpoS in regulating stress responses has
not been investigated in strain CHA0, however in P.fluorescens Pf-5 a
rpoS mutant reduced the capacity of stationary-phase cells to survive
exposure to oxidative stress (Whistler et al., 1998; Sarniguet et al.,
1995) and osmotic stress (Sarniguet et al., 1995).
RpoN has been found to control the expression of many genes
in response to nutritional and environmental conditions (Merrick,
1993). In P. aeruginosa, lack of RpoN causes inability to utilize a variety of carbon and nitrogen sources, and furthermore results in loss of
motility (promoted by flagella and pili)(Nishijyo et al., 2001; Totten et
al., 1990; Ishimoto and Lory, 1989). In addition, it was found that mucoidity, normally induced by a mutation in mucA, can be caused by
N
another pathway dependent of σ (Boucher et al., 2000). RpoN also
governs polar flagellar synthesis in P. putida (Pandza et al., 1997), and
moreover biodegradation of some recalcitrant hydrocarbons (Ramos
et al., 1997). We found, that an rpoN mutant of P. fluorescens CHA0
was impaired in the utilization of several carbon and nitrogen
sources, sensitive to osmotic stress, and was defective for flagella
11
(Manuscript V). The same mutant showed enhanced production of
DAPG but lowered production of PLT (Manuscript V).
12
4 Conclusion and future directions
Many traits and genes involved in Pseudomonas-mediated
biological control of plant pathogenic fungi and results from numerous studies add to the understanding of interactions taking place
during the event. However, going through literature, several questions are still poorly answered:
Our knowledge about the influence of the plant at the species
as well as cultivar level on biocontrol efficiency is still very scarce,
although the host plant may play a major role for successful biocontrol. This demands cross-disciplinary research involving microbiology, plant physiology, and genetics in future studies. Quantitative
and qualitative chemical analysis of root exudates at the cultivar level
would be interesting in relation to optimal/specific nutritional support of a specific biocontrol agent. Moreover, supportiveness of biocontrol, and hospitality to biocontrol agents could be enhanced
through studying cultivar specific diversity, or by directed breeding
or genetic modification of the host plant.
Modification of single traits or genes adds to our understanding of interactions taking place during disease suppression. This
approach has been used in numerous studies, however, as stated by
Haas and Keel (2003), “engineering of a single trait in a single biocontrol strain can hardly overcome the problem of inconsistent performance in the field, given the multifactorial nature of biocontrol
mechanisms.” Moreover, it has been established, that overexpressing
genes in order to enhance biocontrol effectivity (antibiotics, exopolysaccharides) in many cases does not lead to the wanted “superbiocontrol-agent”, and in worst case cause more harm than good (e.g.
toxicity towards the host plant).
Still most studies are done in sterile and gnotobiotic laboratory experiments. This is convenient for simplicity and is needed in
revealing simple biocontrol mechanisms. However, several studies
have shown that just the step from single inoculation to coinoculation in gnotobiotic systems can change the outcome of studies
radically. On this basis it is difficult to draw conclusions that apply to
non-sterile systems, and indeed to field conditions.
13
References
Bianciotto, V., Andreotti, S., Balestrini, R., Bonfante, P., and
Perotto, S. (2001). Mucoid mutants of the biocontrol
strain Pseudomonas fluorescens CHA0 show increased
ability in biofilm formation on mycorrhizal and nonmycorrhizal carrot roots. Molecular Plant-Microbe Interactions 14:255-260.
Boucher, J.C., Schurr, M.J., and Deretic, V. (2000). Dual regulation of mucoidy in Pseudomonas aeruginosa and sigma
factor antagonism. Molecular Microbiology 36:341-351.
Bowen, G.D. and Rovira, A.D. (1973). Are modelling approaches useful in rhizosphere biology? Bulletin from
the Ecological Research Committee 17:443-450.
Bowen, G.D. and Rovira, A.D. (1991). The hidden half of the
hidden half. In: Plant roots: The hidden half., Y. Waisel,
A. Eschel, and U. Kafkafi, eds., pp. 349-388. Marcel Dekker, New York.
Buck, M., Gallegos, M.T., Studholme, D.J., Guo, Y., and Gralla,
J.D. (2000). The bacterial enhancer-dependent sigma(54)
(sigma(N)) transcription factor. [Review] [129 refs]. Journal of Bacteriology 182:4129-4136.
Burgess, R.R., Travers, A.A., Dunn, J.J., and Bautz, E.K. (1969).
Factor stimulating transcription by RNA polymerase.
Nature 221:43-46.
Campbell, R. and Greaves, M.P. (1990). Anatomy and community structure of the rhizosphere. In: The rhizosphere,
J.M. Lynch, ed., pp. 11-34. John Wiley & sons, New York.
Chin-A-Woeng, T.F.C., Bloemberg, G.V., and Lugtenberg, B.J.J.
(2003). Phenazines and their role in biocontrol by Pseudomonas bacteria. New Phytologist 157:503-523.
Chin-A-Woeng, T.F.C., Bloemberg, G.V., Mulders, I.H.M., Dekkers, L.C., and Lugtenberg, B.J.J. (2000). Root colonization by phenazine-1-carboxamide-producing bacterium
Pseudomonas chlororaphis PCL1391 is essential for biocontrol of tomato foot and root rot. Molecular PlantMicrobe Interactions 13:1340-1345.
Chin-A-Woeng, T.F.C., Bloemberg, G.V., van der Bij, A.J., Van
der Drift, K.M.G.M., Schripsema, J., Kroon, B., Scheffer,
R.J., Keel, C., Bakker, P.A.H.M., De Bruijn, F.J., ThomasOates, J.E., and Lugtenberg, B.J.J. (1998). Biocontrol by
phenazine-1-carboxamide producing Pseudomonas chlororaphis PCL1391 of tomato root rot caused by Fusarium
oxysporum f.sp. radicis-lycopersici. Molecular PlantMicrobe Interactions 10:79-86.
Chin-A-Woeng, T.F.C., de Priester, W., van der Bij, A.J., and
Lugtenberg, B.J.J. (1997). Description of the colonization
of a gnotobiotic tomato rhizosphere by Pseudomonas fluo14
rescens biocontrol strain WCS365, using scanning electron microscopy. Molecular Plant-Microbe Interactions
10:79-86.
Cook, R.J. and Baker, K.F. (1983). The nature and practice of
biological control of plant practice. The American phytopathological Society, St. Paul.
Corbell, N. and Loper, J.E. (1995). A global regulator of secondary metabolite production in Pseudomonas fluorescens
PF-5 . Journal of Bacteriology 177:6230-6236.
Curl, E.A. and Truelove, B. (1986). The Rhizosphere. SpringerVerlag, Berlin.
Dakora, F.D. and Phillips, D.A. (2002). Root exudates as mediators of mineral acquisition in low- nutrient environments. Plant and Soil 245:35-47.
de Weert, S., Dekkers, L.C., Kuiper, I., Bloemberg, G.V., and
Lugtenberg, B.J.J. (2004). Generation of enhanced competitive root-tip-colonizing Pseudomonas bacteria
through accelerated evolution. Journal of Bacteriology
186:3153-3159.
de Weert, S., Vermeiren, H., Mulders, I.H.M., Kuiper, I.,
Hendrickx, N., Bloemberg, G.V., Vanderleyden, J., De
Mot, R., and Lugtenberg, B.J.J. (2002). Flagella-driven
chemotaxis towards exudate components is an important
trait for tomato root colonization by Pseudomonas fluorescens. Molecular Plant-Microbe Interactions 15:11731180.
de Weger, L.A., Vandervlugt, C.I.M., Wijfjes, A.H.M., Bakker,
P.A.H.M., Schippers, B., and Lugtenberg, B.J.J. (1987).
Flagella of a plant growth stimulating Pseudomonas fluorescens strain are required for colonization of potato
roots. Journal of Bacteriology 169:2769-2773.
Dekkers, L.C., van der Bij, A.J., Mulders, I.H.M., Phoelich, C.C.,
Wentwoord, R.A.R., Glandorf, D.C.M., Wijffelman, C.A.,
and Lugtenberg, B.J.J. (1998). Role of the O-antigen of
lipopolysaccharide, and possible roles of growth rate
and of NADH : Ubiquinone oxidoreductase (nuo) in
competitive tomato root-tip colonization by Pseudomonas fluorescens WCS365. Molecular Plant-Microbe Interactions 11:763-771.
Delany, I.R., Walsh, U.F., Ross, I., Fenton, A.M., Corkery, D.M.,
and O’Gara, F. (2001). Enhancing the biocontrol efficacy
of Pseudomonas fluorescens F113 by altering the regulation and production of 2,4-diacetylphloroglucinol - Improved Pseudomonas biocontrol inoculants. Plant and
Soil 232:195-205.
Dowling, D.N. and O´Gara, F. (1994). Metabolites of Pseudomonas involved in the biocontrol of plant-diseaes. Trends in
Biotechnology 12:133-141.
Duijff, B.J., Bakker, P.A.H.M., and Schippers, B. (1994). Suppression of Fusarium wilt of carnation by Pseudomonas
15
putida WCS358 at different levels of disease incidence
and iron availability. Biocontrol Science and Technology
4:279-288.
Duijff, B.J., GianinazziPearson, V., and Lemanceau, P. (1997).
Involvement of the outer membrane lipopolysaccharides
in the endophytic colonization of tomato roots by biocontrol Pseudomonas fluorescens strain WCS417r. New
Phytologist 135:325-334.
Dwivedi, D. and Johri, B.N. (2003). Antifungals from fluorescent pseudomonads: Biosynthesis and regulation. Current Science 85:1693-1703.
Fakhr, M.K., Peñaloza-vázquez, A., Chakrabarty, A.M., and
Bender, C.L. (1999). Regullation of alginate biosynthesis
in Pseudomonas syringae pv. syringae. Journal of Bacteriology 181:3478-3485.
Haas, D. and Keel, C. (2003). Regulation of antibiotic production in root-colonizing Pseudomonas spp. and relevance
for biological control of plant disease. Annual Review of
Phytopathology 41:117-153.
Handelsman, J. and Stabb, E.V. (1996). Biocontrol of soilborne
plant pathogens. Plant Cell 8:1855-1869.
Hansen, M., Kragelund, L., Nybroe, O., and Sorensen, J. (1997).
Early colonization of barley roots by Pseudomonas fluorescens studied by immunofluorescence technique and
confocal laser scanning microscopy. FEMS Microbiology
Ecology 23:353-360.
Harman, G.E., Nedrow, B., and Nash, G. (1978). Stimulation of
fungal spore germination by volatiles from aged seeds.
Canadian Journal of Botany 56:2124-2127.
Hawes, M.C., Bengough, G., Cassab, G., and Ponce, G. (2003).
Root caps and rhizosphere. Journal of Plant Growth
Regulation 21:352-367.
Hiltner, L. (1904). Über neuere erfahrungen und probleme auf
dem gebiet der bodenbakteriologie und unter besonderer berücksichtigung der gründüngung und brache. Arbeiten der Deutschen Landwirtschafts-Gesellschaft 98:5978.
Howie, W.J., Cook, R.J., and Weller, D.M. (1987). Effects of soil
matric potential and cell motility on wheat root colonization by fluorescent pseudomonads suppressive to
take-all. Phytopathology 77:286-292.
Huang, Z.Y., Bonsall, R.F., Mavrodi, D.V., Weller, D.M., and
Thomashow, L.S. (2004). Transformation of Pseudomonas fluorescens with genes for biosynthesis of phenazine-1-carboxylic acid improves biocontrol of rhizoctonia
root rot and in situ antibiotic production. FEMS Microbiology Ecology 49:243-251.
Ishimoto, K.S. and Lory, S. (1989). Formation of pilin in Pseudomonas aeruginosa requires the alternative sigma factor
(RpoN) of RNA polymerase. Proceedings of the National
16
Academy of Sciences of the United States of America
86:1954-1957.
Jenny, H. and Grossenbacher, K. (1963). Root-soil boundary
zones as seen in electron microscopy. Soil Science Society
of America Proceedings 27:273-277.
Jørgensen, F., Bally, M., Chapon-Herve, V., Michel, G., Lazdunski, A., Williams, P., and Stewart, G.S. (1999). RpoSdependent stress tolerance in Pseudomonas aeruginosa.
Microbiology 145:835-844.
Keel, C. and Défago, G. (1997). Interaction between beneficial
soil bacteria and root pathogens: Mechanisms and ecological impact. In: Multitrophic interactions in terrestrial
systems, A.C. Gange and V.K. Brown, eds., pp. 27-46.
Blackwell Science, London.
Keel, C., Voisard, C., Berling, C.-H., kahr, G., and Défago, G.
(1989). Iron sufficiency, a prerequisite for suppression of
tobacco black root rot by Pseudomonas fluorescens strain
CHA0 under gnotobiotic conditions. Phytopathology
79:584-589.
Keel, C., Wirthner, P., Oberhansli, T., Voisard, C., Burger, U.,
Haas, D., and Defago, G. (1990). Pseudomonads as antagonists of plant-pathogens in the rhizosphere - role of
the antibiotic 2,4-diacetylphloroglucinol in the suppression of black root-rot of tobacco. Symbiosis 9:327-341.
22
Keith, L.M.W. and Bender, C.L. (1999). AlgT(s ) controls alginate production and tolerance to environmental stress in
Pseudomonas syringae. Journal of Bacteriology 181:71767184.
King, E.B. and Parke, J.L. (1993). Biocontrol of aphanomyces rootrot and Pythium damping-off by Pseudomonas cepacia
AMMD on 4 pea cultivars. Plant disease 77:1185-1188.
Knee, E.M., Gong, F.C., Gao, M.S., Teplitski, M., Jones, A.R.,
Foxworthy, A., Mort, A.J., and Bauer, W.D. (2001). Root
mucilage from pea and its utilization by rhizosphere
bacteria as a sole carbon source. Molecular PlantMicrobe Interactions 14:775-784.
Latour, X., Corberand, T.S., Laguerre, G., Allard, F., and Lemanceau, P. (1996). The composition of fluorescent
pseudomonad populations associated with roots is influenced by plant and soil type. Applied and Environmental Microbiology 62:2449-2456.
Lemanceau, P., Corberand, T.S., Gardan, L., Latour, X.,
Laguerre, G., Boeufgras, J.M., and Alabouvette, C. (1995).
Effect of 2 plant-species, flax (Linum usitatissinum L.) and
tomato (Lycopersicon esculentum Mill.), on the diversity of
soilborne populations of fluorescent pseudomonads.
Applied and Environmental Microbiology 61:1004-1012.
Liu, L., Kloepper, J.W., and Tuzun, S. (1995). Induction of systemic resistance in cucumber by plant growth promoting
rhizobacteria - duration of protection and effect of host
17
resistance on protection and root colonization. Phytopathology 85:1064-1068.
Lugtenberg, B.J.J. and Dekkers, L.C. (1999). What makes Pseudomonas bacteria rhizosphere competent? Environmental Microbiology 1:9-13.
Lugtenberg, B.J.J., Dekkers, L.C., and Bloemberg, G.V. (2001).
Molecular determinants of rhizosphere colonization by
Pseudomonas. Annual Review of Phytopathology
39:461-490.
Lynch, J.M. (1983). Soil Biotechnology - Microbiological factors
in crop productivity. Blackwell Scientific Publications,
Oxford.
Lynch, J.M. and Whipps, J.M. (1991). Substrate flow in the
rhizosphere. In: The rhizosphere and plant growth., D.L.
Keister and P.B. Cregan, eds., pp. 15-24. Kluwer Academic Publishers, Dordrecht.
Marschner, P., Crowley, D.E., and Sattelmacher, B. (1997). Root
colonization and iron nutritional status of a Pseudomonas fluorescens in different plant species. Plant and Soil
196:311-316.
Martin, D.W., Schurr, M.J., Yu, H., and Deretic, V. (1994).
Analysis of promoters controlled by the putative sigma
factor AlgU regulating conversion to mucoidy in Pseudomonas aeruginosa: relationship to sigma E and stress
response. Journal of Bacteriology 176:6688-6696.
Maurhofer, M., Keel, C., Schnider, U., Voisard, C., Haas, D., and
Défago, G. (1992). Influence of enhanced antibiotic production i Pseudomonas fluorescens strain CHA0 on its disease suppressive capacity. Phytopathology 82:190-195.
Mazzola, M., Cook, R.J., Thomashow, L.S., Weller, D.M., and
Pierson, L.S. (1992). Contribution of phenazine antibiotic
biosynthesis to the ecological competence of fluorescent
pseudomonads in soil habitats. Applied and Environmental Microbiology 58:2616-2624.
Merrick, M.J. (1993). In a class of its own--the RNA polymerase
sigma factor sigma 54 (sigma N). [Review] [64 refs]. Molecular Microbiology 10:903-909.
Miller, H.J., Henken, G., and Van Veen, J.A. (1989). Variation
and composition of bacterial populations in the rhizopheres of maize, wheat, and grass cultivars. Canadian
Journal of Microbiology 35:656-660.
Natsch, A., Keel, C., Pfirter, H.A., Haas, D., and Défago, G.
(1994). Contribution of the global regulator gene gacA to
persistence and dissemination of Pseudomonas fluorescens biocontrol strain CHA0 introduced into soil microcosms. Applied and Environmental Microbiology
60:2553-2560.
Nielsen, M.N., Sørensen, J., Fels, J., and Pedersen, H.C. (1998).
Secondary metabolite- and endochitinase-dependent
antagonism toward plant-pathogenic microfungi of
18
Pseudomonas fluorescens isolates from sugar beet rhizosphere. Applied and Environmental Microbiology
64:3563-3569.
Nielsen, T.H., Christophersen, C., Anthoni, U., and Sorensen, J.
(1999). Viscosinamide, a new cyclic depsipeptide with
surfactant and antifungal properties produced by Pseudomonas fluorescens DR54. Journal of Applied Microbiology 87:80-90.
Nielsen, T.H., Sorensen, D., Tobiasen, C., Andersen, J.B., Christophersen, C., Givskov, M., and Sorensen, J. (2002). Antibiotic and biosurfactant properties of cyclic lipopeptides produced by fluorescent Pseudomonas spp. from
the sugar beet rhizosphere. Applied and Environmental
Microbiology 68:3416-3423.
Nielsen, T.H., Thrane, C., Christophersen, C., Anthoni, U., and
Sorensen, J. (2000). Structure, production characteristics
and fungal antagonism of tensin - a new antifungal cyclic
lipopeptide from Pseudomonas fluorescens strain 96.578.
Journal of Applied Microbiology 89:992-1001.
Nishijyo, T., Haas, D., and Itoh, Y. (2001). The CbrA-CbrB twocomponent regulatory system controls the utilization of
multiple carbon and nitrogen sources in Pseudomonas
aeruginosa. Molecular Microbiology 40:917-931.
Normander, B., Hendriksen, N.B., and Nybroe, O. (1999). Green
Fluorescent Protein-Marked Pseudomonas fluorescens:
Localization, Viability, and Activity in the Natural Barley
Rhizosphere. Applied and Environmental Microbiology
65:4646-4651.
Notz, R., Maurhofer, M., Schnider-Keel, U., Duffy, B., Haas, D.,
and Défago, G. (2001). Biotic factors affecting expression
of the 2,4-Diacetylphlorooglucinol biosynthesis gene
phlA in pseudomonas fluorescens biocontrol strain CHA0 in
the rhizosphere. Phytopathology 91:873-881.
Okubara, P.A., Kornoely, J.P., and Landa, B.B. (2004). Rhizosphere colonization of hexaploid wheat by Pseudomonas
fluorescens strains Q8r1-96 and Q2-87 is cultivar-variable
and associated with changes in gross root morphology.
Biological Control 30:392-403.
Pandza, S., Baetens, M., Park, C.H., Au, T., Keyhan, M., and
Matin, A.C. (1997). The G-protein FlhF has a role in polar
flagella placement and general stress response induction
in Pseudomonas putida. Molecular Microbiology 36:414423.
Persello-Cartieaux, F., Nussaume, L., and Robaglia, C. (2003).
Tales from the underground: molecular plantrhizobacteria interactions. Plant Cell and Environment
26:189-199.
Raaijmakers, J.M., Vlami, M., and de Souza, J.T. (2002). Antibiotic production by bacterial biocontrol agents. Antonie
19
Van Leeuwenhoek International Journal of General and
Molecular Microbiology 81:537-547.
Ramos, J.L., Marqués, S., and Timmis, K.N. (1997). Transcriptional control of the Pseudomonas TOL plasmid catabolic
operons is achieved through an interplay of host factors
and plasmid encoded regulators. Annual Review of Microbiology 51:341-373.
Rengel, Z. (2002). Genetic control of root exudation. Plant and
Soil 245:59-70.
Rovira, A.D., Newman, E.I., Bowen, H.J., and Campbell, R.
(1974). Quantitative assessment of the rhizosplane microflora by direct microscopy. Soil Biology and Biochemistry 6:211-216.
Rowen, D.W. and Deretic, V. (2000). Membrane-to-cytosol redistribution of ECF sigma factor AlgU and conversion to
mucoidy in Pseudomonas aeruginosa isolates from cystic
fibrosis patients. Molecular Microbiology 36:314-327.
Sarniguet, A., Kraus, J., Henkels, D., Muehlchen, A.M., and
Loper, J.E. (1995). The sigma factor sigma s affects antibiotic production and biological control activity of Pseudomonas fluorescens Pf-5. Proceedings of the National
Academy of Sciences of the United States of America
92:12255-12259.
Scher, F.M., Kloepper, J.W., Singleton, C., Zaleska, I., and Laliberte, M. (1988). Colonization of soybean roots by Pseudomonas and Serratia species - relationship to bacterial
motility, chemotaxis, and generation time. Phytopathology 78:1055-1059.
Schnider-Keel, U., Seematter, A., Maurhofer, M., Blumer, C.,
Duffy, B., Gigot-Bonnefoy, C., Reimmann, C., Notz, R.,
Défago, G., Haas, D., and Keel, C. (2000). Autoinduction
of 2,4-diacetylphloroglucinol biosynthesis in the biocontrol agent Pseudomonas fluorescens CHA0 and repression by the bacterial metabolites salicylate and pyoluteorin. Journal of Bacteriology 182:1215-1225.
Scumann, G.L. (1991). Plant diseases: Their biology and social
impact. APS Press, St. Paul.
Séveno, N.A., Morgan, J.A.W., and Wellington, E.M.H. (2001).
Growth of Pseudomonas aureofaciens PGS12 and the
dynamics of HHL and phenazine production in liquid
culture, on nutrient agar, and on plant roots. Microbial
Ecology 41:314-324.
Shanahan, P., O´Sullivan, D.J., Simpson, P., Glennon, J.D., and
O´Gara, F. (1992). Isolation of 2,4-Diacetylphloroglucinol
from a fluorescent Pseudomonad and investigation of
physiological parameters influencing its production.
Applied and Environmental Microbiology 58:353-358.
Sharma, A. and Johri, B.N. (2003). Combat of iron-deprivation
through a plant growth promoting fluorescent Pseu-
20
domonas strain GRP3A in mung bean (Vigna radiata L.
Wilzeck). Microbiological Research 158:77-81.
Simon, H.M., Smith, K.P., Dodsworth, J.A., Guenthner, B.,
Handelsman, J., and Goodman, R.M. (2001). Influence of
tomato genotype on growth of inoculated and indigenous bacteria in the spermosphere. Applied and Environmental Microbiology 67:514-520.
Simons, M., Permentier, H.P., de Weger, L.A., Wijffelman, C.A.,
and Lugtenberg, B.J.J. (1997). Amino acid synthesis is
necessary for tomato root colonization by Pseudomonas
fluorescens strain WCS365. Molecular Plant-Microbe Interactions 10:102-106.
Simons, M., vanderBij, A.J., Brand, I., de Weger, L.A., Wijffelman, C.A., and Lugtenberg, B.J.J. (1996). Gnotobiotic
system for studying rhizosphere colonization by plant
growth-promoting Pseudomonas bacteria. Molecular
Plant-Microbe Interactions 9:600-607.
Smith, J.L., Papendick, R.I., Bezdicek, D.F., and Lynch, J.M.
(1993). Soil organic matter dynamics and crop residue
management. In: Soil microbial ecology, F.B. Metting,
ed., pp. 65-94. Marcel Dekker Inc., New York.
Smith, K.P. and Goodman, R.M. (1999). Host variation for interactions with beneficial plant-associated microbes. Annual Review of Phytopathology 37:473-491.
Stephensen Lübeck, P., Hansen, M., and Sørensen, J. (2000).
Simultanious detection of the establishment of seedinoculated Pseudomonas fluorescens strain DR54 and native soil bacteria on sugar beet root surfaces using fluorescence antibody and in situ hybridization techniques.
FEMS Microbiology Ecology 33:11-19.
Suh, S., Silo-Suh, L., Woods, D.E., Hassett, D.J., West, S.E.H.,
and Ohman, D.E. (1999). Effect of rpoS mutation on the
stress response and expression of virulence factors in
Pseudomonas aeruginosa. Journal of Bacteriology 181:38903897.
Sørensen, J. (1997). The rhizosphere as ahabitat for soil microorganisms. In: Modern soil microbiology, J. Dirk van Elsas, J.T. Trevors, and E.M.H. Wellington, eds., pp. 21-45.
Marcel Dekker, New York.
Thomashow, L.S. (1996). Biological control of plant root pathogens. Current Opinion in Biotechnology 7:343-347.
Thomashow, L.S. and Weller, D.M. (1988). Role of phenazine
antibiotic from Pseudomonas fluorescens in biological control of Gaeumannomyces graminis var. tritici. Journal of
Bacteriology 170:3499-3508.
Thomashow, L.S. and Weller, D.M. (1995). Current concepts in
the use of introduced bacteria for biological disease control: Mechanisms and antifungal metabolites. In: PlantMicrobe interactions, G. Stacey and N.T. Keen, eds., pp.
187-235. Chapman and Hall, New York.
21
Totten, P.A., Lara, J.C., and Lory, S. (1990). The rpoN gene
product of Pseudomonas aeruginosa is required for expression of diverse genes, including flagellin gene. Journal of
Bacteriology 172:389-396.
van Loon, L.C., Bakker, P.A.H.M., and Pieterse, C.M.J. (1998).
Systemic resistance induced by rhizosphere bacteria.
Annual Review of Phytopathology 36:453-483.
Vesper, S.J. (1987). Production of pili (fimbriae) by Pseudomonas
fluorescens and correlation with attachment to corn roots.
Applied and Environmental Microbiology 53:1397-1405.
Voisard, C., Bull, C.T., Keel, C., Laville, J., Maurhofer, M.,
Schnider, U., Défago, G., and Haas, D. (1994). Biocontrol
of root diseases by Pseudomonas fluorescens CHA0: Current concepts and experimantal approaches. In: Molecular ecology of rhozosphere microorganisms, F. O'Gara,
D. Dowling, and B. Boesten, eds., pp. 67-89. VCH Publishers, Weinheim, Germany.
Weller, D.M. (1986). Effects of wheat genotype on root colonization by a take -all suppressive strain of Pseudomonas
fluorescens. Phytopathology 76:1059-1059.
Whipps, J.M. and Lynch, J.M. (1985). Energy losses by the plant
in rhizodeposition. Annual Proceedings of the Phytochemistry Society of Europe 26:59-71.
Whistler, C.A., Corbell, N.A., Sarniguet, A., Ream, W., and
Loper, J.E. (1998). The two-component regulators GacS
and GacA influence accumulation of the stationaryphase sigma factor sigmaS and the stress response in
Pseudomonas fluorescens Pf-5. Journal of Bacteriology
180:6635-6641.
Wosten, M.M. (1998). Eubacterial sigma-factors. FEMS Microbiology Reviews 22:127-150.
Åström, B. and Gerhardson, B. (1988). Differential reactions of
wheat and pea genotypes to root inoculation with
growth-affecting rhizosphere bacteria. Plant and Soil
109:263-269.
22
Manuscript I
'LIIHUHQWLDOURRWFRORQL]DWLRQRIIRXUEHHWJHQRW\SHVE\WKH
ELRFRQWURODJHQW3VHXGRPRQDVIOXRUHVFHQV&+$
K.B. Lejbølle, J. Sørensen, and S.J. Binnerup
In preparation
Differential root colonization of four
beet cultivars by the biocontrol agent
Pseudomonas fluorescens CHA0
1
2
1
Kirsten Bang Lejbølle , Jan Sørensen , and Svend J. Binnerup
1
Department of Environmental Chemistry and Microbiology, The
National EnvironmentalResearch Institute, Roskilde
2
Section of Genetics and Microbiology, Department of Ecology,
Royal Veterinary and Agricultural University, Frederiksberg, Denmark.
Corresponding author: Kirsten Bang Lejbølle,
Telephone: +45 46 30 12 44; E-mail: [email protected]
ABSTRACT
Root exudates play an essential role in the plant-microbe interaction,
serving as energy sources for soil microbes. The stimulation of microbes through root exudates can be plant species and cultivar dependent.
In this study, four related cultivars of beet, among which one was genetically modified to be herbicide resistant, were examined in soil/
plant microcosms for their ability to support root colonization by indigenous fluorescent pseudomonads, a biocontrol inoculant Pseudomonas fluorescens CHA0, and a mutant derivative of P. fluorescens
CHA0, CHA212, showing reduced survival compared to the wildtype,
when exposed to certain stress conditions. CO2 emission from the
below ground microcosm was assessed to give a joint measure of
plant and microbial respiratory activity. Major microbial populations
in the rhizosphere did not seem to be affected by plant cultivar. The
total population of indigenous fluorescent pseudomonads was affected
by neither plant cultivar nor the inoculant strains. However, it was
demonstrated that the beet cultivar Kyros did not support proliferation
of the biocontrol bacterium P.fluorescens strain CHA0 and its mutant
derivative, whereas the other three related cultivars, including the herbicide resistant, did.
Manuscript II
,PSDFWRIELRFRQWUROVWUDLQ3VHXGRPRQDVIOXRUHVFHQV&+$RQ
UKL]RVSKHUHEDFWHULDLVRODWHGIURPEDUOH\+RUGHXPYXOJDUH/
ZLWKUHIHUHQFHWR&\WRSKDJDOLNHEDFWHULD
J.E. Johansen, S.J. Binnerup, K.B. Lejbølle, F. Mascher, J. Sørensen,
and K. Keel
Journal of Applied Microbiology 2002, 93, 1065-1074
(Blank page)
Journal of Applied Microbiology 2002, 93, 1065–1074
Impact of biocontrol strain Pseudomonas fluorescens
CHA0 on rhizosphere bacteria isolated from barley (Hordeum
vulgare L.) with special reference to Cytophaga-like bacteria
J.E. Johansen1,2, S.J. Binnerup2, K.B. Lejbølle1*, F. Mascher3, J. Sørensen4
and C. Keel1
1
Laboratorie de Biologie Microbienne,Université de Lausanne, Switzerland, 2Department of Environmental
Chemistry and Microbiology, National Environmental Research Institute, Roskilde, Denmark, 3Département de
Biologie, Université de Fribourg, Switzerland, and 4Department of Ecology, Royal Veterinary & Agricultural
University, Frederiksberg, Denmark
2002 ⁄ 98: received 4 March 2002, revised 27 August 2002 and accepted 6 September 2002
J.E. JOHANSEN, S.J. BINNERUP, K.B. LEJBØLLE, F. MASCHER, J. SØRENSEN AND
C . K E E L . 2002.
