Journal of Experimental Botany, Vol. 52, No. 360, pp. 1417±1425, July 2001
Arabidopsis thaliana ecotype Cvi shows an increased
tolerance to photo-oxidative stress and contains a new
chloroplastic copperuzinc superoxide dismutase isoenzyme
Dolores Abarca1, Marta RoldaÂn2, Mercedes MartõÂn and Bartolome Sabater
Departamento de BiologõÂa Vegetal, Facultad de BiologõÂa, Universidad de AlcalaÂ, 28871-Madrid, Spain
Received 20 September 2000; Accepted 26 February 2001
Abstract
A new chloroplastic CuuZn-superoxide dismutase
(SOD) isoenzyme was identified in Arabidopsis thaliana ecotype Cvi. Genetic analyses indicated that the
new isoenzyme was encoded by a Cvi-specific allele
of Csd2 that was named Csd2-2. Paraquat treatments
of A. thaliana ecotypes Ler and Cvi resulted in higher
levels of chloroplastic CuuZn-SOD activity in Cvi, suggesting that the Cvi isoenzyme has a higher stability
anduor turnover rate than the Ler variant under photooxidative conditions. In addition, Cvi showed a higher
tolerance to paraquat treatments. Hybrid plant
populations expressing Csd2-2 also exhibited an
increased tolerance, suggesting that the Cvi isoenzyme is one of the factors that contribute to a
better fitness in photo-oxidative stress conditions.
Key words: Arabidopsis thaliana Cvi, chloroplast, CuuZnsuperoxide dismutase, photo-oxidative stress.
Introduction
Plants are continually exposed to environmental ¯uctuations that lead to oxidative stress. Part of the damage
caused by conditions such as intense light, drought,
temperature stress, air pollutants etc. is associated with
oxidative damage at the cellular level. The direct cause of
oxidative stress is an increase in the production of reactive
oxygen species (ROS). ROS are formed mainly in chloroplasts where, even in non-stressful conditions, light harvesting and electron transport lead to the formation of
singlet oxygen and superoxide anion radical (Levine,
1999).
To improve the tolerance to environmental oxidative
stress it is essential to have an extensive knowledge of the
1
2
components of the plant antioxidative system, their roles
and relative contributions to the response to different
oxidative stress situations. Plant cells contain a number of
enzymatic and non-enzymatic ROS detoxifying agents
that are distributed in most cellular compartments and
have been well characterized (Bowler et al., 1992; Casano
et al., 1994). Special attention has been given to superoxide dismutases (SOD, EC 1.15.1.1), which are key elements of the protective system since they catalyse the
dismutation of superoxide radical to O2 and H2O2, a
reaction that constitutes the ®rst cellular defence against
many oxidative stress situations (Bowler et al., 1994).
Plant cells contain three SOD types that differ in their
metal ligands: Mn-, Fe- and CuuZn-SODs. Mn-SODs are
located in mitochondria, Fe-SODs are in chloroplasts and
CuuZn-SODs have been found in both cytosol and
chloroplasts (reviewed in Bowler et al., 1994). SOD activity has been reported to increase in response to stress
conditions such as high irradiance, low temperature, air
pollutants, etc. (Tsang et al., 1991; Scandalios, 1993). The
importance of SODs in plant response to oxidative stress
has been analysed using transgenic plants overexpressing Sod genes. This approach has yielded plants with
enhanced resistance to oxidative stress, suggesting that
SOD activity is an important factor in plant tolerance
to such stress conditions (reviewed in Holmberg and
BuÈlow, 1998).
An alternative approach to study the plant antioxidative system would be to characterize plants from
particular climatic regions. By comparing the results
obtained with plants adapted to different environmental
conditions, it would be possible to assess the importance
of the different components of their antioxidative system
in the response to particular oxidative stress conditions.
The availability of Arabidopsis thaliana (L.) Heynh.
ecotypes from distant regions of the world provides
To whom correspondence should be addressed. Fax: q34 91 8855066. E-mail: [email protected]
Present address: IBMCP, CSIC-UPV, Camino de Vera sun, 46022-Valencia, Spain.
ß Society for Experimental Biology 2001
1418
Abarca et al.
an easy experimental system for such an approach.
A. thaliana was originally isolated in northern Europe
(ReÂdei, 1992), a region belonging to the temperate bioclimatic zone where the spring average monthly precipitation is around 100 mm, the annual global radiation
is 300±400 3 108 kJ ha 1 and average spring temperatures
range from 2±21 8C (Schultz, 1995; The Washington Post
historical weather database in www.weatherpost.com).
Ecotypes such as Ler, that have been traditionally used
for genetic studies, come from that region. There are,
however, many accessions in the seed banks that were
collected in other geographical regions. Among them, the
ecotype Cvi, from the Cape Verde islands, represents
the accession that was isolated in the region closest to
the ecuator (Lobin, 1983). The Cape Verde islands are
located in the tropical bioclimatic zone. Their situation
in the Atlantic ocean, separated from the continent,
gives rise to speci®c ecological conditions, so that Cape
Verde is included in the Macaronesian ¯oristic region,
together with the Azores, Madeira and Canary islands
(Takhtajan, 1986). Cape Verde is the driest area of the
region, with an average monthly precipitation around
9.4 mm during the rainy season. Average temperatures
in that period range from 23±28 8C, and the annual
global radiation is around 700 3 108 kJ ha 1 (Schultz,
1995; The Washington Post historical weather database
in www.weatherpost.com). In short, Cvi, compared to
Ler, is adapted to drier conditions, higher temperatures and higher irradiance levels. Not surprisingly, the
response of Ler and Cvi to stress factors such as ozone or
freezing has been reported to be different, and genetic
approaches to determine the bases for these differences
are in progress in several research groups (Alonso-Blanco
and Koornneef, 2000, and references therein; Rao et al.,
2000).
