Title: Translation, Protein Synthesis and Mutations Models
Author: Ninah Butler
Subject Area(s): Biology
Grade(s): 9-12
Description of Lesson: The models that are attached are based on the POGIL method
of inquiry. Students are given a diagram, figure, or other manipulative and from
analyzing this they gain knowledge on that topic.
Length of Lesson: Each module takes from 20-45 minutes
Student Objectives: See standards below
Materials:
For the teacher: POGIL worksheets
For each group: POGIL worksheets
For the class: POGIL worksheets
Procedure: See below.
Scientific Explanation: Students learn the structure of DNA and RNA through
manipulation of models and diagrams. Because this is an active method as opposed to
lecture or reading the information is learned to a greater depth.
Assessment: Completion of the worksheet and application of the information to the next
model.
Missouri and Kansas Standards Addressed:
Kansas Science Standards:
Standard 3, Benchmark 2: The student will demonstrate an
understanding of chromosomes, genes, and the molecular basis of heredity.
Missouri Science Standards (GLE’s):
Strand 3,E: Protein structure and function are coded by the DNA
(Deoxyribonucleic acid) molecule.
a. Explain how the DNA code determines the sequence of amino acids necessary for
protein synthesis
b. Recognize the function of protein in cell structure and function (i.e., enzyme action,
growth and repair of body parts, regulation of cell division and differentiation)
Model 4: Translation & Protein Synthesis
The mRNA leaves the nucleus and attaches to the ribosomes in the cytoplasm. It
attaches in groups of 3 bases, known as a CODON. A second type of RNA, known as
tRNA (TRANSFER) is found in the cytoplasm. This molecule has a unique folded
structure, with a 3 base sequence known as an ANTICODON exposed along one side,
allowing it to join with a matching codon from mRNA. The tRNA also has an amino acid
attached at one end. The amino acid that is attached is determined by the 3 base
anticodon sequence.
Critical Thinking Questions
1. What is the group of 3 bases on an mRNA molecule known as?
2. What is the group of 3 bases on a tRNA molecule known as?
3. What does the “t” stand for in tRNA?
4. What is attached to a free end of tRNA?
5. If the mRNA codon is ACG, what would the matching tRNA anticodon be?
6. After the mRNA codon and tRNA anticodon have matched up what happens to
the tRNA?
7. What happens to the individual amino acids that have been brought to the
ribosome by the tRNA and what do the amino acids form?
8. Why would the process of the tRNA molecule matching the mRNA molecule be
known as translation?
9. Where did the mRNA base sequence (code) come from?
10. If the mRNA code is transcribed incorrectly what would happen during translation
and protein synthesis and what is this type of mistake known as?
Model 5: Protein Synthesis
Materials:
•
DNA Template Worksheet:
o
•
Anti-Codon Worksheet:
o
•
These can only be read by the rRNA.
Paper:
o
•
These will be kept on your desk at all times. After all, DNA cannot leave
the nucleus.
For the transcription and translation process.
Pen/Pencil
Procedures:
1. Create groups of three and have students select jobs from the following list:
1. mRNA:
2. rRNA:
3. tRNA:
2. Have the DNA template in the ‘nucleus’. The mRNA must come here to make
copies of the sequence.
3. A student is to pick up a DNA template card, write down the DNA template card
number, and transcribe it into mRNA.
4. mRNA will return to the group and the rRNA will write out the tRNA Anti-Codon
sequence and break it into triplets this will be given to the tRNA.
5. The tRNA student will search out the correct Anti-Codon and will write down the
word.
6. After completing the sentence mRNA will return to the teacher to have the
sentence checked. If not correct, have the group go over the same DNA
template. If correct, give students their ‘protein’ and have them transcribe another
sentence.
Note: Every sentence must have a start (ATG) and a stop (TAG) codon.