Aims: To assess the impact of the biocontrol strain Pseudomonas fluorescens CHA0 on a
collection of barley rhizosphere bacteria using an agar plate inhibition assay and a plant
microcosm, focusing on a CHA0-sensitive member of the Cytophaga-like bacteria (CLB).
Methods and Results: The effect of strain CHA0 on a collection of barley rhizosphere
bacteria, in particular CLB and fluorescent pseudomonads sampled during a growth season,
was assessed by a growth inhibition assay. On average, 85% of the bacteria were sensitive in the
May sample, while the effect was reduced to around 68% in the July and August samples. In
the May sample, around 95% of the CLB and around 45% of the fluorescent pseudomonads
were sensitive to strain CHA0. The proportion of CHA0-sensitive CLB and fluorescent
pseudomonad isolates decreased during the plant growth season, i.e. in the July and August
samples. A particularly sensitive CLB isolate, CLB23, was selected, exposed to strain CHA0
(wild type) and its genetically modified derivatives in the rhizosphere of barley grown in
gnotobiotic soil microcosms. Two dry-stress periods were imposed during the experiment.
Derivatives of strain CHA0 included antibiotic or exopolysaccharide (EPS) overproducing
strains and a dry-stress-sensitive mutant. Despite their inhibitory activity against CLB23
in vitro, neither wild-type strain CHA0, nor any of its derivatives, had a major effect on
culturable and total cell numbers of CLB23 during the 23-day microcosm experiment.
Populations of all inoculants declined during the two dry-stress periods, with soil water
contents below 5% and plants reaching the wilting point, but they recovered after re-wetting
the soil. Survival of the dry-stress-sensitive mutant of CHA0 was most affected by the dry
periods; however, this did not result in an increased population density of CLB23.
Conclusions: CLB comprise a large fraction of barley rhizosphere bacteria that are sensitive to
the biocontrol pseudomonad CHA0 in vitro. However, in plant microcosm experiments with
varying soil humidity conditions, CHA0 or its derivatives had no major impact on the survival
of the highly sensitive CLB strain, CLB23, during two dry-stress periods and a re-wetting
period; all co-existed well in the rhizosphere of barley plants.
Correspondence to: Dr J.E. Johansen, Department of Environmental Chemistry and Microbiology, National Environmental Research Institute, Frederiksborgvej 399, PO Box 358,
4000 Roskilde, Denmark (e-mail: [email protected]).
*Present address: Department of Environmental Chemistry and Microbiology, National Environmental Research Institute, DK-4000 Roskilde, Denmark.
ª 2002 The Society for Applied Microbiology
1066 J . E . J O H A N S E N ET AL.
Significance and Impact of the Study: Results indicate a lack of interaction between the biocontrol
pseudomonad CHA0 and a sensitive CLB when the complexity increases from agar plate assays to plant
microcosm experiments. This suggests the occurrence of low levels of antibiotic production and ⁄ or that
the two bacterial genera occupy different niches in the rhizosphere.
INTRODUCTION
In agriculture, the use of bacteria and fungi antagonistic
towards plant pathogenic fungi has been suggested as an
alternative to chemical pesticides for control of plant
diseases (Kloepper 1993; Keel and Défago 1997; Walsh
et al. 2001; Whipps 2001). Among bacteria, the fluorescent
pseudomonads have received attention, since certain strains
are highly rhizosphere competent and can produce potent
antifungal metabolites (O’Sullivan and O’Gara 1992; Keel
and Défago 1997). 2,4-Diacetylphloroglucinol (Phl), pyoluteorin (Plt), pyrrolnitrin, hydrogen cyanide and viscosinamide are some examples of antifungal metabolites that
are produced by biocontrol strains of fluorescent pseudomonads (Nielsen et al. 1998; Haas et al. 2000). However,
the effect of these metabolites is not necessarily restricted
to root pathogenic fungi as some of them, such as Phl and
Plt, have also been reported to affect other soil microorganisms, including bacteria (Keel et al. 1992; Natsch
et al. 1998), protozoa (Schlimme et al. 1999) and fungi
(Girlanda et al. 2001). Another non-target effect may be
competition with the resident pseudomonads for nutrients
and space when applying large numbers of pseudomonads
for biocontrol (Natsch et al. 1997, 1998; Moënne-Loccoz
et al. 2001; Thirup et al. 2001). It is therefore important to
obtain information on potential detrimental effects of
biocontrol strains on the microbial community structure
and function within the agricultural ecosystem before
application (Smit et al. 1992; Cook et al. 1996).
Side effects of biocontrol strains on bacteria, ranging from
toxicity assays and microcosm experiments to field studies,
have been reported in the last few years (e.g. De Leij et al.
1995; Gilbert et al. 1996; Natsch et al. 1997; Niemann et al.
1997; Brimecombe et al. 1998; Naseby et al. 1998; Natsch
et al. 1998; Glandorf et al. 2001; Moënne-Loccoz et al.
2001; Thirup et al. 2001). High impact on indigenous
rhizosphere bacteria has been found in simple toxicity assays
(Niemann et al. 1997; Natsch et al. 1998). In contrast,
effects reported from more complex systems, i.e. microcosms or field studies, have so far been transient perturbations, often within the population of closely-related
organisms belonging to the same genera, e.g. Pseudomonas
(De Leij et al. 1995; Natsch et al. 1997, 1998; Naseby et al.
1998; Moënne-Loccoz et al. 2001; Thirup et al. 2001).
When a significant effect has been found it has been
attributed to a displacement effect on resident bacteria
(competition for the same niche) rather than to particular
characteristics of the biocontrol agent such as (enhanced)
antibiotic production (e.g. De Leij et al. 1995; Natsch et al.
1997; Thirup et al. 2001).
The biocontrol strain Pseudomonas fluorescens CHA0 used
in this study is a well-characterized root-colonizing bacterium with broad-spectrum biocontrol activity mediated, to a
large extent, by the antifungal metabolites Phl and Plt (Stutz
et al. 1986; Voisard et al. 1994; Keel and Défago 1997; Haas
et al. 2000). Attempts have been made to improve the
biocontrol efficacy of strain CHA0. For instance, amplification of the rpoD gene encoding the housekeeping sigma
factor r70 resulted in increased production of the antibiotics
Phl and Plt and improved the disease suppressive capacity of
strain CHA0 (Schnider et al. 1995). Recently, highly
mucoid, exopolysaccharide (EPS) overproducing derivatives
of strain CHA0 have been obtained by overexpression of the
algU gene encoding the stress sigma factor AlgU (AlgT,
RpoE, r22), for instance, by insertion of a plasmid
containing algU under control of the lac promoter, or by
interruption of mucA encoding a negative regulator of AlgU
(Schnider-Keel et al. 2001). It has been speculated that
enhanced EPS production improves bacterial survival in
soil, since EPS surrounding the bacterial cells may act as a
protective layer against environmental stress (Roberson and
Firestone 1992; Roberson et al. 1993).
Biocontrol strains genetically engineered for improved
activity or survival may also have increased deleterious
effects on non-target bacterial populations. In the present
work, the inhibitory effect of Ps. fluorescens CHA0 on a
number of bacteria isolated during a growth season from the
rhizosphere of field-grown barley (Hordeum vulgare L.) was
assessed. Cytophaga-like bacteria (CLB) and fluorescent
pseudomonads were specifically monitored, as they have
been reported to be involved in the turnover of organic
matter and are abundant in the rhizosphere (Palleroni 1993;
Olsson and Persson 1999; Johansen and Binnerup 2002). A
microcosm experiment was set up to study the survival of a
sensitive CLB strain (CLB23) in competition with either the
wild type of Ps. fluorescens CHA0, or antibiotic-overproducing, EPS-overproducing or dry-stress-sensitive derivatives of
the strain in the rhizosphere of barley. Two dry periods were
introduced to determine whether the changes in EPS
production or dry-stress sensitivity affected survival of Ps.
fluorescens in the rhizosphere and, thereby, also influenced
survival of the CLB isolate.
ª 2002 The Society for Applied Microbiology, Journal of Applied Microbiology, 93, 1065–1074
IMPACT OF BIOCONTROL ON BACTERIA
MATERIALS AND METHODS
Isolation and characterization of barley
rhizosphere bacteria
In this study, the bacteria used were isolated in May, July
and August from the rhizosphere of field-grown barley
plants (H. vulgare) collected at the experimental station
Højbakkegaard, Taastrup, Denmark. A detailed description of sampling, purification, and characterization of the
isolates can be found in Johansen and Binnerup (2002).
Two groups of bacteria, i.e. CLB and fluorescent
pseudomonads, were identified based on their characteristic phenotypes. CLB were identified by checking
colonies for a typical yellow ⁄ orange colony pigmentation,
typical CLB colony morphology and the flexirubinpositive reaction, i.e. red coloration of the colony after
addition of 10% KOH (Reichenbach 1992). Fluorescent
pseudomonads were identified by testing colonies grown
for up to 7 days on King’s medium B (KMB) agar (King
et al. 1954) for siderophore-dependent fluorescence under
u.v. light.
Screening for sensitivity to Ps. fluorescens
CHA0 among barley rhizosphere bacteria
The barley rhizosphere isolates were scored for sensitivity
towards the biocontrol agent Ps. fluorescens CHA0 (Voisard
et al. 1994) with a rapid microplate assay as follows. From
cultures stored in microtitre plates at ) 80 C, approximately 1 ll from each well was transferred by a 96-pin
replicator (Life Technology, Tåstrup, Denmark) to the
surface of 1 ⁄ 10 strength tryptic soy broth agar (1 ⁄ 10 TSBA;
3 g l)1 Difco tryptic soy broth, 15 g l)1 Difco agar) poured
into omni-well microplates (Life Technology). The spots
were allowed to dry on the agar before an overnight culture
of strain CHA0 grown in 1 ⁄ 10 TSB (3 g l)1 Difco tryptic
soy broth) was transferred to the agar surface using the 96pin replicator. The dots of CHA0 suspension were placed
about 3 mm away from the dots of the rhizosphere bacteria,
so that the colonies would meet each other after few days of
growth during incubation at 20 C. Inhibition of rhizosphere bacteria by strain CHA0 was recorded as full or
partial colony growth inhibition compared with growth of
bacteria in the absence of CHA0. The reproducibility of the
screening method was validated by testing a total of 96
randomly-selected bacteria on separate Petri dishes containing 1 ⁄ 10 TSBA.
Inhibition of CLB isolate CLB23 by Ps. fluorescens
CHA0 and derivatives in an agar plate assay
Among the CLB sensitive to Ps. fluorescens CHA0, one
isolate, named CLB23, was selected for further studies.
1067
Strain CLB23 was isolated from the rhizosphere of barley in
May and showed a high degree of growth inhibition
compared with other CLB isolates (data not shown) when
exposed to CHA0. Partial sequencing of the 16S rDNA gene
confirmed that CLB23 belonged to the genus Flavobacterium
(data not shown). The effect of strain CHA0 and its
genetically-modified derivatives on growth and survival of
CLB23 was studied in an in vitro inhibition assay and in
plant (barley) microcosms. The following derivatives of
strain CHA0 were used: CHA0 ⁄ pME3424 which overproduces the antibiotics Phl and Plt due to amplification of the
rpoD gene encoding the housekeeping sigma factor r70
(Schnider et al. 1995); the dry-stress-sensitive mutant
CHA212, which is non-mucoid and carries an in-frame
deletion in the algU gene encoding the stress sigma factor
AlgU (RpoE) (Schnider-Keel et al. 2001); and
CHA0 ⁄ pME6555, which over-expresses algU resulting in
a highly mucoid phenotype due to EPS overproduction
(Schnider-Keel et al. 2001). In contrast to CHA0 ⁄
pME6555, the wild-type strain CHA0 and the algU mutant
CHA212 produce only low levels of EPS (Schnider-Keel
et al. 2001). For strains CHA0 ⁄ pME3424 and CHA0 ⁄
pME6555, respectively, 125 lg ml)1 tetracycline hydrochloride and 10 lg ml)1 gentamicin were added to the
growth media when required.
The in vitro inhibition of CLB23 by strain CHA0 and
derivatives was studied on 1 ⁄ 10 TSBA and KMB,
substrates which promote production of antibiotics in
strain CHA0, in particular Plt. Suspensions of washed
cells of strain CHA0 and derivatives were prepared from
overnight KMB cultures grown at 20 C and adjusted to
an O.D.600 of 0Æ6. Aliquots (5 ll) of the cell suspensions
were spotted on the plates and the plates were incubated
at 20 C for 18 h. Thereafter, bacteria grown on the agar
were killed by exposure to u.v. light and overlaid with
4 ml soft agar (1 ⁄ 10 TSBA with 0Æ5% [w ⁄ v] agar) mixed
with 400 ll of an overnight culture of CLB23. After
3 days of incubation at 20 C, inhibition of CLB23 was
assessed by measuring the diameter of growth inhibition
and subtracting the diameter of the Ps. fluorescens spot.
Inhibition by the derivatives was expressed relative to the
inhibition caused by strain CHA0 that had been spotted
on the same plate. The inhibition assays were performed
in triplicate.
Interactions between CLB isolate CLB23 and
Ps. fluorescens in plant microcosms
The interactions between Ps. fluorescens strains and the
CLB strain CLB23 were studied in the rhizosphere of
barley grown in microcosms consisting of sterile, artificial
soil. The artificial soil contained pure vermiculite, quartz
sand and quartz powder mixed at a ratio of 10:70:20 (by
ª 2002 The Society for Applied Microbiology, Journal of Applied Microbiology, 93, 1065–1074
1068 J . E . J O H A N S E N ET AL.
2 weight), and was moistened with distilled water to 10% of
the soil weight (Keel et al. 1989). The artificial soil was
autoclaved twice prior to bacterial inoculation. Barley seeds
(H. vulgare L., cv. Lambda) were surface-disinfected in
5% (w ⁄ v) sodium hypochlorite for 20 min, rinsed twice
3 with distilled filter-sterilized water and then germinated for
3 days on 1 ⁄ 10 TSBA supplemented with 0Æ8% agar
(Serva) at 20 C in darkness. The bacterial cell suspensions
used in microcosms were prepared from overnight cultures
of CLB23 and Ps. fluorescens strains grown in 1 ⁄ 10 TSB
and KMB, respectively, at 20 C. The cells were washed
twice in sterile distilled water, and the cell concentration
was adjusted to an O.D.600 of 0Æ6. For inoculation of the
artificial soil, the suspensions (17 ml) of CHA0 or its
derivatives were diluted in 107 ml sterile distilled water
combined with 10 ml Knop’s plant nutrient solution (Keel
et al. 1989), and this combination (134 ml) was thoroughly
mixed into 2000 g of soil to obtain around 8 · 108 ± 3 ·
108 cfu g)1 of soil. Aliquots of 50 g of soil inoculated with
the Ps. fluorescens strains were placed into sterile 200 ml
Erlenmeyer flasks with wide openings. Three-day-old
barley seedlings (450 in total) were then inoculated with
strain CLB23 by shaking them for 30 min at 100 rev min)1
in a suspension of the bacterial strain adjusted to 3Æ1 ·
109 ± 0Æ3 · 109 cfu ml)1. This treatment resulted in 2Æ0 ·
107 ± 0Æ6 · 107 cfu of strain CLB23 per seedling. Three
inoculated seedlings were then carefully placed in each
flask. In one treatment, survival of CLB23 was followed in
the barley rhizosphere in the absence of CHA0 or its
derivatives. The openings of the flasks were covered with a
layer of sterilized paper cloth, which allowed slow evaporation of the soil water. The microcosms were incubated in
a randomized block design for up to 23 days in a growth
chamber at 80% relative humidity and 18 C with light
(200 lmol s)1 m)2; ratio of 1Æ37 of light at 660 nm to
730 nm) for 16 h, followed by an 8 h dark period at 15 C.
On two occasions (days 7–9 and days 18–23), evaporation
from the soil was increased by reducing the air humidity
temporarily to 50%. To re-wet the soil at the end of the
first dry-stress period (day 9), 10 ml sterile distilled water
were sprayed into each flask.
At each sampling, microcosms in triplicates of each of
the five treatments were harvested. Plants were removed
from the soil by gently shaking, and the remaining soil
adhering to the roots was defined as the rhizosphere. Roots
with adhering soil from each flask were pooled and
transferred into 50 ml plastic tubes containing 10 ml
sterile distilled water. Tubes were vigorously shaken at
250 rev min)1 for 1 h and serial dilutions of the resulting
rhizosphere soil suspensions were plated on 1 ⁄ 10 TSBA.
Petri dishes were incubated at 20 C in darkness for up to
6 days. Colonies of CLB23 and of CHA0 and its derivatives were distinguished based on their colony morphology.
For assessing total bacterial counts, 5 ml aliquots of the
rhizosphere suspensions were fixed by addition of 330 ll
37% formaldehyde solution (2Æ5% [w ⁄ v]). Total cell
numbers of CHA0 and its derivatives were determined
by immuno-fluorescence microscopy as described by
Mascher et al. (2000). Total counts of CLB23 were
assessed after acridine orange staining and fluorescence
microscopy according to Binnerup et al. (1993). The
CLB23 cells were recognized by their cell morphology.
Soil water content was determined by oven drying of soil
samples at 80 C for 48 h.
Statistical analysis of data
Data on cfu were first log10 transformed and then subjected
to variance analysis (version 2 of GraphPad PRISMTM
GraphPad Software Inc., San Diego, USA) and, when
appropriate, a Tukey post-test was applied. Significance was
determined at a P-value of 0Æ05.
RESULTS
Sensitivity of barley rhizosphere isolates
to Ps. fluorescens CHA0 in agar plate assay
The majority of the 2532 rhizosphere bacteria isolated from
field-grown barley plants were inhibited by Ps. fluorescens
CHA0 in the agar plate (in vitro) assay. On average, 85%
of the bacteria (Fig. 1) from May samples, and around
68% of the isolates from July and August samples, were
sensitive to strain CHA0. The frequency of sensitive
isolates within two predominant groups of rhizosphere
bacteria, i.e. CLB and fluorescent pseudomonads, was
specifically recorded. A high proportion of CLB isolates in
the May and July samples (95% and 81%, respectively)
was found to be sensitive to strain CHA0, whereas the
proportion was reduced to 62% in the August sample
(Fig. 1). The proportion of CHA0-sensitive fluorescent
pseudomonads was 44% in the May sample and was
reduced to 5% and 0% in the July and August samples,
respectively (Fig. 1).
Effect of Ps. fluorescens CHA0 and its derivatives
on CLB isolate CLB23 in agar plate assay
One of the CLB isolates (CLB23) which was strongly
inhibited by the biocontrol agent CHA0 in the agar plate
assay was chosen and challenged with CHA0 and its
genetically-modified derivatives in the agar-plate assay
4 and the plant microcosm with the barley rhizosphere (in
vivo). In the agar plate assay, inhibition zones obtained
with
the
antibiotic
overproducing
derivative
CHA0 ⁄ pME3424 were more than two times larger than
ª 2002 The Society for Applied Microbiology, Journal of Applied Microbiology, 93, 1065–1074
Fig. 2 Inhibition of the Cytophaga-like bacterium CLB23 by Pseudomonas fluorescens
CHA0, the Phl and Plt overproducing derivative CHA0 ⁄ pME3424, the non-mucoid algU
mutant CHA212 and the algU overexpressing
mucoid mutant CHA0 ⁄ pME6555 on KMB
(j) and 1 ⁄ 10 TSBA (h). Inhibition by the
derivative mutant strains is expressed relative
to inhibition by wild-type strain CHA0. Mean
± S.D.; n ¼ 3
1069
100
90
80
70
60
50
n = 14
n = 62
n = 937
n = 22
n = 82
n = 915
n = 15
20
n = 89
30
n = 396
40
10
0
0
May
August
July
Month of Sampling
Relative inhibition of the Cytophaga-like bacterium
isolate CLB23
Fig. 1 Sensitivity towards Pseudomonas
fluorescens strain CHA0 among bacteria
isolated from the rhizosphere of field-grown
barley at different months in the growth
season. Other rhizosphere bacteria (j);
Cytophaga-like bacteria ( ); fluorescent
pseudomonads (h). Mean ± S.D.; n ¼ 3
Percentage of isolates inhibited by Ps. fluorescens CHA0
IMPACT OF BIOCONTROL ON BACTERIA
4
3
2
1
0
CHA0
those produced by the wild-type strain CHA0 (Fig. 2).
The inhibitory effect of the algU overexpressing, highly
mucoid derivative CHA0 ⁄ pME6555 on CLB23 was even
more pronounced (Fig. 2). It remains to be seen whether
this effect was due to enhanced antibiotic production
caused by the overexpression of algU. In contrast, the
degree of inhibition by the non-mucoid algU mutant
CHA212 was similar to that obtained with wild-type
strain CHA0 (Fig. 2). No major difference was observed
between results obtained on KMB and 1 ⁄ 10 TSBA agar
substrates (Fig. 2).
CHA0/pME3424
CHA0/pME6555
CHA212
Ps. fluorescens biocontrol strain
Effect of Ps. fluorescens CHA0 and its derivatives
on CLB isolate CLB23 in the barley rhizosphere
The survival of the CLB isolate CLB23 was monitored in
the rhizosphere of barley growing in gnotobiotic soil
microcosms to which strain CHA0 or its derivatives had
been applied in high numbers. During the experiment, two
dry-stress events were included (Fig. 3a). Dry-stress conditions were defined here by a soil water content of 5% or
below, corresponding to a soil water potential of )0Æ5 MPa
(Schnider-Keel et al. 2001). The first dry-stress period
ª 2002 The Society for Applied Microbiology, Journal of Applied Microbiology, 93, 1065–1074
1070 J . E . J O H A N S E N ET AL.
(a)
Soil water content (%)
24
Watering
20
16
12
8
Dry
Dry
4
0
cfu of CLB23, g–1 rhizosphere soil (dw)
(b)
108
107
106
105
cfu of CHA strains, g–1 rhizosphere soil (dw)
(c)
108
107
106
105
0
3
6
9
12
15
Time (days)
lasted from day 7 to day 9, when the soil water content was
dropping from 5% to 1Æ8% (Fig. 3a). The plants showed
signs of dry stress, i.e. recoiled leaves and a temporary
growth arrest. The soil was subsequently re-wetted after
sampling at day 9 (Fig. 3a). The second dry-stress period
18
21
24
Fig. 3 Effect of Pseudomonas fluorescens
CHA0 and derivative mutant strains on barley
rhizosphere colonization by the Cytophagalike bacterium CLB23 in a gnotobiotic soil
microcosm. (a) Soil water content (%); (b)
Colony-forming units of CLB23 when added
alone (h) and when mixed with wild-type
strain CHA0 (j), the Phl and Plt overproducer CHA0 ⁄ pME3424 (m), the non-mucoid
algU mutant CHA212 (.), or the algU
overexpressing mucoid mutant
CHA0 ⁄ pME6555 (d); (c) cfu of strain CHA0
and its derivatives when mixed with CLB23;
symbols are the same as those used for treatments listed under (b). Counts of CLB23
when added alone showing statistically significant differences to counts of CLB23 in
mixed treatments are indicated by q. Statistically significant differences between counts
of CLB23 or CHA0 and its derivatives in
mixed treatments (b) and (c) are indicated
by w. Means ± S.D.; n ¼ 3
lasted from day 16 to day 23 when the soil water content was
dropping from 5% (Fig. 3a). During the second dry-stress
period, plants reached wilting point and began to die at the
end of the experiment. In all treatments, cfu of CLB23 were
reduced by a factor of 10 from the first sampling at day 2 to
ª 2002 The Society for Applied Microbiology, Journal of Applied Microbiology, 93, 1065–1074
IMPACT OF BIOCONTROL ON BACTERIA
the end of the first dry-stress period, and reached about 3 ·
106 cfu g)1 soil just before re-wetting of the soil (Fig. 3b).
Even though a significant difference between cfu of CLB23
in the various treatments was found (Fig. 3b), it did not
correlate with the degree of inhibition of CLB23 provided
by strain CHA0 or its derivatives in vitro (Fig. 2), since the
most inhibitory strains CHA0 ⁄ pME6555 and the antibiotic
overproducer CHA0 ⁄ pME3424 had the same or a smaller
effect on the CLB23 population compared with strain
CHA0 in the microcosm (Fig. 3b). Re-wetting of the soil at
day 9 resulted in a significant increase of about 7Æ5-fold in
the number of culturable cells of CLB23, reaching a
maximum of around 1Æ2 · 107 cfu g)1 soil at day 15
(Fig. 3b), but no significant difference between the CHA
treatments was found. During the second dry-stress period,
cfu of CLB23 decreased again by a factor of 10, and a
significant difference between treatment with CHA0 ⁄
pME6555 and the other CHA strains was observed at the
end of the experiment (Fig. 3b). In general, cfu of CLB23
when added alone were slightly, but not significantly higher
than cfu of CLB23 incubated with CHA0 or one of the
derivatives, except at day 9 (Fig. 3b).
The cfu of strain CHA0 and its different derivatives
remained almost constant at 5 · 106 cfu g)1 soil during the
first 9 days of the experiment (Fig. 3c). After re-wetting of
the soil at day 9, culturable counts of all Ps. fluorescens strains
significantly increased to around 3 · 107 cfu g)1 soil until
day 15, when they started to decline at the onset of the
second dry-stress period to around 106 g)1 cfu soil or below
at the end of the experiment (Fig. 3c). Compared with the
other Ps. fluorescens inoculants, the non-mucoid algU mutant
CHA212 was most affected by dry stress. This became
particularly evident during the second dry-stress period,
where a decline from 1Æ1 · 107 to 3 · 105 cfu g)1 soil of the
CHA212 population could be observed (Fig. 3c). However,
the lower number of culturable cells of CHA212 in the soil
did not significantly stimulate numbers of culturable CLB23
(Fig. 3b).
The total cell number of the CLB isolate CLB23 in
rhizosphere soil counted after acridine orange staining
slightly decreased from 3Æ6 · 107 cells g)1 soil at the
beginning of the experiment to 8Æ7 · 106 cells g)1 soil at the
end of the experiment, while total cell counts of strain
CHA0 and its derivatives determined after immuno-fluorescence staining remained almost constant at 109 cells g)1 of
soil throughout the experiment. The percentage of CLB23
cells able to form colonies varied from 14Æ5% to 100%, with
the highest culturability obtained at the beginning of
experiment (71%) and after re-wetting of the soil (100%).
Culturability of CLB23 was not influenced by the presence
of CHA0 or its derivatives. The culturability of strain CHA0
and its derivatives remained at a much lower level than that
of CLB23, since only 0Æ17–7% of total immuno-fluorescence
1071
counts were able to form colonies. If enhanced antibiotic
production by CHA0 ⁄ pME3424 and EPS overproduction
by CHA0 ⁄ pME6555 occurred, this did not significantly
affect culturability of these strains. However, culturability of
the algU mutant CHA212 was three to seven times lower at
day 23 compared with the other Pseudomonas strains (data
not shown).
DISCUSSION
In this study, an in vitro assay showed that the majority of
the culturable rhizosphere bacteria on barley (up to 87%)
could be inhibited by the biocontrol strain Ps. fluorescens
CHA0. Among CLB, an even higher percentage (up to
95%) of the isolates was affected by CHA0, while less than
45% of the fluorescent pseudomonads were inhibited.
Natsch et al. (1997) found that between 30% and 55% of
pea rhizosphere bacteria were inhibited by the purified
antibiotics Phl and Plt. The higher percentage of inhibition
in this study could be due to the use of living CHA cells in
our in vitro assay, or to differences in the native bacterial
population.
The results presented here showed that the highest
frequency of inhibited bacteria occurred in the May sample
and the lowest in August. This reduction in the frequency of
inhibited bacteria could possibly reflect a shift in the
composition of the bacterial community during the plant
growth season, as observed by others (Lilley et al. 1996;
Mahaffee and Kloepper 1997; Johansen and Binnerup 2002).
Results from this study and previous work show that the
inhibitory activity of strain CHA0 is mainly based on the
excretion of the broad-spectrum antibiotics Phl and Plt (see
Fig. 2; Keel et al. 1992; Maurhofer et al. 1994). It may
therefore be speculated that during the growth of the barley,
there was a shift in the composition of the rhizosphere
bacterial community towards subpopulations that were more
resistant to antibiotics such as Phl and Plt. It is noteworthy
in this context that an increase in the number of Phlproducing bacteria has been observed in the rhizosphere of
5 maize during plant growth (Picard et al. 2000).
Bacteria identified as CLB are abundant in the rhizosphere of barley and, especially in spring, they have recently
been found to be numerous and may play an important role
due to their potential to produce several extracelluar
enzymes involved in the degradation of different biopolymers (Olsson and Persson 1999; Johansen and Binnerup
2002). Since it was found that 95% of the CLB from the
May sample were inhibited by CHA0 in in vitro assays
(Fig. 1), a sensitive CLB isolate (CLB23) was selected to
study its interaction with CHA0 wild-type and mutant
derivatives in a plant microcosm experiment. Though
CLB23 was shown to be strongly inhibited by CHA0 in
the in vitro assay, this was not the case in the barley
ª 2002 The Society for Applied Microbiology, Journal of Applied Microbiology, 93, 1065–1074
1072 J . E . J O H A N S E N ET AL.
rhizosphere as a reduction in the cfu of CLB23 could not be
correlated with the interaction by either the wild-type
CHA0 or one of its derivatives (see Fig. 3b).
The lack of interaction in the rhizosphere could be
attributed to low levels of Phl and Plt antibiotic production
in the rhizosphere by CHA0. However, CHA0 has actually
been shown to produce antibiotics in the rhizosphere (Keel
6 et al. 1992; Maurhofer et al. 1992), and it is therefore likely
that the antibiotics were also produced in the present
microcosm experiment. In comparable experiments, it has
previously been found that strains of Bacillus sphaericus,
B. mycoides and Sinorhizobium meliloti, which were inhibited
by strain CHA0 in in vitro tests, were unaffected by CHA0
or its antibiotic overproducer in soil microcosms experiments (Niemann et al. 1997; Natsch et al. 1998). Natsch
et al. (1998) speculated that the lack of inhibition might be
due to a low inoculation level of CHA0 and its antibiotic
overproducer. However, they observed that increasing the
inoculation level to 107 cfu g)1 soil did not result in any
effect. A rapid loss of culturability of CHA0 cells could be
another explanation, since such a loss has been observed
soon after its release into soil (Troxler et al. 1997; Mascher
et al. 2000). In this study, only 0Æ17% of the inoculated cell
number could be cultivated after 23 days. This may explain
the lack of interaction between CHA0 and CLB23. By
comparison, the culturability of CLB23 was remarkably high
(14Æ5–100%) compared with CHA0 or its derivatives (0Æ17–
7Æ3%), illustrating the robust survival of this CLB strain in
the rhizosphere. Furthermore, the inoculation of CLB23
together with CHA0 or its derivatives had no influence on
the maintenance of CLB23 culturability. Finally, the lack of
interaction between CHA0 and CLB23 could also be due to
occupancy of different niches in the rhizosphere by the two
bacteria. The nutritional capacity actually suggests this, as
pseudomonads may easily degrade simple sugars (Palleroni
1993) whereas CLB often degrade more recalcitrant biopolymers (Reichenbach 1992). Occupancy of different
niches is further supported by the fact that most of the
impact reported by CHA0 is observed for closely-related
bacteria such as other members of the Pseudomonas population (Natsch et al. 1997, 1998).