The different levels of freezing tolerance in Ler and
Cvi suggest that their antioxidative systems might be
adapted to different kinds of stress. Indeed, the sequence
of the Csd2 gene, which encodes a chloroplastic CuuZnSOD in A. thaliana ecotype Col (Kliebenstein et al.,
1998), is different in Ler and Cvi (Abarca et al., 1999). In
this report, a new chloroplastic CuuZn-SOD isoenzyme is
described that is encoded by a Cvi-speci®c Csd2 allele.
Ecotype Cvi and two hybrid plant populations expressing
this allele show an increased tolerance to paraquat treatments, suggesting that chloroplastic CuuZn-SOD activity
is one of the factors that contribute to a better ®tness
in photo-oxidative stress conditions.
Materials and methods
Plant material and growth conditions
Arabidopsis thaliana (L.) Heynh. ecotypes Columbia (Col),
Landsberg erecta (Ler) and Cape Verdi Islands (Cvi) were
provided by JM MartõÂnez-Zapater (CIT-INIA, Spain). Seeds
were strati®ed at 4 8C for 4 d on vermiculite:sphagnum (1 : 1,
v : v) and then transferred to a growth chamber at 23 8C with a
lightudark regime of 16u8 h. Light intensity was 100 mE m 2 s 1.
Plants were irrigated with mineral nutrient solution (Haughn
and Somerville, 1986).
SOD activity assays
Whole leaf extracts were prepared as follows: leaves were
homogenized (approximately 2 ml of homogenization buffer g 1
of fresh leaves) in 0.1 M potassium phosphate buffer pH 7.0;
1 mM EDTA; 1% polyvinylpyrrolidone; 0.1% Triton X-100;
15% glycerol; 0.1 M phenylmethanesulphonyl ¯uoride; 0.05%
b-mercaptoethanol (vuv). The mixture was centrifuged at
10 000 g for 5 min. For SOD activity assays, 40±100 mg protein
samples were fractionated by native PAGE at 4 8C, in 12%
acrylamide gels containing 10% glycerol. Activity was detected
in gels by the photochemical nitro-blue tetrazolium staining
method (Beauchamp and Fridovich, 1971). Inhibitor studies to
identify the different kinds of SOD isoforms were as described
earlier (Kanematsu and Asada, 1990). For quanti®cation of
relative activities, chloroplastic CuuZn-SOD isoforms were
separated from cytosolic CuuZn-SOD in 10±16% acrylamide
gradient gels. Activities were quanti®ed with a digital image
analyser (UVP Easy, Cambridge, UK) and expressed as
percentages of the values obtained in control samples. In all
cases, activities were quanti®ed within the linear range of detection. Statistical signi®cance of SOD activity variations was
determined by analysis of variance of results from linear
regression analyses.
DNA analysis
Total DNA was extracted from leaves as described previously
(Doyle and Doyle, 1990). For Csd2 polymorphism detection, a
0.64 kbp DNA fragment containing a region of the Csd2
genomic sequence was ampli®ed with primers D2-6 (ACAATAGTGGACAATCAGGTT) and D2-2 (GACAAGATCAACACAGTAGAC), and digested with HindIII. When Ler genomic
DNA was used as a template, two fragments of 0.55 and
0.09 kbp were obtained. When the template DNA was from
Cvi, the digestion yielded three fragments of 0.35, 0.20 and
0.09 kbp. A weak 0.29 kbp band that was sometimes observed
in Cvi samples corresponded to a partially digested fragment.
Photo-oxidative stress treatments
All treatments were carried out using plants in the vegetative
growth phase. Low temperature incubations were performed at
4 8C under the lightudark regime of the growth chamber, and
were timed so that treated plants were always collected at the
end of the light period. For high light intensity treatments, plants
were transferred to constant illumination at 200 mE m 2 s 1.
For foliar paraquat applications, 50±100 plants were sprayed
with 0±14 mM paraquat solutions in 0.01% Tween-20 and
transferred to continuous high light (200 mE m 2 s 1) for 24 h.
Plants were subsequently returned to standard growth conditions in the growth chamber, where they were maintained for a
further 7 d. During that time, seriously affected plants became
completely dry and surviving plants developed new leaves.
For the in vitro paraquat tolerance test, plants were cut at the
crown and placed in Petri dishes containing 0±400 nM paraquat
in 0.01% Tween-20, so that all the leaves were in contact with
the liquid. Dishes were placed under continuous high light
New chloroplastic CuuZn-SOD isoenzyme 1419
2
1
(200 mE m s ) for 24 h. After the treatments, chlorophylls
were extracted in 95% ethanol at 4 8C in the dark and quanti®ed
as described earlier (Lichtenthaler, 1987). Chlorophyll contents
were referred to fresh weight and expressed as percentages of
the values obtained for uncut, untreated plants. Alternatively,
treated plants were collected and used to extract RNA for
expression studies or to evaluate SOD activity. Control experiments were performed to ensure that cutting the plants did not
cause increases in Csd2 expression or SOD activity levels.
