BIO-100: Great Experiments in Biology, Lab Manual
BIO-100: Great Experiments in Biology, Lab
Manual
Labratory Manual to Accompany “Great Experiments in
Biology”
Alyssa Pedersen-Shear, Meg Bentley, Sarah Frances-Knight, Nancy Zeller,
Kathryn Walters-Conte
American University
Washington D.C.
Copyright:2015
BIO-100: Great Experiments in Biology, Lab Manual by Alyssa Pedersen-Shear, Meg Bentley, Sarah Frances-Knight, Nancy
Zeller, Kathryn Walters-Conte is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0
International License, except where otherwise noted.
BIO-100: Great Experiments in Biology,
Lab Manual
Syllabus
BIO-100: Great Experiments in Biology,
Lab Manual
4
Spring 2016 Syllabus
Welcome to the laboratory portion of Biology 100: Great Experiments! The purpose of the laboratory is to provide
you with an opportunity to experience how the knowledge we call Biology is generated through observation and
experimentation. The lab exercises in this course emphasize the scientific method using observations,
measurements, and technology. We hope that you will learn to see how knowing a little about biology and how
science is performed will enhance the way you articulate and explore problems at AU and after you graduate.
Biology 100 laboratory covers a huge breadth of biological topics. These topics build from smallest to largest and
try to echo what you are covering in lecture.
There is a lab manual that is required for the laboratory portion of this course. We host an electronic version of
this manual at http://bio100labmanual.openbooks.wpengine.com/. You are encouraged to read online so that you
can follow links and see images in color. However, you are required to print out a hard copy of the manual
and bring it to every lab class – a PDF of the lab manual is on the Blackboard Lecture site for Biology 100. It is
each student’s responsibility to print out the entire document – black and white, double-sided is fine. Note that
you can have your pages bound at the UPS store on campus for a fee. Beyond your printing costs, there is no cost
to access the lab manual online.
Please know that the laboratory portion of Biology 100 represents 40% of your total course grade. Your lab grade
is based on cash-out assignments (done in lab), lab reports, weekly quizzes, worksheets and written assignments
and a final infographic poster related to endangered species. Your TA will elaborate on each of these assignments
as we work through the semester.
Five important rules that will ensure you have fun and get something out of lab –
Laboratory attendance is required. We have a simple policy in laboratory courses in the Biology
department – 3 absences and you fail the lab portion of the course. You cannot pass Biology 100 if you fail
the laboratory portion, so make it a priority to attend your own lab session! If you are going to miss a lab
section, notify your TA immediately by email. Missed labs must be made up within one week of your
absence! Documentation for your absence and make-up lab paperwork must be turned in.
Read the lab manual before each class! Reading the lab manual will provide insight into what you are
doing in lab. It gives you essential background information to our lab, describes the protocols that you will
follow to complete lab experiments. If you read the lab manual before coming to class, you will finish lab
faster and do better on assessments. Also, there will be one question based on the lab manual on each
week’s quiz.
Read the article or listen to the podcast that your quiz is based on. These articles and podcasts are
intended to give the lab context and meaning. They are examples of how you will encounter biology outside
of the classroom and after college. These articles will be the basis for majority of the content on your
weekly quizzes, so make sure you give yourself adequate time to read and listen each week.
All assignments are due in the first 10 minutes of class and will not be accepted any time after that
point. If you know that you will miss a lab section, you must submit your assignment to your TA by the
beginning of your regularly scheduled lab class. All assignments must be submitted by hard copy and must
be typed. In class assignments are due at the end of your lab section and cannot be turned in at a later time.
Do your own work! Plagiarism of any form will not be tolerated as stated in the University’s Academic
Integrity Code. If there is any evidence that any part of an assignment is plagiarized, then the work will be
sent to the Dean of the College of Arts and Sciences for review. This includes work that is done in pairs or
groups within lab. Question? Then ask before you get into any academic trouble.
Some other important stuff: Each student is responsible for taking care of the lab materials (i.e., microscopes
and pipettors) and completely understanding the safety procedures and how to use chemicals (MSDS information).
No food or drink is ever allowed in the laboratory. We will go over lab safety and our expectations on the first day
to help prevent mishaps and injuries.
BIO-100: Great Experiments in Biology,
Lab Manual
5
Emergency Preparedness (pandemics, earthquakes, and hurricanes, etc) American University has put
together an emergency plan that would be implemented to meet the needs of all members of the university
community. Should the university be required to close for a period of time, we are committed to ensuring that all
aspects of our educational programs will be delivered to our students. These may include altering and extending
the duration of the traditional term schedule to complete essential instruction in the traditional format and/or use
of distance instructional methods. Specific strategies will vary from class to class, depending on the format of the
course and the timing of the emergency. Faculty will communicate class-specific information to students via AU email and Blackboard, while students must inform their faculty immediately of any absence due to illness. Students
are responsible for checking their AU e-mail regularly and keeping themselves informed of emergencies. In the
event of a declared pandemic or other emergency, students should refer to the AU Web site (www. prepared.
american.edu) and the AU information line at (202) 885-1100 for general university-wide information, as well as
contact their faculty and/or respective dean’s office for course and school/ college-specific information.