Dry stress can influence the survival of rhizosphere
bacteria (Harris 1981; Pedersen and Jacobsen 1993). Rewetting of soil or plant systems after dry stress may lead to a
release of carbon and nutrients from the plants as well as soil
particles, resulting in increased (Højberg et al. 1996)
microbial activity or higher cell numbers (Kieft et al.
1987; Pedersen and Jacobsen 1993). Further, secretion of
mucilage from epidermal cells of the plant root may provide
protection of bacteria in the rhizosphere against dry stress
(Campbell and Greaves 1990). At the end of the second drystress period, all plants reached wilting point, and a
reduction in the numbers of CLB23 as well as CHA0 or
its derivatives was observed. The algU mutant CHA212
showed a significantly poorer survival than the other
Pseudomonas inoculants during the two dry stress periods
(Fig. 3c), thus confirming the recent results of SchniderKeel et al. (2001), although these authors found a faster cell
number decline in their soil experiments than in the present
rhizosphere experiments. It is therefore suggested that due
to a slower decline of CHA212 in the barley rhizosphere
than in the soil, roots may provide a certain degree of
protection against dry stress. The enhanced production of
EPS by CHA0 ⁄ pME6555 did not result in improved
survival of the strain during the dry-stress periods (Fig. 3c).
However, this is in contrast to Roberson and Firestone
(1992), who suggested that EPS production may provide a
microenvironment that enhances bacterial survival during
dry stress by holding water and drying more slowly than the
surrounding soil. Nevertheless, it is possible that the
conditions in the rhizosphere were not conducive to
enhanced EPS production and thus, better survival by
CHA0 ⁄ pME6555.
The rhizosphere is described as an environment with
enhanced availability of carbon and other nutrient sources
compared with bulk soil (Bazin et al. 1990). Bacteria can
grow on a wide variety of soluble compounds leaching from
the roots (Rovira 1969; Bolton et al. 1993), and from the
mucilage produced by the root cap and sloughed off plantcell materials (Campbell and Greaves 1990; Lynch and
Whipps 1990). However, the environment is very heterogeneous and survival may be high for some and low for other
bacteria. The results of the present study demonstrated that
establishment of both CLB23 and CHA0 and its derivatives
in the rhizosphere occurred and that the rhizosphere was a
niche for survival of subpopulations of both bacteria under
dry stress (Fig. 3). The lack of inhibition of CLB23 by
CHA0 and its derivatives in the plant microcosm experiment underscores the contrast between results from in vitro
and in situ studies. By increasing the complexity, the
negative impact of CHA0 and its derivatives on the CLB
isolate basically disappeared, possibly due to low antibiotic
production or occupancy of different niches by the two
bacteria. These aspects should be considered when evaluating the use of bacteria for biological control.
ACKNOWLEDGEMENTS
The skilful technical assistance of Anja Fløjstrup, Margit
Møller Fernquist and Lene Hemmingsen during screening
of the rhizosphere isolates is very much appreciated. Patrick
Michaux (Université de Lausanne) is acknowledged for help
during the microcosm experiment. The authors gratefully
acknowledge the financial support for JEJ from the Centre
for Effects and Risks of Biotechnology in Agriculture under
the Danish Environmental Research Programme (SMP 2),
ª 2002 The Society for Applied Microbiology, Journal of Applied Microbiology, 93, 1065–1074
IMPACT OF BIOCONTROL ON BACTERIA
and for KBL from the Swiss Federal Office for Education
and Science (project C99.0032, COST action 830).
REFERENCES
Bazin, M.J., Markham, P., Scott, E.M. and Lynch, J.M. (1990)
Population dynamics and rhizosphere interactions. In The Rhizosphere ed. Lynch, J.M. pp. 99–127. Chichester: John Wiley and
Sons.
Binnerup, S.J., Jensen, D.F., Thordal-Christensen, H. and Sørensen,
J. (1993) Detection of viable, but non-culturable Pseudomonas
fluorescens DF57 in soil using a microcolony epifluorescence
technique. FEMS Microbiology Ecology 12, 97–105.
Bolton, H., Fredrickson, J.K. and Elliott, L.F. (1993) Microbial
ecology of the rhizosphere. In Soil Microbial Ecology ed. Metting,
F.B. pp. 27–53. New York: Marcel Dekker.
Brimecombe, M.J., De Leij, F.A.A.M. and Lynch, J.M. (1998) Effect
of genetically modified Pseudomonas fluorescens strains on uptake of
nitrogen by pea from 15N enriched organic residues. Letters in
Applied Microbiology 26, 155–160.
Campbell, R. and Greaves, M.P. (1990) Anatomy and community
structure of the rhizosphere. In The Rhizosphere ed. Lynch, J.M.
pp. 11–34. Chichester: John Wiley and Sons.
Cook, J., Bruckart, W.L., Coulson, J.R. et al. (1996) Safety of
microorganisms intended for pest and plant disease control: a
framework for scientific evaluation. Biological Control 7, 333–351.
De Leij, F.A.A.M., Sutton, E.M., Whipps, J.M., Fenlon, J.S. and
Lynch, J.M. (1995) Impact of field release of genetically modified
Pseudomonas fluorescens on indigenous microbial populations of
wheat. Applied and Environmental Microbiology 61, 3443–3453.
Gilbert, G.S., Clayton, M.K., Handelsman, J. and Parke, J.L. (1996)
Use of cluster and discriminant analysis to compare rhizosphere
bacterial communities following biological perturbation. Microbial
Ecology 32, 123–147.
Girlanda, M., Perotto, S., Moënne-Loccoz, Y. et al. (2001) Impact
of biocontrol Pseudomonas fluorescens CHA0 and a genetically
modified derivative on the diversity of culturable fungi in the
cucumber rhizosphere. Applied and Environmental Microbiology 67,
1851–1864.
Glandorf, D.C.M., Verheggen, P., Jansen, T. et al. (2001) Effect of
genetically modified Pseudomonas putida WCS358r on the fungal
rhizosphere microflora of field-grown wheat. Applied and Environmental Microbiology 67, 3371–3378.
Haas, D., Blumer, C. and Keel, C. (2000) Biocontrol ability of
fluorescent pseudomonads genetically dissected: importance of
positive feedback regulation. Current Opinion in Biotechnology 11,
290–297.
Harris, R.F. (1981) Effect of water potential in microbial growth and
activity. In Water Potential in Soil Microbiology Special Publication
no. 9, ed. Parr, J.F., Gardner, M.R. and Elliott, L.F. pp. 23–95.
Madison: Soil Science Society of America.
Højberg, O., Binnerup, S.J. and Sørensen, J. (1996) Potential rates of
ammonium oxidation, nitrite oxidation, nitrate reduction and
denitrification in the young barley rhizosphere. Soil Biology and
Biochemistry 28, 47–54.
Johansen, J.E. and Binnerup, S.J. (2002) Contribution of Cytophagalike bacteria to the potential of turnover of carbon, nitrogen, and
1073
phosphorous by bacteria in the rhizosphere of barley (Hordeum
vulgare L.). Microbial Ecology 43, 298–306.
Keel, C. and Défago, G. (1997) Interaction between beneficial soil
bacteria and root pathogen: Mechanisms and ecological impact. In
Multitrophic Interactions in Terrestrial Systems ed. Gange, A.C. and
Brown, V.K. pp. 27–46. London: Blackwell Science.
Keel, C., Schnider, U., Maurhofer, M. et al. (1992) Suppression of
root diseases by Pseudomonas fluorescens CHA0: Importance of the
bacterial secondary metabolite 2,4-diacetylphloroglucinol. Molecular
Plant–Microbe Interactions 5, 4–13.
Keel, C., Voisard, C., Berling, C.H., Kahr, G. and Défago, G. (1989)
Iron sufficiency, a prerequisite for suppression of tobacco black root
rot by Pseudomonas fluorescens CHA0 under gnotobiotic conditions.
Phytopathology 79, 584–589.
Kieft, T.L., Soroker, A. and Firstone, M.K. (1987) Microbial biomass
response to a rapid increase in water potential when dry soil is
wetted. Soil Biology and Biochemistry 19, 119–126.
King, E.O., Ward, M.K. and Raney, D.E. (1954) Two simple media
for the demonstration of pyocyanin and fluorescein. Journal of
Laboratory and Clinical Medicine 44, 301–307.
Kloepper, J.W. (1993) Plant-growth promoting rhizobacteria as
biological control agents. In Soil Microbial Ecology ed. Metting,
F.B. Jr pp. 255–274. New York: Dekker.
Lilley, A.K., Fry, J.C., Bailey, M.J. and Day, M.J. (1996) Comparison of
aerobic heterotrophic taxa isolated from four root domains of mature
sugar beet (Beta vulgaris) FEMS Microbiology Ecology 21, 231–242.
Lynch, J.M. and Whipps, J.M. (1990) Substrate flow in the
rhizosphere. Plant and Soil 129, 1–10.
Mahaffee, W.F. and Kloepper, J.W. (1997) Temporal changes in the
bacterial community of soil rhizosphere, and endorhiza associated
with field-grown cucumber (Cucumis sativus L.). Microbial Ecology
34, 210–223.
Mascher, F., Hase, C., Moënne-Loccoz, Y. and Défago, G. (2000) The
viable-but-nonculturable state induced by abiotic stress in the
biocontrol agent Pseudomonas fluorescens CHA0 does not promote
strain persistence in soil. Applied and Environmental Microbiology 66,
1662–1667.
Maurhofer, M., Keel, C., Haas, D. and Défago, G. (1994) Pyoluteorin
production by Pseudomonas fluorescens strain CHA0 is involved in the
suppression of Pythium damping-off of cress but not of cucumber.
European Journal of Plant Pathology 100, 221–232.
Maurhofer, M., Keel, C., Schnider, U., Voisard, C., Haas, D. and
Défago, G. (1992) Influence of enhanced antibiotic production in
Pseudomonas fluorescens strain CHA0 on its disease suppressive
capacity. Phytopathology 82, 190–195.
Moënne-Loccoz, Y., Tichy, H.V., O’Donnell, A., Simon, R. and
O’Gara, F. (2001) Impact of 2,4-diacetylphloroglycenol-producing
biocontrol strain Pseudomonas fluorescens F113 on intraspecies
diversity of resident culturable fluorescent pseudomonads associated
with the roots of field-grown sugar beet seedlings. Applied and
Environmental Microbiology 67, 3418–3425.
Naseby, D.C., Moënne-Loccoz, Y., Powell, J., O’Gara, F. and Lynch,
J.M. (1998) Soil enzyme activities in the rhizosphere of field-grown
sugar beet inoculated with the biocontrol agent Pseudomonas
fluorescens F113. Biology and Fertility of Soils 27, 39–43.
Natsch, A., Keel, C., Hebecker, N., Laasik, E. and Défago, G. (1997)
Influence of biocontrol strain Pseudomonas fluorescens CHA0 and its
ª 2002 The Society for Applied Microbiology, Journal of Applied Microbiology, 93, 1065–1074
1074 J . E . J O H A N S E N ET AL.
antibiotic overproducing derivative on the diversity of resident root
colonizing pseudomonads. FEMS Microbiology Ecology 23, 341–
352.
Natsch, A., Keel, C., Hebecker, N., Laasik, E. and Défago, G. (1998)
Impact of Pseudomonas fluorescens strain CHA0 and a derivative with
improved biocontrol activity on the culturable resident bacterial
community on cucumber roots. FEMS Microbiology Ecology 27,
365–380.
Nielsen, M.N., Sørensen, J., Fels, J. and Pedersen, H.C. (1998)
Secondary metabolite- and endochitinase-dependent antagonism
toward plant-pathogenic microfungi of Pseudomonas fluorescens
isolates from sugar beet rhizosphere. Applied and Environmental
Microbiology 64, 3563–3569.
Niemann, S., Keel, C., Pühler, A. and Selbitschka, W. (1997)
Biocontrol strain Pseudomonas fluorescens CHA0 and its genetically
modified derivative with enhanced biocontrol capability exert comparable effects on the structure of a Sinorhizobium meliloti population
in gnotobiotic systems. Biology and Fertility of Soils 25, 240–244.
O’Sullivan, D.J. and O’Gara, F. (1992) Traits of fluorescent
Pseudomonas ssp. involved in suppression of plant root pathogen.
Microbiological Reviews 56, 662–676.
Olsson, S. and Persson, P. (1999) The composition of bacterial
populations in soil fractions differing in their degree of adherence to
barley roots. Applied Soil Ecology 12, 205–215.
Palleroni, N.J. (1993) Pseudomonas classification. A new case history in
the taxonomy of Gram-negative bacteria. Antonie van Leeuwenhoek
64, 231–251.
Pedersen, J.C. and Jacobsen, C.S. (1993) Fate of Enterobacter cloacae
JP120 and Alcaligenes eutrophus AEO106 (pRO101) in soil during
water stress: Effects on culturability and viability. Applied and
Environmental Microbiology 59, 1560–1564.
Picard, C., Di Cello, F., Ventura, M., Fani, R. and Guckert, A. (2000)
Frequency and biodiversity of 2,4-diacetylphloroglucinol producing
bacteria isolated from the maize rhizosphere at different stages of
plant growth. Applied and Environmental Microbiology 66, 948–955.
Reichenbach, H. (1992) The order Cytophagales. In The Prokaryotes
Vol. 2, ed. Balows, A., Trüper, H.G., Dworkin, H., Harder, W. and
Schleifer, K.H. pp. 3631–3675. New York: Springer-Verlag.
Roberson, E.B., Chenu, C. and Firestone, M.K. (1993) Microstructural changes in bacterial exopolysaccharides during desiccation. Soil
Biology and Biochemistry 25, 1299–1301.
Roberson, E.B. and Firestone, M.K. (1992) Relationship between
desiccation and exopolysaccharide production in a soil Pseudomonas
sp. Applied and Environmental Microbiology 58, 1284–1291.
Rovira, A.D. (1969) Plant root exudates. The Botanical Review 35,
35–57.
Schlimme, W., Marchiani, M., Hanselmann, K. and Jenni, B. (1999)
BACTOX, a rapid bioassay that uses protozoa to assess the toxicity
of bacteria. Applied and Environmental Microbiology 65, 2754–2757.
Schnider, U., Keel, C., Blumer, C., Troxler, J., Défago, G. and Haas,
D. (1995) Amplification of the house-keeping sigma factor in
Pseudomonas fluorescens CHA0 enhances antibiotic production and
improves biocontrol abilities. Journal of Bacteriology 177, 5387–5392.
Schnider-Keel, U., Lejbølle, K.B., Baehler, E., Haas, D. and Keel, C.
(2001) The sigma factor AlgU (AlgT) controls exopolysaccharide
production and tolerance towards desiccation and osmotic stress in
the biocontrol agent Pseudomonas fluorescens CHA0. Applied and
Environmental Microbiology 67, 5683–5693.
Smit, E., van Elsas, J.D. and van Veen, J.N. (1992) Risk associated with
the application of genetically modified microorganisms in terrestrial
environments. FEMS Microbiology Reviews 88, 263–278.
Stutz, E.W., Défago, G. and Kern, H. (1986) Naturally occurring
fluorescent pseudomonads involved in suppression of black root rot
of tobacco. Phytopathology 76, 181–185.
Thirup, L., Johnsen, K. and Winding, A. (2001) Succession of
Pseudomonas ssp. and Actinomycetes on barley roots affected by the
antagonistic strain Pseudomonas fluorescens DR54 and the fungicide
Imazalil. Applied and Environmental Microbiology 67, 1147–1153.
Troxler, J., Zala, M., Moënne-Loccoz, Y., Keel, C. and Défago, G.
(1997) Predominance of nonculturable cells of the biocontrol strain
Pseudomonas fluorescens CHA0 in the surface horizon of large outdoor
lysimeters. Applied and Environmental Microbiology 63, 3776–3782.
Voisard, C., Bull, C., Keel, C. et al. (1994) Biocontrol of root diseases
by Pseudomonas fluorescens CHA0: Current concepts and experimental approaches. In Molecular Ecology of Rhizosphere Microorganisms
ed. O’Gara, F., Dowling, D. and Boesten, B. pp. 67–89. Weinheim:
VCH Publishers.
Walsh, F.U., Morrissey, J.P. and O’Gara, F. (2001) Pseudomonas for
biocontrol of phytopathogens: from functional genomics to commercial exploitation. Current Opinion in Biotechnology 12, 289–295.
Whipps, J.M. (2001) Microbial interactions and biocontrol in the
rhizosphere. Journal of Experimental Botany 52, 487–511.
ª 2002 The Society for Applied Microbiology, Journal of Applied Microbiology, 93, 1065–1074
Manuscript III
(QKDQFHGH[RSRO\VDFFKDULGHSURGXFWLRQLVQRDGYDQWDJHIRU
ELRFRQWURODFWLYLW\RI3VHXGRPRQDVIOXRUHVFHQV&+$
K.B. Lejbølle, M. Péchy-Tarr, E. Baehler, U. Schnider-Keel, M. Zala,
S.J. Binnerup, and K. Keel
In preparation
Enhanced exopolysaccharide production
is no advantage for biocontrol activity of
Pseudomonas fluorescens CHA0
Kirsten Bang Lejbølle1, Maria Péchy-Tarr2, Ursula
Schnider-Keel2, Eric Baehler2, Marcello Zala3, Svend
Binnerup1, and Christoph Keel2
1
Department of Environmental Chemistry and Microbiology, National
Environmental Research Institute, Roskilde, Denmark,
2
Department of Fundamental Microbiology, University of Lausanne,
Lausanne, Switzerland,
3
Institute of Plant Sciences /Phytopathology, Swiss Federal Institute of
Technology (ETH) Zurich, Switzerland Corresponding author: Christoph Keel; Telephone: +41 21 692 56 36; Fax: +41 21 692 56 05;
E-mail: [email protected]
ABSTRACT
Extracellular polysaccharides (EPS) may contribute to host colonization, virulence and stress tolerance in plant-associated bacteria. Some
bacteria naturally produce EPS in abundant quantities and as a consequence have a highly mucoid appearance. This study focused on the
potential contribution of EPS hyperproduction to biocontrol activity of
plant-beneficial pseudomonads against root pathogens. Around 20%
of the fluorescent Pseudomonas strains isolated from soils of worldwide origin were found to have a highly mucoid phenotype. However,
the proportion of mucoid isolates that showed biocontrol activity
against either Pythium or Fusarium was about 2-3 times lower than
the proportion of the nonmucoid isolates with biocontrol activity. This
phenomenon was further investigated using the wellcharacterized
nonmucoid biocontrol agent Pseudomonas fluorescens CHA0 and two
EPSoverproducing derivatives as model strains. In the two mutants,
the mucA gene encoding an anti-sigma factor for AlgU (AlgT) is inactivated. The mucA mutants were significantly impaired in their capacity to protect cress from Pythium damping-off and had a strongly
reduced antimicrobial activity in vitro. Examination of the production
of the antifungal metabolites pyoluteorin and 2,4-diacetylphloroglucinol indicated that these compounds may be retained by the EPS
matrix of the mucA mutants, causing reduced biocontrol efficacy.
Other exoproducts such as extracellular protease(s) may be affected
by this mechanism as well. Microscopic observation of strains tagged
with the green fluorescent protein revealed that the mucoid mutants
were restricted in colonization of cress roots. This effect could be related to the diminished surface motility of the mucA mutants, possibly
caused by the
Manuscript IV
7KHVLJPDIDFWRU$OJ8$OJ7FRQWUROVH[RSRO\VDFFKDULGH
SURGXFWLRQDQGWROHUDQFHWRZDUGVGHVLFFDWLRQDQGRVPRWLF
VWUHVVLQWKHELRFRQWURODJHQW3VHXGRPRQDVIOXRUHVFHQV&+$
U. Schnider-Keel, K.B. Lejbølle, E. Baehler, D. Haas, and C. Keel
Applied and Environmental Microbiology 2001, 67, 5683-5693
(Blank page)
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2001, p. 5683–5693
0099-2240/01/$04.00⫹0 DOI: 10.1128/AEM.67.12.5683–5693.2001
Copyright © 2001, American Society for Microbiology. All Rights Reserved.
Vol. 67, No. 12
The Sigma Factor AlgU (AlgT) Controls Exopolysaccharide
Production and Tolerance towards Desiccation and
Osmotic Stress in the Biocontrol Agent
Pseudomonas fluorescens CHA0
URSULA SCHNIDER-KEEL, KIRSTEN BANG LEJBØLLE, ERIC BAEHLER,
DIETER HAAS, AND CHRISTOPH KEEL*
Laboratoire de Biologie Microbienne, Université de Lausanne, CH-1015 Lausanne, Switzerland
Received 8 August 2001/Accepted 26 September 2001
A variety of stress situations may affect the activity and survival of plant-beneficial pseudomonads added to
soil to control root diseases. This study focused on the roles of the sigma factor AlgU (synonyms, AlgT, RpoE,
and ␴22) and the anti-sigma factor MucA in stress adaptation of the biocontrol agent Pseudomonas fluorescens
CHA0. The algU-mucA-mucB gene cluster of strain CHA0 was similar to that of the pathogens Pseudomonas
aeruginosa and Pseudomonas syringae. Strain CHA0 is naturally nonmucoid, whereas a mucA deletion mutant
or algU-overexpressing strains were highly mucoid due to exopolysaccharide overproduction. Mucoidy strictly
depended on the global regulator GacA. An algU deletion mutant was significantly more sensitive to osmotic
stress than the wild-type CHA0 strain and the mucA mutant were. Expression of an algUⴕ-ⴕlacZ reporter fusion
was induced severalfold in the wild type and in the mucA mutant upon exposure to osmotic stress, whereas a
lower, noninducible level of expression was observed in the algU mutant. Overexpression of algU did not
enhance tolerance towards osmotic stress. AlgU was found to be essential for tolerance of P. fluorescens towards
desiccation stress in a sterile vermiculite-sand mixture and in a natural sandy loam soil. The size of the
population of the algU mutant declined much more rapidly than the size of the wild-type population at soil
water contents below 5%. In contrast to its role in pathogenic pseudomonads, AlgU did not contribute to
tolerance of P. fluorescens towards oxidative and heat stress. In conclusion, AlgU is a crucial determinant in the
adaptation of P. fluorescens to dry conditions and hyperosmolarity, two major stress factors that limit bacterial
survival in the environment.
Some strains of fluorescent pseudomonads colonize the
roots of many crop plants and protect them from diseases
caused by soilborne fungal pathogens. Disease suppression by
these bacteria involves a blend of mechanisms, including effective competition for nutrients and colonization sites, pathogen inhibition by production of antimicrobial compounds, and
induction of resistance in the plant (3, 24, 62). Following introduction into soil, the biocontrol performance of pseudomonads depends largely on their ability to maintain stable
populations and to be metabolically active at least over the
period needed to exert their beneficial effects. However, in soil
these bacteria are exposed to a range of variable biotic and
abiotic stress factors, such as competition, predation, and
changes in temperature, osmolarity, and availability of water
and nutrients (42, 63). Therefore, the sizes of introduced
pseudomonad populations may decline considerably within a
few weeks, and biocontrol activity often tends to be variable
(24, 62).
To ensure survival in changing environments, bacteria rely
on regulatory mechanisms that allow them to respond rapidly
to stress situations (60). Regulatory elements that make essential contributions to bacterial survival under stress conditions
include the alternative sigma factors RpoS (␴s) and RpoE (␴22;
also referred to as AlgU or AlgT in fluorescent pseudomonads). RpoS is required for tolerance of stationary-phase
cultures of different Pseudomonas species towards hyperosmolarity, high temperatures, and agents generating reactive oxygen intermediates (ROIs) (23, 52, 61). AlgU contributes to
tolerance towards osmotic, oxidative, and heat stresses in the
pathogens Pseudomonas aeruginosa (32, 54, 56, 70) and Pseudomonas syringae (26).
The extracytoplasmic function sigma factor AlgU is encoded
by the algU gene, which is part of a highly conserved operon in
gram-negative bacteria (19, 26, 35, 44). The function of algU
has been extensively studied in P. aeruginosa with respect to its
roles in stress response and in regulation of biosynthesis of the
exopolysaccharide (EPS) alginate. Regulation of AlgU activity
in P. aeruginosa is complex. AlgU positively regulates its own
transcription (12, 22, 56, 68). Located downstream of algU, the
mucABCD genes ensure tight control of AlgU activity in P.
aeruginosa (19). The mucA gene encodes a transmembrane
protein which acts as an anti-sigma factor for AlgU, and mucB
codes for a periplasmic protein which is another negative regulator of AlgU (36, 57, 69). MucC and MucD modulate algU
expression, but the precise functions of these proteins have not
been fully established yet (5, 6). Binding of AlgU to the inner
membrane protein MucA occurs when MucA interacts with
the periplasmic MucB protein (36, 44, 50). Environmental
stress conditions are thought to destabilize the MucB-MucAAlgU complex, leading to release of AlgU into the cytosol. As
a consequence, AlgU becomes active and transcription of al-
* Corresponding author. Mailing address: Laboratoire de Biologie
Microbienne, Bâtiment de Biologie, Université de Lausanne, CH-1015
Lausanne, Switzerland. Phone: (41-21) 692-5636. Fax: (41-21) 6925635. E-mail: [email protected].
5683
5684
SCHNIDER-KEEL ET AL.
APPL. ENVIRON. MICROBIOL.
TABLE 1. Bacterial strains and plasmids used in this study
Genotype and/or phenotypea
Strain or plasmid
P. fluorescens strains
CHA0
CHA0-Rif
CHA89
CHA211
CHA212
CHA212-Rif
CHA213M
CHA213M.gacA
CHA510
P. aeruginosa strains
PAO1
PAO568
PAO6852
E. coli strains
DH5␣
W3110
Plasmids
pBluescript II KS⫹
pLG221
pME497
pME3049
pME3087
pME3088
pME3089Km
pME6000
pME6010
pME6010⌬B
pME6200B
pME6200X
pME6202X
pME6202X⌬EV
pME6217
pME6219
pME6220
pME6221
pME6222
pME6551
pME6555
pML8
pNM482
pUK21
a
b
Reference or source
Wild type
Spontaneous Rifr derivative of CHA0
gacA::⍀-Km, Kmr
mucA::Tn5, Kmr
⌬algU
CHA0-Rif ⌬algU, Rifr
⌬mucA
⌬mucA gacA::⍀-Km, Kmr
gacS::Tn5, Kmr
65
45
29
This
This
This
This
This
8
Wild type
mucA2 leu-38 str-2 FP2⫹
PAO1 algU::Tcr, Tcr
ATCC 15692
32
32
recA1 endA1 hsdR17 deoR thi-1 supE44 gyrA96 relA1 ⌬(lacZYA-argF)U169 (␸80dlacZ⌬M15)
Prototroph, sup0 ␭⫺
51
51
Cloning vector, ColE1 replicon, Apr
Suicide vector, Coll1drd-1::Tn5, IncI␣, Kmr
Mobilizing plasmid, IncP-1, Tra RepA(Ts), Apr
Suicide vector, ColE1 replicon, RK2-Mob, Hgr Kmr
Suicide vector, ColE1 replicon, RK2-Mob, Tcr
Suicide vector, ColE1 replicon, RK2-Mob, Tcr
pME3088 carrying gacA of P. fluorescens disrupted by an ⍀-Km cassette, Tcr Kmr
Cloning vector, pBBR1MCS derivative, 18 copies per chromosome equivalent in P. fluorescens, Tcr
Cloning vector, pACYC177-pVS1 shuttle vector, 6 copies per chromosome equivalent in P. fluorescens, Tcr
pME6010 with deletion of the unique BamHI site, Tcr
pME3049 with a 0.8-kb genomic DNA fragment of P. fluorescens CHA211
pME3049 with a 4.5-kb genomic DNA fragment of P. fluorescens CHA211
pME3049 with a 14.5-kb genomic DNA fragment of P. fluorescens CHA0
pME6202X with a 9.8-kb EcoRV deletion
pME6000 with a 2.6-kb ApaI-BamHI fragment of pME6202X⌬EV, containing algUmucA
pME6010⌬B with a 2.6-kb ApaI-BamHI fragment of pME6202X⌬EV in which the 275-bp NotIClaI fragment in algU is replaced by the 56-bp NotI-ClaI polylinker of pBluescript II KS⫹, contains intact mucA
pME6000 with a 1.7-kb ApaI-MscI fragment of pME6202X⌬EV, containing algU
pME6010⌬B with a 1.7-kb ApaI-MscI fragment of pME6202X⌬EV, containing algU
pME6010⌬B with a 1.0-kb ApaI-NotI fragment of pME6202X⌬EV and the 3-kb BamHI-DraI fragment of pNM482 containing ⬘lacZ, algU⬘-⬘lacZ translational fusion at the NotI site in algU
Cloning vector, pME6000 derivative with insertion of the Gmr determinant (aac1 gene) of pML8 at
the EcoRV site in the tetA gene, Tcs Gmr
pME6551 with a 1,712-bp Sau3A fragment of pME6215 (5⬘ end located 48 bp upstream of the algU
start codon) containing algUmucA placed under the control of the lac promoter
RSF1010-derived cloning vector carrying the Gmr gene aac1, Tcr Gmr
ColE1 replicon, ⬘lacZ, Apr
Cloning vector, lacZ␣, Kmr
Stratagene
7
66
53
65
65
29
38
21
This
This
This
This
This
This
This
study
study
study
study
study
study
studyb
studyb
studyb
studyb
studyb
studyb
This studyb
This studyb
This studyb
This study
This studyb
28
43
64
Apr, ampicillin resistance; Gmr, gentamicin resistance; Hgr, mercury resistance; Kmr, kanamycin resistance; Rifr, rifampin resistance; Tcr, tetracycline resistance.
See Fig. 1.
ginate biosynthesis and other genes occurs. Any change in the
balance of this regulatory system influences the titer of available active AlgU. For example, mutations in mucA or mucB
cause increased activity of AlgU, which leads to mucoidy due
to overproduction of alginate (33, 34, 36). Mucoid conversion
due to spontaneous lesions in mucA is typically detected in P.
aeruginosa isolates from chronically infected cystic fibrosis patients, and the production of copious amounts of alginate is
thought to be important for virulence and survival of these
bacteria in the lungs (4, 34).
Little is known about the role of AlgU and its negative
regulators in plant-beneficial pseudomonads. In the present
study, we identified a genomic region which comprises the
algU-mucA-mucB gene cluster in Pseudomonas fluorescens
CHA0, a well-characterized soil bacterium with broad-spectrum biocontrol activity (24, 65). We found that AlgU, along
with MucA, tightly controls EPS biosynthesis and tolerance
towards osmotic stress in this bacterium. In contrast to AlgU of
pathogenic pseudomonads, AlgU of strain CHA0 does not
contribute to survival in response to treatment with heat and
ROIs. Finally, we present the first evidence that AlgU is a
crucial determinant in adaptation of P. fluorescens to desiccation stress, a major factor that limits bacterial survival in formulations or in soil.