RNA extraction and Northern blot analysis
Total RNA was obtained by phenoluSDS extraction and LiCl
precipitation (Ausubel et al., 1990). RNA was fractionated
in formaldehyde gels, transferred to Zeta-Probe nylon membranes (BioRad) and hybridized following standard procedures
(Sambrook et al., 1989). Digoxigenin probe labelling and
detection were performed according to the protocol provided
by the manufacturer (Roche Molecular Biochemicals). For
hybridizations with Csd2, a 0.75 kpb cDNA fragment from Ler
containing the complete open reading frame of Csd2-1 was
PCR-ampli®ed with primers D2-1 (CGTCCGCTCATTTCCTCCAA) and D2-2 (see above). To detect Pal1 transcripts, a 1.0 kb
DNA fragment containing part of the coding region (Leyva
et al., 1995) was ampli®ed and used as a probe. Relative transcript levels were quanti®ed with a digital image analyser (see
above) and corrected for total RNA loading. Indicated numeric
data are means of three independent experiments.
Results
A new allele of Csd2 encodes a chloroplastic
CuuZn-SOD isoform characteristic of Arabidopsis
thaliana ecotype Cvi
Four major SOD activities have been described in total
leaf protein extracts from A. thaliana ecotype Col using
native PAGE enzyme assays (Kliebenstein et al., 1998).
These activities correspond, from slow to fast migration,
to a Mn-SOD, an Fe-SOD, a chloroplastic CuuZn-SOD,
and a cytosolic CuuZn-SOD (Kliebenstein et al., 1998).
As an approach to study the antioxidative systems of
A. thaliana ecotypes Ler and Cvi, their SOD isoenzymatic
patterns were compared with that of ecotype Col. Native
PAGE enzyme assays of soluble leaf protein extracts
revealed that, in all cases, four activity bands were
detected (Fig. 1). The patterns obtained for Col and Ler
were identical, and corresponded to that described for
Col (Kliebenstein et al., 1998). In contrast, Cvi extracts
showed a different pro®le in which the band corresponding to the chloroplastic CuuZn-SOD in Col and Ler
extracts (CZ1) was not detected, and a new band of
lower mobility appeared (CZ3). Subcellular fractionation (Casano et al., 1994) and preincubation with SOD
inhibitors (results not shown) revealed that the new band
detected in Cvi extracts was a chloroplastic CuuZn-SOD.
To analyse the genetic basis of the different SOD
pro®les in Ler and Cvi, hybrid plants resulting from
crosses between the two ecotypes were generated, and
SOD isoenzymatic patterns were analysed in protein
extracts from individual plants of the F1 and F2 progeny.
In F1 plants from crosses in either direction, three putative
chloroplastic CuuZn-SODs were detected (Fig. 2A, lane
b). Two of them (bands CZ1 and CZ3) had the same
mobility as the parental-speci®c isoforms, while a third
(CZ4) migrated to an intermediate position, and could
therefore represent an active heterodimeric form. Analysis of the SOD pro®le in F2 plants (Fig. 2A, lanes
d±k) revealed a Mendelian segregation of the two isoforms: from a total of 69 F2 plants tested, a 18 :35: 16
distribution of the Ler:hybrid :Cvi phenotypes was
obtained, indicating that the chloroplastic CuuZn-SOD
Fig. 1. SOD isoenzymatic pro®les of A. thaliana ecotypes Col, Ler and
Cvi. Protein extracts (100 mg) were fractionated by native PAGE. SOD
activity was developed as described in Materials and methods. Mn.- MnSOD; Fe.- Fe-SOD; CZ1.- Chloroplastic CuuZn-SOD detected in Col
and Ler; CZ2.- Cytosolic CuuZn-SOD; CZ3.- Cvi-speci®c chloroplastic
CuuZn-SOD.
Fig. 2. Csd2 segregation in F2 plants. (A) CuuZn-SOD activities detected
in Ler, Cvi, one F1 and eight F2 plants. Equal protein amounts (100 mg)
were loaded per lane. CZ1 to CZ3 are as in Fig. 1. CZ4.- Chloroplastic
CuuZn-SOD speci®c of hybrid plants. (B) DNA polymorphism between
Csd2-1 (Ler) and Csd2-2 (Cvi) in plants shown in (A) Size markers (in
kbp) are indicated on the left. The sizes of the DNA fragments obtained
are indicated on the right. For details, see Materials and methods.
1420
Abarca et al.
detected in Cvi leaf extracts represented a Cvi-speci®c
variant of the isoform detected in Ler.
Chloroplastic CuuZn-SOD is encoded by the Csd2 gene
in A. thaliana ecotype Col (Kliebenstein et al., 1998). The
Csd2 genomic sequences for ecotypes Ler and Cvi have
been previously reported (Abarca et al., 1999). A comparison of the two sequences with the Col gene revealed
nucleotide differences in the Cvi gene that originated two
amino acid changes in the deduced polypeptide sequence.
These changes lead to an increase in the isoelectric point
(Abarca et al., 1999) that would cause a reduction in the
mobility of the protein in native PAGE. The fact that the
chloroplastic CuuZn-SOD detected in Cvi had a lower
mobility than the Ler variant (Fig. 1, bands CZ3 and
CZ1) suggested that the two isoenzymes could be encoded
by two different alleles of the Csd2 gene. To verify this
hypothesis, the Csd2 genotype was determined in plants
with different chloroplastic CuuZn-SOD combinations
using a polymorphism between the Ler and Cvi genes
(see Materials and methods). Analysis of the F1 and F2
progeny of crosses between the two ecotypes showed that,
in all cases, plants with the high mobility isoenzyme
contained the Ler-speci®c Csd2 gene, while plants with
the low mobility variant presented the Cvi-type gene.