In the event of a declared pandemic or other emergency, students should refer to the AU Web site
(www.prepared.american.edu) and the AU information line at (202) 885-1100 for general university-wide
information, as well as contact their faculty and/or respective dean’s office for course and school/ college-specific
information.
Academic Integrity Policy: The University takes academic dishonesty very seriously, and all instructors are
required to report cases to the Dean of the College of Arts and Sciences. Please read the University’s Academic
Integrity Code closely, and be sure to ask if you have any questions.
http://www.american.edu/academics/integrity/code.cfm. It is considered plagiarism to submit assignments without
properly citing sources and acknowledging intellectual debts. Collaboration with other students, when expressly
not permitted by instructors, may also be a violation of the Code, as in cheating on exams, using electronic devices
during tests or exams when prohibited. The Dean’s standard policy for any of the above offenses is failure of the
course.
Laboratory Grading Summary:
Your lab grade is 40% of your Biology 100 course grade.
Assessment
Points Available
11 pre-lab quizzes (10x 10 points, lowest one dropped)
100
7 cash-out assignments (6 x 10 points)
(completed in class)
70
2 lab reports (2 x 50 points)
100
2 writing assignments (2 x 30 points)
60
Case Study Presentation
25
Presenting Plans for Endangered Species Protection and Ethogram Observations
75
Lab Performance (Attendance, punctuality, appropriate dress, attitude, etc. )
20
TOTAL
450
#
Week of:
Laboratory
Pre-Lab
Quiz
1
1/11
Introduction to Lab, Lab Safety,
the Scientific Method and
Literacy
No
BIO-100: Great Experiments in Biology,
Lab Manual
Assignments (points)
6
2
1/18
Nano, Micro, Milli Oh My!
Yes
Cash out assignment (10)
3
1/25
What’s in Your Water?
Yes
Lab Report (50) – Due in week 4
4
2/1
What’s in Your Food?
Yes
Cash out assignment (10)
5
2/8
Testing the 5-Second Rule (Week
1)
Yes
Cash out assignment (10)
6
2/15
Testing the 5-Second Rule (Week
2)
Yes
Lab Report (50) – Due in week 7
7
2/22
Cells and DNA
Yes
23andMe Writing Assignment
(30) – Due in week 8
8
2/29
The Information in DNA
Yes
Cash out assignment (10)
9
3/14
Personal Genetics
Yes
Inherited Disease Writing
Assignment (30) – Due in Week
10
10
3/21
Simulating Natural Selection
Yes
Cash out assignment (10)
11
3/28
Neuroscience: Cells, Organ
Structure and Function
Yes
Case Study Presentation (25) –
Due in week 12
12
4/4
Neuroscience: Using Model
Systems to Learn More
Yes
Cash out assignment (10)
13
4/11
Visit the Zoo and Ethograms
No
Ethogram and Infographic on an
Endangered Species (75) – Due in
week 14
14
4/18
Presenting Plans for Protecting
Endangered Species
No
Cash out assignment (10)
Spring
break
BIO-100: Great Experiments in Biology,
Lab Manual
7
Policies for Introductory Biology Labs at AU
BIO-100: Great Experiments in Biology,
Lab Manual
8
Attendance Policy for Biology Courses
Attendance to laboratories is required. If you have 3 or more unexcused absences from lab, you fail the lab
portion of Biology 210. You cannot pass Biology 210 if you fail the laboratory portion, so make it a priority to
attend your own lab session!
If you know you are going to miss a lab, email your TA immediately! Missed labs must be made up within
one week of your absence! Documentation for your absence and make-up lab paperwork must be turned
in along with make-up assignments.
If you miss a lab, you are responsible for submitting a hard copy of your assignment on time! An absence
from lab does not give you additional time to complete assignments.
BIO-100: Great Experiments in Biology,
Lab Manual
9
Assignment Policy for Biology 100 Laboratory
All laboratory assignments are due within the first 10 minutes of lab (usually when any lab quizzes are
completed).
If you are more than 10 minutes late for class, you will not be able to turn in your assignment. This includes
worksheets, lab reports, and any other homework. You will not be given any credit for late
assignments.
No electronic lab assignments will be accepted. A hard copy is required for all assignments. Make
sure that you are not late to class because you are waiting in line to print your assignment.
If you know you will miss a lab, then you may hand in an assignment early. Alternatively, you can have a
fellow student submit a hard copy to your TA in class. Missing lab is not an excuse to not turn in an
assignment.
Lab attendance is mandatory. You cannot turn in an assignment unless you have performed the lab. If you
have unexcused absences for three labs, you will fail the entire Biology 100 course.
