Allocation of Absorbed Light Energy in PSII to Thermal
Dissipations in the Presence or Absence of PsbS
Subunits of Rice
Regular Paper
Satoshi Ishida1,4, Ken-ichi Morita1,4, Masahiro Kishine1, Atsushi Takabayashi1, Reiko Murakami1,
Satomi Takeda2, Ko Shimamoto3, Fumihiko Sato1 and Tsuyoshi Endo1,*
1
Division of Integrated Life Sciences, Graduate School of Biostudies, Kyoto University, Kyoto, 606-8502 Japan
Department of Biological Science, Graduate School of Science, Osaka Prefecture University, 2-1 Daisen-cho, Sakai, 590-0035 Japan
3
Laboratory of Plant Molecular Genetics, Nara Institute of Science and Technology, Takayama 8916-5, Ikoma, Nara, 630-0192 Japan
4
These authors contributed equally to this study
*Corresponding author: E-mail, [email protected]; Fax, +81-75-753-6398
(Received July 12, 2011; Accepted August 22, 2011)
2
The thermal dissipation (TD) of absorbed light energy in PSII
is considered to be an important photoprotection process in
photosynthesis. A major portion of TD has been visualized
through the analysis of Chl fluorescence as energy quenching
(qE) which depends on the presence of the PsbS subunit.
Although the physiological importance of qE-associated TD
(qE-TD) has been widely accepted, it is not yet clear how
much of the absorbed light energy is dissipated through a
qE-associated mechanism. In this study, the fates of absorbed light energy in PSII with regard to different TD processes, including qE-TD, were quantitatively estimated by
the typical energy allocation models using transgenic rice
in which psbS genes were silenced by RNA interference
(RNAi). The silencing of psbS genes resulted in a decrease
in the light-inducible portion of TD, whereas the allocation
of energy to electron transport did not change over a wide
range of light intensities. The allocation models indicate that
the energy allocated to qE-TD under saturating light is
30–50%. We also showed that a large portion of absorbed
light energy is thermally dissipated in manners that are independent of qE. The nature of such dissipations is
discussed.
Keywords: Energy allocation in PSII Non-photochemical
quenching (NPQ) PsbS PSII Thermal dissipation of absorbed light energy.
Abbreviations: EST, expressed sequence tag; Fm (Fm0 ), the
maximum fluorescence achieved with a saturating light
pulse in the dark (or in the light); Fo (Fo0 ), the minimum
fluorescence achieved under the measuring light in the dark
(or in the light); Fs, steady-state fluorescence in the light; D,
the quantum rate of absorbed light energy in PSII allocated
to Dissipation in the Demmig-Adams model; E, the quantum rate of absorbed light energy in PSII allocated to Exess in
the Demmig-Adams model; f,D, the quantum yield of basic
dissipation in the Hendrickson model; NPQ, the quantum
yield of light-inducible dissipation in the Hendrickson model;
P = II, the quantum rate of absorbed light energy in PSII
allocated to electron transport; GAPDH, glyceraldehyde phosphate dehydrogenase; NPQ, non-photochemical quenching
of Chl fluorescence: PAR, photosynthetically active radiation;
qE, energy quenching; qI, photoinhibition; qT, state transition; qU, unknown quenching; RNAi, RNA interference; RT–
PCR, reverse transcription–PCR; TD, thermal dissipation;
UTR, untranslated region.
Introduction
Some of the excess light energy absorbed in PSII is dissipated as
heat, which can be monitored as the non-photochemical
quenching of Chl fluorescence (NPQ). This NPQ-associated
thermal dissipation (NPQ-TD) has been extensively studied as
an important photoprotection process of PSII. A major portion
of NPQ is referred to as energy quenching (qE) because it is
triggered by the light-induced generation of a pH gradient
across thylakoid membranes (for reviews, see Horton et al.
1996, Müller et al. 2001). This process has been shown to be
associated with the reversible de-epoxidation of violaxanthin to
zeaxanthin, the so-called xanthophyll cycle (Demmig-Adams
1990), and depends on the presence of PsbS, a subunit of PSII
which shows sequence similarity to light-harvesting complex
proteins (Li et al. 2000). Although previous studies showed that
not all of qE was associated with the presence of PsbS (Johnson
and Ruban 2010), in this report we define qE as PsbS-dependent
quenching.
Although the physiological importance of qE-associated TD
(qE-TD) has been widely accepted, it is not clear how much of
the absorbed light energy is dissipated through a qE-associated
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119, available online at www.pcp.oxfordjournals.org
! The Author 2011. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
All rights reserved. For permissions, please email: [email protected]
1822
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119 ! The Author 2011.
Energy allocation in PSII in PsbS-silenced rice
mechanism. The aim of this study was to quantify the allocation
of absorbed light energy to qE-dependent TD (qE-TD) and to
understand the re-distribution of absorbed energy between
antennae and reaction centers when qE is absent.
Although the parameter NPQ [= (Fm Fm0 )/Fm0 ] is a good
indicator of NPQ-TD and qE-TD, it is not suitable for a quantitative analysis of the allocation of light energy. Therefore, we
used the energy allocation models of Demmig-Adams et al.
(1996) and of Hendrickson et al. (2004), in which the allocation
of light energy to TD can be quantitatively compared with the
photochemical quantum yield of PSII (II). In this study, we
sought to evaluate these theoretical models of energy allocation
experimentally.
The fluorescence parameter II was proposed by Genty
et al. (1989) and has been shown as (Fm0 Fs)/Fm0 , which can
be easily measured by a fluorescence analysis with pulsemodulated fluorometry (Schreiber et al. 1986). Since its proposal, this parameter has been examined and justified in extensive physiological studies. As a reasonable extension of this
proposal, Demmig-Adams et al. (1996) further proposed that
the parameter Fv0 /Fm0 , which represents the portion of absorbed light energy that reaches the PSII centers, can be divided
into two categories, Photosynthesis (P = II) and Excess (E).