Anti-Codon List
UAG = Stop (period) CCG = is
AUG = Start (Capital) CCU = subject
CGC = water
CGG = every
AAA = Your
AAC = mother
ACG = funny
ACA = breath
AGU = Beatles
AUC = band
CAC = rubber
CCA = when
CUC = love
GAA = all
GAU = and
GCG = fun
GGC = to
GUA = a
GUU = nothing
UAU = this
UCG = be
UGC = you
UUA = DNA
UUU = life
CGA = drink
CGU = day
AAG = wears
AAU = dresses
ACC = have
ACU = dog
AGA = the
AGG = are
AGC = best
AUA = rock
AUU = an
CAA = old
CAG = breaks
CAU = pulled
CCC = Biology
CUA = I
CUG = roll
CUU = music
GAC = demented
GAG = puppies
GCA = so
GCC = much
GCU = education
GGA = door
GGG = future
GGU = father
GUC = dress
GUG = brother
UAA = we
UAC = in
UCA = together
UCC = must
UCU = informed
UGA = around
UGG = read
UGU = little
UUC = code
UUG = for
DNA Fragments
1. ATGAAAAACAAGGTACACATCTAG
2. ATGAAAAACAATTGCACGTAG
3. ATGTAAACCACTACATAG
4. ATGAGAAGTAGGAGAAGCATAATCTAG
5. ATGATTCAACACATCCAGCCACATTAG
6. ATGCCCCCGAGAAGCCCTTAG
7. ATGCGACGCCGGCGTTAG
8. ATGCTACTCATAGATCTGCTTTAG
9. ATGTAAAGGGAAGACGAGTAG
10. ATGCCCCCGGCAGCCGCGTAG
11. ATGGCTCCGAGAGGAGGCAGAGGGTAG
12. ATGAAAGGTAAGGTAGTCTAG
13. ATGAAAGTGAAGGTTTAG
14. ATGTAAAGGGAATACTATTCATAG
15. ATGTAATCCTCGTCTCGGCGTTAG
16. ATGATAGATCTGCTTCCGAGAAGCTAG
17. ATGCCCCCGGAATGATGCTAG
18. ATGTGGGTATGTCGGCGTTAG
19. ATGTTACCGAGATTCTTGTTTTAG
20. ATGTTATCCTCGTGGTTGTTTTAG
Key for the sentences 20 Sentences
1. Your mother wears a rubber band.
2. Your mother dresses you funny.
3. We have dog breath.
4. The Beatles are the best rock band.
5. An old rubber band breaks when pulled.
6. Biology is the best subject.
7. Drink water every day.
8. I love rock and roll music.
9. We are all demented puppies.
10. Biology is so much fun.
11. Education is the door to the future.
12. Your father wears a dress.
13. Your brother wears nothing.
14. We are all in this together.
15. We must be informed every day.
16. Rock and roll music is the best.
17. Biology is all around you.
18. Read a little every day.
19. DNA is the code of life.
20. DNA must be read for life.
Model 6: Mutations
If a base in the genetic code is switched, this is known as a POINT MUTATION. If a
base is left out, this is known as a DELETION and if a base is added in to the sequence,
this is known as an INSERTION. Both of these lead to a FRAME SHIFT. Since the
bases are read in sets of 3 (CODON), an insertion or deletion results in the shifting of
the reading frame, resulting in a change to the entire code from that point onwards.
Mutation #1
Mutation # 2
Critical Thinking Questions
1. Identify the 5’-3’ strand below the original DNA template.
2. What strand is used by the tRNA to build a peptide?
3. What type of mutation is mutation #1?
4. What type of mutation is mutation #2? (be specific)
5. Which type of mutation (point mutation or frame shift) would have a greater effect
on the protein produced? Why?
6. Which would have the greatest effect: a frame shift at the start of the code or a
frame shift at the end of the code?
7. Show what an INSERTION mutation would look like. Create a model of this
mutation using the original strand; include mRNA, tRNA & the final peptide
sequence.