A mixture of the two genes was detected in all plants with
a hybrid phenotype (Fig. 2B). These results indicated that
the two chloroplastic CuuZn-SOD isoenzymes detected
in protein extracts from Ler and Cvi were encoded by
two Csd2 alleles that were named Csd2-1 and Csd2-2,
respectively.
Csd2 responds to mild photo-oxidative stress
Chloroplastic SODs are involved in the defense
against light-related oxidative stress (Bowler et al., 1992;
Scandalios, 1993; Casano et al., 1994). In order to study
Csd2 response to mild photo-oxidative stress conditions
in Ler and Cvi, its expression was analysed in plants
exposed to low temperature or incubated under high light
intensity (see Materials and methods). Northern hybridization revealed differences between the two ecotypes
(Fig. 3A, upper panel). In control plants, the relative
transcript levels were higher in Cvi (lanes a and j). As
a response to the treatments, Csd2 mRNA levels evolved
differently in the two ecotypes. Low temperature induced
a progressive mRNA accumulation in Ler that reached a
6-fold after 48 h (lanes a±e). In the case of Cvi, low temperature resulted in a reduction in the relative transcript
levels, with a transient recovery at 24 h (lanes k±n).
Incubation under high light intensity resulted in a weak
mRNA increase in Ler (lanes f±i), while it caused
a decrease in Cvi after 24 h (lanes o±r). Thus, Ler
responded to both stress conditions with an increase
in Csd2 mRNA. In contrast, reduced transcript levels
were detected in Cvi after the treatments. To ensure that
Fig. 3. Analysis of Csd2 response to mild photo-oxidative stress in Ler
and Cvi. (A) Northern blot hybridizations with Csd2 (upper panel) and
Pal1 (middle panel) probes (see Materials and methods). The lower
panel shows ethidium-bromide staining of the RNA on the membrane.
Ler (lanes a±i) and Cvi (lanes j±r) plants were incubated for 12, 24, 36 or
48 h at 4 8C (Low temp, lanes b±e and k±n) or under high light intensity
(High light, lanes f±i and o±r). Control plants (lanes a and j) were
maintained in the growth chamber for 48 h. Twenty micrograms of total
RNA were loaded per lane. (B) Relative chloroplastic CuuZn-SOD
activity detected in plants treated as in (A). Activities are expressed as
percentages of the control plant values (C). Bars represent the mean
("SE) of three independent experiments. Signi®cant differences
(P-0.03). Highly signi®cant differences (P-0.001).
these differences were not due to a higher response threshold in Cvi, that is, that the mild stress treatments were
causing stress to both ecotypes, the RNA samples were
hybridized with a Pal1 probe. Pal1 encodes a phenylalanine ammonia-lyase and responds to low temperature
and light treatments in A. thaliana (Leyva et al., 1995).
In this case, transcript increases were detected in both
ecotypes after the treatments (Fig. 3A, middle panel). The
response was higher in Cvi, with maximum Pal1 mRNA
accumulation after a 36 h exposure to low temperature,
indicating that the mild stress conditions used here were
suf®cient to elicit a response in this ecotype.
As a complementary assay to study Csd2 response to
low temperature and high light intensity, chloroplastic
CuuZn-SOD activity was analysed in Ler and Cvi after
the treatments (Fig. 3B). Low temperature induced a
transient activity decrease in both ecotypes that was
followed by a progressive increase. A 48 h exposure to
New chloroplastic CuuZn-SOD isoenzyme 1421
low temperature resulted in a 35% and 40% activity
increase in Ler and Cvi, respectively. On the other hand,
incubation under high light intensity caused a progressive activity reduction in Ler, reaching a 34% reduction
after 48 h. In Cvi, the treatment did not cause signi®cant
activity variations.
A comparison between Csd2 mRNA levels and chloroplastic CuuZn-SOD activity after the photo-oxidative
treatments revealed further differences between the two
ecotypes. In Ler, a 6-fold increase in mRNA level after
low temperature treatments resulted in a 35% activity
increase. Upon exposure to high light, the activity
decreased even though mRNA levels increased. In the
case of Cvi, mRNA levels decreased after the treatments,
yet the activity increased up to 40% at low temperature or
remained constant after high light exposure. Thus, Ler
seemed to require higher Csd2 mRNA levels than Cvi
to maintain or increase the activity under mild photooxidative stress conditions. This disparity suggests a
complex regulation of chloroplastic CuuZn-SOD activity,
and could be related to an unequal stability of the two
isoenzymes in photo-oxidative conditions (Casano et al.,
1997) or to the effect of other protective mechanisms.
Tolerance to paraquat is higher in Cvi
The different response of the two chloroplastic CuuZnSOD isoenzymes to mild photo-oxidative conditions
suggested that Ler and Cvi could have different levels
of tolerance to photo-oxidative stress. To analyse that
possibility the effect of paraquat, a herbicide that causes a
light-dependent increase in the production of superoxide
radical in chloroplasts, was tested in Ler and Cvi. Plants
sprayed with different concentrations of paraquat were
incubated for 24 h under high light (see Materials and
methods), and then returned to the growth chamber for
1 week. The evaluation of survival rates showed reductions in Ler plant populations treated with as low as
8 mM paraquat (Fig. 4A). In contrast, concentrations up
to 12 mM had no effect in Cvi survival, indicating that Cvi
had a higher tolerance to in vivo foliar applications of
the herbicide.