They defined the remaining absorbed light energy as Dissipation
(D), which represents the dissipation of energy as heat outside
of PSII centers, i.e. the core antenna of the PSII complex. This
model is based on the assumption that the value of Fv0 /Fm0
represents the energy partitioned to PSII centers, and this requires both experimental and theoretical verification before
this model can be applied generally. It should be noted that
the molecular identities of ‘antennae’ and ‘PSII centers’ in the
studies with traditional quenching analysis of Chl fluorescence
and the allocation model of Demmig-Adams based on the
quenching analysis remain obscure. Thus, ‘PSII center’ does
not literally means the P680 Chl molecule, but probably includes Chls closely associated with P680. Also, a recent study
on Arabidopsis mutants suggests that ‘antenna’ does not include the outer antenna. The Chl b-less mutants, which have a
reduced size of the outer antenna of the PSII, showed energy
allocation identical to that of the wild type (A. Takabayashi, in
preparation). This probably means that fluorescence emission
from the outer antenna is very little because of efficient energy
transfer to the inner antenna.
An alternative model for energy partitioning in 1 II was
proposed by Kramer et al. 2004, and a simplified modification
was also reported in the same year (Hendrickson et al. 2004). In
these models, the simple energy localization to the ‘antennae’
(D) and the ‘PSII centers’ (II + E) was questioned based on
the lake model of energy transduction, in which energy absorbed in antennae can leak to adjacent PSII centers. Instead,
these models categorize total dissipations (1 II) according to their origins, i.e. the basal intrinsic decay of
excited Chls (NO in the Kramer model or f,D in the
Hendrickson model) and light-dependent regulative TD
(NPQ), including PsbS-dependent TD. Recently, Kasajima
et al. (2009) demonstrated that the models proposed by
Kramer et al. (2004) and Hendrickson et al. (2004) could be
regarded as different expressions of the same model.
With the use of these energy allocation models, we estimated the proportion of qE-TD in the total energy distribution
in PSII by comparing Chl fluorescence in wild-type and
psbS-silenced rice generated for this study. Li et al. (2000,
2002) showed an interesting result, i.e. that the knockout of
PsbS in Arabidopsis did not result in an increase in II, meaning
that qE-TD did not function as a regulatory mechanism of II.
We wanted to know if this rather unexpected result could be
generalized to all other plants. We chose rice in this study because rice is a cultivated monocotyledonous plant, which is
different from Arabidopsis, a wild dicotyledonous plant.
Knockout of the psbS gene(s) in rice has been reported by
Koo et al. (2003), but the genetic background of this mutant
has not been clearly shown. Therefore, we produced new transformants in which the expression of both psbS genes in rice was
knocked down, and estimated the allocation of absorbed
energy in PSII of these transformants. As a result, the patterns
of TDs in these transformants were drastically changed in both
the Demmig-Adams model and the Hendrickson model.
Results and Discussion
Sequences of two psbS genes in rice
Two psbS genes were found in the rice genome by BLASTN
in the NCBI database (http://www.ncbi.nlm.nih.gov/) based
on the sequence of psbS of Arabidopsis thaliana. In
this study, we call the gene located on chromosome 1 psbS1
(Os01g0869800) and that on chromosome 4 psbS2
(Os04g0690800). We compared their deduced amino acid sequences (Supplementary Fig. S1A) using the CLUSTAL W algorithm (Thompson et al. 1994). The number of registered
expressed sequence tags (ESTs) in leaves (total ESTs, 171,890)
of psbS1 was 50, while that of psbS2 was six based on the NCBI
UniGene database (http://www.ncbi.nlm.nih.gov/unigene),
suggesting that psbS1 is expressed more than psbS2.
Phylogenetic analysis showed that PsbS1 had high sequence
homology with proteins from other Gramineae plants, while
PsbS2 rather resembled proteins from dicot species
(Supplementary Fig. S1B), although the bootstrap values are
too low to draw any unambiguous conclusions regarding the
rather unexpected position of psbS2.
RNAi-mediated silencing of psbSs
RNA interference (RNAi)-mediated gene silencing using 529
and 568 bp psbS1-specific fragments resulted in transgenic
lines 1&2-1 and 1&2-2, respectively. Both of these gene
fragments showed 87% sequence identity with psbS2, and
therefore silencing of both genes was expected in these transgenic lines. A 151 bp psbS2-specific fragment on the untranslated region (UTR) was also used in an RNAi construct to
generate transgenic line 2, in which only psbS2 was expected
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119 ! The Author 2011.
1823
S. Ishida et al.
to be silenced. Genomic PCR of transgenic rice clones using
primers for the pUBQ region of the pANDA vector demonstrated the presence of the transgene in all of the regenerated
plants (data not shown). The same genomic PCR in the T1
generation showed a 3 : 1 or 15 : 1 separation, in terms of transgene possession, which demonstrated that T0 plants contained
one or two copies of the transgene. In the experiments
described below, we used T1 or T2 plants which contained at
least one copy of the transgene.
Expression of psbS genes in transgenic plants
To confirm the RNAi effect, the expression of psbS genes in T2
transgenic rice was analyzed (Fig. 1A). Quantitative reverse
transcription–PCR (RT–PCR) analysis revealed that the
amounts of both psbS1 and psbS2 transcripts were significantly
reduced in the 1&2-1 and 1&2-2 lines. On the other hand,
psbS gene expression in the 2 line was not distinguishable
from that in the wild type, suggesting that gene silencing of
psbS2 in the 2 line did not work. Immunoblot analysis using
anti-PsbS antibody showed that the accumulation of PsbS protein was not detected in the 1&2-1 and 1&2-2 lines
(Fig. 1B). Two isoproteins derived from each of the homolog
genes could not be distinguished by SDS–PAGE analysis. These
results indicate that the expression of psbS genes in the 1&2-1
and 1&2-2 lines was successfully silenced by RNAi.