MATERIALS AND METHODS
Bacterial strains, plasmids, and culture conditions. The bacterial strains and
plasmids used in this study are described in Table 1. P. fluorescens strains were
cultivated on nutrient agar (NA) (59), on King’s medium B (KMB) agar (27), in
nutrient yeast broth (NYB) (59), in KMB broth, and in Luria-Bertani broth (LB)
(51) at 30°C with aeration. Escherichia coli and P. aeruginosa strains were grown
on NA and in NYB at 37°C. Antimicrobial compounds, when required, were
added to the growth media at the following concentrations: ampicillin, 100
VOL. 67, 2001
AlgU OF P. FLUORESCENS
5685
FIG. 1. Physical location of the nadB, algU, mucA, and mucB genes in P. fluorescens CHA0. Symbols: , Tn5 insertion in the chromosome of
strain CHA211; ‚, region deleted in strains CHA212 and CHA213M and in plasmid pME6219. The shaded arrows indicate the genes sequenced
or partly sequenced on the EcoRI-BamHI fragment of pME6202X⌬EV. The open boxes indicate the genomic inserts in ColE1-based plasmids
pME6200B, pME6200X, pME6202X, and pME6202X⌬EV. The lines indicate the fragments cloned into vector pME6000 to obtain pME6217,
pME6220, and pME6555 and into vector pME6010⌬B to obtain pME6219, pME6221, and pME6222.
␮g/ml; chloramphenicol, 25 ␮g/ml; HgCl2, 20 ␮g/ml; gentamicin, 10 ␮g/ml; kanamycin sulfate, 25 ␮g/ml; rifampin, 100 ␮g/ml; and tetracycline hydrochloride, 25
␮g/ml for E. coli and 125 ␮g/ml for P. fluorescens strains. When appropriate,
5-bromo-4-chloro-3-indolyl-␤-D-galactoside (X-Gal) was incorporated into solid
media to monitor ␤-galactosidase expression (51).
DNA manipulation and sequencing. Small-scale plasmid DNA preparations
were obtained from P. fluorescens strains and pME3049-, pME3087-, and
pME3088-based plasmids were isolated from E. coli by the alkaline lysis method
(51). All other plasmids were prepared from E. coli by the method of Del Sal et
al. (10). Qiagen-tip 100 columns (Qiagen Inc.) were used for large-scale plasmid
DNA preparation. Chromosomal DNA of P. fluorescens was isolated as described by Schnider et al. (53). Standard techniques were used for restriction,
agarose gel electrophoresis, dephosphorylation, generation of blunt ends with
the Klenow fragment of E. coli DNA polymerase I or T4 DNA polymerase
(Roche), isolation of DNA fragments from low-melting-point agarose gels, and
ligation (51). Restriction fragments were purified from agarose gels with a Geneclean II kit (Bio 101). Bacterial cells were transformed with plasmid DNA by
CaCl2 treatment (51) or electroporation (15). Southern blotting with Hybond N
membranes (Amersham), random-primed DNA labeling with digoxigenin-11dUTP, hybridization, and detection (Roche) were performed by using the protocols of the suppliers. Subclones of pME6202X⌬EV (Table 1; Fig. 1) constructed in pBluescript II KS⫹ were used for nucleotide sequence determination.
Both strands of the 2,825-bp EcoRI-BamHI fragment of pME6202X⌬EV were
sequenced by the dideoxy chain termination method using a Sequenase 2.0 kit
(United States Biochemical, Cleveland, Ohio) and T7 polymerase from Pharmacia. Nucleotide and deduced amino acid sequences were analyzed with programs of the University of Wisconsin Genetics Computer Group package (version 9.1).
Plasmid mobilization and transposition. Derivatives of the suicide plasmids
pME3049, pME3087, and pME3088 were mobilized from E. coli to P. fluorescens
with helper plasmid pME497 in triparental matings as described by Schnider et
al. (53). Transposon mutagenesis in which E. coli W3110 containing Tn5 suicide
plasmid pLG221 (7) was used as the donor strain and P. fluorescens CHA0 was
used as the recipient strain was carried out as described previously (37).
Construction of P. fluorescens mutants by gene replacement. For construction
of the algU in-frame mutant CHA212 (Fig. 1), the 275-bp NotI-ClaI fragment in
algU was replaced by the 56-bp NotI-ClaI polylinker from pBluescript II KS⫹.
The flanking genomic DNA, consisting of the 1.2-kb HincII-NotI fragment and
the 1.4-kb ClaI-BamHI fragment of pME6202X⌬EV (Fig. 1), was cloned into
suicide vector pME3087 (65). To obtain the mucA in-frame mutant CHA213M
(Fig. 1), the 309-bp SmaI-McsI fragment in mucA was deleted. The flanking
genomic DNA, consisting of the 0.6-kb PvuII-SmaI fragment and the 0.8-kb
McsI-BamHI fragment of pME6202X⌬EV, was cloned into suicide vector
pME3088 (65). The derivatives of the suicide plasmids, which carried a tetracy-
5686
SCHNIDER-KEEL ET AL.
cline resistance determinant, were mobilized with helper plasmid pME497 (66)
to wild-type strain CHA0. Cells with a chromosomally integrated plasmid were
selected for tetracycline resistance. Excision of the vector by a second homologous recombination event was observed after enrichment for tetracycline-sensitive cells (53). The same approach was used to create an algU in-frame mutation
in rifampin-resistant strain CHA0-Rif. To obtain the mucA gacA double mutant
CHA213M.gacA, plasmid pME3089Km, a derivative of suicide vector pME3088
carrying gacA disrupted by an ⍀-Km cassette (29), was mobilized into strain
CHA213M. Selection of cells with a chromosomally integrated plasmid and
excision of the vector by a second crossover were performed as described above.
Selection for kanamycin resistance ensured the presence of the ⍀-Km insertion
in strain CHA213M.gacA. The algU, mucA, and gacA mutations were checked by
Southern blotting (data not shown).
Extraction and quantification of EPS from P. fluorescens. Aliquots (100 ␮l) of
an overnight LB culture of strain CHA0 or one of its derivatives were plated on
KMB agar plates. Three replicate plates per strain were prepared and incubated
for 24 h at 30°C. Extraction and quantification of EPS were performed by using
a procedure described by May and Chakrabarty (39). Briefly, cells were removed
from the medium and suspended in 0.9% NaCl. The suspensions were centrifuged for 30 min at 17,700 ⫻ g and 4°C to separate the cells from the EPS. The
cell pellets were kept for determinations of total cell protein contents. The EPS
was repeatedly precipitated and washed with ice-cold absolute ethanol. The
contents of uronic acid polymers (components of alginate) in the samples were
then assessed by performing the colorimetric carbazole assay (39), using Dmannurolactone (Sigma Chemical Co., St. Louis, Mo.) and alginic acid from
seaweed (Macrocystis pyrifera; Sigma) as the standards. The uronic acid content
was expressed per milligram of total cell protein as determined by the Lowry
method, using bovine serum albumin as the standard.
Purification and biochemical analysis of EPS. Mucoid layers from five KMB
agar cultures of highly mucoid mutant strains CHA211 and CHA213M, cultivated under the conditions described above, were scraped off the plates with a
sterilized spatula, pooled, and suspended in 50 ml of phosphate-buffered saline
(pH 7.2). After vigorous stirring at 4°C for 1 h, the viscous solution was centrifuged at 17,700 ⫻ g and 4°C for 4 h to remove the bacterial cells. The remaining
proteins in the supernatant were denatured by heating at 80°C for 30 min and
removed by centrifugation at 17,700 ⫻ g for 30 min. Precipitation of EPS by the
addition of ice-cold absolute ethanol, washing, and removal of nucleic acids by
digestion with DNase I (type IV; Sigma) and RNase A (type 1A; Sigma) were
performed as described by Pedersen et al. (47). The EPS was then further
purified by ion-exchange chromatography. Samples were dissolved in 25 mM
ammonium carbonate, loaded onto a DEAE-Sepharose CL-6B column (1.6 by
20 cm; bed volume, 40 ml; Pharmacia), which had been equilibrated with the
same buffer, and eluted with a linear 25 mM to 1 M ammonium carbonate
gradient (39, 47). Fractions (5 ml) containing uronic acids were pooled, extensively dialyzed against sterile water, and lyophilized.
The total carbohydrate of the purified EPS was quantified colorimetrically by
performing the phenol-sulfuric acid assay (13) with 3% (wt/vol) phenol, using
D-mannuronic acid lactone (Sigma) and seaweed alginate as the standards. The
degree of acetylation of uronic acids was assessed on the basis of a colorimetric
reaction with hydroxylamine hydrochloride (40), using ␤-D-glucose-pentaacetate
(Sigma) as the standard.
Effect of osmotic stress on algUⴕ-ⴕlacZ expression and growth. P. fluorescens
CHA0 and its mutant derivatives carrying an algU⬘-⬘lacZ translational fusion on
plasmid pME6222 (Table 1; Fig. 1) were grown in 20 ml of KMB without
selective antibiotics in 100-ml Erlenmeyer flasks plugged with cotton. Plasmid
pME6222 carries the algU promoter region and the 5⬘ end of algU fused to ⬘lacZ
from pMN482 (43). To induce osmotic stress, KMB was supplemented with NaCl
(0.6, 0.8, 1.0, or 1.2 M) or sorbitol (1.2 or 1.6 M), a nonionic solute which cannot
be metabolized by strain CHA0. For inoculation, aliquots of exponential-growthphase LB cultures of the bacterial strains were used to adjust the cell concentrations to an optical density at 600 nm (OD600) of 0.05. Cultures were incubated
with rotational shaking (180 rpm) at 30°C. ␤-Galactosidase specific activities of
at least three independent cultures were monitored by the Miller method (51).
Doubling times of strain CHA0 and its derivatives (cultivated as described
above) were calculated from OD600 values between 0.05 and 1.5 (i.e., during
exponential growth). After 24 h of incubation, bacterial survival was assessed by
plating serial dilutions of the cultures on NA and determining the ratio of CFU
from osmotically stressed cultures to CFU from nonstressed cultures.
Desiccation survival assay performed with filter disks. The sensitivity of P.
fluorescens to desiccation on filters was assessed by using a modification of the
procedure described by Ophir and Gutnick (46). Dilutions of overnight bacterial
cultures were vacuum filtered onto Millipore filters (no. HAWP04700; pore size,
0.45 ␮m; diameter, 3.5 cm) in order to obtain about 10 to 20 physically separated
APPL. ENVIRON. MICROBIOL.
bacterial cells per filter. The filters were placed onto KMB agar plates and
incubated at 30°C for 24 h, which yielded about 5 ⫻ 107 CFU per colony that had
developed from the individual bacterial cells. Bacterial colonies were then slowly
dried by removing the filters from the agar plates, cutting the filters into small
pieces so that each piece contained a single bacterial colony, and incubating the
pieces in empty petri dishes at 30°C for 24 h. Colonies on filter pieces that were
placed on agar medium lacking nutrients (18 g of Serva agar per liter, 1.15 g of
K2HPO4 per liter, 1.5 g of MgSO4 䡠 7H2O per liter) and were incubated for the
same period served as controls. Cells from a single colony on each filter were
then suspended in 1 ml of a 0.85% NaCl solution by vigorous mixing with a
Vortex mixer for 15 min, and serial dilutions were plated on NA to determine the
number of CFU per colony. Washed filter pieces incubated on NA plates showed
that almost all cells were removed by this treatment. The level of survival was
calculated by determining the percentage of the number of CFU in desiccated
colonies relative to the number of CFU in control colonies. Each filter piece was
handled separately, and the numbers of CFU were determined for at least five
colonies per treatment. The experiment was repeated three times.
Desiccation survival assay performed with soil microcosms. Survival of bacterial strains was monitored in desiccating, sterile, artificial soil and in desiccating, nonsterile, natural soil. The artificial soil consisted of pure vermiculite
(expanded with 30% H2O2), quartz sand with different sizes of particles, and
quartz powder mixed at a ratio of 10:70:20 (by weight) and moistened with 10%
(wt/wt) distilled water (25). The artificial soil was autoclaved twice prior to
bacterial inoculation. Natural sandy loam soil was collected from the surface
horizon of a Swiss cambisol located at Eschikon near Zurich (45). The soil was
sieved through a 5-mm mesh screen prior to use, and stones and roots were
removed. The bacterial cell suspensions used in microcosms were prepared from
exponential-growth-phase cultures grown in LB at 24°C for 16 h. The cells were
washed twice in sterile distilled water, and the cell concentration was adjusted to
an OD600 of 0.2. For inoculation of the artificial or natural soil, 67 ml of the
bacterial suspension was thoroughly mixed into 1,000 g of soil with a sterilized
spoon to obtain about 107 CFU per g of soil. For natural soil microcosms,
rifampin-resistant derivatives of the bacterial strains were used as the inoculants.
Aliquots (20 g) of inoculated soil were placed into sterile 200-ml Erlenmeyer
flasks with wide openings. The openings were covered with one layer of sterilized
paper cloth, which allowed slow evaporation of the soil water. Control microcosms kept at a constant soil moisture level were prepared by placing 200-g
portions of sterile, artificial soil or nonsterile, natural soil containing the bacterial
inoculum into 500-ml bottles, which then were sealed hermetically. The initial
water content of the artificial soil after addition of bacteria was 15.2% ⫾ 0.2%,
which corresponded to a soil water potential (⌿W) of about ⫺0.01 MPa. Natural
soil contained 26.9% ⫾ 0.2% water, which corresponded to a ⌿W of about ⫺0.02
MPa. The soil microcosms were incubated in the dark at 24°C with 65% relative
humidity. For sampling and enumeration of the bacterial inoculants, the entire
contents of a flask with desiccated soil or a 5-g sample from a control soil kept
at a constant humidity was suspended in sterile distilled water by vigorous
agitation on a shaker at 260 rpm for 20 min. At each time point, the number of
cultivable cells and the soil water content were determined for three replicate
flasks or soil samples per treatment. The numbers of CFU were determined by
plating serial dilutions of the soil suspensions on NA. Rifampin-resistant derivatives were recovered from natural soil by plating samples on NA containing 100
␮g of rifampin per ml. No rifampin-resistant background bacterial population
was present in the natural soil. CFU data were expressed per gram (dry weight)
of soil and were log10 transformed before means and standard deviations were
calculated. Water content was assessed by oven drying soil samples at 105°C to
constant weight. The ␺W of soil was determined by using a filter paper method
described by McInnes et al. (41).
Susceptibility to oxidative stress. Sensitivity to paraquat (1,1⬘-dimethyl-4,4⬘bipyridinium dichloride; Sigma), hydrogen peroxide (H2O2), or sodium hypochlorite (NaOCl) was examined as described by Martin et al. (32). Filter disks
(diameter, 6 mm; Millipore) were soaked with 10 ␮l of paraquat (1.9 or 3.8%,
wt/vol), H2O2 (3 or 12%, vol/vol), or NaOCl (5 or 10%, vol/vol) and placed on
a layer of soft agar (2 ml of NYB with 0.8% agar) containing 100 ␮l of a P.
fluorescens or P. aeruginosa overnight culture covering NA. In another approach,
disks (diameter, 10 mm) were soaked with 50-␮l portions of the agents mentioned above. The diameters of the inhibition zones surrounding the impregnated disks were measured after overnight incubation at 30°C for P. fluorescens
strains and at 37°C for P. aeruginosa strains.
Sensitivity to high temperatures. P. fluorescens CHA0 and mutant derivatives
of this strain were grown at 30°C in 20 ml of KMB or NYB in 100-ml Erlenmeyer
flasks sealed with cellulose stoppers. When the cultures reached an OD600 of 0.5,
the flasks were transferred to a water bath and incubated for 0, 5, 10, 20, 30, 60,
and 90 min at 42 or 48°C with rotational shaking at 180 rpm. At each time point,
AlgU OF P. FLUORESCENS
VOL. 67, 2001
three replicate cultures were sampled to determine the number of CFU on NA.
CFU were counted after incubation for 24 and 72 h at room temperature. Levels
of survival were expressed as percentages of the input number of CFU at time
zero.
Nucleotide sequence accession number. The nucleotide sequence of the
nadB⬘, algU, mucA, and mucB⬘ genes of P. fluorescens CHA0 has been deposited
in the GenBank database under accession no. AF399758.
RESULTS
Isolation and characterization of mucoid mutant CHA211.
Following Tn5 mutagenesis of P. fluorescens strain CHA0, 1 of
the 1,000 mutants tested had a highly mucoid colony phenotype when it was grown on KMB or NA. In contrast, wild-type
strain CHA0 is naturally nonmucoid. The mucoid phenotype
of the mutant strain, CHA211, was stable, even when the strain
was repeatedly subcultured in nonselective media for more
than 1 week. Southern hybridization confirmed that mutant
CHA211 contained a single Tn5 insertion (data not shown).
The Tn5 insertion was located 550 bp downstream of the initiation codon of the mucA gene (Fig. 1 and see below).
Cloning and sequence analysis of the genes surrounding the
Tn5 insertion in strain CHA211. To localize the genomic region mediating mucoidy in strain CHA211, a two-step Tn5directed cloning strategy (53) was used to clone the wild-type
genes corresponding to the genes that were inactivated by the
Tn5 insertion in the mutant. Suicide vector pME3049 carrying
the kanamycin resistance determinant of Tn5 was mobilized
into strain CHA211. Integration of pME3049 into the chromosome occurred at a frequency of 7.2 ⫻ 10⫺7 per donor. Chromosomal DNA of CHA211::pME3049 was digested with
BamHI or XbaI, ligated, and used to transform E. coli DH5␣.
The resulting plasmids, pME6200B and pME6200X, carried
0.8- and 4.5-kb genomic DNA inserts, respectively, downstream of the Tn5 insertion site (Fig. 1). For isolation of
the wild-type genes, plasmid pME6200B was transferred
into wild-type strain CHA0. Digestion of genomic DNA of
CHA0::pME6200B with XhoI, self-ligation, and transformation of E. coli resulted in plasmid pME6202X (Fig. 1) carrying
a 14.6-kb genomic fragment. To reduce the size of the insert in
pME6202X, the plasmid was digested with EcoRV and ligated.
The plasmid obtained, pME6202X⌬EV (Fig. 1), contained a
4.7-kb genomic DNA fragment.
The 2,825-bp nucleotide sequence of the EcoRI-BamHI
genomic fragment in pME6202X⌬EV (Fig. 1, expanded region) revealed that there were two complete and two partial
open reading frames, designated nadB⬘, algU, mucA, and
mucB⬘, by analogy with homologous genes in P. aeruginosa (12,
31, 33), P. syringae pv. syringae (26), and Azotobacter vinelandii
(35). The proposed start codons of nadB⬘, algU, mucA, and
mucB⬘of P. fluorescens CHA0 are preceded by plausible ribosome-binding sites. The deduced product (193 amino acids,
22.2 kDa) of the algU gene of P. fluorescens CHA0 is very
similar to alternative sigma factor AlgU (␴22) of P. syringae pv.
syringae (accession no. AF190580; 97% identity), A. vinelandii
(accession no. U22895; 93% identity), and P. aeruginosa (accession no. L04794 and L36379; 91% identity) and is also
related to RpoE of E. coli (accession no. EC37089; 63% identity). The mucA gene is located downstream of algU, and its
product (195 amino acids, 20.9 kDa) is 82, 74, and 63% identical to the MucA anti-␴22 factor of P. syringae pv. syringae
5687
TABLE 2. EPS production by P. fluorescens CHA0
and derivatives of this strain
Straina
CHA0
CHA0/pME6000
CHA0/pME6220
CHA0/pME6217
CHA0/pME6555
CHA212
CHA212/pME6010⌬B
CHA212/pME6221
CHA211
CHA213M
CHA213M/pME6010⌬B
CHA213M/pME6219
CHA213M.89
CHA89
Genotype
Phenotype
EPS production (␮g/mg
of protein)b
Wild type
Wild type/⫺c
Wild type/Palg-algU⫹
Wild type/Palg-algU⫹
mucA⫹
Wild type/Plac-algU⫹
mucA⫹
⌬algU
⌬algU/⫺
⌬algU/algU⫹
mucA::Tn5
⌬mucA
⌬mucA/⫺
⌬mucA/mucA⫹
⌬mucA gacA::⍀-Km
gacA::⍀-Km
Nonmucoid
Nonmucoid
Mucoid
Mucoid
42 d
54 d
4,602 c
6,365 c
Mucoid
14,802 b
Nonmucoid
Nonmucoid
Nonmucoid
Mucoid
Mucoid
Mucoid
Nonmucoid
Nonmucoid
Nonmucoid
77 d
70 d
21 d
28,143 a
4,123 c
4,464 c
61 d
54 d
43 d
a
Bacteria were grown on KMB agar plates at 30°C for 24 h. Plasmid pME6221
was derived from the low-copy-number vector pME6010 (six copies per chromosome equivalent) (21); plasmids pME6217, pME6220, and pME6555 were
derivatives of the multiple-copy-number vector pME6000 (18 copies per chromosome equivalent) (38). Palg and Plac indicate control from the natural promoter and the lac promoter, respectively.
b
EPS production was measured in micrograms of uronic acid produced per
milligram of total cell protein. The data are means based on three individually
assessed cultures. Values followed by different letters are significantly different at
P ⫽ 0.05 (Student’s t test).
⫺
, empty vector.
(accession no. AF190580), P. aeruginosa (accession no. L14760
and L36379), and A. vinelandii (accession no. U22660), respectively. The product of the adjacent, incompletely sequenced
mucB gene is 66, 61, and 65% identical to MucB (AlgN) of
P. syringae pv. syringae (accession no. AF190580), P. aeruginosa (accession no. L14760), and A. vinelandii (accession no.
U22660), respectively. The intergenic region upstream of algU
of P. fluorescens comprises 558 nucleotides and exhibits only
48% nucleotide identity with the corresponding region of P.
aeruginosa. Two putative AlgU (RpoE) recognition sites were
found 60 bp (GAACTT-16 nucleotides-TCTAT) and 253 bp
(GAACTT-17 nucleotides-TCAAT) upstream of the translational start site of algU. Remarkably, the location and sequence
of the first AlgU recognition site (60 bp upstream of the initiation codon of algU) are conserved in P. fluorescens, P. syringae pv. syringae (26), and P. aeruginosa (56). The location and
sequence of the second AlgU recognition site are almost identical in P. fluorescens and P. syringae pv. syringae. The divergently oriented nadB⬘ gene upstream of algU was sequenced
only in its 5⬘ region. The deduced product (117 amino acids)
exhibits similarities to N termini of the L-aspartate oxidase for
NAD biosynthesis of P. aeruginosa (accession no. U17232; 82%
identity) and E. coli (accession no. X12714; 56% identity).
Based on these sequence comparisons, it appears that the
arrangement of the nadB, algU, mucA, and mucB genes is
conserved in P. fluorescens, P. syringae, P. aeruginosa, and A.
vinelandii.
EPS production in P. fluorescens is controlled by the AlgU
regulon. Chromosomal algU and mucA in-frame deletion mutations were created in strain CHA0 (Fig. 1) as described in
Materials and Methods, and the mutants were tested for EPS
production by using the carbazole assay for uronic acids. The
nonmucoid strains CHA0 (wild type) and CHA212 (algU mu-
5688
SCHNIDER-KEEL ET AL.
APPL. ENVIRON. MICROBIOL.
FIG. 2. Kinetics of expression of an algU⬘-⬘lacZ fusion in response to NaCl stress. ␤-Galactosidase activity was assayed in P. fluorescens CHA0
(F) and ⌬algU mutant CHA212 (E), both carrying pME6222. Growth of CHA0 (Œ) and growth of CHA212 (‚) were determined by measuring
OD600. Strains were grown at 30°C in KMB without (A) or with (B) 0.6 M NaCl. The data are means ⫾ standard deviations based on three
experiments. Some of the error bars were too small to be included.
tant) produced very low levels of EPS after incubation on
KMB agar for 24 h (Table 2). In contrast, mucA in-frame
deletion mutant CHA213M developed a mucoid phenotype on
KMB agar and produced copious amounts of EPS (Table 2).
The mucA::Tn5 mutant CHA211 (Fig. 1) produced even more
mucoid material than the mucA in-frame deletion mutant
CH213M produced (Table 2). This may have been due to a
polar effect of the Tn5 insertion on other AlgU regulatory
genes downstream of mucA, especially mucB (36, 50). The
level of EPS production in mucoid mutant CHA213M could be
restored to the low wild-type level by complementation with
mucA⫹ plasmid pME6219 (Fig. 1), whereas introduction of the
cloning vector pME6010⌬B alone had no effect (Table 2).
Complementation of the ⌬algU mutation in CHA212 by
pME6221 carrying intact algU⫹ (Fig. 1) did not significantly
affect the nonmucoid phenotype of the strain (Table 2).
When AlgU was overexpressed from multicopy plasmids
pME6220 (algU⫹) and pME6217 (algU⫹mucA⫹) (Table 1; Fig.
1) in strain CHA0, the level of EPS production increased to the
level observed in mucA mutant CHA213M (Table 2). Interestingly, the presence of multiple copies of mucA in CHA0 carrying pME6217 did not interfere with the EPS-stimulating
effect of the algU amplification (Table 2), perhaps because
other regulators, such as MucB, were not present at titers that
were high enough. Constitutively high levels of expression of
algU and mucA from the lac promoter on plasmid pME6555
(Table 1; Fig. 1) in strain CHA0 resulted in further increases in
the level of EPS production to levels that were about 3.5 times
greater than the level in mucA mutant CHA213M (Table 2).
Attempts to clone algU alone under the control of the lac
promoter failed, since E. coli and P. fluorescens transformants
carrying plasmid constructs with such an insert were not viable
and did not maintain the plasmid, respectively (unpublished
data). Similar problems have been reported for attempts to
overexpress algU in P. aeruginosa and were attributed to potential toxicity of AlgU in the absence of its negative regulators, MucA and MucB (22, 55). In conclusion, EPS biosynthesis in strain CHA0 is controlled by a fine-tuned balance
between AlgU and MucA, probably assisted by MucB.
Biochemical analysis of EPS from mucoid mutants of P.
fluorescens. EPS was extracted and purified from mucoid material of KMB agar cultures of mucA mutants CHA211 and
CHA213M by using the procedure described by Pedersen et al.
(47). During DEAE-Sepharose ion-exchange chromatography,
EPS of both P. fluorescens mutants, like alginate of P. aeruginosa (47), eluted between 0.4 and 0.7 M ammonium carbonate,
with a maximum peak at 0.53 M ammonium carbonate. The P.
fluorescens EPS preparations had total carbohydrate contents
of 62% ⫾ 9% and 87% ⫾ 12% (on a dry weight basis) when
seaweed alginate and D-mannuronic acid lactone, respectively,
were used as the standards. When either of these standards was
used, 46% ⫾ 5% of the dry weight could be attributed to
uronic acids, a value which is lower than the uronic acid content (70 to 100%) described for P. aeruginosa alginate (47).
Nevertheless, the degree of acetylation of P. fluorescens uronic
acids determined by a colorimetric assay was 16% ⫾ 2%, a
value identical to the value obtained for P. aeruginosa (47).
Acetylation of uronic acid polymers is a typical feature of
bacterial alginates, whereas algal alginates are not acetylated
(18). No contaminating proteins or nucleic acids were detected
in purified EPS from P. fluorescens. These results indicate that
mucoidy in mucA mutants of P. fluorescens CHA0 is due to
overproduction of an acetylated EPS which may be related to
some extent to the EPS produced by P. aeruginosa. Fluorescent
pseudomonads have been shown to produce a wide variety of
EPS which may differ considerably in composition, and alginate has been detected in only some of these EPS (16, 17).
Kinetics of algU expression in response to osmotic stress. To
test algU regulation in response to osmotic stress, we monitored expression of an algU⬘-⬘lacZ reporter fusion carried by
pME6222 (Table 1; Fig. 1) in wild-type strain CHA0 and mutant derivatives of this strain in the presence of NaCl and the
nonionic solute sorbitol. In KMB without NaCl, algU was expressed at low, almost constant levels in strain CHA0 and in
algU mutant CHA212 (Fig. 2A). Upon exposure to 0.6 M
NaCl, algU expression in wild-type cells was transiently induced about two- to threefold in the early exponential growth
phase, whereas no induction occurred in the algU mutant (Fig.
AlgU OF P. FLUORESCENS
VOL. 67, 2001
5689
TABLE 3. Expression of an algU⬘-⬘lacZ fusion in P. fluorescens CHA0 and mutant derivatives of strain CHA0 in response to osmotic stress
Straina
Genotype
CHA0
CHA212
CHA0/pME6555
CHA213M
CHA89
CHA510
Wild type
⌬algU
Plac-algU⫹mucA⫹
⌬mucA
gacA::⍀-Km
gacS::Tn5
␤-Galactosidase activity (Miller units)b
Without stress
174
104
275
268
147
151
b
c
a
a
b
b
0.6 M NaCl
448
77
683
694
381
379
Induction factorc
1.2 M Sorbitol
NaCl
Sorbitol
469 b
124 b
657 a
ND
ND
ND
2.6
0.7
2.5
2.6
2.6
2.5
2.7
1.2
2.4
ND
ND
ND
b
c
a
a
b
b
a
All bacterial strains carried the reporter construct pME6222 containing an algU‘-’lacZ fusion.
The initial bacterial cell concentration was adjusted to an OD600 of 0.05, and cells were grown for 12 h at 30°C in KMB broth with no supplement or amended with
0.6 M NaCl or 1.2 M sorbitol. The data are means based on three experiments, and three replicate cultures were used for each experiment. Values in the same column
followed by different letters are significantly different at P ⫽ 0.05 (Student’s t test). ND, not determined.
c
Expression of algU⬘-⬘lacZ in a bacterial strain grown in the presence of a stress relative to expression of the reporter construct in the absence of the stress.
b
2B). Similar results were obtained when an osmotically equivalent concentration of sorbitol (1.2 M) was added to the
growth medium (Table 3). Overexpression of algU from
pME6555 or the lack of mucA in strain CHA213M led to
expression of the algU⬘-⬘lacZ reporter that was significantly
greater than the expression in the wild type in the nonsupplemented medium (Table 3). Expression of algU⬘-⬘lacZ was further enhanced by exposure to osmotic stress (Table 3). In
summary, algU expression in P. fluorescens is induced in response to osmotic stress, and moreover, as in P. aeruginosa (12,
22, 56, 69), AlgU in P. fluorescens positively regulates its own
expression.
In P. fluorescens CHA0 a conserved two-component regulatory system consisting of the sensor kinase GacS and the cognate response regulator GacA globally controls the biosynthesis of a range of extracellular products, including antimicrobial
compounds and exoenzymes (20, 29). EPS is another exoproduct of strain CHA0 controlled by the GacS-GacA system,
as disruption of the gacA gene in mucoid mucA mutant
CHA213M.gacA made the strain nonmucoid and reduced the
levels of EPS production to the levels in the wild type or gacA
mutant CHA89 (Table 2). GacS-GacA also regulates alginate
production in P. syringae (67), Pseudomonas viridiflava (30),
and A. vinelandii (9). In P. fluorescens, algU expression in gacA
or gacS mutants was not significantly different from algU expression in the wild type in the absence or presence of osmotic
stress (Table 3), indicating that GacS-GacA control of EPS
production is not exerted via the sigma factor AlgU.