To analyse the different response of Ler and Cvi to
paraquat treatments further, an in vitro tolerance test was
devised in which plants were cut at the crown, placed in
Petri dishes containing paraquat solutions and exposed
to high light for 24 h (see Materials and methods).
Tolerance to the herbicide was evaluated by measuring
chlorophyll contents after the treatments. In cut plants
incubated in the absence of paraquat, a 20% chlorophyll
reduction was detected in both Ler and Cvi (Fig. 4B) that
represented the chlorophyll loss due to the exposure of
cut plants to high light. In Ler, paraquat caused chlorophyll losses that were proportional to the herbicide concentrations and reached an 80% in plants treated with
Fig. 4. Tolerance to paraquat in Ler and Cvi. (A) Survival percentages
of Ler and Cvi plant populations after foliar applications of 0 to 14 mM
paraquat (see Materials and methods). Bars represent the mean ("SE)
of three independent experiments. (B) Chlorophyll content of Ler and
Cvi plants after in vitro treatments with 0±400 nM paraquat (for details,
see Materials and methods). Values are expressed as percentages of the
chlorophyll content of uncut, untreated plants. Bars represent the mean
("SE) of four independent experiments.
400 nM paraquat. In contrast, Cvi plants treated with up
to 200 nM paraquat did not show alterations in their
chlorophyll content, and higher herbicide concentrations
caused reductions that reached a 40% in plants treated
with 400 nM paraquat. Taken together, these results
indicate that tolerance to paraquat is higher in Cvi,
suggesting that its antioxidative system is better suited to
respond to strong photo-oxidative stress conditions.
Csd2-1 and Csd2-2 could be associated to
different levels of paraquat tolerance
Since the chloroplasts are the main target of paraquat
toxicity in the light, chloroplastic CuuZn-SOD activity
could be important for the herbicide tolerance. The in
vitro tolerance test was used to analyse Csd2 response to
paraquat treatments in Ler and Cvi. Northern hybridization showed that Csd2 mRNA levels suffered similar
variations in the two ecotypes (Fig. 5A). Incubation with
50 nM paraquat induced an increase in the relative
mRNA levels (5-fold in Ler and 2-fold in Cvi). Transcript levels were maintained close to control values
at 100±200 nM paraquat, and were reduced by half at
300 nM paraquat. At all paraquat concentrations, the
relative mRNA levels were higher in Cvi.
1422
Abarca et al.
Fig. 6. Tolerance to paraquat in homozygous F3 populations. Survival
percentages of F3 plant populations homozygous for Csd2-1 (L1 and L2)
or Csd2-2 (C1 and C2) were evaluated after foliar application of
0±14 mM paraquat. Bars represent the mean ("SE) of two independent
experiments.
survival (Fig. 4A). These results suggest that Csd2-2
could be involved in Cvi tolerance to paraquat, although
other elements of the Cvi antioxidative system appear
to be required to reach maximum tolerance.
Fig. 5. Csd2 response to paraquat treatments. (A) Northern blot
hybridization analysis. Total RNA (20 mg) from Ler or Cvi plants
treated in vitro with 0±300 nM paraquat was hybridized with a Csd2
probe (upper panel). The lower panel shows ethidium-bromide staining
of the RNA in the membrane (B). Relative chloroplastic CuuZn-SOD
activity detected in plants treated as in (A). Results from one
representative experiment are shown (upper panel). In the lower panel,
activities are expressed as percentages of the activity detected in plants
incubated without paraquat. Bars represent the mean ("SE) of three
independent experiments.
Chloroplastic CuuZn-SOD activity was also analysed
in paraquat-treated plants (Fig. 5B). In Ler, the herbicide
caused activity losses that reached 40% in plants treated
with 300 nM paraquat. In contrast, the treatments
induced activity increases in Cvi that reached 55% with
200 nM paraquat. Again, a comparison of the relative
mRNA and activity pro®les suggested a higher stability
or turnover rate of the Cvi isoenzyme. This difference
could contribute to the higher paraquat tolerance detected
in Cvi. To study that possibility, paraquat tolerance was
evaluated in plants that were homozygous for Csd2-1
or Csd2-2 and had different genetic backgrounds. Four
homozygous F3 plant populations, containing either
Csd2-1 or Csd2-2, were exposed to foliar paraquat applications. The analysis was performed using the progenies of
two F2 plants of each genotype that were selected using
both native PAGE and DNA polymorphism analysis,
and showed that survival rates were lower in plant
populations containing Csd2-1 (Fig. 6, L1 and L2) than
in plant populations containing Csd2-2 (C1 and C2).
Interestingly, Csd2-2 plants exhibited lower levels of paraquat tolerance than Cvi, since herbicide concentrations
between 8 and 12 mM caused slight reductions in survival
rates in these plants, while they did not affect Cvi
Discussion
The ecotypes Ler and Cvi represent two A. thaliana
varieties adapted to different climatic regions and, therefore, equipped to respond to particular stress situations.
In this report, the response of Ler and Cvi to photooxidative stress was studied using paraquat treatments
under high light intensity. The data presented here indicate that Cvi can tolerate higher herbicide concentrations
after either foliar applications or in vitro treatments. In
as much as paraquat enhances the effect of exposure to
high light intensity, these results are consistent with the
idea that Cvi is better adapted than Ler to respond to
high irradiance, and suggest that this difference could
be related to a higher superoxide detoxifying capability
in Cvi chloroplasts in that particular stress situation.