0.8
A
0.7
psbS1
psbS/GAPDH
0.6
psbS2
0.5
0.4
0.3
0.1
0
Wild
WT
D2-1
D1&2-1
D1&2-1
D1&2-2
D1&2-2
D2-1
Anti-PsbS
Anti-PsbO
Fig. 1 Expression of psbS genes in transgenic plants. (A) Real-time
RT–PCR. (B) Western analysis. The ratios of the average expression
levels of psbS1 and psbS2 to that of GAPDH were estimated by
real-time quantitative RT–PCR as described in the Materials and
Methods. The average values were obtained from the results of
three individual T2 and wild-type plants. (B) Immunoblot analysis of
PsbS. Thylakoid membrane proteins corresponding to 5 mg of Chl were
electrophoresed and immunodetected by antibody against PsbS.
PsbO, the extrinsic subunit of PSII, was used as a loading control.
1824
Quantification of the xanthophyll cycle pigments
zeaxanthin, violaxanthin and anthoraxanthin in 1&2-1 and
1&2-2 showed that the light-induced de-epoxidation of
violaxanthin occurred normally in these transformants
(Supplementary Fig. S2), which is the same phenotype that
was reported in the knockout mutant of psbS in Arabidopsis
(Li et al. 2000).
Suppression of NPQ and its effect on the quantum yield of
PSII (II) by RNAi of psbS genes in rice was measured under
moderate light (Fig. 2A). NPQ was clearly suppressed in the
transgenic lines 1&2-1 and 1&2-2, in which both genes were
silenced. In the 2 line, which showed no clear suppression of
gene expression, NPQ formation was comparable with that in
wild-type plants. No correlation was found between NPQ and
II, which suggests that the suppression of TD associated
with NPQ (NPQ-TD) did not increase the proportion of absorbed light energy allocated to photosynthetic electron transport, as in a PsbS-deficient mutant of Arabidopsis (Li et al.
2000) and an npq1 Arabidopsis mutant that had no functional
violaxanthin de-epoxidase (Niyogi et al. 1998, Havaux and
Niyogi 1999).
The level of reduction of QA, an electron acceptor in PSII, as
estimated by the fluorescence parameter 1 qP, is an indicator
of ‘excitation pressure’ at PSII centers. A greater reduction in
the level of QA in transgenic lines 1&2-1 and 1&2-2 than in
the wild type was found (Fig. 2B), which is also consistent
with the results obtained in a PsbS-deficient mutant of
Arabidopsis (Li et al. 2002). This result suggests that the
energy input at PSII centers increased in the PsbS-deficient
mutants, which, however, did not result in an increase in
output as electron transport. This ‘excitation pressure’ may
be quantified on a basis of quantum yields as E in the
energy allocation model of Demmig-Adams et al. (1996) as
shown below.
Allocation of absorbed light energy in PSII
estimated by the model of Demmig-Adams
et al. (1996)
0.2
B
Photosynthetic electron transport in psbS
RNAi lines
The allocation of absorbed light energy to Photosynthesis (P),
Dissipation (D) and Excess (E) was first estimated according to
Demmig-Adams et al. (1996). To avoid confusion, we use the
terms ‘Photosynthesis (P)’, ‘Dissipation (D)’ and ‘Excess (E)’ to
refer to the rate of the energy flux, and P = II, D or E as
the quantum yields of each process. Thus, for example,
P ¼ II 0:84 0:5,
where 0.5 is the assumed propotion of absorbed quanta in PSII
and 0.84 is the assumed leaf absorbance (Melis et al. 1987, Weis
and Lechtenberg 1989).
First, we wanted to know whether the quantum yield of the
D fraction (D) could be used as a good indicator of NPQ-TD.
The relationship between the parameter ‘NPQ’ and D
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119 ! The Author 2011.
Energy allocation in PSII in PsbS-silenced rice
A
B
2.5
0.7
0.6
2
0.5
1-qP
NPQ
1.5
1
0.4
0.3
0.2
0.5
0.1
0
0
0.2
0.4
φII
0.5
0.6
D
1
0.4
0.8
ΦD
0.3
y = 0.1437x + 0.2138
R2 = 0.9596
0 9596
0.2
Δ
Δ 1&2-2
Δ
Δ
Δ 1&2-2
ΦD
0.6
0.4
0.2
0.1
Δ
1.2
0.5
Yield
C
0.3
ΦE
ΦII
0
0
0
0.5
1
1.5
2
2.5
NPQ
Fig. 2 The electron transport and allocation of absorbed light energy to P (photosynthesis), D (dissipation) and E (excess) in wild-type and
psbS-silenced rice leaves (n = 7). (A) Relationship between the quantum yield of PSII (II) and NPQ. (B) Comparison of the level of reduction of
QA. (C) Relationship between NPQ and D. (D) Allocation of energy (n = 7). Diamond, wild type; circle, 2; square, 1&2-1; triangle, 1&2-2.
Leaves of 15-week-old rice were illuminated with actinic white light (400 mmol m2 s1) for 3 min, after which a saturation pulse of white light
was applied to determine Fm0 . The actinic light was then turned off and Fo0 was recorded under far-red light.
0.7
0.6
0.5
WT
0.4
ΦD
D1&2-2
0.3
0.2
0.1
0
0
500
1000
1500
2000
PAR (mmol m-2s-1)
Fig. 3 Light–response curves of D in the wild type and 1&2-2.
Leaves of 12-week-old rice were illuminated with varying intensities of
white light (80–1,600 mmol m2 s1) for 3 min to determine Chl fluorescence parameters (n = 3).
(Fig. 2C) showed that there is a close correlation between the
two fluorescence parameters. Thus, the major portion of D is
closely associated with NPQ-TD. The intercept of the y-axis may
represent the portion of D that is associated with TD in
the antennae, which may be found even in very low light (see
Figs. 3, 5).
The allocation of absorbed light energy in the RNAi lines and
the wild type is compared in Fig. 2D. Values of Fv/Fm were at the
same level in the wild type and the transgenic lines (data not
shown). In transgenic lines 1&2-1 and 1&2-2, a decrease in
D and an increase in E, as compared with the wild type and
2, were found, while II was at the same level in all lines.
Light-dependent changes in II in the wild type and these
transformants were also identical (Supplementary Fig. S3).