AlgU is required for tolerance of P. fluorescens towards osmotic stress. We next tested how different levels of algU ex-
pression affect growth and survival of P. fluorescens in response
to osmotic stress. To do this, the doubling times of strain
CHA0 and mutant derivatives of this strain were determined
during exponential growth of the bacteria in KMB supplemented with different concentrations of NaCl or sorbitol. The
algU mutant CHA212 was significantly more sensitive to osmotic stress (0.6 or 0.8 M NaCl, 1.2 or 1.6 M sorbitol) than the
wild type and the algU mutant complemented with pME6221
(Table 4). After 24 h of incubation, the numbers of CFU
obtained from NaCl-stressed cultures of the algU mutant were
about 10 to 30 times lower than the numbers of CFU obtained
from cultures of the wild type and the complemented mutant
exposed to the same stress (data not shown). Constitutive
expression of algU from the lac promoter in CHA0/pME6555
made the strain hypersensitive to osmotic stress instead of
protecting it (Table 4). Since high levels of AlgU may be toxic
to bacterial cells (22, 55), this may have accounted for the
increased sensitivity of strain CHA0/pME6555 under stress
conditions. Mutant CHA213M lacking the anti-sigma factor
MucA exhibited stress tolerance similar to that of the wild type
(Table 4). Analogous results were obtained when bacterial
strains were exposed to 1.0 M NaCl (data not shown). None of
the strains tested was able to grow in medium supplemented
with 1.2 M NaCl. In conclusion, AlgU is essential for adaptation of P. fluorescens to osmotic stress, but tolerance towards
this stress apparently cannot be improved by overexpression of
AlgU.
AlgU is essential for tolerance of P. fluorescens towards desiccation stress in vitro and in soil microcosms. To investigate
whether AlgU contributes to tolerance of P. fluorescens to-
TABLE 4. Effect of osmotic stress on the growth of P. fluorescens CHA0 and derivatives of this strain
Straina
Genotype
CHA0
CHA212
CHA212/pME6221
CHA0/pME6555
CHA213M
CHA213M/pME6219
Wild type
⌬algU
⌬algU/algU⫹
Plac-algU⫹mucA⫹
⌬mucA
⌬mucA/mucA⫹
a
Doubling time (h)b
Without stress
0.72
0.72
0.72
0.73
0.75
0.73
a
a
a
a
a
a
0.6 M NaCl
1.63
2.01
1.71
2.53
1.73
1.72
c
b
c
a
c
c
0.8 M NaCl
3.75
7.83
3.97
6.23
4.03
3.79
c
a
c
b
c
c
1.2 M Sorbitol
1.6 M Sorbitol
1.88 b
2.82 a
1.92 b
1.94 b
ND
ND
3.05 b
NGc
3.72 b
5.59 a
ND
ND
Bacteria were grown at 30°C in KMB broth with and without NaCl or sorbitol.
Doubling time was calculated from OD600 values determined during the exponential growth phase (six to eight measurements). During this time the relationship
of OD600 values to CFU counts was linear (data not shown). The data are means based on three independent experiments, and three replicate cultures were used for
each experiment. Values in the same column followed by different letters are significantly different at P ⫽ 0.05 (Student’s t test). ND, not determined.
c
NG, no measurable growth during 48 h.
b
5690
SCHNIDER-KEEL ET AL.
APPL. ENVIRON. MICROBIOL.
FIG. 3. Survival of P. fluorescens. Strain CHA0 (wild type) (F) and its derivatives CHA212 (⌬algU) (E), CHA212/pME6010⌬B (⌬algU/⫺) (‚),
and CHA212/pME6221 (⌬algU/algU⫹) (Œ) were included in a desiccating sterile artificial soil consisting of a mixture of quartz sand and vermiculite
(A) and in a desiccating natural sandy loam soil (B). For microcosms containing natural soil, rifampin-resistant derivatives of the bacterial strains
were used as inoculants. The soil water content ( ) at different times is shown only for the treatment with wild-type strain CHA0 since it did not
vary among the different treatments. In the artificial soil, water contents of 15, 10, 5, 1, and 0.5% corresponded to soil ⌿W of about ⫺0.01, ⫺0.03,
⫺0.5, ⫺2.7, and ⫺40 MPa, respectively. In the natural soil, water contents of 20, 15, 10, and 1% corresponded to ⌿W of about ⫺0.03, ⫺1.5, ⫺3.0,
and ⫺9.5 MPa, respectively. The data are means ⫾ standard deviations based on three experiments. Some of the error bars were too small to be
included.
wards desiccation stress, strain CHA0 and algU and mucA
mutants of this strain were exposed to desiccation stress under
various conditions. In the first series of experiments, bacterial
colonies grown on filter disks were slowly desiccated for 24 h or
were kept at a constant humidity (see Materials and Methods).
The numbers of CFU obtained from desiccated colonies of
wild-type strain CHA0 were 7% of the numbers of CFU obtained from nondesiccated control colonies. The algU mutant
CHA212 did not survive this treatment (⬍0.1% survival).
Complementation of strain CHA212 with algU⫹ plasmid
pME6221 restored survival to wild-type levels (9%). mucA
mutant CHA213M had a wild-type level of survival (8%), suggesting that a lack of AlgU inhibition and enhanced EPS production do not improve survival in response to desiccation
stress.
In a second series of experiments, the contribution of AlgU
to the stress tolerance of P. fluorescens was examined in desiccating artificial and natural soil microcosms. The population
dynamics of wild-type strain CHA0 and mutants of this strain
were monitored for several weeks and were related to the
decrease in the soil water content. In a sterile mixture of
vermiculite and quartz sand that mimicked formulation conditions, the sizes of the populations of all bacterial strains started
to decline at soil water contents below 5% (Fig. 3A), which
corresponded to a soil ⌿W of about ⫺0.5 MPa. The decline in
the size of the population was much more rapid for algU
mutant CHA212, and the number of CFU per gram (dry
weight) of soil was up to 4 log units lower than the value
obtained for the wild type 10 days after bacteria were added to
the soil (Fig. 3A). From day 15, no cultivable cells of the algU
mutant were recovered from the soil (Fig. 3A). In contrast,
wild-type strain CHA0 was detected for up to 60 days after
inoculation (Fig. 3A; data not shown). Interestingly, strain
CHA212 complemented with intact algU carried by pME6221
appeared to be slightly more tolerant towards desiccation
stress than the wild type, whereas introduction of cloning vector pME6010⌬B alone had no effect on the sensitivity to stress
(Fig. 3A). No significant differences among the strains tested
were observed in control experiments in which the water content of the vermiculite-sand mixture was kept constant at 15%.
Under these conditions, the bacterial population densities remained stable at about 0.6 ⫻ 107 to 1.1 ⫻ 107 CFU/g (dry
weight) of soil throughout the 6-week experiment.
Similar results were obtained when strain CHA0 and algU
mutant CHA212 were exposed to desiccation stress in a natural, nonsterile, sandy loam soil (Fig. 3B). For this experiment,
the rifampin-resistant derivatives CHA0-Rif and CHA212-Rif
(Table 1) were used. These derivatives were indistinguishable
from their parent strains in terms of growth, EPS production,
and tolerance towards osmotic stress and desiccation on filter
disks (data not shown). The natural soil had a better water
retention capacity than the artificial soil, which resulted in a
lower desiccation rate and, consequently, in less rapid declines
in the sizes of the bacterial populations (Fig. 3B). However, as
soon as the soil water content dropped below a critical level,
about 5% (i.e., a ⌿W of about ⫺4.9 MPa), the algU mutant
again was significantly more sensitive to desiccation stress than
the wild type or the complemented mutant (Fig. 3B). In natural soil kept at a constant moisture level, the sizes of the
populations of all bacterial strains remained at equally high
levels, and there was a slight decline from 107 to 106 CFU/g
(dry weight) of soil until the end of the 30-day experiment.
Taken together, these results demonstrate that the sigma factor AlgU is a crucial determinant in the adaptation of P.
fluorescens to desiccation stress.
AlgU is not required for tolerance of P. fluorescens towards
ROIs and heat. AlgU contributes to the tolerance of the pathogens P. aeruginosa and P. syringae towards certain agents that
generate ROIs and towards heat (26, 32). To determine
whether inactivation of algU or mucA affected the susceptibility of P. fluorescens to ROIs, wild-type strain CHA0, algU
mutant CHA212, and mucA mutant CHA213M were exposed
to 1.9% (wt/vol) paraquat, 3% (vol/vol) hydrogen peroxide, or
5% (vol/vol) sodium hypochlorite. Table 5 shows that both
mutants displayed wild-type susceptibility to these agents.
Additional experiments in which the concentrations of the
AlgU OF P. FLUORESCENS
VOL. 67, 2001
TABLE 5. Sensitivity to killing by ROIs in algU and mucA
mutants of P. fluorescens and P. aeruginosa
Strain
P. fluorescens strains
CHA0
CHA212
CHA213M
P. aeruginosa strains
PAO1
PAO6852
PAO568
Characteristics
Mean diam of growth
inhibition zone (mm) with:
Paraquat
(1.9%)
H2O2
(3%)
NaOCl
(5%)
Nonmucoid, wild type
Nonmucoid, ⌬algU
Mucoid, ⌬mucA
18.0 a
17.0 a
19.0 a
12.0 a
12.0 a
12.5 a
6.5 a
6.5 a
6.5 a
Nonmucoid, wild type
Nonmucoid, algU::Tcr
Mucoid, mucA2
14.0 y
22.0 x
14.0 y
7.5 x
9.5 x
9.0 x
7.0 x
8.5 x
8.0 x
a
Sensitivities to paraquat, H2O2, and NaOCl are expressed as the diameters of
the growth inhibition zones surrounding filter disks impregnated with 10-␮l
portions of the agents. The data are means based on three replicates. Values in
the same column followed by different letters (a for P. fluorescens, x and y for
P. aeruginosa) are significantly different at P ⫽ 0.05 (Student’s t test).
ROI-generating agents were increased up to 10-fold gave analogous results (data not shown). In contrast, an algU mutant
(PAO6852) of P. aeruginosa, which was included as a control in
the same experiment, was significantly more sensitive to paraquat, but not to H2O2 and NaOCl, than wild-type strain PAO1
and mucoid strain PAO568 were (Table 5), confirming previous data of Martin et al. (32). A series of experiments was then
performed to evaluate the role of AlgU in tolerance of P.
fluorescens towards heat killing. Exponential-growth-phase cultures of strain CHA0 and algU mutant CHA212 were exposed
to 42 or 48°C for 5 to 90 min. However, in none of the experiments was there a significant difference in viability between
the wild type and the algU mutant (data not shown). In an
experiment in which we screened for additional factors that
may involve the AlgU-mediated stress response, we found no
differences in the tolerance of strain CHA0 and its algU mutant
towards a series of other stresses, including exposure to the
strong reducing agent dithiothreitol (8 mM), which triggers
RpoE function in E. coli (44), exposure to a range of antibiotics, and exposure to pH extremes (data not shown). In summary, these results suggest that AlgU is not required for tolerance towards ROIs and heat in P. fluorescens, in marked
contrast to the role of this sigma factor in P. aeruginosa, P. syringae, and E. coli.
DISCUSSION
In the present study, we identified the algU-mucA-mucB
gene cluster in the plant-beneficial strain P. fluorescens CHA0;
this gene arrangement is conserved in P. aeruginosa (12, 31, 33)
and P. syringae (26). In P. aeruginosa, the algU, mucA, and
mucB genes are cotranscribed and encode (respectively) the
sigma factor AlgU and its main negative regulators, MucA and
MucB, which act in concert to control production of the EPS
alginate and the response to extreme environmental stress (19,
32, 50, 54, 57, 70). In P. syringae, AlgU is also a major determinant in the regulation of alginate biosynthesis and stress
response (26). Here, we provide evidence that on the one
hand, AlgU of P. fluorescens is functionally equivalent to its
counterparts in pathogenic pseudomonads with respect to control of EPS production. On the other hand, the role of AlgU in
5691
the stress response of P. fluorescens is distinct from its role in
the stress responses of other bacteria.
Regulation of EPS production. In P. fluorescens CHA0, EPS
production was regulated by at least four mechanisms. First,
the level of algU expression was important. This was seen most
clearly in a strain with moderate algU overexpression, CHA0/
pME6220, which overproduced EPS (Table 2). The level of
algU expression is determined by AlgU itself: expression of an
algU⬘-⬘lacZ reporter was about 40% lower in an algU mutant
than in wild-type strain CHA0 (Fig. 2A; Table 3). AlgU autoregulation has also been described for P. aeruginosa (12, 22).
The algU promoter region in P. fluorescens CHA0 was found to
contain two putative AlgU/RpoE recognition sequences. In P.
aeruginosa, the corresponding promoters are designated P1
and P3, and they are absolutely dependent on AlgU (56).
Second, the anti-sigma factor MucA made a major contribution to EPS production. Without MucA the EPS levels were
100-fold higher than those in a MucA⫹ background (Table 2).
In contrast, the (indirect) effect of MucA on algU transcription
was relatively small (Table 3). Third, the GacS-GacA twocomponent system was essential to sustain high EPS productivity in a mucA mutant (Table 2). This positive effect of the
transcriptional regulator GacA was not mediated by AlgU (Table 3). Fourth, the hypermucoid phenotype of strains CHA211
(mucA::Tn5) and CHA0/pME6555 (Plac-algU⫹mucA⫹) points
to negative AlgU control by MucB, as in P. aeruginosa (36, 50).
Role of AlgU in tolerance towards environmental stress.
Little is known about the regulatory mechanisms that determine adaptation of plant-beneficial pseudomonads to environmental stress. The present study established that AlgU is a
second sigma factor, in addition to RpoS (52), involved in the
response of P. fluorescens to extreme environmental stress. Our
work shows, for the first time, that AlgU is a key determinant
in the tolerance of P. fluorescens towards desiccation stress,
since the survival of an algU mutant was severely impaired
when the organism was exposed to desiccation in vitro, in a
vermiculite-sand mixture mimicking formulation conditions,
and in natural soil (Fig. 3). Furthermore, this sigma factor was
important in the adaptation of P. fluorescens to high-osmolarity
conditions (Table 4), and high concentrations of NaCl or sorbitol stimulated algU expression in both P. fluorescens (Table 3;
Fig. 2) and P. syringae (26). Since plant-associated pseudomonads may be exposed to dry and osmotically harsh conditions in the rhizosphere and in the phyllosphere, the capacity
to adapt to these conditions is likely to be important for colonization of these plant surfaces (26, 42, 63).
High osmolarity and ethanol (as a dehydrating agent) enhance transcription of alginate biosynthesis genes in P. aeruginosa (1, 11, 14, 71) and P. syringae (48). Osmotic stress and
dehydration stress also stimulate, to a limited extent, alginate
production in P. syringae and certain P. fluorescens strains (49,
58). However, exposure of nonmucoid P. aeruginosa (1, 56) or
P. fluorescens CHA0 (unpublished data) to osmotic stress does
not fully induce EPS synthesis, indicating that other environmental factors and cellular regulators are required for full
activation of the EPS biosynthesis genes. Remarkably, the
highly mucoid, algU-overexpressing or mucA mutants of P.
fluorescens CHA0 did not display improved tolerance towards
osmotic stress (Table 4) and desiccation in vitro and in soil
microcosms (Table 5; unpublished data). This might argue
5692
SCHNIDER-KEEL ET AL.
against a protective role for EPS in P. fluorescens CHA0. Nevertheless, we cannot rule out the possibility that the soil conditions used were not conducive to enhanced EPS production
by the mucoid variants. In this context it is noteworthy that
mucoid mutants of P. fluorescens CHA0 have exhibited an
improved ability to form biofilms on roots (2). However, it is
also possible that the (low) wild-type level of EPS production
was already sufficient for maximum EPS-mediated stress protection of the bacterium and that stress defense may not be
further optimized by EPS overproduction.
At present, it is difficult to explain the fact that the algUoverexpressing mutants (i.e., CHA213M and CHA0/pME6555)
(Table 3) failed to be more stress tolerant than wild-type strain
CHA0, as we expected these mutants to overexpress defenserelated functions in addition to EPS overproduction. One possibility is that AlgU acts as an on-off switch which, when activated, drives the expression of stress defense-related genes.
This system may operate until a certain level of saturation of
available active AlgU is reached; beyond this level, AlgU may
even become toxic to the cell.
Interestingly, an algU mutant of P. fluorescens CHA0 was not
hypersensitive to a high temperature (48°C) (data not shown)
or paraquat, H2O2, and NaClO (Table 5). This contrasts with
the demonstrated involvement of AlgU in tolerance towards
these stresses in P. aeruginosa (32, 54, 56, 70) and in P. syringae
(26). Activation of algU by ROIs may help these pathogens
withstand the oxidative burst associated with host defense responses (19, 26). This AlgU-mediated mechanism may not be
required in the nonpathogenic strain P. fluorescens CHA0, as
this bacterium may not be critically exposed to the plant defense response. Alternatively, the sigma factor RpoS, which is
required for tolerance towards oxidative stress in the closely
related plant-beneficial bacterium P. fluorescens Pf-5 (52),
might ensure protection of strain CHA0 from plant ROIs.
ACKNOWLEDGMENTS
We gratefully acknowledge financial support from the Swiss Federal
Office for Education and Science (project C99.0032, COST action
830) and the Swiss Priority Program Biotechnology (project 500204502311).
We thank Patrick Michaux for help with some of the experiments.
We are grateful to Stephan Heeb, Cécile Gigot-Bonnefoy, and Cornelia Reimmann for advice and to Fabio Mascher for help with determining the soil ␺W.
REFERENCES
1. Berry, A., J. D. DeVault, and A. M. Chakrabarty. 1989. High osmolarity is a
signal for enhanced algD transcription in mucoid and nonmucoid Pseudomonas aeruginosa strains. J. Bacteriol. 171:2312–2317.
2. Bianciotto, V., S. Andreotti, R. Balestrini, P. Bonfante, and S. Perotto. 2001.
Mucoid mutants of the biocontrol strain Pseudomonas fluorescens CHA0
show increased ability in biofilm formation on mycorrhizal and nonmycorrhizal carrot roots. Mol. Plant-Microbe Interact. 14:255–260.
3. Bloemberg, G. V., and B. J. J. Lugtenberg. 2001. Molecular basis of plant
growth promotion and biocontrol by rhizobacteria. Curr. Opin. Plant Biol.
4:343–350.
4. Boucher, J. C., H. Yu, H. Mudd, and V. Deretic. 1997. Mucoid Pseudomonas
aeruginosa in cystic fibrosis: characterization of muc mutations in clinical
isolates and analysis of clearance in a mouse model of respiratory infection.
Infect. Immun. 65:3838–3846.
5. Boucher, J. C., J. Martinez-Salazar, M. J. Schurr, M. H. Mudd, H. Yu, and
V. Deretic. 1996. Two distinct loci affecting conversion to mucoidy in Pseudomonas aeruginosa in cystic fibrosis encode homologs of the serine protease
HtrA. J. Bacteriol. 178:511–523.
6. Boucher, J. C., M. J. Schurr, H. Yu, D. W. Rowen, and V. Deretic. 1997.
Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of
alginate production and stress sensitivity. Microbiology 143:3473–3480.
APPL. ENVIRON. MICROBIOL.
7. Boulnois, G. J., J. M. Varley, G. S. Sharpe, and F. C. H. Franklin. 1985.
Transposon donor plasmids, based on ColIb-P9, for use in Pseudomonas
putida and a variety of other gram negative bacteria. Mol. Gen. Genet.
200:65–67.
8. Bull, C. T., B. Duffy, C. Voisard, G. Défago, C. Keel, and D. Haas. 2001.
Characterization of spontaneous gacS and gacA regulatory mutants of
Pseudomonas fluorescens biocontrol strain CHA0. Antonie Leeuwenhoek
79:327–336.
9. Castañeda, M., J. Guzmán, S. Moreno, and G. Espı́n. 2000. The GacS sensor
kinase regulates alginate and poly-␤-hydroxybutyrate production in Azotobacter vinelandii. J. Bacteriol. 182:2624–2628.
10. Del Sal, G., G. Manfioletti, and C. Schneider. 1988. A one-tube plasmid
DNA mini-preparation suitable for sequencing. Nucleic Acids Res. 16:9878.
11. DeVault, J. D., K. Kimbara, and A. M. Chakrabarty. 1990. Pulmonary
dehydration and infection in cystic fibrosis: evidence that ethanol activates
alginate gene expression and induction of mucoidy in Pseudomonas aeruginosa. Mol. Microbiol. 4:737–745.
12. DeVries, C. A., and D. E. Ohman. 1994. Mucoid-to-nonmucoid conversion in
alginate-producing Pseudomonas aeruginosa often results from spontaneous
mutations in algT, encoding a putative alternative sigma factor, and shows
evidence of autoregulation. J. Bacteriol. 176:6677–6687.
13. Dubois, M., K. A. Gilles, J. K. Hamilton, P. A. Rebers, and F. Smith. 1956.
Colorimetric method for determination of sugars and related substances.
Anal. Chem. 28:350–356.
14. Edwards, K. J., and N. A. Saunders. 2001. Real-time PCR used to measure
stress-induced changes in the expression of the genes of the alginate pathway
of Pseudomonas aeruginosa. J. Appl. Microbiol. 91:29–37.
15. Farinha, M. A., and A. M. Kropinski. 1990. High efficiency electroporation
of Pseudomonas aeruginosa using frozen cell suspensions. FEMS Microbiol.
Lett. 70:221–226.
16. Fett, W. F., J. M. Wells, P. Cescutti, and C. Wijey. 1995. Identification of
exopolysaccharides produced by fluorescent pseudomonads associated with
commercial mushroom (Agaricus bisporus) production. Appl. Environ. Microbiol. 61:513–517.
17. Fett, W. F., S. F. Osman, M. L. Fisman, and T. S. Siebles III. 1986. Alginate
production by plant-pathogenic pseudomonads. Appl. Environ. Microbiol.
52:466–473.
18. Gacesa, P. 1998. Bacterial alginate biosynthesis—recent progress and future
prospects. Microbiology 144:1133–1143.
19. Govan, J., and V. Deretic. 1996. Microbial pathogenesis in cystic fibrosis:
mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol. Rev.
60:539–574.
20. Haas, D., C. Blumer, and C. Keel. 2000. Biocontrol ability of fluorescent
pseudomonads genetically dissected: importance of positive feedback regulation. Curr. Opin. Biotechnol. 11:290–297.
21. Heeb, S., Y. Itoh, T. Nishijyo, U. Schnider, C. Keel, J. Wade, U. Walsh, F.
O’Gara, and D. Haas. 2000. Small, stable shuttle vectors based on the
minimal pVS1 replicon for use in gram-negative, plant-associated bacteria.
Mol. Plant-Microbe Interact. 13:232–237.
22. Hershberger, C. D., R. W. Ye, M. R. Parsek, Z. D. Xie, and A. M.
Chakrabarty. 1995. The algT (algU) gene of Pseudomonas aeruginosa, a key
regulator involved in alginate biosynthesis, encodes an alternative ␴ factor
(␴E). Proc. Natl. Acad. Sci. USA 92:7941–7945.
23. Jørgensen, F., M. Bally, V. Chapon-Herve, G. Michel, A. Lazdunski, P.
Williams, and G. S. A. B. Stewart. 1999. RpoS-dependent stress tolerance in
Pseudomonas aeruginosa. Microbiology 145:835–844.
24. Keel, C., and G. Défago. 1997. Interactions between beneficial soil bacteria
and root pathogens: mechanisms and ecological impact, p. 27–46. In A. C.
Gange and V. K. Brown (ed.), Multitrophic interactions in terrestrial systems. Blackwell Science, London, United Kingdom.
25. Keel, C., C. Voisard, C.-H. Berling, G. Kahr, and G. Défago. 1989. Iron
sufficiency, a prerequisite for suppression of tobacco black root rot by
Pseudomonas fluorescens strain CHA0 under gnotobiotic conditions. Phytopathology 79:584–589.
26. Keith, L. M. W., and C. L. Bender. 1999. AlgT (␴22) controls alginate
production and tolerance to environmental stress in Pseudomonas syringae.
J. Bacteriol. 181:7176–7184.
27. King, E. O., M. K. Ward, and D. E. Raney. 1954. Two simple media for the
demonstration of pyocyanin and fluorescein. J. Lab. Clin. Med. 44:301–307.
28. Labes, M., A. Pühler, and R. Simon. 1990. A new family of RSF1010-derived
expression and lac-fusion broad-host-range vectors for Gram-negative bacteria. Gene 89:37–46.
29. Laville, J., C. Voisard, C. Keel, M. Maurhofer, G. Défago, and D. Haas. 1992.
Global, stationary-phase control in Pseudomonas fluorescens mediating antibiotic synthesis and suppression of black root rot of tobacco. Proc. Natl.
Acad. Sci. USA 89:1562–1566.
30. Liao, C. H., D. E. McCallus, and W. F. Fett. 1994. Molecular characterization
of two gene loci required for production of the key pathogenicity factor
pectate lyase in Pseudomonas viridiflava. Mol. Plant-Microbe Interact. 7:391–
400.
31. Martin, D. W., B. W. Holloway, and V. Deretic. 1993. Characterization of a
locus determining the mucoid status of Pseudomonas aeruginosa: algU shows
AlgU OF P. FLUORESCENS
VOL. 67, 2001
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
sequence similarities with a Bacillus sigma factor. J. Bacteriol. 175:1153–
1164.
Martin, D. W., M. J. Schurr, H. Yu, and V. Deretic. 1994. Analysis of
promoters controlled by the putative sigma factor AlgU regulating conversion to mucoidy in Pseudomonas aeruginosa: relationship to ␴E and stress
response. J. Bacteriol. 176:6688–6696.
Martin, D. W., M. J. Schurr, M. H. Mudd, and V. Deretic. 1993. Differentiation of Pseudomonas aeruginosa into the alginate-producing form: inactivation of mucB causes conversion to mucoidy. Mol. Microbiol. 9:497–506.
Martin, D. W., M. J. Schurr, M. H. Mudd, J. R. Govan, B. W. Holloway, and
V. Deretic. 1993. Mechanism of conversion to mucoidy in Pseudomonas
aeruginosa infecting cystic fibrosis patients. Proc. Natl. Acad. Sci. USA 90:
8377–8381.
Martı́nez-Salazar, J. M., S. Moreno, R. Nájera, J. C. Boucher, G. Espı́n, G.
Soberón-Chávez, and V. Deretic. 1996. Characterization of the genes coding
for the putative sigma factor AlgU and its regulators MucA, MucB, MucC,
and MucD in Azotobacter vinelandii and evaluation of their roles in alginate
biosynthesis. J. Bacteriol. 178:1800–1808.
Mathee, K., C. J. McPherson, and D. E. Ohman. 1997. Posttranslational
control of the algT (algU)-encoded ␴22 for expression of the alginate regulon
in Pseudomonas aeruginosa and localization of its antagonist proteins MucA
and MucB (AlgN). J. Bacteriol. 179:3711–3720.
Maurhofer, M., C. Keel, D. Haas, and G. Défago. 1994. Pyoluteorin production by Pseudomonas fluorescens strain CHA0 is involved in the suppression
of Pythium damping-off of cress but not of cucumber. Eur. J. Plant Pathol.
100:221–232.
Maurhofer, M., C. Reimmann, P. Schmidli-Sacherer, S. Heeb, D. Haas, and
G. Défago. 1998. Salicylic acid biosynthetic genes expressed in Pseudomonas
fluorescens strain P3 improve the induction of systemic resistance in tobacco
against tobacco necrosis virus. Phytopathology 88:678–684.
May, T. B., and A. M. Chakrabarty. 1994. Isolation and assay of Pseudomonas aeruginosa alginate. Methods Enzymol. 235:295–304.
McComb, E. A., and R. M. McCready. 1957. Determination of acetyl in
pectin and in acetylated carbohydrate polymers. Hydroxamic acid reaction.
Anal. Chem. 29:819–821.
McInnes, K. J., R. W. Weaver, and M. J. Savage. 1994. Soil water potential,
p. 53–58. In S. H. Mickelson (ed.), Methods of soil analysis, part 2. Soil
Science Society of America, Madison, Wis.
Miller, K. J., and J. M. Wood. 1996. Osmoadaptation by rhizosphere bacteria. Annu. Rev. Microbiol. 50:101–136.
Minton, N. P. 1984. Improved plasmid vectors for the isolation of translational lacZ fusions. Gene 31:269–273.
Missiakas, D., and S. Raina. 1998. The extracytoplasmic function sigma
factors: role and regulation. Mol. Microbiol. 28:1059–1066.
Natsch, A., C. Keel, H. A. Pfirter, D. Haas, and G. Défago. 1994. Contribution of the global regulator gene gacA to persistence and dissemination of
Pseudomonas fluorescens biocontrol strain CHA0 introduced into soil microcosms. Appl. Environ. Microbiol. 60:2553–2560.
Ophir, T., and D. L. Gutnick. 1994. A role for exopolysaccharides in the
protection of microorganisms from desiccation. Appl. Environ. Microbiol.
60:740–745.
Pedersen, S. S., F. Espersen, N. Høiby, and G. H. Shand. 1989. Purification,
characterization, and immunological cross-reactivity of alginates produced
by mucoid Pseudomonas aeruginosa from patients with cystic fibrosis. J. Clin.
Microbiol. 27:691–699.
Peñaloza-Vàzquez, A., S. P. Kidambi, A. M. Chakrabarty, and C. L. Bender.
1997. Characterization of the alginate biosynthetic gene cluster in Pseudomonas syringae pv. syringae. J. Bacteriol. 179:4464–4472.
Roberson, E. B., and M. K. Firestone. 1992. Relationship between desiccation and exopolysaccharide production in a soil Pseudomonas sp. Appl.
Environ. Microbiol. 58:1284–1291.
Rowen, D. W., and V. Deretic. 2000. Membrane-to-cytosol redistribution of
ECF sigma factor AlgU and conversion to mucoidy in Pseudomonas aeruginosa isolates from cystic fibrosis patients. Mol. Microbiol. 36:314–327.
Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, N.Y.
Sarniguet, A., J. Kraus, M. D. Henkels, A. M. Muehlchen, and J. E. Loper.
1995. The sigma factor ␴S affects antibiotic production and biological control
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
5693
activity of Pseudomonas fluorescens Pf-5. Proc. Natl. Acad. Sci. USA 92:
12255–12259.
Schnider, U., C. Keel, C. Voisard, G. Defago, and D. Haas. 1995. Tn5directed cloning of pqq genes from Pseudomonas fluorescens CHA0: mutational inactivation of the genes results in overproduction of the antibiotic
pyoluteorin. Appl. Environ. Microbiol. 61:3856–3864.
Schurr, M. J., and V. Deretic. 1997. Microbial pathogenesis in cystic fibrosis:
co-ordinate regulation of heat-shock response and conversion to mucoidy in
Pseudomonas aeruginosa. Mol. Microbiol. 24:411–420.
Schurr, M. J., D. W. Martin, M. H. Mudd, and V. Deretic. 1994. Gene cluster
controlling conversion to alginate-overproducing phenotype in Pseudomonas
aeruginosa: functional analysis in a heterologous host and role in the instability of mucoidy. J. Bacteriol. 176:3375–3382.