The chloroplastic CuuZn-SOD activities detected in
Ler and Cvi leaf extracts were found to be encoded by
two Csd2 alleles. Expression analyses in the two ecotypes
showed that the basal Csd2 transcript levels were higher
in Cvi. Analysis of Csd2 response to mild photo-oxidative
stress revealed that, in both ecotypes, incubation at low
temperature induced an increase in chloroplastic CuuZnSOD activity. This increase was supported by an increase
in the mRNA level in Ler, but not in Cvi. On the other
hand, high light treatments induced higher mRNA
levels in Ler, while lower mRNA levels were detected in
Cvi. However, the activity suffered a moderate decrease
in Ler and was maintained at control levels in Cvi. This
apparent disparity could be explained by a different
stability of the two isoenzymes. Damage to CuuZn-SOD
by ROS has been well documented (Casano et al., 1997).
New chloroplastic CuuZn-SOD isoenzyme 1423
ROS increases associated to the mild stress treatments
used in this work could have a higher detrimental effect in
the activity of the Ler variant. Thus, higher mRNA levels
would be required in Ler to increase the enzymatic activity at low temperature and to maintain the activity levels
in high light intensity.
Upon exposure to the strong photo-oxidative conditions caused by paraquat, the differences in Csd2 response
between Ler and Cvi were more conspicuous. Treatments
with 50 nM paraquat induced mRNA increases in both
ecotypes that were higher in Ler, 100±200 nM paraquat
had no apparent effect in Ler and caused a slight reduction in Cvi, and 300 nM paraquat caused a strong
reduction in the mRNA levels in both Ler and Cvi. In
contrast, the relative enzymatic activity decreased in Ler
at all paraquat concentrations, while it increased in Cvi
plants exposed to paraquat concentrations up to 200 nM,
and was maintained at control values at higher herbicide
concentrations. Again, these results suggested a higher
stability of the Cvi isoenzyme under stress conditions.
The possibility of obtaining plants homozygous for the
two Csd2 alleles in different genetic backgrounds provided the means to study a possible contribution of
chloroplastic CuuZn-SOD to paraquat tolerance. Analysis
of four homozygous F3 populations revealed that plants
containing Csd2-2 were more tolerant than plants containing Csd2-1, suggesting that the two chloroplastic
CuuZn-SOD isoenzymes could be associated to different
levels of paraquat tolerance. This is consistent with the
fact that paraquat toxicity is mediated by superoxide
production. Tolerance to paraquat has been correlated
with high levels of antioxidative enzymes in resistant
biotypes (Amsellem et al., 1993; Scandalios, 1993) and
transgenic plants (Sen Gupta et al., 1993a; Perl et al.,
1993; Slooten et al., 1995; Van Camp et al., 1996;
McKersie et al., 2000). The role of Csd2-2 in paraquat
tolerance could be based on several possibilities. Since the
mRNA levels are higher in Cvi, both in untreated plants
and after treatments with any herbicide concentration, a
higher turnover rate of the protein could be afforded in
this ecotype in conditions in which, due to the production
of superoxide radical, the stability of the enzyme is
reduced (Casano et al., 1997). In addition, a different
stability of the two isoenzymes under stress-related ROS
increases, as suggested by the disparity between mRNA
and activity levels after the treatments, could contribute to the better performance of the Cvi isoenzyme. A
similar situation has been described in maize: superoxide
increases induced by cercosporin led to accumulation of
Sod transcripts, but SOD activity remained constant,
suggesting that protein turnover might play a key role
in the response of the different SODs to ROS (Scandalios,
1993). Lastly, an increased tolerance to paraquat in plants
containing Csd2-2 could also be related to biochemical
peculiarities of its gene product, since the two amino acids
that are different in the Cvi isoenzyme are located near
the two poles of the active centre (Bordo et al., 1994)
and map in regions that seem to be important for the
enzymatic activity (Abarca et al., 1999).
Analysis of paraquat tolerance in F3 homozygous
plant populations revealed that Csd2-2 plants were more
sensitive than Cvi, indicating that other factors might
contribute to paraquat tolerance. This is to be expected,
since high levels of SOD activity should be complemented
with an ef®cient hydrogen peroxide detoxifying system in
order to offer an adequate protection. This has been
reported in transgenic plants overexpressing SOD, in
which increased levels of peroxidase activity were detected
(Sen Gupta et al., 1993b). A similar situation has been
described for a Conyza bonariensis variety with high levels
of tolerance to paraquat; in this plant, the genetic basis of
herbicide tolerance was found to be restricted to a single
gene that controls the expression of both SOD and
peroxidase encoding genes (Amsellem et al., 1993). In
addition, differences in paraquat tolerance have been
related to higher glutathione reductase activity (Amsellem
et al., 1993) or to a reduced paraquat uptake (Preston
et al., 1992). These and other factors, such as a higher
capability of excess light energy dissipation, or higher
concentrations of superoxide scavengers such as phenolic compounds, hydroquinones or carotenoids (Foyer
et al., 1994; Salin, 1987) could contribute to the natural
tolerance of Cvi to paraquat treatments.
Paraquat tolerance has also been related to peroxidase
and NADH dehydrogenase activities in barley chloroplasts (Casano et al., 1999). The chloroplastic NADH
dehydrogenase complex, which is encoded in the plastid
genome by the Ndh genes, seems to be involved in the
poising of the cyclic electron transport and in the protection against photo-oxidative stress (Casano et al., 2000).