This means that the decrease in NPQ-TD, in transgenic plants
with little PsbS, resulted in an increase in energy dissipation in
the PSII centers, but not in an increase in photosynthetic electron transport. These results suggest that an increase in the
input at the start of energy transduction in PSII centers did
not increase the output (electron transport rate), but did increase energy dissipation at PSII centers. This also means that
the rate-limiting step in the overall electron transport system is
not the harvesting of light energy in PSII, but rather is found in
the intersystem chain or PSI under moderate or non-saturating
light [400 mmol photosynthetically active radiation (PAR)
m2 s1]. We therefore concluded that PsbS-associated TD
(qE-TD) has a role to minimize TD in closed PSII centers.
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119 ! The Author 2011.
1825
S. Ishida et al.
0.4
0.3
0.2
0.1
0
0
Evaluation of the model of Demmig-Adams et al.
We first adopted the simple allocation model to define D and
E after Demmig-Adams et al. (1996) because D and E in
this definition may be useful for distinguishing whether the
antenna or PSII center is responsible for dissipation. The lake
1826
500
1000
1500
2000
PAR (µmol m-22s-11)
B
E
A
qE-TD
Photochemistry
150
50
0
0
Light intensity-dependent changes in energy
allocation in PSII
The light intensity dependence of P, E, A and qE-TD in the wild
type were calculated to estimate the key factors that determine
energy allocation in PSII (Fig. 4). Here, the D fraction is divided
into qE-TD and A according to the assumption above. The
contribution of these factors to total light absorption
(Fig. 4A) demonstrates that qE-TD and E increased depending on the light intensity, mostly in a similar manner. Under
saturating light, about 10% of the energy is used for photosynthetic electron transport. The rate of the electron transport
under saturating light in PSII measured similarly in field conditions was about 20% (not shown). Thus the value of 10% was
probably due to the susceptibility of the plants grown in room
light to strong light. The quantum yield for each of the four
fates is shown in Fig. 4A, and the allocated energy flow to each
factor was estimated from absorbed quanta in PSII (Fig. 4B).
Within a saturating light range, an increase in light intensity is
associated with linear increases in A, qE-TD and E. TDs as A and
E, the molecular nature of which are not yet clear, are apparently as important as the well-studied qE-TD for the dissipation
of excess energy in PSII.
ΦE
ΦA
ΦqE-TD
ΦII
0.5
Yield
A comparison of D in the wild type and 1&2-2 under varying
light intensities is shown in Fig. 3. In the transgenic line
1&2-2, the D level was almost independent of light intensity,
suggesting that D in the transformant might represent an
inevitable energy loss during energy transduction from the
antennae to PSII centers. In the wild type, D increased with
PAR. Thus, in the wild type, the D fraction contained two
processes of energy transduction; one is light dependent and
is associated with qE-TD, and the other is light independent and
probably occurs in the antennae (designated as A). A very
rough estimation of qE-TD in the wild type might be given
by the difference in the D level between the wild type and
the PsbS-deficient mutant. Based on this assumption, qE-TD in
the wild type in very low light is nearly zero, and it increased
under light.
Dark values of A (= Fo/Fm) have been shown to be about 0.2
in a wide variety of photosynthetic organisms with PSII antennae composed mainly of Chls, which might mean that the
constitutive component is conserved among these species. A
slight increase in A under light might reflect involvement of
NPQ-associated factors such as qT (state transition) and qI
(photoinhibition) (Quick and Stitt 1989). Probably, a portion
of qE which is independent of PsbS might also be involved in
the increase in A under light.
A
Rate (µ
µmol m-2s-1)
Light intensity-dependent changes in D
500
1000
1500
2000
PAR (µm-2s-1)
Fig. 4 Light–response curves of the quantum yields (A) and the rates
of energy flow allocated (B) to P (photosynthesis), E (excess), A (TD in
antenna Chl) and NPD-TD (NPQ-associated TD) in wild-type rice.
Leaves of 12-week-old rice were illuminated with varying intensities
of white light (80–1,600 mmol m2 s1) for 3 min to determine Chl
fluorescence parameters (n = 3). NPQ-TD was calculated as the difference between D in the wild type and that in 1&2-2. A was represented by D in 1&2–2.
models by Kramer et al. (2004) and Hendrickson et al. (2004)
do not provide information regarding the localization of each
dissipation process (see below). We found that the energy allocation model of Demmig-Adams et al. (1996) could be
applied to elucidate the nature of D and E of wild-type and
PsbS-deficient rice. In particular, an intrinsic relationship between qE-TD and D was shown experimentally for the first
time using PsbS-deficient transformants of rice. Further, a drastic shift in the site of thermal dissipation from antennae to PSII
centers in the absence of PsbS could be visualized. Thus, this
model can be a useful tool for elucidating the fate of absorbed
light energy in PSII. However, this model needs further verification by experiments because the molecular nature of E and A
requires further elucidation. For example, we have described a
relationship between antennae and PSII centers without clear
definitions of these terms. Although both can be conveniently
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119 ! The Author 2011.
Energy allocation in PSII in PsbS-silenced rice
Although the model of Demmig-Adams et al. does not have a
rigid theoretical background, several lines of evidence support
this model.
Kato et al. (2003) demonstrated that E is closely associated
with the parameter Fv/Fm, an indicator of photoinhibition.
Thus, the E portion may be intrinsically associated with the
energy flow in or around the PSII centers.
The molecular basis of E remains obscure. When the parameter (Fm0 Fs)/Fm0 truly represents II, then the portion of absorbed light energy that is not used in photochemistry can be
expressed as 1 II = F/Fm0 (= E + D). This portion of
energy may represent total thermal dissipation in PSII, since
the absorbed light energy must be allocated either to photochemistry or to TD according to the principle of the conservation of energy. Thus, although Demmig-Adams et al. (1996) did
not identify the nature of the Excess portion of energy, the
above assumption that F/Fm0 represents total TD in PSII indicates that the E portion should be regarded as TD at or around
closed PSII centers. The direct de-excitation of Chl a to the basal
energy level should currently be regarded as a main dissipation
process, although we cannot exclude the possibility that unknown quenching mechanisms are involved in energy
dissipation.