Schurr, M. J., H. Yu, J. C. Boucher, N. S. Hibler, and V. Deretic. 1995.
Multiple promoters and induction by heat shock of the gene encoding the
alternative sigma factor AlgU (␴E) which controls mucoidy in cystic fibrosis
isolates of Pseudomonas aeruginosa. J. Bacteriol. 177:5670–5679.
Schurr, M. J., H. Yu, J. M. Martinez-Salazar, J. C. Boucher, and V. Deretic.
1996. Control of AlgU, a member of the ␴E-like family of stress sigma
factors, by the negative regulators MucA and MucB and Pseudomonas
aeruginosa conversion to mucoidy in cystic fibrosis. J. Bacteriol. 178:4997–
5004.
Singh, S., B. Koehler, and W. Fett. 1992. Effect of osmolarity and dehydration on alginate production by fluorescent pseudomonads. Curr. Microbiol.
25:335–339.
Stanisich, V. A., and B. W. Holloway. 1972. A mutant sex factor of Pseudomonas aeruginosa. Genet. Res. 19:91–108.
Storz, G., and R. Hengge-Aronis. 2000. Bacterial stress responses. ASM
Press, Washington, D.C.
Suh, S. J., L. Siloh-Suh, D. E. Woods, D. J. Hassett, S. E. H. West, and D. E.
Ohman. 1999. Effect of rpoS mutation on the stress response and expression
of virulence factors in Pseudomonas aeruginosa. J. Bacteriol. 181:3890–3897.
Thomashow, L. S., and D. M. Weller. 1995. Current concepts in the use of
introduced bacteria for biological disease control, p. 187–235. In G. Stacey
and N. Keen (ed.), Plant-microbe interactions, vol. 1. Chapman & Hall, New
York, N.Y.
Van Veen, J. A., L. S. Van Overbeek, and J. D. Van Elsas. 1997. Fate and
activity of microorganisms introduced into soil. Microbiol. Mol. Biol. Rev.
61:121–135.
Vieira, J., and J. Messing. 1991. New pUC-derived cloning vectors with
different selectable markers and DNA replication origins. Gene 100:189–
194.
Voisard, C., C. Bull, C. Keel, J. Laville, M. Maurhofer, U. Schnider, G.
Défago, and D. Haas. 1994. Biocontrol of root diseases by Pseudomonas
fluorescens CHA0: current concepts and experimental approaches, p. 67–89.
In F. O’Gara, D. Dowling, and B. Boesten (ed.), Molecular ecology of
rhizosphere microorganisms. VCH Publishers, Weinheim, Germany.
Voisard, C., M. Rella, and D. Haas. 1988. Conjugative transfer of plasmid
RP1 to soil isolates of Pseudomonas fluorescens is facilitated by certain large
RP1 deletions. FEMS Microbiol. Lett. 55:9–14.
Willis, D. K., J. J. Holmstadt, and T. G. Kinscherf. 2001. Genetic evidence
that loss of virulence associated with gacS or gacA mutations in Pseudomonas
syringae B728a does not result from effects on alginate production. Appl.
Environ. Microbiol. 67:1400–1403.
Wozniak, D. J., and D. E. Ohman. 1994. Transcriptional analysis of the
Pseudomonas aeruginosa genes algR, algB, and algD reveals a hierarchy of
alginate gene expression which is modulated by algT. J. Bacteriol. 176:6007–
6014.
Xie, Z., C. D. Hershberger, S. Shankar, R. W. Ye, and A. M. Chakrabarty.
1996. Sigma factor–anti-sigma factor interaction in alginate synthesis: inhibition of AlgT by MucA. J. Bacteriol. 178:4990–4996.
Yu, H., M. J. Schurr, and V. Deretic. 1995. Functional equivalence of Escherichia coli ␴E and Pseudomonas aeruginosa AlgU: E. coli rpoE restores
mucoidy and reduces sensitivity to reactive oxygen intermediates in algU
mutants of P. aeruginosa. J. Bacteriol. 177:3259–3268.
Zielinski, N. A., R. Maharaj, S. Roychoudhury, C. E. Danganan, W. Hendrickson, and A. M. Chakrabarty. 1992. Alginate synthesis in Pseudomonas
aeruginosa: environmental regulation of the algC promoter. J. Bacteriol.
174:7680–7688.
Manuscript V
5SR1V)FRQWUROVSURGXFWLRQRIDQWLIXQJDOFRPSRXQGVDQG
ELRFRQWURODFWLYLW\LQ3VHXGRPRQDVIOXRUHVFHQV&+$
M. Péchy-Tarr, M. Bottiglieri, S. Mathys, K.B. Lejbølle, U. Schnider-Keel,
M. Maurhofer, and C. Keel
Molecular Plant-Microbe Interactions 2005, 18, 260-272
This article is from the
March 2005 issue of
published by
The American Phytopathological Society
For more information on this and other topics
related to plant pathology,
we invite you to visit APSnet at
www.apsnet.org
MPMI Vol. 18, No. 3, 2005, pp. 260–272. DOI: 10.1094 / MPMI -18-0260. © 2005 The American Phytopathological Society
RpoN (σ54) Controls Production of
Antifungal Compounds and Biocontrol Activity in
Pseudomonas fluorescens CHA0
Maria Péchy-Tarr,1 Mélanie Bottiglieri,1 Sophie Mathys,1 Kirsten Bang Lejbølle,1 Ursula Schnider-Keel,1
Monika Maurhofer,2 and Christoph Keel1
1
Département de Microbiologie Fondamentale, Université de Lausanne, CH-1015 Lausanne, Switzerland; 2Institut für
Pflanzenwissenschaften/Phytopathologie, Eidgenössische Technische Hochschule (ETH), CH-8092 Zürich, Switzerland
Submitted 14 July 2004. Accepted 8 November 2004.
Pseudomonas fluorescens CHA0 is an effective biocontrol
agent of root diseases caused by fungal pathogens. The
strain produces the antibiotics 2,4-diacetylphloroglucinol
(DAPG) and pyoluteorin (PLT) that make essential contributions to pathogen suppression. This study focused on the
role of the sigma factor RpoN (σ54) in regulation of antibiotic production and biocontrol activity in P. fluorescens. An
rpoN in-frame-deletion mutant of CHA0 had a delayed
growth, was impaired in the utilization of several carbon
and nitrogen sources, and was more sensitive to salt stress.
The rpoN mutant was defective for flagella and displayed
drastically reduced swimming and swarming motilities. Interestingly, the rpoN mutant showed a severalfold enhanced
production of DAPG and expression of the biosynthetic
gene phlA compared with the wild type and the mutant
complemented with monocopy rpoN+. By contrast, loss of
RpoN function resulted in markedly lowered PLT production and plt gene expression, suggesting that RpoN controls
the balance of the two antibiotics in strain CHA0. In natural soil microcosms, the rpoN mutant was less effective in
protecting cucumber from a root rot caused by Pythium
ultimum. Remarkably, the mutant was not significantly impaired in its root colonization capacity, even at early stages
of root infection by Pythium spp. Taken together, our results
establish RpoN for the first time as a major regulator of
biocontrol activity in Pseudomonas fluorescens.
Additional keyword: rhizosphere.
Certain strains of fluorescent Pseudomonas spp. that are
closely associated with roots can protect crop plants from
soilborne diseases caused by pathogenic fungi, oomycetes,
and bacteria (Cook et al. 1995; Keel and Défago 1997). In
addition to their capacity to efficiently colonize plant roots,
Corresponding author: C. Keel; Telephone: +41 21 692 56 36; Fax: +41
21 692 56 05; E-mail: [email protected]
Current address of Kirsten Bang Lejbølle: Department of Environmental
Chemistry and Microbiology, The National Environmental Research
Institute, DK-4000 Roskilde, Denmark.
Current address of Sophie Mathys: Institut für Lebensmittel- und
Ernährungswissenschaften, Eidgenössische Technische Hochschule, CH8803 Rüschlikon, Switzerland.
Nucleotide and amino acid sequence data reported are available in the
GenBank and EMBL databases under accession numbers AY341911 and
AY459536.
260 / Molecular Plant-Microbe Interactions
the production of metabolites that are inhibitory to plantpathogenic rhizosphere inhabitants is considered to be one of
the principal backbones of biocontrol activity in many of
these bacteria (Haas and Keel 2003; Raaijmakers et al. 2002;
Thomashow and Weller 1995). 2,4-Diacetylphloroglucinol
(DAPG) and pyoluteorin (PLT) are two metabolites that have
received particular attention because of their broad-spectrum
antifungal and antibacterial activity (Haas and Keel 2003;
Keel et al. 1992; Maurhofer et al. 1992, 1995; Raaijmakers et
al. 2002; Thomashow and Weller 1995). Some effective biocontrol pseudomonads produce both DAPG and PLT (Keel et
al. 1996), among them the well-characterized Pseudomonas
fluorescens strain CHA0 (Haas and Keel 2003; Keel and Défago 1997; Voisard et al. 1994) and the very closely related P.
fluorescens strain Pf-5 (Howell and Stipanovic 1980; Kraus
and Loper 1995; Sarniguet et al. 1995). DAPG and PLT
make major contributions to biocontrol activity in these
strains. DAPG has been shown to contribute to the protection
of wheat from take-all disease (Keel et al. 1992) and of tobacco from black root rot (Keel et al. 1990), whereas PLT
has been associated mainly with the suppression of root rot
and damping-off diseases caused by Pythium spp. (Howell
and Stipanovic 1980; Kraus and Loper 1995; Maurhofer et
al. 1994).
The DAPG and PLT biosynthetic genes are organized as
clusters, probably operons, and have been identified in several
Pseudomonas strains (Haas et al. 2000; Haas and Keel 2003).
The DAPG locus comprises the phlACBD biosynthetic genes
and the divergently transcribed phlF gene located upstream of
phlA and encoding a pathway-specific transcriptional repressor
(Bangera and Thomashow 1999; Delany et al. 2000; SchniderKeel et al. 2000). The PLT biosynthetic genes pltLABCDEFG
are preceded by the divergently transcribed pltR gene, which
encodes a pathway-specific transcriptional activator (Haas and
Keel 2003; Nowak-Thompson et al. 1999). Remarkably, the
biosyntheses of both compounds, DAPG and PLT, are controlled
by positive autoregulatory circuits (Brodhagen et al. 2004;
Haas and Keel 2003; Schnider-Keel et al. 2000). There is evidence for a molecular cross-talk between the DAGP and PLT
biosynthetic pathways, inasmuch as the two metabolites were
found to display an inverse relationship in which each metabolite, besides activating its own biosynthesis, represses the synthesis of the other metabolite (Brodhagen et al. 2004; Haas
and Keel 2003; Schnider-Keel et al. 2000). In addition, levels
of DAPG and PLT production may be modulated by other
phenolic metabolites released by microorganisms and plant
roots in the rhizosphere as well as in response to certain min-
eral and carbon sources (Duffy and Défago 1999; Haas and
Keel 2003; Maurhofer et al. 2004; Notz et al. 2001; SchniderKeel et al. 2000).
In addition to the pathway-specific regulatory mechanisms,
a series of global regulatory networks that respond to environmental and cell density-dependent signals and probably also to
the physiological status of the bacterium contribute to the control of DAPG and PLT biosyntheses (Haas et al. 2000; Haas
and Keel 2003; Thomashow and Weller 1995). They include a
regulatory cascade controlled by a two-component system
composed of the sensor kinase GacS and the response regulator GacA that positively controls antibiotic biosynthesis upon
activation by a yet unidentified quorum sensing-signal (Haas
and Keel 2003; Valverde et al. 2003; Zuber et al. 2003). An
additional level of control may be provided by the relative concentrations of the housekeeping σ factor RpoD and the stress
and stationary phase σ factor RpoS in the bacterial cell. In P.
fluorescens CHA0, overexpression of the housekeeping σ factor RpoD enhances DAPG and PLT production in vitro and in
the rhizosphere, resulting in improved biocontrol or phytotoxic
effects depending on the plant species (Maurhofer et al. 1992,
1995; Schnider et al. 1995). Likewise, an rpoS mutant of the
related strain Pf-5 shows strongly enhanced PLT and DAPG
production (Sarniguet et al. 1995), whereas rpoS overexpression in strain CHA0 was found to shut off PLT production
(Haas and Keel 2003).
In recent years, the alternative σ factor RpoN (σ54) has
evolved as an important regulator of virulence in pathogenic
pseudomonads. RpoN works in concert with specialized transcriptional activators (enhancer-binding proteins) to control the
expression of genes coding for very diverse functions in response to environmental stimuli (Buck et al. 2000; Merrick
1993). Typical features that depend on RpoN function in pseudomonads and in a broad range of other bacteria include motility and diverse metabolic functions such as transport and metabolism of various nitrogen and carbon sources (Cases et al.
2003; Köhler et al. 1989; Reitzer and Schneider 2001; Studholme and Buck 2000). In the plant-pathogenic P. syringae
pvs. maculicola and glycinea, RpoN is required for the expression of the pathogenicity-related hrp genes, for the production
of the phytotoxin coronatine, and for full virulence on host
plants (Alarcón-Chaidez et al. 2003; Hendrickson et al.
2000a,b). Similarly, in the opportunistic human pathogen P.
aeruginosa, RpoN regulates the expression of a series of virulence factors, including flagella, pili, alginate, rhamnolipid
biosurfactants, exotoxins, cyanide, and pyocyanin, and contributes to virulence in certain animal models (Boucher et al.
2000; Hendrickson et al. 2001; Heurlier et al. 2003; Ishimoto
and Lory 1989; Studholme and Buck 2000; Thompson et al.
2003; Totten et al. 1990). Recent evidence suggests that the
RpoN regulon in pathogenic pseudomonads may be interlinked
with other regulatory networks, in particular those controlled
by the GacS/GacA two-component system, by quorum-sensing
systems, and by other σ factors, but the exact mechanisms
involved are not yet fully understood (Boucher et al. 2000;
Chatterjee et al. 2003; Hendrickson et al. 2000a; Heurlier et al.
2003; Thompson et al. 2003).
To our best knowledge, a regulatory role for RpoN in plantbeneficial pseudomonads has not been described so far. To
address this issue, we have cloned and sequenced the rpoN locus
from P. fluorescens CHA0. In the present study, we show that
an rpoN in-frame-deletion mutant of strain CHA0 displays
several phenotypes that typically are associated with loss of
RpoN function, including a drastically reduced motility and a
defect in the utilization of several nitrogen and carbon sources.
We report that rpoN mutation in strain CHA0 entails increased
sensitivity to salt stress but does not affect tolerance to oxidative
stress. Finally, we demonstrate that deletion of rpoN in CHA0
results in an altered expression of the antifungal compounds
DAPG and PLT and in a strongly reduced capacity to control
Pythium root rot of cucumber, thus providing the first evidence
that RpoN is a further key regulator of biocontrol activity in
plant-beneficial pseudomonads.
RESULTS
Characterization of the chromosome region
containing rpoN in P. fluorescens CHA0.
We cloned and sequenced a 2.2-kb chromosomal region in
P. fluorescens strain CHA0 containing rpoN and adjacent
genes (Fig. 1) in an arrangement identical to that described
for other Pseudomonas spp. (Alarcón-Chaidez and Bender
2001; Härtig and Zumft 1998; Jin et al. 1994; Köhler et al.
1994; Stover et al. 2000). The deduced product (497 amino
acids) of the rpoN gene of P. fluorescens CHA0 is very similar to σ factor RpoN (σ54) of P. syringae pv. maculicola (accession no. AF199600; 95% identity), P. syringae pv. glycinea
(AF283815; 93% identity), P. syringae pv. tomato (AE016872;
96% identity), P. syringae pv. syringae (ZP_00126321; 95%
identity), P. putida (M24916 and X16474; 91% identity); P.
aeruginosa (AE004860 and L26916; 86% identity), P. stutzeri MK21 (AJ223088; 85%), and Azotobacter vinelandii
(X05888; 80% identity). The predicted protein sequence of
RpoN of strain CHA0 is in accordance with the highly conserved domain structure identified in RpoN of other bacteria,
in particular with respect to the helix-turn-helix motif
(MKPLVLHDIAEAVGMHESTISRVTTQ) and the RpoNbox motif (ARRTVAKYRE) in the C-terminus which are
identical to those in other pseudomonads and in Azotobacter
sp. (Alarcón-Chaidez and Bender 2001; Buck et al. 2000; Jin
et al. 1994; Merrick 1993). RpoN recognizes an YTGGCAC
R-N4-TTGCW consensus sequence situated at positions –24
and –12 relative to the transcription start site (Barrios et al.
1999; Reitzer and Schneider 2001; Studholme and Buck
2000). A putative RpoN recognition site (CAGGCATATAAT
TTGCT) was found 89 bp upstream of the translational start
site of rpoN of strain CHA0. Remarkably, the sequence and
location of the RpoN recognition site appears to be highly
conserved in P. fluorescens, P. syringae (Alarcón-Chaidez and
Bender 2001), P. putida (Köhler et al. 1994), and P. aeruginosa (Jin et al. 1994).
As in other pseudomonads, rpoN in P. fluorescens CHA0 is
flanked by an upstream open reading frame (ORF) coding for
the ATPase component of an ABC-type transport system
(ORFA; Fig. 1) and by two downstream ORFs (ORFB and
ORFC) encoding, respectively, a protein with putative σ54modulating function and the enzyme IIA (PtsN) of the phosphoenolpyruvate/sugar phosphotransferase system (AlarcónChaidez and Bender 2001; Cases et al. 1999; Härtig and Zumft
1998; Jin et al. 1994; Köhler et al. 1994; Stover et al. 2000).
The amino acid sequences of the deduced products of ORFB
and the partially sequenced ORFA and ORFC were found to be
between 72 and 89% identical to the corresponding sequences
of their counterparts in P. syringae, P. aeruginosa, P. putida, P.
stutzeri, and A. vinelandii. Homologues of these ORFs also
have been found in an identical arrangement in the rpoN regions of various other gram-negative bacterial species, but
their precise function and their relation to RpoN function is
not yet fully understood (Merrick 1993; Michiels et al. 1998).
It has been suggested that the products of the downstream
rpoN-linked genes might contribute to the modulation of
RpoN activity or might be involved in the coregulation of
some of the RpoN promoters (Cases et al. 1999; Jin et al.
1994; Merrick 1993; Michiels et al. 1998).
Vol. 18, No. 3, 2005 / 261
Growth characteristics of an rpoN mutant of P. fluorescens.
A chromosomal rpoN in-frame mutation was created in P.
fluorescens CHA0 (Fig. 1) as described below. The rpoN mutant (CHA250) was complemented by a single copy of intact
rpoN+ introduced into the chromosomal Tn7 attachment site,
resulting in strain CHA251. The constructs then were compared
with the wild type for changes in growth characteristics. In
nutrient-rich media, the rpoN mutant CHA250 had a markedly
longer doubling time (approximately 75 min in King’s medium
B [KMB] broth, 71 min in Luria-Bertani [LB] broth, and 133
min in glycerol-Casamino acids medium [GCM]) than the wildtype CHA0 and the complemented mutant CHA251 (approximately 44 min in KMB broth, 38 min in LB broth, and 72 min
in GCM). However, in the stationary growth phase, all three
strains had reached similar final cell densities in these media
(data not shown). In the following, KMB broth was chosen as
the standard culture medium for most of the experiments because growth kinetics of the rpoN mutant most resembled
those of the wild type in this medium, except that the mutant
had an extended lag phase and a slightly slower growth during
the exponential phase.
Unlike wild-type CHA0 (doubling time of 99 min), the rpoN
mutant CHA250 was unable to grow in the minimal glucoseammonium medium (OSG). Therefore, the capacity of the
mutant to utilize different nitrogen sources was tested in M9
minimal salt medium in which NH4Cl was replaced or supplemented by an alternative nitrogen source. In contrast to
the wild type or the complemented mutant, the rpoN mutant
was unable to grow in M9 minimal medium when it contained NH4Cl, histidine, or proline as the sole nitrogen
source. The growth of the mutant in M9 minimal medium
supplemented or not with NH4Cl could be restored largely by
addition of glutamine, glutamate, or aspartate to the medium
(data not shown). In addition, carbon source utilization profiles were determined for wild-type CHA0 and the rpoN mutant using Biolog GN2 and GP2 plates. Of the 128 carbon
sources tested, 53 were assimilated by strain CHA0 and, of
these, the rpoN mutant could not utilize 18 (i.e., N-acetyl-Dglucosamine, cis-aconitate, 2-aminoethanol, D-arabitol, DL-
carnitine, citrate, L-histidine, γ-hydroxybutyrate, α-ketoglutarate, D-mannitol, monomethylsuccinate, L-proline, L-serine,
succinamate, succinate, L-threonine, D-trehalose, and urocanate). Moreover, CHA250 displayed poor growth on 15 additional carbon sources (data not shown).
Overexpression of rpoN from the multicopy plasmids
pME8013 (PrpoN-rpoN+) and pME8014 (Plac-rpoN+) (Fig. 1) in
a CHA0 background did not significantly affect growth characteristics of the derivatives in rich and minimal media compared
with the wild-type strain (data not shown). In conclusion, loss
of RpoN function in P. fluorescens, as in other Pseudomonas
spp. (Alarcón-Chaidez et al. 2003; Köhler et al. 1989; Totten et
al. 1990), results in some growth defects, particularly with
respect to the utilization of certain C and N sources.
RpoN is required for motility in P. fluorescens.
For P. aeruginosa, three types of surface motility have been
described: i) swimming motility, which depends on the polar
flagellum and can be observed on low-agar medium; ii) swarming motility, which occurs as a coordinate cell movement on
semisolid agar surfaces and requires flagella, biosurfactants,
and, in some cases, also type IV pili; and iii) twitching motility,
which is mediated by type IV pili and takes place at surface
interfaces (Köhler et al. 2000; Rashid and Kornberg 2000).
Here, we report that these modes of surface translocation also
can be observed in P. fluorescens (Table 1; Fig. 2). As in P.
aeruginosa, swarming motility in P. fluorescens strain CHA0
was accompanied by a typical dendritic pattern of the swarm
colony (Fig. 2A). Loss of RpoN function had a dramatic impact
on the surface motility of P. fluorescens. Swimming and
swarming motilities in the rpoN mutant CHA250 were drastically reduced, whereas twitching motility appeared to be less
affected (Table 1; Fig. 2A and B). Motility could be restored to
wild-type levels by complementation of the mutant with a single copy of intact rpoN+ (Table 1). Overexpression of rpoN
from its natural promoter in CHA0/pME8013 and from the
constitutive lac promoter in CHA0/pME8014 had no statistically significant effect on motility (Table 1). Transmission
electron microscopy confirmed that cells of the rpoN mutant
Fig. 1. Organization of the rpoN region in Pseudomonas fluorescens strain CHA0; ∆ = region deleted in strain CHA250 and in plasmid pME7066. The
shaded arrows show the genes sequenced or partly sequenced on the 2209-bp BamHI-XbaI fragment of pME7069. Open reading frame (ORF)A, ORFB, and
ORFC designate ORFs that are highly similar to PA4461, PA4463, and PA4464 (ptsN), respectively, of P. aeruginosa PAO1 (Stover et al. 2000). The bars
indicate the fragments cloned into the vectors pME6000, pME3087, pME6182, and pME6551 to give pME7069, pME7066, pME7070, and pME8014,
respectively. The fragment inserted in pME7070 was used to complement the rpoN mutation in CHA250 with single-copy rpoN+ using the mini-Tn7 delivery
system. Artificial restriction sites are marked with an asterisk.
262 / Molecular Plant-Microbe Interactions
were defective for flagella, whereas swarmer cells of the wild
type, the complemented mutant, and the rpoN-overexpressing
mutants possessed two to three, sometimes even more, polar
flagella (Fig. 2C; data not shown). However, at least under the
experimental conditions chosen here, we did not detect pili on
swarmer cells. On swim plates, P. fluorescens cells with intact
rpoN generally had one polar flagellum, although occasionally
cells with two flagella also could be observed (data not
shown). In summary, our results establish that RpoN, as in
other bacterial species, is essential for flagella formation and
thus for motility in P. fluorescens.
Contribution of RpoN to stress tolerance in P. fluorescens.
We next tested whether lack of RpoN affects growth of P.
fluorescens in response to osmotic stress. For this purpose, we
determined the doubling times of strain CHA0 and its derivatives during exponential growth of the bacteria in KMB broth
supplemented with NaCl or sorbitol. The rpoN mutant was significantly more sensitive to high salinity than the wild type.
The doubling time of CHA250 cells quadrupled when they
were exposed to 0.6 M NaCl, whereas it was only threefold
longer in CHA0 and the complemented rpoN mutant CHA251
(Table 2). This effect also could be observed at higher salt concentrations (0.8 M NaCl) (data not shown). No such difference
in stress sensitivity between the wild type and the rpoN mutant
could be noted when bacteria were exposed to 1.2 M sorbitol
(Table 2). The mutant complemented with monocopy rpoN+
and CHA0 derivatives overxpressing rpoN from plasmids
pME8013 or pME8014 exhibited stress tolerances largely similar to that of the wild type (Table 2).
To test the contribution of RpoN to bacterial survival in
response to osmotic stress, stationary-phase cells were exposed
to 1.2 M NaCl or 2.4 M sorbitol (i.e., conditions which no
longer allowed P. fluorescens to grow). In contrast to the wildtype CHA0 and the rpoN-overexpressing derivative
CHA0/pME8014, culturability in the rpoN mutant CHA250
significantly dropped soon after exposure to salt stress (Fig. 3).
By contrast, no such differences could be observed when bacteria were exposed to 2.4 M sorbitol (data not shown).
To determine whether inactivation of rpoN affects the susceptibility of P. fluorescens to agents generating reactive oxygen
intermediates (ROIs), wild-type strain CHA0, the rpoN deletion mutant, and the rpoN-overexpressing derivatives were
exposed to paraquat, hydrogen peroxide, and sodium hypochlorite. All mutant strains were found to display wild-type
susceptibility to various concentrations of these agents (data
not shown). In contrast, an rpoS mutant of strain CHA0 (Heeb
et al. 2002) (Table 3) included as a control was significantly
more sensitive to oxidative stress than the parental strain (data
not shown), thus confirming previous findings of Sarniguet
and associates (1995) obtained with an rpoS mutant of P. fluorescens Pf-5. In summary, these results suggest that RpoN contributes to tolerance of P. fluorescens to conditions of high
salinity, but is not required for tolerance toward ROIs and osmotic stress induced by sorbitol.
RpoN controls the production
of antifungal compounds in P. fluorescens.
We then evaluated the effect of the rpoN mutation on the
production of the antifungal compounds DAPG and PLT,
which make significant contributions to the biocontrol activity
of P. fluorescens CHA0. For this purpose, we followed the expression of lacZ reporter fusions to the DAPG and PLT biosynthetic genes in bacterial cultures growing in KMB broth
and we determined the production of the two antifungal compounds in parallel. Interestingly, the expression of a phlA-lacZ
transcriptional fusion carried by pME6710 (Schnider-Keel et
al. 2000) was enhanced severalfold in the rpoN mutant as of
the end of the exponential growth phase compared with the
wild-type CHA0 and the complemented mutant CHA251 (Fig.
Fig. 2. Swarming and swimming motilities of Pseudomonas fluorescens
wild-type CHA0 (left) and its rpoN mutant CHA250 (right) on A, swarm
plates (nutrient broth with 0.5% glucose and 0.5% agar) and B, swim
plates (tryptone broth with 0.3% agar), respectively, after a 48-h
incubation at room temperature. C, Electron micrographs showing
flagellated cells of strain CHA0 (left) and nonflagellated cells of the rpoN
mutant CHA250 (right) taken from the edge of swarm colonies.
Table 1. Contribution of RpoN to swimming, swarming, and twitching motilities of Pseudomonas fluorescens CHA0z
Strain
CHA0
CHA250
CHA251
CHA0/pME8013
CHA0/pME8014
z
Relevant genotype
Wild type
∆rpoN
∆rpoN attTn7::rpoN+
PrpoN-rpoN+
Plac-rpoN+
Swim area, % wt
Swarm area, % wt
Twitch area, % wt
100 ± 12
32 ± 4
110 ± 4
122 ± 17
110 ± 8
100 ± 8
4±1
118 ± 27
105 ± 12
79 ± 24
100 ± 6
60 ± 12
100 ± 20
88 ± 19
128 ± 21
Diameter of bacterial displacement on swim plates, swarm plates, and twitch plates after incubation for 24 h (swim and swarm plates) and 4 to 5 days
(twitch plates) at room temperature, assessed as described in the Materials and Methods section. Data are expressed as percentage of the diameters obtained
for the wild type which were arbitrarily set to 100%. Data represent the means ± standard deviation from three experiments with 12 replicate plates per
treatment in each experiment.
Vol. 18, No. 3, 2005 / 263
4A). In contrast, expression levels of a pltA-lacZ transcriptional fusion carried by pME8007 (Table 3) were two- to
+
threefold lower in the rpoN mutant than in the rpoN strains
CHA0 and CHA251 (Fig. 4B). RpoN overexpression in strain
CHA0 carrying the multicopy plasmids pME8013 or
pME8014 (Table 3) did not significantly alter phl or plt gene
expression (data not shown). The kinetics of DAPG and PLT
production paralleled the expression of the phlA-lacZ and pltAlacZ reporter constructs: DAPG levels were enhanced whereas
PLT levels were reduced in cultures of the rpoN mutant (Fig.
4C and D). The rpoN-overexpressing strains CHA0/pME8013
and CHA0/pME8014 produced wild-type levels of DAPG and
PLT (data not shown). The strong decrease of DAPG and PLT
levels at the end of the experiments may be due to degradation
of the two compounds by the producer strains (Schnider-Keel
et al. 2000; our unpublished observations). Experiments also
were carried out using a phlA′-′lacZ translational fusion on
pME6259 (Schnider-Keel et al. 2000) and a pltA′-′lacZ translational fusion on pME6751 (Table 3), and kinetics of gene expression in the rpoN mutant, the wild type, and the complemented rpoN mutant were found to be almost identical to those
obtained with the transcriptional reporter fusions described
above (data not shown). Glycerol is known to favor PLT production in P. fluorescens (Duffy and Défago 1999; SchniderKeel et al. 2000); therefore, the influence of RpoN on phlA
expression also was tested in KMB broth in which glycerol
was replaced by glucose (0.89%, wt/vol). A similar upregulation of phlA expression could be observed in the rpoN mutant
(data not shown), thus excluding a potential effect of the carbon
source. Taken together, these findings demonstrate that RpoN
may control the balance of antibiotic production in a
biocontrol strain of P. fluorescens.
RpoN is essential for biocontrol capacity of P. fluorescens.
The contribution of RpoN to the biocontrol ability of P. fluorescens strain CHA0 against a root rot and damping-off disease of cucumber caused by the pathogenic oomycete Pythium
ultimum was tested in natural soil microcosms. P. ultimum severely reduced growth and survival of cucumber plants when
no biocontrol bacteria were applied to soil (Table 4). Addition
of strain CHA0 to pathogen-infested soil enhanced plant survival by 29% and plant fresh weights were increased threefold
(Table 4). The rpoN mutant CHA250 was severely impaired in
its capacity to protect cucumber from the root disease; plant
survival and plant fresh weights were only marginally higher
than those of plants treated with the pathogen alone (Table 4).