Differences in the Ler and Cvi sequences for the NdhG
gene have been previously described (MartõÂnez et al.,
1997). Whether these differences have an effect on the
activity of the complex remains to be proved; if that were
the case, this could be an additional source of enhanced
tolerance in Cvi.
In addition to differences at the chloroplast level, other
peculiarities of the Cvi ecotype could be involved in its
high tolerance to photo-oxidative stress. After ozone
exposure, a high level of salicylic acid (SA) accumulation
that leads to a hypersensitive response-like cell death has
been reported for Cvi (Rao and Davis, 1999). This effect
has been attributed to a reduced sensitivity to jasmonic
acid, which acts as a negative modulator of the SA
response pathway (Rao et al., 2000). A direct relationship
between ozone and photo-oxidative stress responses
seems unlikely, since ROS production after ozone
decomposition takes place mainly in the apoplast
(Sandermann, 1996) and the oxidative burst associated
to SA accumulation appears to initiate at the plasma
1424
Abarca et al.
membrane level (Chen et al., 1993). However, since hydrogen peroxide can diffuse among subcellular compartments, cross-talk between light- and defence-signalling
pathways probably occurs. In fact, a systemic acquired
resistance-like response to high light has been described
in A. thaliana that appears to involve hydrogen peroxide signalling (Karpinski et al., 1999). It is not known
whether this response involves SA. If that were the case,
it would be interesting to quantify SA accumulation in
Ler and Cvi after photo-oxidative stress.
In summary, the results presented here show that two
A. thaliana ecotypes adapted to different light regimes
have different levels of tolerance to paraquat that could
be related, at least in part, to the possession of speci®c
chloroplastic CuuZn-SOD isoenzymes. Further genetic
analyses will be required to con®rm this point. The identi®cation of other features that contribute to the better
response of Cvi to light-related stress will make it possible
to improve the tolerance of less tolerant ecotypes such
as Ler, and will lead to a better understanding of the
mechanisms used by plants to respond to oxidative stress.
Acknowledgements
The authors wish to thank C Bartolome and J Alvarez for advice
on bioclimatic and ¯oristic regions, L Casano for helpful hints
on SOD activity assays and C DõÂaz-Sala for critical reading of
the manuscript. This work was supported by the Spanish
DGICYT (Grant PB96-0675).
References
Abarca D, MartõÂn M, Sabater B. 1999. Two genomic sequences
encoding chloroplastic CuuZn superoxide dismutases from
Arabidopsis thaliana ecotypes Ler (Acc. No. AJ238521) and
Cvi (Acc. No. AJ238522). PGR99-089. Plant Physiology
120, 933.
Alonso-Blanco C, Koornneef M. 2000. Naturally occurring
variation in Arabidopsis: an underexploited resource for plant
genetics. Trends in Plant Science 5, 22±29.
Amsellem Z, Jansen MAK, Driesenaar ARJ, Gressel J. 1993.
Developmental variability of photo-oxidative stress tolerance in paraquat-resistant Conyza. Plant Physiology
103, 1097±1106.
Ausubel FH, Brent R, Kingston RE, Moore DD, Smith JA,
Seidman JG, Struhl K. (eds) 1990. Current protocols in
molecular biology. Greene Publishing Associates, 4.3.1.
Beauchamp CO, Fridovich I. 1971. Superoxide dismutase.
Improved assay and an assay applicable to acrylamide gels.
Analytical Biochemistry 44, 276±287.
Bordo D, Djinovic K, Bolognesi M. 1994. Conserved patterns in
the Cu,Zn superoxide dismutase family. Journal of Molecular
Biology 238, 366±386.
Bowler C, Van Montagu M, Inze D. 1992. Superoxide dismutase
and stress tolerance. Annual Review of Plant Physiology and
Plant Molecular Biology 43, 83±116.
Bowler C, Van Camp W, Van Montagu M, Inze D. 1994.
Superoxide dismutase in plants. Critical Reviews in Plant
Science 13, 199±218.
Casano LM, GoÂmez LD, Lascano HR, GonzaÂlez CA,
Trippi VS. 1997. Inactivation and degradation of
CuZn-SOD by active oxygen species in wheat chloroplasts
exposed to photo-oxidative stress. Plant Cell Physiology 38,
433±440.
Casano LM, MartõÂn M, Sabater B. 1994. Sensitivity of superoxide dismutase transcript levels and activities to oxidative
stress is lower in mature-senescent than in young barley
leaves. Plant Physiology 106, 1033±1039.
Casano LM, MartõÂn M, Zapata JM, Sabater B. 1999. Leaf ageand paraquat concentration-dependent effects on the levels
of enzymes protecting against photo-oxidative stress. Plant
Science 149, 13±22.
Casano LM, Zapata JM, MartõÂn M, Sabater B. 2000.
Chlororespiration and poising of cyclic electron transport.
Plastoquinone as electron transporter between thylakoid dehydrogenase and peroxidase. Journal of Biological
Chemistry 275, 942±948.
Chen Z, Silva H, Klessig DF. 1993. Active oxygen species in the
induction of plant systemic acquired resistance by salicylic
acid. Science 262, 1883±1886.
Doyle JJ, Doyle JL. 1990. Isolation of plant DNA from fresh
tissue. BRL Focus 12, 13±15.
Foyer CH, Lelandais M, Kunert KJ. 1994. Photo-oxidative stress
in plants. Physiologia Plantarum 92, 696±717.
Haughn G, Somerville C. 1986. Sulfonylurea-resistant mutants
of Arabidopsis thaliana. Molecular and General Genetics
204, 430±434.