Nature of D
The D fraction in the wild type is composed of two different
energy fates (see Fig. 4). One is light dependent and qE associated (qE-TD), and the other is light independent (A in Fig. 4).
When the value of Fv0 /Fm0 really represents the absorption of
light energy in PSII centers, D (= 1 Fv0 /Fm0 ) indicates energy
that did not reach PSII centers. Thus, D represents energy
dissipation in the antennae. Localization of PsbS protein in
the PSII complex and the site of energy quenching depending
on PsbS are a matter of debate (Bukhov et al. 2001, Niyogi et al.
2005). In this sense, it is interesting that qE-TD clearly belongs
to the D fraction, which most probably represents energy dissipation in the core antenna.
Oxborough and Baker (1997) presented a formula for calculating Fo0 from Fm, Fo and Fm0 :
0
Fo0 ¼ Fo =ðFv =Fm ¼ Fo =Fm
Þ:
From this formula, a direct relationship between D and the
parameter ‘NPQ’ can be derived:
D ¼ 1 Fv =½Fv +Fo ðNPQ+1Þ:
In a given sample, Fv and Fo values are constant during
measurement, and thus D can be determined exclusively by
1
NPQ
qN
8
0.8
6
0.6
4
0.4
2
0.2
qN
10
NPQ
Nature of E
1.2
12
distinguished by fluorescence measurements based on the allocation model, the molecular basis of the antenna- and PSII
center-dependent quenchings remains obscure. Samples with
mutant antennae and PSII centers might be the most suitable
materials for verifying and improving the present model.
0
0
0
0.2
0.4
0.6
0.8
FD
Fig. 5 Relationship between D and ‘NPQ’ or ‘qN’. The values are
calculated based on an Fv/Fm value of 0.83. NPQ = (Fm Fo)/Fo D/
(1 D) 1. qN = 1 Fm Fo/(Fm Fo)2 (1 D)2/D.
the parameter ‘NPQ’, and vice versa. Therefore, D can be regarded as an alternative indicator of NPQ. The relationship
between the parameter ‘NPQ’ and D calculated from the formula is shown in Fig. 5. At low NPQ formation (D < 0.3), the
parameter ‘NPQ’ is linearly related to D. However, under high
light where D is >0.6, ‘NPQ’ increases much more rapidly
than D.
In a similar way, another common parameter for NPQ, qN
[= 1 (Fm0 Fo0 )/(Fm Fo)], can be determined from D and
Fv/Fm (Fig. 5). In contrast to the case for NPQ, qN increases
steeply depending on the light intensity in low light ranges,
whereas the rate of this increase decreased under high light
conditions.
The molecular mechanism of NPQ-TD has been studied
extensively. However, the molecular nature of the energy loss
designated as A remains to be clarified. If most of A is due to an
inevitable loss during energy transduction from the antennae
to PSII centers, it may be difficult to control this path via future
gene engineering.
Recalculation by the energy allocation model of
Hendrickson et al. (2004)
To obtain further insight into the allocation of light energy in
PSII, we re-calculated our data used for Fig. 4 according to the
model of Hendrickson et al. (2004) (Fig. 6). In this model,
energy allocation assigned to 1 II was divided into f,D
(= Fs/Fm) and NPQ [= 1 (II + f,D)]. In the wild type rice,
constitutive TD and fluorescence (f,D) was around 0.25–0.3
over a wide range of light intensities, and was mostly independent of light intensity. In contrast, in the mutant 1&2-2, f,D
increased depending on light intensity.
Another important observation here is that quite a large
portion of energy was dissipated under high light as NPQ
even in the absence of PsbS. Therefore, we tried to calculate
the relative contribution of this portion of energy dissipation,
designated qU (unknown quenching)-related TD (qU-TD), and
qE-TD in total NPQ as shown below.
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119 ! The Author 2011.
1827
A
A 0.7
WT
0.6
ΦNPQ
Φf, D
ΦII
Yield
0.5
0.4
0.3
Relative velocity of qU
associtated disspation (ksi = 1)
S. Ishida et al.
0.1
0.08
0.06
0.04
0.02
0
B
0
0
500
1500
1000
PAR (mmol m-2s-1)
2000
B 0.7
D1&2-2
0.6
Yield
0.5
ΦNPQ
Φf, D
ΦII
0.4
C
0.3
0.2
0.1
0
0
500
1500
1000
PAR (mmol m-2s-1)
2000
Fig. 6 Light–response curves of energy allocation re-calculated according to Hendrickson et al. (2004) using the same data set as for
Fig. 4. (A) Wild type. (B) 1&2-2.
Estimation of relative velocities (rate constants) of
qE-TD using the model of Hendrickson et al.
The relative velocities (rate constant) of NPQ-TD (kNPQ) to
those of the sum of Chl a de-excitation of dark-adapted
plants (ksi) in each light intensity condition was calculated,
based on Kasajima et al. (2009). Because NPQ-TD in the
PsbS-silenced lines did not include qE, we estimated the relative
velocities of kNPQ of the PsbS-silenced lines as the relative velocities of kqU, where qU represents a portion of NPQ-TD that is
not associated with qE-TD. We hypothesized that kqU of the
PsbS-silenced lines would be similar to kqU of the wild type
under similar light conditions, and calculated the relative velocities of the rate constant of qE-TD (kqE) to those of ksi as
follows:
relative kqE ðin the wild typeÞ ¼relative kNPQ ðin the wild typeÞ
relative kqU ðin the PsbSsilenced linesÞ :
qU-TD was increased with light intensity (Fig. 7A), as well as
qE-TD (Fig. 7B). qU-TD in the wild type was estimated as
1828
Ratio of qU-associtated disspation
to NPQ-associtated disspation
0.1
Relative velocity of qEassocitated disspation (ksi = 1)
0.2
0
500
1000
1500
2000
0
500
1000
1500
2000
0
500
1000
1500
2000
1.2
1
0.8
0.6
0.4
0.2
0
0.35
0.3
0.25
0.2
0.15
0.1
0.05
0
Fig. 7 Light dependencies of two portions of NPQ-TD. (A) Velocities
of the rate constant of qU-associated TD, kqU, relative to those of the
sum of Chl a de-excitation of dark-adapted plants, ksi, in the PsbS
RNAi lines. The relative velocities of kqU were estimated under various
light conditions, based on Kasajima et al. (2009). (B) Velocities of the
rate constant of qE-TD, kqE, relative to those of ksi in the wild type. The
relative velocities of kqE were calculated based on the estimated kqU in
the PsbS RNAi lines. (C) The ratio of qU-associated dissipation to
NPQ-TD in the wild type under various light conditions. The ratio
was calculated from the values of Fig. 6A and B.