Biocontrol activity of the rpoN mutant could be restored by
complementing the strain with monocopy rpoN+ (Table 4).
Overexpression of rpoN from the natural promoter or from the
constitutive lac promoter in strains CHA0/pME8013 and
CHA0/pME8014, respectively, did not result in a significantly
altered biocontrol activity (Table 4). In the absence of the patho-
gen, plant growth was not significantly affected by addition of
bacteria (Table 4). Remarkably, root colonization levels at the
end of the experiment were similar for all bacterial strains and
varied between 0.4 and 1.7 × 107 CFU/g of roots in the absence
of Pythium spp. and between 2.1 and 4.9 × 107 CFU/g of roots
in pathogen-infested soil. To check whether differences in bacterial root colonization levels occurred eventually at earlier
stages of Pythium spp. infection, we determined population
densities of the wild-type CHA0 and the rpoN mutant
CHA250 on cucumber roots also at 2 and 3 days after bacterial
application to soil. However, in no case were population densities of the two strains on cucumber roots significantly different
in either the presence or absence of the pathogen (data not
shown).
DISCUSSION
In this study, we identified the rpoN locus in the plant-beneficial Pseudomonas fluorescens strain CHA0. The arrangement
of rpoN and adjacent genes in P. fluorescens (Fig. 1) is identical to that described for P. putida (Köhler et al. 1994), P. stutzeri (Härtig and Zumft 1998), P. aeruginosa (Jin et al. 1994;
Stover et al. 2000), and P. syringae (Alarcón-Chaidez and
Bender 2001), thus confirming that the gene alignment in this
chromosomal region is conserved in different Pseudomonas
spp. Our results demonstrate that RpoN of P. fluorescens is
Fig. 3. Survival of Pseudomonas fluorescens wild-type CHA0 (black
circle), the rpoN mutant CHA250 (open circle), and the rpoNoverexpressing derivative CHA0/pME8014 (gray-shaded circle) during
exposure to 1.2 M NaCl. Survival was expressed as the log10 of the ratio of
CFU in the exposed suspension to the CFU in the initial suspension
(Sarniguet et al. 1995). Means ± standard deviation from three replicate
cultures are shown. The experiment was repeated, with similar results.
Some of the error bars were too small to be included.
Table 2. Effect of an rpoN mutation on tolerance of Pseudomonas fluorescens to osmotic stress
Doubling time (h)x
Strain
z
CHA0
CHA250
CHA251
CHA0/pME8013
CHA0/pME8014
Relevant genotype
Wild type
∆rpoN
∆rpoN attTn7::rpoN+
PrpoN-rpoN+
Plac-rpoN+
x
Without stress
0.74 c
1.09 a
0.75 c
0.82 bc
0.86 b
Ratioy
0.6 M NaCl
1.2 M Sorbitol
0.6 M NaCl
1.2 M Sorbitol
2.28 b
4.52 a
2.02 b
1.92 b
1.69 b
1.51 c
2.42 a
1.62 bc
2.06 b
2.07 b
3.1
4.2
2.7
2.3
2.0
2.0
2.2
2.2
2.5
2.4
Doubling time was calculated from optical density (OD) at 600 nm values determined during exponential growth phase (eight measurements). During this,
the relation of OD at 600 nm values to CFU counts was linear (data not shown). Data are means from two independent experiments, with three replicate
cultures per experiment. Values in the same column with different letters are significantly different at P = 0.05 (Fisher’s least significant difference test).
y
Ratio denotes the x-fold increase in doubling time of stressed (0.6 M NaCl or 1.2 M sorbitol) versus nonstressed cultures for each bacterial strain.
z
Bacteria were grown at 30°C in King’s medium B broth with (and without) the addition of NaCl or sorbitol.
264 / Molecular Plant-Microbe Interactions
functionally equivalent to its counterparts in other Pseudomonas spp. with respect to its importance for motility and utilization of various carbon and nitrogen sources (Alarcón-Chaidez
et al. 2003; Hendrickson et al. 2000b, 2001; Ishimoto and Lory
1989; Köhler et al. 1989; Merrick 1993; Totten et al. 1990).
We also tested whether RpoN, as well as RpoS (Sarniguet et
al. 1995) and AlgU (Schnider-Keel et al. 2001), may be an additional σ factor required for tolerance of P. fluorescens to environmental stress. Indeed, the rpoN mutant of strain CHA0 was
significantly more sensitive to hyperosmotic conditions induced
by NaCl (Table 2; Fig. 3), confirming previous results obtained
with an rpoN mutant of P. aeruginosa PAO1 (Sage et al.
1997). By contrast, the rpoN mutant of strain CHA0 displayed
wild-type sensitivities to agents that generate ROIs. Similarly,
an rpoN mutant of P. putida KT2440 was reported not to be
impaired in its tolerance toward oxidative stress; however, this
mutant was not affected in its sensitivity to either salt stress or
high temperature (Cases and de Lorenzo 2001).
More intriguingly, our findings provide evidence for novel
roles of RpoN as a key regulator of antibiotic production and
biocontrol activity in P. fluorescens. On the one hand, RpoN was
found to positively control the expression of plt biosynthetic
genes (Fig. 4B) and PLT production (Fig. 4D) in strain CHA0.
Interestingly, RpoN has been reported previously to be essential
for the expression of the phytotoxin coronatine in the plantpathogenic bacteria P. syringae pv. maculicola (Hendrickson et
al. 2000b) and P. syringae pv. glycinea (Alarcón-Chaidez et al.
2003). In the same vein, RpoN was required for the production
of the antibiotic and virulence factor pyocyanin in P. aeruginosa
(Hendrickson et al. 2001; Thompson et al. 2003). On the other
hand, RpoN exerted a strong negative effect on the expression of
phl biosynthetic genes (Fig. 4A) and DAPG production (Fig.
4C) in P. fluorescens CHA0. Recently, a negative effect of RpoN
has been reported by Heurlier and associates (2003), who found
that mutation of rpoN in P. aeruginosa leads to overexpression
of N-acyl homoserine lactones and some quorum-sensing-regulated virulence factors such as the biocide hydrogen cyanide, but
the precise mechanisms involved remain unknown.
At the current stage, we can only speculate on how RpoN
might affect the balance of antibiotic production in P. fluorescens CHA0. We could not detect typical motifs recognized by
σ54 (i.e. YTGGCACR-N4-TTGCW) (Barrios et al. 1999;
Reitzer and Schneider 2001; Studholme and Buck 2000) in the
phlA and pltA leader regions, suggesting that RpoN does not
directly interact with the promoters of the DAPG and PLT biosynthetic genes. However, we could find a potential σ54-binding
motif (ATGGCCCCAGCACTGCT) approximately 100 bp upstream of the translational start of pltR (M. Bottiglieri and C.
Keel, unpublished data). Because PltR functions as a pathwayspecific activator of PLT gene expression (Haas and Keel
2003; Nowak-Thompson et al. 1999), it seems possible that
the positive effect of RpoN on pltA expression is mediated by
σ54-dependent activation of pltR transcription. Using a transcriptional pltR-lacZ fusion, we have obtained preliminary evi-
Table 3. Bacterial strains and plasmids used in this study
Relevant characteristicsz
Strain or plasmid
Pseudomonas fluorescens
CHA0
CHA250
CHA251
CHA815
Escherichia coli
DH5α, HB101
Plasmids
pBluescript II KS+
pME497
pME3087
pME3280a
pME6000
pME6001
pME6010
pME6014, pME6015
pME6016
pME6182
pME6259
pME6551
pME6710
pME6751
pME7066
pME7069
pME7070
pME8007
pME8013
pME8014
pNAB1
pUK21
pUX-BF13
z
r
Reference or source
Wild type
∆rpoN
CHA250::attTn7-rpoN+; Gmr
∆rpoS
Voisard et al. 1994
This study
This study
Heeb et al. 2002
Laboratory strains
Sambrook and Russell 2001
Cloning vector; ColE1 replicon; Apr
Mobilizing plasmid; IncP-1, Tra; RepA(Ts); Apr
Suicide vector; ColE1 replicon; RK2-Mob; Tcr
Carrier plasmid for Tn7; containing the mini Tn7-Gm transposon with translational and
transcriptional signals; pUC19ori; Apr Gmr
Cloning vector, pBBR1MCS derivative; Tcr
Cloning vector, pBBR1MCS derivative; Gmr
Cloning vector; pACYC177-pVS1 shuttle vector; Tcr
Cloning vectors for construction of translational lacZ-fusions; derived from pME6010; Tcr
Stratagene
Voisard et al. 1994
Voisard et al. 1994
Schnider-Keel et al. 2000;
Zuber et al. 2003
Schnider-Keel et al. 2001
Valverde et al. 2003
Heeb et al. 2000
Schnider-Keel et al. 2000;
this study
Schnider-Keel et al. 2000
Cloning vector for construction of transcriptional lacZ fusions; derived from pME6010; Tcr
Carrier plasmid for Tn7 containing the mini Tn7-Gm transposon; derived from pME3280a;
multiple cloning site flanked by transcription terminators; Apr Gmr
pME6014 carrying a translational phlA’-’lacZ fusion; Tcr
Cloning vector; derivative of pME6000; Gmr
pME6016 carrying a transcriptional phlA-lacZ fusion; Tcr
pME6015 with a 864-bp pltA upstream fragment and a translational pltA′-′lacZ fusion
containing the first 43 pltA codons; Tcr
pME3087 carrying a 867-bp BamHI-HindIII insert with a deletion in rpoN; Tcr
pME6000 with a 2,199-bp BamHI-XbaI fragment containing rpoN and its flanking regions of
CHA0; Tcr
pME6182 with the 1,952-bp BamHI-NcoI fragment of pME7069 containing rpoN; Apr Gmr
pME6016 with a 798-bp pltA upstream fragment and a transcriptional pltA-lacZ fusion
containing the first 9 pltA codons; Tcr
pME6551 with a 2.2-kb HindIII-EcoRI fragment of pME7070 containing rpoN; Gmr
pME6551 with a 1,515-bp fragment derived from pME7070 containing rpoN and a
21-bp upstream region placed under the control of the lac promoter; Gmr
pBluescript II KS+ with a 0.86-kb PstI-BamHI fragment encompassing the pltR-pltLA
intergenic region
Cloning vector; lacZα; Kmr
Helper plasmid for Tn7-based transposon mutagenesis containing the transposition functions;
R6K-replicon; Apr
r
r
C. Reimmann
Schnider-Keel et al. 2000
Schnider-Keel et al. 2001
Schnider-Keel et al. 2000
This study
This study
This study
This study
This study
This study
This study
This study
Vieira and Messing 1991
Bao et al. 1991
r
Ap , ampicillin resistance; Gm , gentamicin resistance; Km , kanamycin resistance; Tc , tetracycline resistance.
Vol. 18, No. 3, 2005 / 265
dence that RpoN may function as an activator of pltR transcription (M. Bottiglieri and C. Keel, unpublished data). Analogously, in P. syringae, putative σ54 recognition motifs were localized upstream of the start codon of corR encoding a transcriptional activator of coronatine gene expression, but were
not found in the promoter regions of the coronatine biosynthetic genes (Alarcón-Chaidez et al. 2003; Hendrickson et al.
2000b). Surprisingly, a similar plausible σ54 recognition motif
appears to lack in the leader region of phlF (M. Bottiglieri and
C. Keel, unpublished findings), which encodes a pathway-specific transcriptional repressor of DAPG gene expression in P.
fluorescens (Bangera and Thomashow 1999; Delany et al.
2000; Schnider-Keel et al. 2000). PLT is known to strongly repress DAPG gene expression in P. fluorescens CHA0
(Schnider-Keel et al. 2000); therefore, it is tempting to speculate that the negative effect of RpoN on phl gene expression
may take place indirectly through enhanced production of PLT
following σ54-dependent activation of pltR expression.
However, other regulatory elements might interfere with
RpoN-mediated control of antibiotic production as well. A po-
tential candidate is the alternative σ factor RpoS, which is
known to exert an effect on PLT expression that is opposite to
that of RpoN. In rpoS mutants of P. fluorescens strains CHA0
and Pf-5, expression of plt biosynthetic genes and PLT production is enhanced severalfold (Haas and Keel 2003; Sarniguet et
al. 1995), pointing to the possibility that cellular levels of RpoN
and RpoS could influence the relative amounts of this antifungal
compound produced by the bacterium. Future work also may
include investigations of the potential interactions of RpoN with
components of the GacS/GacA signal transduction cascade
(Haas and Keel 2003; Valverde et al. 2003; Zuber et al. 2003).
The rpoN mutant of P. fluorescens CHA0 had a drastically
reduced capacity to protect cucumber plants from Pythium root
rot and damping-off disease in natural soil (Table 4), thus establishing RpoN, in addition to RpoD and RpoS, as a further σ
factor involved in the regulation of biocontrol activity in plantbeneficial pseudomonads. Previous studies have shown that
RpoD overexpression or loss of RpoS function enhances the disease suppressive effect of P. fluorescens against Pythium spp. on
cucumber (Maurhofer et al. 1992; Sarniguet et al. 1995;
Fig. 4. RpoN control of the biosynthesis of antifungal compounds in Pseudomonas fluorescens strain CHA0. Expression of the plasmid-borne transcriptional
reporter fusions A, phlA-lacZ (pME6710) and B, pltA′-lacZ (pME8007) and production of C, 2,4-diacetylphloroglucinol and D, pyoluteorin in growing
cultures of wild-type CHA0 (black circle), the rpoN in-frame-deletion mutant CHA250 (open circle), and the rpoN mutant complemented with monocopy
+
rpoN CHA251 (gray-shaded circle). Specific β-galactosidase activities and antibiotic production were determined for bacteria cultivated in King’s medium
B broth at 30°C. Growth (optical density [OD] at 600 nm) of strains CHA0, CHA250, and CHA251 are indicated by black, open, and gray-shaded triangles,
respectively. Means ± standard deviation from three replicate cultures are shown. The experiment was repeated, with similar results. Some of the error bars
were too small to be included.
266 / Molecular Plant-Microbe Interactions
Schnider et al. 1995), suggesting that a balance between the
three σ factors may be important for calibrating levels of biocontrol activity. Due to the pleiotropic effects of the rpoN mutation in Pseudomonas fluorescens CHA0, it is difficult to assign
the defect in biocontrol efficacy to a certain phenotype of the
rpoN mutant. Reduced production of the antifungal compound
PLT (Fig. 4D), which has been associated with the suppression
of Pythium diseases by P. fluorescens (Howell and Stipanovic
1980; Kraus and Loper 1995; Maurhofer et al. 1994), may have
accounted, at least partly, for this effect. However, there is the
conflicting finding that the rpoN mutant excretes enhanced levels of DAPG (Fig. 4C) and there is some evidence that DAPG
also may contribute to Pythium spp. suppression (Maurhofer et
al. 1992, 1995; Schnider et al. 1995; M. Péchy-Tarr and C. Keel,
unpublished data). However, the actual kinetics of DAPG and
PLT expression on plant roots might be significantly different
from those observed in vitro. Moreover, because the rpoN mutant shows several defects in nitrogen and carbon source metabolism, it also may be impaired in the utilization of certain
root exudates that may be required for effective production of
the two antifungal compounds. In pathogenic pseudomonads,
deletion of rpoN results in significantly reduced virulence in
some animal and plant models, but decreased pathogenicity also
could be only partly explained by lowered expression of virulence factors (i.e., certain toxins) by the rpoN mutants (AlarcónChaidez et al. 2003; Hendrickson et al. 2000a,b, 2001). In some
cases, decreased virulence of these mutants was associated with
defects in their host colonization ability. For instance, rpoN mutants of Pseudomonas aeruginosa and P. syringae showed
strongly reduced proliferation in planta (Alarcón-Chaidez et al.
2003; Hendrickson et al. 2000b, 2001) and a P. aeruginosa rpoN
mutant was impaired in its capacity to form biofilms on the fungal pathogen Candida albicans (Hogan and Kolter 2002). In
contrast, root colonization levels of the P. fluorescens rpoN
mutant used in the present study were not significantly different
from those of the wild type at different plant growth stages
(Table 4; data not shown). Nevertheless, it still is possible that
the rpoN mutation could have resulted in altered root colonization patterns at a microniche level, eventually leading to reduced biocontrol efficacy.
At present, it is difficult to explain our finding that overexpression of RpoN has no major effects on the expression of the
RpoN-dependent phenotypes described for P. fluorescens
CHA0 in this study. One possibility is that higher intracellular
levels of σ54 also require higher levels of the different enhancer-binding proteins that are necessary for activation of the
σ54-RNAP complex and, thus, for efficient expression of
RpoN-dependent functions (Buck et al. 2000). Alternatively, it
is possible that wild-type levels of σ54 in the cells are already
sufficient for effective expression of the RpoN-dependent phenotypes. In P. putida and Escherichia coli, intracellular levels
of σ54 remain constant at relatively low levels (compared with
the housekeeping σ factor σ70) throughout the different growth
stages (Jishage et al. 1996; Jurado et al. 2003). This is in agreement with our recent finding that, in P. fluorescens wild-type
CHA0, an rpoN-lacZ reporter fusion was expressed at a very
low and constant level throughout bacterial growth (S. Mathys
and C. Keel, unpublished data). Remarkably, rpoN expression
was enhanced approximately fivefold in the rpoN mutant
CHA250, pointing to a mechanism of negative autoregulation
of rpoN expression. By contrast, in CHA0 derivatives overexpressing RpoN from the vectors pME8013 and pME8014,
rpoN expression was reduced to levels below that of the wild
type (S. Mathys and C. Keel, unpublished findings), thus providing a possible explanation for the lack of a significant effect
of RpoN overexpression in P. fluorescens. Negative autoregulation of rpoN expression has been reported previously in P.
putida (Köhler et al. 1994) and several other bacterial species
(Buck et al. 2000).
In conclusion, our results confirm the important role of
RpoN in bacterial motility and nitrogen and carbon metabolism and establish this σ factor for the first time as a major
regulator of antibiotic production and biocontrol activity in P.
fluorescens. However, due to the complex consequences of the
rpoN mutation, the exact mechanism of loss of biocontrol activity awaits further elucidation.
MATERIALS AND METHODS
Microorganisms, plasmids, and culture conditions.
The bacterial strains and plasmids used in this study are described in Table 3. P. fluorescens strains were cultivated on
nutrient agar (NA) (Stanisich and Holloway 1972), on KMB
agar (King et al. 1954), in nutrient yeast broth (NYB)
(Stanisich and Holloway 1972), in KMB broth, and in LB
broth (Sambrook and Russell 2001) at 30°C with aeration. E.
coli strains were grown on NA and in NYB at 37°C. Antimicrobial compounds, when required, were added to the growth
Table 4. Contribution of RpoN to the suppression of Pythium damping-off and root rot of cucumber by Pseudomonas fluorescens CHA0 in natural soilx
Bacterial strain addedy
None
CHA0 (wild type)
CHA250 (∆rpoN)
CHA251 (∆rpoN attTn7::rpoN+)
CHA0/pME8013 (PrpoN-rpoN+)
CHA0/pME8014 (Plac-rpoN+)
None
CHA0
CHA250
CHA251
CHA0/pME8013
CHA0/pME8014
Pythium
added
Surviving plants
per flask (%)
Shoot fresh weight
per flask (g)
–
–
–
–
–
–
+
+
+
+
+
+
100 a
99 a
100 a
98 ab
97 ab
100 a
63 c
92 ab
73 c
90 b
95 ab
93 ab
2.09 a
2.12 a
1.92 a
1.96 a
1.92 a
2.16 a
0.52 d
1.54 b
0.75 c
1.43 b
1.61 b
1.65 b
Root fresh weight
per flask (g)
0.46 a
0.45 a
0.40 b
0.42 ab
0.41 ab
0.49 a
0.13 d
0.33 c
0.18 d
0.31 c
0.38 bc
0.33 c
Colonization by P. fluorescens
(log10 CFU/g of roots)z
ND
6.67 ± 0.37
6.55 ± 0.15
7.19 ± 0.24
6.62 ± 0.10
6.53 ± 0.02
ND
7.56 ± 0.43
7.20 ± 0.73
7.30 ± 0.15
7.44 ± 0.16
7.57 ± 0.48
x
Data represent the means from six individual repetitions of the same experimental setup, with 5 to 10 replicates (flasks containing three cucumber plants)
per treatment in each experiment. Means within the same column followed by different letters differ significantly at P = 0.05, according to Fisher’s least
significant difference test; ND = not detected.
y
P. fluorescens strains were added at 107 CFU/g of natural soil contained within 200-ml flasks (60 g of soil per flask), after planting three 72-h-old, sterilegrown cucumber seedlings per flask. Pythium ultimum was added as a millet-seed inoculum at 2.5 g/kg of soil before planting. Plants were harvested after
7 days.
z
A derivative of the rhizosphere-stable plasmid pME6010 (Heeb et al. 2000) was introduced into Pseudomonas fluorescens strains to determine their root
colonization capacity.
Vol. 18, No. 3, 2005 / 267
media at the following concentrations: ampicillin sodium salt,
100 µg/ml; chloramphenicol, 25 µg/ml; gentamicin sulphate,
10 µg/ml; kanamycin sulphate, 25 µg/ml; and tetracycline hydrochloride, 25 µg/ml for E. coli and 125 µg/ml for P. fluorescens strains. When appropriate, 5-bromo-4-chloro-3-indolyl-βD-galactoside was incorporated into solid media to monitor βgalactosidase expression (Sambrook and Russell 2001). P. ultimum strain 67-1 was cultured on malt agar and, for use in
plant disease suppression assays, on autoclaved millet seed as
described previously (Maurhofer et al. 1992).
kb band with an annealing temperature of 59°C. The PCR product was digested with BamHI and XbaI and cloned into vector
pME6000 to give pME7069 (Fig. 1; Table 3). The inserts of
three of the clones obtained were sequenced to confirm the identity of the cloned fragment.
Construction of an rpoN in-frame-deletion mutant
of P. fluorescens.
For the construction of the rpoN mutant CHA250, a 1,212-bp
fragment, including the XLINK motif, the helix-turn-helix motif,
the RpoN box, and associated motifs (Buck et al. 2000; Merrick
1993) was deleted in-frame in the rpoN gene (Fig. 1) as follows.
A 487-bp BamHI-XhoI fragment, including the first 88 codons
of rpoN, was isolated from pME7069. A 510-bp fragment from
pME7069, including the last six codons of rpoN, ORF1, and the
start of ptsN (Fig. 1), then was amplified by PCR with primers
CK-P3 (5′-GCGCCTTCCCTCGAGCGTAAGCGG-3′), which
created an artificial XhoI site (underlined), and CK-P2 (discussed above). The PCR product was trimmed to 380 bp with
XhoI-HindIII (Fig. 1). The 487-bp BamHI-XhoI and 380-bp
XhoI-HindIII fragments were cloned by a triple ligation into the
suicide plasmid pME3087 digested with BamHI-HindIII, giving
plasmid pME7066 (Fig. 1). In parallel, the two fragments also
were cloned into pUK21 and the insert was checked by sequencing. Plasmid pME6077 then was integrated into the chromosome of strain CHA0 by triparental mating using E. coli HB101/
pME497 as the mobilizing strain (Schnider-Keel et al. 2000,
2001), with selection for tetracycline- and chloramphenicolresistant recombinants. Excision of the vector by a second crossing-over occurred after enrichment for tetracycline-sensitive
cells (Schnider-Keel et al. 2000, 2001). The rpoN mutation was
verified by PCR and Southern blotting (data not shown).
DNA manipulations and sequencing.
Chromosomal DNA of P. fluorescens was prepared as described elsewhere (Schnider-Keel et al. 2000). Isolation of
pME3087-based plasmids from E. coli was done by alkaline
lysis (Sambrook and Russel 2001). All other small- and largescale plasmid preparations were performed with the cetyltrimethylammonium bromide method (Sambrook and Russel
2001) and the Jetstar 2.0 kit (Genomed, Basel, Switzerland),
respectively. Standard techniques were used for restriction,
agarose gel electrophoresis, generation of blunt ends with T4
DNA polymerase (Roche Diagnostics, Rotkreuz, Switzerland),
isolation of DNA fragments from low-melting-point agarose
gels, and ligation (Sambrook and Russell 2001; Schnider-Keel
et al. 2000, 2001). Restriction fragments were purified from
agarose gels using the Qiagen Gel extraction kit (Qiagen,
Hombrechtikon, Switzerland). Bacterial cells were transformed
with plasmid DNA by electroporation (Schnider-Keel et al.
2000). Southern blotting with Hybond N membranes (Amersham Biosciences, Otelfingen, Switzerland), random-primed
DNA labeling with digoxygenin-11-dUTP, hybridization, and
detection (Roche Diagnostics) were performed according to
the protocols of the suppliers.
Polymerase chain reactions (PCRs) typically were carried
out with 1 to 2 U of thermostable DNA polymerase (Expand
High Fidelity PCR System, Roche Diagnostics) in a reaction
mixture containing 100 to 200 ng of target DNA, 200 µM each
of the four dNTPs (Roche Diagnostics), 0.5 µM each primer, 1
to 3 mM MgCl2, and 1× PCR buffer (Roche Diagnostics) in a
final volume of 20 µl. For the amplification reaction, an initial
denaturation step of 5 min at 95°C was followed by 25 to 30
thermal cycles (1 min at 95°C, 30 s at 55 to 60°C, and 1 to 2
min at 72°C) and a final elongation step of 5 min at 72°C.
Nucleotide sequences of PCR-derived constructs were determined on both strands with the Big Dye Terminator Cycle sequencing kit 1.1 (Perkin Elmer, Fremont, CA, U.S.A.) and an
ABI Prism 3100 automatic sequencer (Applied Biosystems,
Foster City, CA, U.S.A.), and, in part, by Microsynth (Balgach, Switzerland). Nucleotide and deduced amino acid sequences were analyzed with programs of the European Molecular Biology Open Software Suite.
Complementation of the rpoN mutation
by monocopy rpoN+.
To complement strain CHA250 (∆rpoN), the rpoN gene was
introduced as a single copy into the chromosome using a miniTn7 delivery system described previously (Bao et al. 1991;
Schnider-Keel et al. 2000; Zuber et al. 2003). For this purpose,
the 1,952-bp BamHI-NcoI fragment of pME7069 (Fig. 1) was
cloned into the mini-Tn7-Gm carrier plasmid pME6182, a derivative of pME3280a (Schnider-Keel et al. 2000; Zuber et al.
2003) in which the multiple cloning site is flanked on both sides
by transcriptional termination signals. The construct obtained,
pME7070 (Fig. 1), and the Tn7 transposition helper plasmid
pUX-BF13 (Bao et al. 1991) were co-electroporated into the
recipient strain CHA250. The single Tn7-rpoN+ insertion in
strain CHA251 was checked by PCR using primers PTn7Gm
(5′-GGCGGTAGTTGGGTCGATAT-3′) and PTn7glmS (5′-AA
CATGGCCAAGTCGGTCACC-3′) and by Southern blotting
(data not shown).
Cloning of the rpoN gene from P. fluorescens.
To amplify the rpoN gene and its surroundings from P. fluorescens CHA0, the degenerate primers CK-P1 (5′-CGGGAT
CCCGGAAGTBTAYCTGGGBCACGARTTCCG-3′) and CKP2 (5′-GCTCTAGAGCTTCACVAGGGAACGGCCGGGGGT
CAGG-3′) containing artificial restriction sites (underlined) for
BamHI and XbaI, respectively, were used. Primers were designed based on the alignment of genomic sequences of strains
P. fluorescens Pf0-1, P. syringae pv. glycinea PG4180 (accession
number AF283815), P. syringae pv. maculicola ES4326 (accession number AF199600), P. putida KT2440 (accession number
X16474), P. putida TN2100 (accession number M24916), P.
aeruginosa PAO1 (accession number AE004860), P. stutzeri
MK21 (accession number AJ223088), and A. vinelandii OP (accession number X05888). The PCR amplification yielded a 2.2-
Overexpression of rpoN in P. fluorescens.
For rpoN overexpression, the CHA0 rpoN gene was cloned
into the multicopy vector pME6551 (18 copies per chromosome equivalent in P. fluorescens) (Schnider-Keel et al. 2001)
and expressed from its natural promoter or the constitutive lac
promoter. Plasmid pME8013 (Table 3) was constructed by
cloning a 2.2-kb HindIII-EcoRI fragment of pME7070 (Fig. 1)
containing rpoN under the control of its own promoter into
pME6551. For the construction of pME8014 (Fig. 1), a 1,515bp fragment derived from pME7070 containing the entire
rpoN gene and a 21-bp region upstream of its start codon was
PCR amplified with primers SM-P1 (5′-CCGGAATTCATA
AGGTGTTAAGCCCCTGCC-3′) and SM-P2 (5′-CGCGGA
TCCCTACATCAACCGCTTACGTTC-3′) containing artificial
restriction sites (underlined) for EcoRI and BamHI, respect-
268 / Molecular Plant-Microbe Interactions
tively. The PCR product was digested with EcoRI and BamHI,
ligated in pME6001 cut with the same enzymes, and verified
by sequencing. A 1.6-kb KpnI-BamHI fragment from the resulting plasmid then was placed under the control of the lac
promoter in pME6551 to give pME8014 (Fig. 1).
Construction of transcriptional and
translational lacZ fusions to the pltA gene.
A pltA′-′lacZ translational fusion was constructed as follows. Sequence information available from the very closely related strain P. fluorescens Pf-5 (GenBank accession number
AF081920) was used to PCR amplify the pltR′-pltL-pltA′ chromosomal region of CHA0 encompassing the promoter region
of the pyoluteorin biosynthetic genes, which is located in the
intergenic region between pltR and pltL (Nowak-Thompson et
al. 1999). Primers CGB-P1 (5′-AACTGCAGAGGTGGGATG
CCAAGTAGTC-3′) and CGB-P2 (5′-CGGGATCCCATGCTC
GCGCTCGAACAGTT-3′), containing artificial restriction sites
(underlined) for PstI and BamHI, respectively, served to amplify
an 864-bp upstream region and the first 43 codons of the pltA
gene. The PCR product was cloned into pBluescript II KS+
giving pNAB1 and the insert was sequenced on both strands.
The nucleotide sequence (accession number AY459536)
showed 99.8% identity to the corresponding sequence of P.
fluorescens Pf-5. A 994-bp EcoRI-BamHI fragment from
pNAB1 then was fused in-frame with the ′lacZ gene in vector
pME6015 (Table 3), to give the pltA′-′lacZ reporter pME6751
(Table 3). The fusion was checked by sequencing.
For the construction of the pltA-lacZ transcriptional fusion,
a fragment encompassing a 798-bp upstream region and the
first nine codons of the pltA gene was amplified by PCR with
primers MB-P14 (5′GGAATTCGTCTATGTCATTGACAACG
CCTAGCGCCTTCATTC-3′; artificial EcoRI site underlined)
and MB-P15 (5′-CGGGATCCTTACACTACATCATCATAAT
CATGATCGCTCATTGCC-3′; artificial BamHI site underlined). The PCR product was cloned into the vector pUK21
and the construct was sequenced on both strands. The 825-bp
EcoRI-BamHI fragment from the pUK21 derivative carrying
pltR′-pltL-pltA′ then was fused to lacZ in plasmid pME6016
(Schnider-Keel et al. 2000), producing the pltA-lacZ reporter
pME8007 (Table 3).