Holmberg N, BuÈlow L. 1998. Improving stress tolerance in plants
by gene transfer. Trends in Plant Science 3, 61±66.
Kanematsu S, Asada K. 1990. Characteristic amino acid
sequences of chloroplast and cytosol isozymes of CuZnsuperoxide dismutase in spinach, rice and horsetail. Plant
Cell Physiology 31, 99±112.
Karpinski S, Reynolds H, Karpinska B, Winsgle G, Creissen G,
Mullineaux P. 1999. Systemic signaling and acclimation in
response to excess excitation energy in Arabidopsis. Science
284, 654±657.
Kliebenstein DJ, Monde RA, Last RL. 1998. Superoxide
dismutase in Arabidopsis: an eclectic enzyme family with
disparate regulation and protein localization. Plant
Physiology 118, 637±650.
Levine A. 1999. Oxidative stress as a regulator of environmental
responses in plants. In: Lerner HR, ed. Plant responses to
environmental stresses. New York: Marcel Dekker Inc,
247±264.
Leyva A, Jarillo JA, Salinas J, MartõÂnez-Zapater JM. 1995.
Low temperature induces the accumulation of phenylalanine
ammonia-lyase and chalcone synthase mRNAs of Arabidopsis
thaliana in a light-dependent manner. Plant Physiology
108, 39±46.
Lichtenthaler HK. 1987. Chlorophylls and carotenoids: pigments
of photosynthetic membranes. Methods in Enzymology
148, 350±382.
Lobin W. 1983. The occurrence of Arabidopsis thaliana in
the Cape Verde Islands. Arabidopsis Information Service
20, 119±123.
MartõÂnez P, LoÂpez C, RoldaÂn M, Sabater B, MartõÂn M. 1997.
Plastid DNA of ®ve ecotypes of Arabidopsis thaliana:
sequence of ndhG gene and maternal inheritance. Plant
Science 123, 113±122.
McKersie BD, Murnaghan J, Jones KS, Bowley SR. 2000. Ironsuperoxide dismutase expression in transgenic alfalfa
increases winter survival without a detectable increase in
photosynthetic oxidative stress tolerance. Plant Physiology
122, 1427±1437.
New chloroplastic CuuZn-SOD isoenzyme 1425
Perl A, Perl-Treves R, Galili S, Aviv D, Shalgi E, Malkin S,
Galun E. 1993. Enhanced oxidative stress defense in
transgenic potato expressing tomato Cu,Zn superoxide
dismutases. Theoretical and Applied Genetics 85, 568±576.
Preston C, Holtum JAM, Powles SB. 1992. On the mechanism of
resistance to paraquat in Hordeum glaucum and H. leporinum.
Delayed inhibition of photosynthetic O2 evolution after
paraquat application. Plant Physiology 100, 630±636.
Rao MV, Lee H, Creelman RA, Mullet JE, Davis KR. 2000.
Jasmonic acid signaling modulates ozone-induced hypersensitive cell death. The Plant Cell 12, 1633±1646.
Rao MV, Davis KR. 1999. Ozone-induced cell death occurs via
two distinct mechanisms in Arabidopsis: the role of salicylic
acid. The Plant Journal 17, 603±614.
ReÂdei GP. 1992. A heuristic glance at the past of Arabidopsis
genetics. In: Koncz C, Chua N, Schell J, eds. Methods in
Arabidopsis research. Singapore: World Scienti®c Publishing
Co Pte Ltd, 1±15.
Salin ML. 1987. Toxic oxygen species and protective systems
of the chloroplast. Physiologia Plantarum 72, 681±689.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a
laboratory manual, 2nd edn. New York: Cold Spring Harbor
Laboratory Press.
Sandermann H. 1996. Ozone and plant health. Annual Review
of Phytopathology 34, 347±366.
Scandalios JG. 1993. Oxygen stress and superoxide dismutases.
Plant Physiology 101, 7±12.
Schultz J. 1995. The ecozones of the world. Berlin: SpringerVerlag.
Sen Gupta A, Heinon JL, Holaday AS, Burke JJ, Allen RD.
1993a. Increased resistance to oxidative stress in transgenic
plants that overexpress chloroplastic CuuZn superoxide
dismutase. Proceedings of the Natural Academy of Sciences,
USA 90, 1629±1633.
Sen Gupta A, Webb RP, Holaday AS, Allen RD. 1993b.
Overexpression of superoxide dismutase protects plants from
oxidative stress. Induction of ascorbate peroxidase in superoxide dismutase-overexpressing plants. Plant Physiology
103, 1067±1073.
Slooten L, Capian K, Van Camp W, Van Montagu M, Sybesma
C, Inze D. 1995. Factors affecting the enhancement of
oxidative stress tolerance in transgenic tobacco overexpressing manganese superoxide dismutase in the chloroplasts.
Plant Physiology 107, 737±750.
Takhtajan A. 1986. Floristic regions of the world. Los Angeles,
CA: University of California Press.
Tsang EdWT, Bowler C, HeÂrouart D, Van Camp W, Villarroel R,
Genetello C, Van Montagu M, Inze D. 1991. Differential
regulation of superoxide dismutases in plants exposed to
environmental stress. The Plant Cell 3, 783±792.
Van Camp W, Capiau K, Van Montagu M, Inze D, Slooten L.
1996. Enhancement of oxidative stress tolerance in transgenic
tobacco plants overproducing Fe-superoxide dismutase in
chloroplasts. Plant Physiology 112, 1703±1714.