approximately 30% of NPQ-TD in low light conditions (approximately 80 mmol m2 s1), whereas that under higher
light conditions (>200 mmol m2 s1) was reduced to approximately 15% of NPQ-TD (Fig. 7C). The quantum yield of qE-TD
under saturating light in the wild-type plants was calculated to
be about 50%, which is much higher than that calculated from
the model of Demmig-Adams as shown above.
qU consisted of more than two components
The relationship of kqU to light intensity was not linear
(Fig. 7A). This suggests that qU consists of at least two components. Indeed, Quick and Stitt (1989) assumed that the components of the slowly relaxing quenching, which does not
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119 ! The Author 2011.
Energy allocation in PSII in PsbS-silenced rice
include qE, consist of qT and qI. In this study we define all qE as
PsbS dependent, but it has been reported that some portion of
total qE is independent of PsbS (Johnson and Ruban 2010).
Therefore, it should be noted that qU shown here included
the PsbS-independent qE as well as qT and qI. Considering
that photoinhibition more probably occurs under high light conditions than under low light conditions, a major component of
qU under low light conditions might be state transition or another unknown component. The efficiencies of light-dependent
induction of qU increased more rapidly than those of qE under
low light conditions (<150 mmol m2 s1) (Fig. 7A–C).
Conclusion: comparison of the two models
Rough estimations of energy allocations in PSII under saturating
light in the two models used in this study are shown in Fig. 8.
The value of f,D calculated after Hendrickson et al. (2004)
for the wild type is constant over a wide range of light intensities, which is consistent with reported results (Hendrickson
et al. 2004, Kramet et al. 2004). One of the most interesting
results obtained here is that f,D increased light dependently in
PsbS-silenced lines. Thus, it seems that qE functions to minimize the light-dependent increase in f,D, although the physiological relevance of this regulation is not clear. In the model of
Demmig-Adams, the decrease in qE in the PsbS-silenced lines
was compensated by the increase in E (Figs. 2D, 4A). As the
close association of E and photoinhibition was shown previously (Kato et al. 2003), the physiological function of qE may be
to minimize E and resulting photooxidative damage. Since the
two models used here are based on different theoretical backgrounds, it is rather difficult to compare the results derived
from both models. However, when we assume that both
models are valid, it can be said that the increase in f,D may
Demmig-Adams model
in part correspond to an increase in E in PsbS-deficient lines.
Thus, a portion of E (TD in closed PSII centers) may be due to
the basal de-excitation of excited Chl a.
One of the most important differences between the two
models is that calculated qE-TD was considerably lower in a
rough estimation based on the model of Demmig-Adams (30%
of total absorbed energy in PSII is dissipated as qE-TD under
saturating light, see Fig. 4A) than in that based on the model of
Hendrickson (50% of the energy is dissipated as qE-TD). The
lower value of qE-TD in the model of Demmig-Adams than
that in the model of Hendrickson is possibly due to a rough
assumption in the model of Demmig-Adams that the rate of
radiative (emitted as fluorescence) and non-radiative (dissipated as heat) energy de-excitation of Chl is constant in antennae and PSII centers. In antennae, a large portion of the
excitation energy may be dissipated via xanthophylls in an
exclusively non-radiative manner. Thus, qE-TD may be underestimated in the model of Demmig-Adams and, consequently,
E may be overestimated.
The fundamental difference between the two models is
whether we accept the presence of E or not. Hendrickson
et al. denied the presence of E, and claimed that the energy
was allocated to light-dependent NPQ and light-independent
f,D. This simple situation seems to be true in steady-state
photosynthesis in the wild type where E is minimal.
However, upon dark light transition, considerable fluctuation
of f,D was found (data not shown). Similarly, a light-inducible
increase in f,D was found in high fluorescence mutants (data
not shown) including the PsbS-silenced lines used here.
Therefore, it seems to be a good idea to make an integrated
model based on the Kitajima–Butler model of fluorescence
analysis in which the presence of E is assumed.
Materials and Methods
ΦE
Total dissipation
ΦNPQ
ΦqE
ΦqU
ΦD
ΦA
30
Plants
30
Seedling-derived calli of Japonica rice cv. Nipponbare (Oryza
sativa L.) were transformed by Agrobacterium tumefaciens
(strain LBA4404) according to the method of Hiei et al.
(1994). Regenerated transgenic plants were cultivated from
May to October in a greenhouse, in which the temperature
was maintained below 40 C.
Little
30
Hendrickson model
ΦqE
ΦNPQ
Total dissipation
ΦqU
Φf,D
Vector constructs
50
10
30
Fig. 8 Rough estimations of energy allocations (%) in PSII under saturation light of the wild type in the two models used in this study.
Total dissipation corresponds to 90% of the absorbed light energy in
PSII, and the remaining 10% is used for the electron transport in both
models.
Partial sequences of the psbS genes were obtained by RT–PCR.
For RT–PCR, total RNA was isolated from 2-week-old seedlings
of rice using an RNeasy Plant Mini Kit (Qiagen), and a
first-strand cDNA pool was then synthesized using
SuperScript III reverse transcriptase (Invitrogen) according to
the manufacturer’s instructions. Primers used for psbS amplification were: 1L (caccCACCAAGGAGAACGAGCTG), 2L (caccG
TAAGGAGACGGTTAAGTGGA), 8L (caccAGGACGGCATCTT
CGGCAC), 2R (GAAGGTTCACCCATCATGC) and 7R (GTCGT
CGCTGACGAACTTGC). Combination of the primers 2L and
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119 ! The Author 2011.