Assessment of growth characteristics
of the P. fluorescens rpoN mutant.
Growth rates for P. fluorescens CHA0 and its mutant derivatives were assessed by growing the strains at 30°C in different
rich media, including NYB, LB broth, KMB broth, and GCM
(Schnider-Keel et al. 2000), as well as in OSG (Schnider-Keel et
al. 2000). Nitrogen source utilization tests were performed in
tubes containing 2 ml of M9 salts minimal medium (Sambrook
and Russell 2001) with 0.4% glucose (wt/vol) by replacing or
complementing NH4Cl with an alternative nitrogen source at 10
mM when required. After inoculation of the media with aliquots
of 20 µl of a suspension of washed bacterial cells adjusted to an
optical density (OD) of 1.0, cultures were incubated for 24 h at
30°C with shaking at 180 rpm and growth was determined by
recording OD at 600 nm values. In addition, carbon source utilization profiles of wild-type CHA0 and its rpoN mutant were
compared by growing the strains in Biolog GN2 and Biolog
GP2 microplates (Biolog Inc., Hayward, CA) containing 128
different carbon sources, including sugars, amino acids, and organic acids (Wang et al. 2001). Bacterial cell suspensions were
prepared from LB overnight cultures grown at 30°C. Cells were
washed twice in sterile distilled water and cell density was adjusted to an OD at 600 nm of 0.25. The Biolog GN2 and GP2
plates were inoculated with aliquots of 150 µl of the bacterial
suspension per well and were incubated at 30°C for 24 h with
shaking (500 rpm) in a Thermostar incubator (BMG Labtechnologies, Offenburg, Germany). Bacterial growth was determined by measuring OD at 595 nm with a Fluostar Galaxy microplate reader (BMG Labtechnologies) and wells were scored
positive for growth when OD readings exceeded those of control
wells that did not contain a carbon source by at least 0.35. The
experiment was repeated twice.
Motility assays.
Swimming, swarming, and twitching motility of P. fluorescens CHA0 and its derivatives was tested following the procedures described by Rashid and Kornberg (2000). Flagellar
swimming was tested on plates containing 0.3% agar (Serva,
Heidleberg, Germany), yeast extract at 10 g/liter (Difco, Detroit),
tryptone at 10 g/liter (Difco), and NaCl at 12.5 g/liter. Swarming motility was examined on plates containing 0.5% agar, nutrient broth at 8 g/liter (Difco), and glucose at 5 g/liter. Twitching motility was assayed on LB broth solidified with 1% agar.
Cells from bacterial overnight cultures on NA were inoculated
into the center of the swim and swarm plates using a sterile
toothpick. Plates were incubated for 24 h at room temperature
prior to the assessment of the diameter of bacterial displacement. For twitch plates, cells were stab inoculated with a toothpick to the bottom of the petri dish. After incubation for 4 to 5
days at room temperature, the agar was carefully removed and
the bacterial cells attached to the bottom of the petri dish were
stained with crystal violet (1%, wt/vol). In all assays, motility
was scored as the diameter of bacterial displacement from the
point of inoculation.
Transmission electron microscopy.
Cells from the edge of a colony grown on swarm plates were
deposited with a toothpick on a drop of water. Carbon-filmcoated transmission electron microscopy grids were placed on
top of the drop for 15 to 20 s to allow for adhesion of bacterial
cells. Grids then were stained with 2% (wt/vol) potassium phosphotungstic acid (pH 3.0) for 20 to 30 s and washed for 20 s in
a drop of water. The grids were allowed to air dry and then
were examined with a Philips CM12 transmission electron microscope (Heindoven, The Netherlands) at 60 to 80 keV. Electron micrographs were taken at a magnification of ×10,000. At
least 15 fields of view were analyzed for each sample.
Assays for sensitivity
of P. fluorescens to osmotic and oxidative stress.
P. fluorescens CHA0 and its mutant derivatives were grown in
20 ml of KMB broth without selective antibiotics in 100-ml
Erlenmeyer flasks plugged with cotton stoppers. To induce conditions of osmotic stress which still allow growth of P. fluorescens, KMB was supplemented with 0.6 M NaCl, 0.8 M NaCl, or
1.2 M sorbitol, a nonionic solute which cannot be metabolized
by strain CHA0. For inoculation, aliquots of exponentialgrowth-phase LB cultures of the bacterial strains were used to
adjust the cell density to an OD at 600 nm of 0.05. Cultures
were incubated with rotational shaking (180 rpm) at 30°C. Doubling times of strain CHA0 and its derivatives were calculated
from OD at 600 nm values between 0.05 and 1.5 (i.e. during exponential growth) (Schnider-Keel et al. 2001).
Susceptibility to oxidative stress was tested by exposing
bacterial cells to paraquat, hydrogen peroxide (H2O2), or sodium
hypochlorite (NaOCl) as described previously (Schnider-Keel
et al. 2001). Sterile filter disks (6-mm diameter; Millipore,
Volketswil, Switzerland) were soaked with 10 µl of paraquat
(1.9 or 3.8%; wt/vol), H2O2 (3 or 12%; vol/vol), or NaOCl (5
or 10%; vol/vol) and placed on a layer of soft agar (2 ml of
NYB with 0.8% agar) containing 100 µl of an LB overnight
culture covering NA. The diameter of the inhibition zone surVol. 18, No. 3, 2005 / 269
rounding the impregnated disks was measured after overnight
incubation at 30°C.
To assess survival in response to osmotic or oxidative stress,
stationary-phase cells were washed and suspended in 10 ml of
distilled H2O to obtain an OD at 600 nm of 1.0. Suspended
cells were exposed to 1.2 M NaCl, 2.4 M sorbitol, or 30 mM
H2O2 (i.e., conditions which no longer allowed growth of P.
fluorescens) and incubated at 30°C with shaking. Cell culturability was determined at different intervals by plating serial dilutions of the cultures on NA.
Assay for expression of DAPG and PLT biosynthetic genes.
P. fluorescens CHA0 and its mutant derivatives carrying a
transcriptional phlA-lacZ fusion on plasmid pME6710, a translational phlA′-′lacZ fusion on pME6259, a transcriptional pltAlacZ fusion on pME8007, or a translational pltA′-′lacZ fusion on
pME6715 (Table 3) were grown in 20 ml of KMB broth without
selective antibiotics using 100-ml Erlenmeyer flasks sealed with
cellulose stoppers. For inoculation, 200 µl of a suspension of
washed cells (OD at 600 nm adjusted to 2) from overnight KMB
broth cultures of the bacterial strains were used. Cultures were
incubated at 30°C with rotational shaking at 180 rpm, and β-galactosidase-specific activities of at least three independent cultures were determined by the method of Miller (Sambrook and
Russell 2001). The experiment was done twice.
Quantification of DAPG and PLT production.
Production of DAPG and PLT was assessed for bacteria
grown in 500-ml Erlenmeyer flasks with 100 ml of KMB broth.
For inoculation, 1-ml aliquots of overnight cultures of the bacterial strains grown in KMB broth at 30°C and adjusted to an OD
at 600 nm of 2.0 were used. Cultures were incubated at 30°C
with rotational shaking at 180 rpm. DAPG and PLT were extracted with ethyl acetate from acidified culture supernatants and
quantified by established high-performance liquid chromatography procedures as described before (Keel et al. 1992; Maurhofer
et al. 1992, 1994). The experiment was repeated twice.
Plant disease suppression and root colonization assays.
For the plant assays, aliquots of 60 g of natural sandy loam
soil from Eschikon, Switzerland (Keel et al. 2002) were distributed into 200-ml Erlenmeyer flasks with wide openings.
When appropriate, the soil was artificially infested with the
pathogenic oomycete P. ultimum 67-1 by adding 2.5 g of a 5day-old millet-seed inoculum (Maurhofer et al. 1992; Keel et
al. 2002) of the pathogen per kilogram of soil. Three sterilegrown, 72-h-old cucumber seedlings (Cucumis sativus cv. Chinese Snake) then were placed in each flask as previously described (Keel et al. 2002). P. fluorescens strains were added to
soil as a suspension (5 ml per flask) of cells washed twice in
sterile distilled water to give 1 × 107 CFU/g of soil. Control
flasks received the same amount of sterile water. Seedlings
were covered with 10 g of nontreated soil and flasks were
sealed with cotton stoppers. The microcosms were incubated
in a randomized block design in a growth chamber containing
80% relative humidity and 22°C with light (200 µmol sec–1 m–
2
; ratio of 1.37 of light at 660 to 730 nm) for 16 h, followed by
an 8-h dark period at 15°C. No watering was necessary. At 6
days after inoculation, the percentage of surviving plants was
determined. Plants were removed from the flasks, washed,
briefly dried with paper towels, and weighed. Roots from each
flask were pooled and transferred into 50-ml plastic tubes containing 20 ml of sterile distilled water. Tubes were vigorously
shaken at 240 rpm for 30 min and the resulting suspensions
were used to determine CFU numbers. In a subset of experiments, root colonization also was determined at 2 and 3 days
after bacterial inoculation. Data represent the means from six
270 / Molecular Plant-Microbe Interactions
individual repetitions of the same experiment with 5 to 10 replicates per treatment in each experiment (1 replicate corresponds to one flask containing three cucumber plants). Data
were analyzed for significance with variance analysis, followed
by Fisher’s least significant difference test. Data for CFU counts
were log10-transformed prior to statistical analysis.
ACKNOWLEDGMENTS
We thank C. Gigot-Bonnefoy, B. Wackwitz, V. Dénervaud, N. Burger, F.
Adamer, N. Wenger, C. Genoud, and P. Michaux for help with some of the
experiments; M. Adrian (Laboratoire d’Analyse ultrastructurale, Université de Lausanne) for electron microscopy; and the Swiss National Foundation for Scientific Research (project 3100-061360.00/1) and the Swiss
Federal Office of Education and Science (project C99.0032, European
COST action 830) for their support.
LITERATURE CITED
Alarcón-Chaidez, F. J., and Bender, C. L. 2001. Analysis of the rpoN locus
in the plant pathogenic bacterium Pseudomonas syringae pv. glycinea.
DNA Seq. 12:77-84.
Alarcón-Chaidez, F. J., Keith, L., Zhao, Y., and Bender, C. L. 2003. RpoN
(σ54) is required for plasmid-encoded coronatine biosynthesis in Pseudomonas syringae. Plasmid 49:106-117.
Bangera, M. G., and Thomashow, L. S. 1999. Identification and characterization of a gene cluster for synthesis of the polyketide antibiotic 2,4diacetylphloroglucinol from Pseudomonas fluorescens Q2-87. J.
Bacteriol. 181:3155-3163.
Bao, Y., Lies, D. P., Fu, H., and Roberts, G. P. 1991. An improved Tn7based system for the single-copy insertion of cloned genes into chromosomes of gram-negative bacteria. Gene 109:167-168.
Barrios, H., Valderrama, B., and Morett, E. 1999. Compilation and analysis of σ54-dependent promoter sequences. Nucleic Acids Res. 72:43054313.
Boucher, J. C., Schurr, M. J., and Deretic, V. 2000. Dual regulation of
mucoidy in Pseudomonas aeruginosa and sigma factor antagonism.
Mol. Microbiol. 36:341-351.
Brodhagen, M., Henkels, M. D., and Loper, J. E. 2004. Positive autoregulation and signaling properties of pyoluteorin, an antibiotic produced by
the biological control organism Pseudomonas fluorescens Pf-5. Appl.
Environ. Microbiol. 70:1758-1766.
Buck, M., Gallegos, M. T., Studholme, D. J., Guo, Y. L., and Gralla, J. D.
2000. The bacterial enhancer-dependent σ54 (σN) transcription factor. J.
Bacteriol. 182:4129-4136.
Cases, I., and de Lorenzo, V. 2001. The limits to genomic predictions: role
of σN in environmental stress survival of Pseudomonas putida. FEMS
Microbiol. Ecol. 35:217-221.
Cases, I., Pérez-Martín, J., and de Lorenzo, V. 1999. The IIANtr (PtsN) protein of Pseudomonas putida mediates the C source inhibition of the σ54dependent Pu promoter of the TOL plasmid. J. Biol. Chem. 274:1556215568.
Cases, I., Ussery, D. W., and de Lorenzo, V. 2003. The σ54 regulon (sigmulon) of Pseudomonas putida. Environ. Microbiol. 5:1281-1293.
Chatterjee, A., Cui, Y., Yang, H., Collier, A., Alfano, J. R., and Chatterjee,
A. K. 2003. GacA, the response regulator of a two-component system,
acts as a master regulator in Pseudomonas syringae pv. tomato DC3000
by controlling regulatory RNA, transcriptional activators and alternate
sigma factors. Mol. Plant-Microbe Interact. 16:1106-1117.
Cook, R. J., Thomashow, L. S., Weller, D. M., Fujimoto, D., Mazzola, M.,
Bangera, G., and Kim, D. 1995. Molecular mechanisms of defense by
rhizobacteria against root disease. Proc. Natl. Acad. Sci. U.S.A.
92:4197-4201.
Delany, I., Sheehan, M. M., Fenton, A., Bardin, S., Aarons, S., and
O’Gara, F. 2000. Regulation of production of the antifungal metabolite
2,4-diacetylphloroglucinol in Pseudomonas fluorescens F113: genetic
analysis of phlF as a transcriptional repressor. Microbiology 146:537546.
Duffy, B. K., and Défago, G. 1999. Environmental factors modulating antibiotic and siderophore biosynthesis by Pseudomonas fluorescens biocontrol strains. Appl. Environ. Microbiol. 65:2429-2438.
Haas, D., Blumer, C., and Keel, C. 2000. Biocontrol ability of fluorescent
pseudomonads genetically dissected: importance of positive feedback
regulation. Curr. Opin. Biotechnol. 11:290-297.
Haas, D., and Keel, C. 2003. Regulation of antibiotic production in rootcolonizing Pseudomonas spp. and relevance for biological control of
plant disease. Annu. Rev. Phytopathol. 41:117-153.
Härtig, E., and Zumft, W. G. 1998. The requirement of RpoN (sigma factor σ54) in denitrification by Pseudomonas stutzeri is indirect and restricted to the reduction of nitrite and nitric oxide. Appl. Environ.
Microbiol. 64:3092-3095.
Heeb, S., Blumer, C., and Haas, D. 2002. Regulatory RNA as mediator in
GacA/RsmA-dependent global control of exoproduct formation in
Pseudomonas fluorescens CHA0. J. Bacteriol. 184:1046-1056.
Heeb, S., Itoh, Y., Nishijyo, T., Schnider, U., Keel, C., Wade, J., Walsh, U.,
O’Gara, F., and Haas, D. 2000. Small, stable shuttle vectors based on
the minimal pVS1 replicon for use in gram-negative, plant-associated
bacteria. Mol. Plant-Microbe Interact. 13:232-237.
Hendrickson, E. L., Guevera, P., and Ausubel, F. M. 2000a. The alternative
sigma factor RpoN is required for hrp activity in Pseudomonas syringae pv. maculicola and acts at the level of hrpL transcription. J.
Bacteriol. 182:3508-3516.
Hendrickson, E. L., Guevera, P., Peñaloza-Vazquez, A., Shao, J., Bender,
C., and Ausubel, F. M. 2000b. Virulence of the phytopathogen Pseudomonas syringae pv. maculicola is rpoN dependent. J. Bacteriol.
182:3498-3507.
Hendrickson, E. L., Plotnikova, J., Mahajan-Miklos, S., Rahme, L. G., and
Ausubel, F. M. 2001. Differential roles of the Pseudomonas aeruginosa
PA14 rpoN gene in pathogenicity in plants, nematodes, insects, and
mice. J. Bacteriol. 183:7126-7134.
Heurlier, K., Dénervaud, V., Pessi, G., Reimmann, C., and Haas, D. 2003.
Negative control of quorum sensing by RpoN (σ54) in Pseudomonas
aeruginosa PAO1. J. Bacteriol. 185:2227-2235.
Hogan, D. A., and Kolter, R. 2002. Pseudomonas-Candida interactions:
An ecological role for virulence factors. Science 296:2229-2232.
Howell, C. R., and Stipanovic, R. D. 1980. Suppression of Pythium ultimum-induced damping-off of cotton seedlings by Pseudomonas fluorescens and its antibiotic, pyoluteorin. Phytopathology 70:712-715.
Ishimoto, K. S., and Lory, S. 1989. Formation of pilin in Pseudomonas
aeruginosa requires the alternative sigma factor (RpoN) of RNA polymerase. Proc. Natl. Acad. Sci. U.S.A. 86:1954-1957.
Jin, S., Ishimoto, K., and Lory, S. 1994. Nucleotide sequence of the rpoN
gene and characterization of two downstream open reading frames in
Pseudomonas aeruginosa. J. Bacteriol. 176:1316-1322.
Jishage, M., Iwata, A., Ueda, S., and Ishihama, A. 1996. Regulation of
RNA polymerase sigma subunit synthesis in Escherichia coli: intracellular levels of four species of sigma subunit under various growth conditions. J. Bacteriol. 178:5447-5451.
Jurado, P., Fernandez, L. A., and de Lorenzo, V. 2003. Sigma 54 levels and
physiological control of the Pseudomonas putida Pu promoter. J.
Bacteriol. 185:3379-3383.
Keel, C., and Défago, G. 1997. Interactions between beneficial soil bacteria and root pathogens: mechanisms and ecological impact. Pages 27-46
in: Multitrophic Interactions in Terrestrial Systems. A. C. Gange and V.
K. Brown, eds. Blackwell Science, London.
Keel, C., Schnider, U., Maurhofer, M., Voisard, C., Laville, J., Burger, U.,
Wirthner, P., Haas, D., and Défago, G. 1992. Suppression of root diseases by Pseudomonas fluorescens CHA0: importance of the bacterial
secondary metabolite 2,4-diacetylphloroglucinol. Mol. Plant-Microbe
Interact. 5:4-13.
Keel, C., Ucurum, Z., Michaux, M., Adrian, M., and Haas, D. 2002. Deleterious impact of a virulent bacteriophage on survival and biocontrol
activity of Pseudomonas fluorescens strain CHA0 in natural soil. Mol.
Plant-Microbe Interact. 15:567-576.
Keel, C., Weller, D. M., Natsch, A., Défago, G., Cook, R. J., and
Thomashow, L. S. 1996. Conservation of the 2,4-diacetylphloroglucinol
biosynthesis locus among fluorescent Pseudomonas strains from diverse
geographic locations. Appl. Environ. Microbiol. 62:552-563.
Keel, C., Wirthner, P., Oberhänsli, T., Voisard, C., Burger, U., Haas, D.,
and Défago, G. 1990. Pseudomonads as antagonists of plant pathogens
in the rhizosphere: Role of the antibiotic 2,4-diacetylphloroglucinol in
the suppression of black root rot of tobacco. Symbiosis 9:327-341.
King, E. O., Ward, M. K., and Raney, D. E. 1954. Two simple media for
the demonstration of pyocyanin and fluorescein. J. Lab. Clin. Med.
44:301-307.
Köhler, T., Alvarez, J. F., and Harayama, S. 1994. Regulation of the rpoN,
ORF102 and ORF154 genes in Pseudomonas putida. FEMS (Fed. Eur.
Microbiol. Soc.) Microbiol. Lett. 115:177-184.
Köhler, T., Curty, L. K., Barja, F., van Delden, C., and Pechère, J. C. 2000.
Swarming of Pseudomonas aeruginosa is dependent on cell-to-cell signaling and requires flagella and pili. J. Bacteriol. 182:5990-5996.
Köhler, T., Harayama, S., Ramos, J. L., and Timmis, K. N. 1989. Involvement of Pseudomonas putida RpoN sigma factor in regulation of various metabolic functions. J. Bacteriol. 171:4326-4333.
Kraus, J., and Loper, J. E. 1995. Characterization of a genomic region required for production of the antibiotic pyoluteorin by the biological
control agent Pseudomonas fluorescens Pf-5. Appl. Environ. Microbiol.
61:849-854.
Maurhofer, M., Baehler, E., Notz, R., Martinez, V., and Keel, C. 2004.
Cross talk between 2,4-diacetylphloroglucinol-producing biocontrol
pseudomonads on wheat roots. Appl. Environ. Microbiol. 70:19901998.
Maurhofer, M., Keel, C., Haas, D., and Défago, G. 1994. Pyoluteorin production by Pseudomonas fluorescens strain CHA0 is involved in the
suppression of Pythium damping-off of cress but not of cucumber. Eur.
J. Plant Pathol. 100:221-232.
Maurhofer, M., Keel, C., Haas, D., and Défago, G. 1995. Influence of
plant species on disease suppression by Pseudomonas fluorescens strain
CHA0 with enhanced antibiotic production. Plant Pathol. 44:40-50.
Maurhofer, M., Keel, C., Schnider, U., Voisard, C., Haas, D., and Défago,
G. 1992. Influence of enhanced antibiotic production in Pseudomonas
fluorescens strain CHA0 on its disease suppressive capacity.
Phytopathology 82:190-195.
Merrick, M. J. 1993. In a class of its own—The RNA polymerase sigma
factor σ54 (σN). Mol. Microbiol. 10:903-909.
Michiels, J., Van Soom, T., D’Hooghe, I., Dombrecht, B., Benhassine, T.,
de Wilde, P., and Vanderleyden, J., 1998. The Rhizobium etli rpoN locus: DNA sequence analysis and phenotypical characterization of rpoN,
ptsN, and ptsA mutants. J. Bacteriol. 180:1729-1740.
Notz, R., Maurhofer, M., Schnider-Keel, U., Duffy, B., Haas, D., and
Défago, G. 2001. Biotic factors affecting expression of the 2,4-diacetylphloroglucinol biosynthesis gene phlA in Pseudomonas fluorescens
biocontrol strain CHA0 in the rhizosphere. Phytopathology 91:873881.
Nowak-Thompson, B., Chaney, N., Wing, J. S., Gould, S. J., and Loper, J.
E. 1999. Characterization of the pyoluteorin biosynthetic gene cluster
of Pseudomonas fluorescens Pf-5. J. Bacteriol. 181:2166-2174.
Raaijmakers, J. M., Vlami, M., and de Souza, J. T. 2002. Antibiotic production by bacterial biocontrol agents. Antonie van Leeuwenhoek Int. J.
Gen. Mol. Microbiol. 81:537–547.
Rashid, M. H., and Kornberg, A. 2000. Inorganic polyphosphate is needed
for swimming, swarming, and twitching motilities of Pseudomonas
aeruginosa. Proc. Natl. Acad. Sci. U.S.A. 97:4885-4890.
Reitzer, L., and Schneider, B. L. 2001. Metabolic context and possible
physiological themes of σ54-dependent genes in Escherichia coli.
Microbiol. Mol. Biol. Rev. 65:422-444.
Sage, A. E., Vasil, A. I., and Vasil, M. L. 1997. Molecular characterization
of mutants affected in the osmoprotectant-dependent induction of phospholipase C in Pseudomonas aeruginosa PAO1. Mol. Microbiol. 23:4356.
Sambrook, J., and Russell, D. W. 2001 Molecular Cloning: A Laboratory
Manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY, U.S.A.
Sarniguet, A., Kraus, J., Henkels, M. D., Muehlchen, A. M., and Loper, J.
E. 1995. The sigma factor σS affects antibiotic production and biological control activity of Pseudomonas fluorescens Pf-5. Proc. Natl. Acad.
Sci. U.S.A. 92:12255-12259.
Schnider, U., Keel, C., Blumer, C., Troxler, J., Défago, G., and Haas, D.
1995. Amplification of the house-keeping sigma factor in Pseudomonas
fluorescens CHA0 enhances antibiotic production and improves biocontrol abilities. J. Bacteriol. 177:5387-5392.
Schnider-Keel, U., Bang Lejbølle, K., Baehler, E., Haas, D., and Keel, C.
2001. The sigma factor AlgU(AlgT) controls exopolysaccharide production and tolerance towards desiccation and osmotic stress in the biocontrol agent Pseudomonas fluorescens CHA0. Appl. Environ.
Microbiol. 67:5683-5693.
Schnider-Keel, U., Seematter, A., Maurhofer, M., Blumer, C., Duffy, B.,
Gigot-Bonnefoy, C., Reimmann, C., Notz, R., Défago, G., Haas, D.,
and Keel, C. 2000 Autoinduction of 2,4-diacetylphloroglucinol biosynthesis in the biocontrol agent Pseudomonas fluorescens CHA0 and repression by the bacterial metabolites salicylate and pyoluteorin. J.
Bacteriol. 182:1215-1225.
Stanisich, V. A., and Holloway, B. W. 1972. A mutant sex factor of Pseudomonas aeruginosa. Genet. Res. 19:91-108.
Stover, C. K., Pham, X. Q., Erwin, A. L., Mizoguchi, S. D., Warrener, P.,
Hickey, M. J., Brinkman, F. S., Hufnagle, W. O., Kowalik, D. J., Lagrou,
M., Garber, R. L., Goltry, L., Tolentino, E., Westbrock-Wadman, S.,
Yuan, Y., Brody, L. L., Coulter, S. N., Folger, K. R., Kas, A., Larbig, K.,
Lim, R., Smith, K., Spencer, D., Wong, G. K., Wu, Z., Paulsen, I. T.,
Reizer, J., Saier, M. H., Hancock, R. E., Lory, S., and Olson, M. V.
2000. Complete genome sequence of Pseudomonas aeruginosa PAO1,
an opportunistic pathogen. Nature 406:959-964.
Studholme, D. J., and Buck, M. 2000. The biology of enhancer-dependent
transcriptional regulation in bacteria: insights from genome sequences.
FEMS (Fed. Eur. Microbiol. Soc.) Microbiol. Lett. 186:1-9.
Thomashow, L. S., and Weller, D. M. 1995. Current concepts in the use of
introduced bacteria for biological disease control. Pages 187-235 in:
Vol. 18, No. 3, 2005 / 271
Plant-Microbe Interactions, Vol. 1. G. Stacey and N. Keen, eds. Chapman
and Hall, Inc., New York.
Thompson, L. S., Webb, J. S., Rice, S. A., and Kjelleberg, S. 2003. The alternative sigma factor RpoN regulates the quorum sensing gene rhlI in
Pseudomonas aeruginosa. FEMS (Fed. Eur. Microbiol. Soc.)
Microbiol. Lett. 220:187-195.
Totten, P. A., Lara, J. C., and Lory, S. 1990. The rpoN gene product of
Pseudomonas aeruginosa is required for expression of diverse genes,
including the flagellin gene. J. Bacteriol. 172:389-396.
Valverde, C., Heeb, S., Keel, C., and Haas, D. 2003. RsmY, a small regulatory RNA, is required in concert with RsmZ for GacA-dependent expression of biocontrol traits in Pseudomonas fluorescens CHA0. Mol.
Microbiol. 50:1361-1379.
Vieira, J., and Messing, J. 1991. New pUC-derived cloning vectors with
different selectable markers and DNA replication origins. Gene
100:189-194.
Voisard, C., Bull, C., Keel, C., Laville, J., Maurhofer, M., Schnider, U.,
Défago, G., and Haas, D. 1994. Biocontrol of root diseases by Pseudomonas fluorescens CHA0: Current concepts and experimental approaches.
Pages 67-89 in: Molecular Ecology of Rhizosphere Microorganisms. F.
272 / Molecular Plant-Microbe Interactions
O’Gara, D. Dowling, and B. Boesten, eds. VCH Publishers, Weinheim,
Germany.
Wang, C., Ramette, A., Punjasamarnwong, P., Zala, M., Natsch, A.,
Moënne-Loccoz, Y., and Défago, G. 2001. Cosmopolitan distribution of
phlD-containing dicotyledonous crop-associated biocontrol pseudomonads of worldwide origin. FEMS (Fed. Eur. Microbiol. Soc.) Microbiol.
Ecol. 37:105-116.
Zuber, S., Carruthers, F., Keel, C., Mattart, A., Blumer, C., Pessi, G.,
Gigot-Bonnefoy, C., Schnider-Keel, U., Heeb, S., Reimmann, C., and
Haas, D. 2003. GacS sensor domains pertinent to the regulation of exoproduct formation and to the biocontrol potential of Pseudomonas fluorescens CHA0. Mol. Plant-Microbe Interact. 16:634-644.
AUTHOR-RECOMMENDED INTERNET RESOURCES
The EMBnet EMBOSS database: www.ch.embnet.org/EMBOSS/index.html
United States Department of Energy Pseudomonas fluorescens genome
website: genome.jgi-psf.org/draft_microbes/psefl/psefl.home.html
The Pseudomonas Genome Project Pseudomonas aeruginosa database:
www.pseudomonas.com
(Blank page)
National Environmental Research Institute
The National Environmental Research Institute, NERI, is a research institute of the Ministry of the Environment.
In Danish, NERI is called Danmarks Miljøundersøgelser (DMU).
NERI's tasks are primarily to conduct research, collect data, and give advice on problems related to the environment and nature.
Addresses:
URL: http://www.dmu.dk
National Environmental Research Institute
Frederiksborgvej 399
PO Box 358
DK-4000 Roskilde
Denmark
Tel: +45 46 30 12 00
Fax: +45 46 30 11 14
Management
Personnel and Economy Secretariat
Monitoring, Advice and Research Secretariat
Department of Policy Analysis
Department of Atmospheric Environment
Department of Marine Ecology
Department of Environmental Chemistry and Microbiology
Department of Arctic Environment
National Environmental Research Institute
Vejlsøvej 25
PO Box 314
DK-8600 Silkeborg
Denmark
Tel: +45 89 20 14 00
Fax: +45 89 20 14 14
Monitoring, Research and Advice Secretariat
Department of Marine Ecology
Department of Terrestrial Ecology
Department of Freshwater Ecology
National Environmental Research Institute
Grenåvej 12-14, Kalø
DK-8410 Rønde
Denmark
Tel: +45 89 20 17 00
Fax: +45 89 20 15 15
Department of Wildlife Ecology and Biodiversity
Publications:
NERI publishes professional reports, technical instructions, and the annual report in Danish.
A R&D projects' catalogue is available in an electronic version on the World Wide Web.
Included in the annual report is a list of the publications from the current year.
(Blank page)
National Environmental Research Institute
Ministry of the Environment
ISBN 87-7772-XXX-X
Molecular and ecological factors affecting survival and activities
of the biocontrol agent Pseudomonas fluorescens CHA0
Biological control is a potential alternative to chemically based disease
control. Among bacteria especially pseudomonads have been found
to be prospective candidates for biological control against root pathogenic fungi. However, the environment in which the protection must
take place is complex, and a major problem for practical application
of pseudomonad biocontrol agents is variable biocontrol activity and
poor survival after addition to soil due to variable biotic and abiotic
factors. The aim of this thesis is to investigate factors and mechanisms
controlling the activity and viability of pseudomonads intended for
biological control of plant pathogenic fungi. The well-characterized
soil bacterium Pseudomonas fluorescens CHA0 was used as model
strain throughout the work.