1829
S. Ishida et al.
2R (2) led to the synthesis of 151 bp in the 30 UTR of psbS2,
which showed <30% identity with psbS1. The combinations
1L + 7R (1&2-1) and 8L + 7R (1&2-2), respectively, resulted
in 529 and 569 bp in the coding sequence (CDS) of psbS1, both
of which showed 87% identity with psbS2. The obtained PCR
products were subcloned to pENTR/D-TOPO (Invitrogen) to
yield entry vectors. Finally, the RNA silencing vectors were constructed by the LR clonase reaction (Invitrogen) between the
entry vectors and the pANDA vector (Miki and Shimamoto
2004).
Phylogenetic analysis
Phylogenetic analyses were conducted by the Neighbor–Joining
algorithm using MEGA version 4.0 (Tamura et al., 2007)
(Supplementary Fig. S1). Bootstrap values from 1,000 replications are shown at the tree nodes. Non-conserved sequences at
the N-terminus (51 amino acid residues of PsbS1 and the corresponding residues of the homologs) were removed for the
alignment of mature sequences of PsbSs.
Real-time quantitative RT–PCR
Total RNA was extracted from leaves of 1-month-old wild-type
and T2 plants using an RNeasy PlantMini Kit (Qiagen), and 1 mg
of total RNA was used as a template for cDNA synthesis using
SuperScript III reverse transcriptase (Invitrogen) following the
manufacturer’s instructions.
For real-time RT–PCR, gene-specific primers were used to
amplify psbS1 (50 -TGAACACCGCAGCAG-30 and 50 -ATTGGCT
CCCGACACCA-30 ), psbS2 (50 -GATGCCGATGATGGTAGT
GTC-30 and 50 -TGTTCGACTTGTCCACCTTG-30 ) and glyceraldehyde phosphate dehydrogenase (GAPDH; 50 -TGAAGGACTG
GAGAGGTGGA-30 and 50 -GACTGTGGGAACACGGAAAG-30 ).
Real-time RT–PCR was performed using iQ SYBR green supermix (Bio-Rad) and a DNA Engine Opticon Continuous
Fluorescence Detection system (Bio-Rad). The data obtained
were analyzed by OPTICON software (Bio-Rad). The relative
amounts of psbS1 and psbS2 were normalized to that of
GAPDH.
Protein electrophoresis and Western analysis
Thylakoid membranes were isolated from leaves of 9-week-old
plants by homogenizing leaves with a Waring blender (Nissei
AM-8, Nihonseiki) in an isolation buffer containing 5 mM
MgCl2, 5 mM EDTA, 10 mM KCl, 5 mM sodium ascorbate,
0.3 M sorbitol and 20 mM HEPES/KOH (pH 7.6). The pellet
obtained after centrifugation at 3,000 g for 5 min was suspended in buffer without sorbitol. The isolated thylakoid fraction was treated in SDS–PAGE sample buffer [2.5% SDS, 10%
glycerol, 2.5% (v/v) 2-mercaptoethanol, 62.5 mM Tris–HCl, pH
6.8] for 30 min. SDS–PAGE was carried out using a 15% polyacrylamide–SDS gel. The proteins on the gel were then blotted
onto PROTORAN nitrocellulose membrane (Schleicher and
Schüll). Western analysis was performed with chicken antibody
against PsbS (Agrisera). PsbS bands were detected by Western
1830
Lightning Chemiluminescence Reagent Plus (PerkinElmer Life
Sciences) using anti-chicken IgY (Agrisera). PsbO antibody from
rabbit was kindly provided by the late Professor A. Watanabe of
the University of Tokyo, and the bands were detected with the
same system using anti-rabbit IgG (Amersham).
Chl fluorescence
Chl fluorescence parameters were measured using a PAM2000
Chl fluorometer (Waltz). The minimum fluorescence at the
open PSII centers was determined by measuring light. The
steady-state Chl fluorescence level (Fs) was recorded during
actinic light illumination. Fm (maximum fluorescence yield at
closed PSII centers) and Fm0 (maximum fluorescence yield
during illumination) were measured by the application of a
1 s pulse of saturating white light. Fo and Fo0 levels were determined under far-red light.
The quantum yield of photochemistry in PSII during
steady-state photosynthesis (II) was calculated as
(Fm0 Fs)Fm0 . NPQ was calculated as (Fm Fm0 )/Fm0 . qN was
calculated as 1 (Fm0 Fo0 )/(Fm Fo). The quantum yields of
thermal dissipation from PSII antenna (Dissipation, D) and
excess energy dissipated at PSII centers (Excess, E) were calculated as D = Fo0 /Fm0 and E = (Fs Fo0 )/Fm0 , respectively, as
reported by Demmig-Adams et al. (1996): II + D + E = 1. Alternatively, the quantum yields of the basal dissipation
and light-inducible dissipation were calculated as f,D = Fs/Fm
and NPQ = 1 ( II + f,D), respectively, according to
Hendrickson et al. (2004).
Quantification of xanthophylls
Pigments from leaves of 20-week-old plants were extracted as
described by Mackinnery (1941). Leaf samples were frozen in
liquid N2 and stored at 70 C. Ground samples were extracted
two or three times with ice-cold 85% acetone. The pigments in
the extracts were separated using HPLC. All extraction procedures were carried out at 4 C. The conditions for HPLC analysis
have been reported previously (Maoka et al. 2000).
Supplementary data
Supplementary data are available at PCP online.
Funding
This work was supported in part by the Ministry of Agriculture
and Fishery of Japan [‘Functional analysis of genes relevant to
agriculturally important traits in rice genome’].
Acknowledgments
We thank Dr. Y. Tazoe, Kyoto University, Mr. K. Iseki, Kyoto
University, and Dr. C. Miyake, Kobe University, for valuable
suggestions.
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119 ! The Author 2011.
Energy allocation in PSII in PsbS-silenced rice
References
Bukhov, N.G., Heber, U., Wiese, C. and Shuvalov, V.A. (2001) Energy
dissipation in photosynthesis: does the quenching of chlorophyll
fluorescence originate from antenna complexes of photosystem II
or from the reaction center?. Planta 212: 749–758.
Demmig-Adams, B. (1990) Carotenoids and photoprotection in
plants: a role for the xanthophyll zeaxanthin. Biochim. Biophys.
Acta 1020: 1–24.
Demmig-Adams, B., Adams, W.W. III, Baker, D.H., Logan, B.A.,
Bowling, D.R. and Verhoeven, A.S. (1996) Using chlorophyll fluorescence to assess the fraction of absorbed light allocated to thermal
dissipation of excess excitation. Physiol. Plant. 98: 253–264.
Genty, B., Briantais, J.-M. and Baker, N.R. (1989) The relationship between the quantum yield of photosynthetic electron transport and
quenching of chlorophyll fluorescence. Biochim. Biophys. Acta 990:
87–92.
Havaux, M. and Niyogi, K.K. (1999) The violaxanthin cycle protects
plants from photooxidative damage by more than one mechanism.
Proc. Natl Acad. Sci. USA 96: 8762–8767.
Hendrickson, L., Furbank, R.T. and Chow, W.S. (2004) A simple alternative approach to assessing the fate of absorbed light energy using
chlorophyll fluorescence. Photosynth. Res. 82: 73–81.
Hiei, Y., Ohta, S., Komari, T. and Kumashiro, T. (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and
sequence analysis of the boundaries of the T-DNA. Plant J. 6:
271–282.
Horton, P., Ruban, A.V. and Walters, R.G. (1996) Regulation of light
harvesting in green plants. Annu. Rev. Plant Physiol. Plant Mol. Biol.
47: 655–684.
Johnson, M.P. and Ruban, A.V. (2010) Arabidopsis plants lacking PsbS
protein possess photoprotective energy dissipation. Plant J. 61:
283–289.
Kasajima, I., Takahara, K., Kawai-Yamada, M. and Uchimiya, H. (2009)
Estimation of the relative sizes of rate constants for chlorophyll
de-excitation processes through comparison of inverse fluorescence
intensities. Plant Cell Physiol. 50: 1600–1616.
Kato, C.K., Hikosaka, K., Hirotsu, N., Makino, A. and Hirose, T. (2003)
The excess light energy that is neither utilized in photosynthesis
nor dissipated by photoprotective mechanisms determines the rate
of photoinactivation in photosystem II. Plant Cell Physiol. 44:
318–325.
Koo, H.Y., Zulfugarov, I.S., Oh, M.H., Moon, Y.-H., Jansson, S., An, G.
et al. (2004) The function of the PsbS protein in relation to nonphotochemical energy dependent quenching in rice plants. In
Photosynthesis: Fundamental Aspects to Global Perspectives.
Edited by van der Est, A. and Bruce, D. pp. 527–530. Allen Press,
Lawrence, KS.
Kramer, D.M., Johnson, G., Kiirats, O. and Edwards, G.E. (2004) New
fluorescence parameters for the determination of QA redox state
and excitation energy fluxes. Photosynth. Res. 79: 209–218.
Li, X.-P., Björkman, O., Shih, C., Grossman, A.R., Rosenquist, M.,
Jansson, S. et al. (2000) A pigment-binding protein essential for
regulation of photosynthetic light harvesting. Nature 403: 391–395.
Li, X.-P., Müller-Moulé, P., Gilmore, A.M. and Niyogi, K. (2002)
PsbS-dependent enhancement of feedback de-excitation protects
photosystem II from photoinhibition. Proc. Natl Acad. Sci. USA 99:
15222–15227.
Mackinnery, G. (1941) Absorption of light by chlorophyll solutions.
J. Biol. Chem. 140: 315–322.
Maoka, T., Fujiwara, Y., Hashimoto, K., Takeda, S., Takaragaki, S. and
Ida, K. (2000) A new retro-carotenoid from the petals of
Californian yellow poppy Eschsholtzia californica. J. Nat. Prod. 65:
1288–1289.
Melis, M., Spangfort, M. and Andersson, B. (1987) Light-absorption
and electron transport balance between Photosystem II and
Photosystem I in spinach chloroplasts. Photochem. Photobiol. 45:
129–136.
Miki, D. and Shimamoto, K. (2004) Simple RNAi vectors for stable and
transient suppression of gene function in rice. Plant Cell Physiol. 45:
490–495.
Müller, P., Li, X.-P. and Niyogi, K.K. (2001) Non-photochemical
quenching. A response to excess light energy. Plant Physiol. 125:
1558–1566.
Niyogi, K.K., Grossman, A.R. and Björkman, O. (1998) Arabidopsis
mutants define a central role for the xanthophyll cycle in the regulation of photosynthetic energy conversion. Plant Cell 10:
1121–1134.
Niyogi, K.K., Li, X.-P., Rosenberg, V. and Jung, H.-S. (2005) Is PsbS the
site of non-photochemical quenching in photosynthesis? . J. Exp.
Bot. 56: 375–382.
Oxborough, K. and Baker, N.R. (1997) Resolving chlorophyll a fluorescence images of photosynthetic efficiency into photochemical and
non-photochemical components—calculation of qP and Fv0 /Fm0
without measuring Fo0 . Photosynth. Res. 54: 135–142.
Quick, W.P. and Stitt, M. (1989) An examination of factors contributing to non-photochemical quenching of chlorophyll fluorescence in
barley leaves. Biochim. Biophys. Acta 977: 287–296.
Schreiber, U., Schliwa, U. and Bilger, W. (1986) Continuous recording
of photochemical and non-photochemical chlorophyll quenching
with a new type of modulation fluorometer. Photosynth. Res. 10:
51–62.
Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007) MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol.
Biol. Evol. 241: 596–1599.
Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W:
improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties
and weight matrix choice. Nucleic Acids Res. 22: 4673–4680.
Weis, E. and Lechtenberg, D. (1989) Fluorescence analysis during
steady-state photosynthesis. Philos. Trans. R. Soc. B: Biol. Sci. 323:
253–268.
Plant Cell Physiol. 52(10): 1822–1831 (2011) doi:10.1093/pcp/pcr119 ! The Author 2011.
1831