BIO-100: Great Experiments in Biology,
Lab Manual
10
Plagiarism Policy for Biology Courses
Plagiarism is copying another person’s work and not identifying it as such. This includes using another student’s
assignment, a textbook or web pages. If there is any evidence indicating that any part of a student’s
assignment is plagiarized, a report will be immediately sent to the College of Arts and Sciences
Academic Integrity Code Administrator.
FOR ALL LABORATORY ASSIGNMENTS:
You must cite everything that is not original thought. Proper in-text citations as well as a reference
section at the end of every lab report or worksheet are required.
Use APA based formatting for citations. Footnotes cannot be used as the reference section. Detailed
information on APA style to be used for lab assignments is found on the following page. Refer to the AU
Library http://subjectguides.library.american.edu/citation#apa
Direct quotes are not permitted in science writing. Everything must be paraphrased and written in your
own words. When you do paraphrase a concept or a finding, cite the source.
You must write your lab report by yourself. While it is perfectly acceptable to discuss the data and
results with your TA and other students, writing is done alone.
even if you have a lab partner
even if you worked in a group
even if the lab data is shared
Never ever share your completed lab assignment with other students under any circumstances. If your
lab assignment I copied with your knowledge each of you will be charged with academic dishonesty.
Instead, try to help by answering their questions or referring them to their lab instructor for help.
Never use anyone else’s old assignment or lab report.
Don’t risk your grade. If you’re unsure how to complete the lab assignment or how to write a lab report or
you are just running out of time, email your instructor immediately. It is better to receive a lower grade on
an assignment than risk failing the course.
Every lab assignment which you turn in this semester will include the following statement with a place for
your signature.
“I have neither given nor received inappropriate aid on this assignment.”
BIO-100: Great Experiments in Biology,
Lab Manual
11
APA Citation Policy for Biology Courses
All references used in writing lab reports and assignments should be listed at the end of the document in a
References section. There is generally no footnoting in science writing. The list should be alphabetized using the
first author’s last name. Citation format of the reference list is as follows:
Books
Author’s Last name, First name. Year of Publication. Book title. Publisher: Where published. Pages Used.
Freeman, Scott. 2002. Biological Science. Prentice Hall: New Jersey. 1017.
Journal Articles
Author’s Last name, Initials of author’s first name. Year of Publication. Title of article. Title of journal. Volume of
journal: page numbers
Connaughton, VP. 2002. Myelin and you. Oligodendrocyte weekly. 17: 5-10.
Web Article
Author’s Last name, First name. “Title of page”. Title of Complete Work. Date of last
posting/revision. Name of institution/organization affiliated with the site. (Date of
your visit to website) <URL>
Felluga, Dino. “Undergraduate Guide to Literary Theory”. 17 Dec. 1999. Purdue
University. (28 Aug. 2012) <http://omni.cc.purdue.edu%7Efelluga/theory2.html>
It is necessary to list your date of access because web postings are often updated, and information available at one
date may no longer be available later. Be sure to include the complete address for the site. Also, note the use of
angled brackets around the electronic address.
Other Requirements and Tips!
In-text citations are standard in science writing! Within the body of the document, references are to be cited
in parentheses (author’s last name, year). If you have more than one reference to be cited at the same time, they
are placed in chronological order (Connaughton, 2008; Zeller, 2012).
As mentioned in the plagiarism section, direct quotes are not allowed in science writing. You must paraphrase,
and therefore cite, any facts from textbooks, journal articles or web sites.
When in doubt, cite it! It is better to cite than be sorry!
BIO-100: Great Experiments in Biology,
Lab Manual
12
Laboratory Safety Contract for Biology Courses
The Department of Biology laboratory safety contract provides a list of laboratory rules to protect you and to teach
you proper lab etiquette. These rules must be followed at all times during the laboratory class for your safety and
the safety of those around you.
Read all the laboratory procedures before lab. This preparation will decrease the likelihood of any
accidents, improve your data and experiments, and reduce the amount of time you spend in lab.
Absolutely no food or drink allowed in the labs at any time
All cell phones must be in a storage cubby during lab. It keeps chemicals off your phone. At certain times
during the semester, we will use your camera phone to record data. This is the only time you are allowed to
have the cell phone out during class.
Students must wear closed-toe shoes and long pants! Be prepared to tie up long hair and avoid baggy
sleeves. You will be sent home to change if you come to lab with inappropriate clothes.
Do not touch any supplies or equipment until you are told to do so by your instructor. If you are at all
unsure of the instructions during the lab – ASK!
If you have any accident, no matter how small, let your instructor know immediately.
Know where the eye-wash, emergency shower, fire extinguisher, fire blanket, and first aid kits are located
in the laboratory. In case of chemical injury to the eye, the eye must be rinsed for 20 minutes with the eyewash.
In the case of emergencies be prepared to call campus security at x3636 and if there is a serious medical
emergency call 911. There is also an automated external defibrillator in the hallway of Hurst Hall.
Always double-check chemical names on the bottle and transfer pipettes. Never put used chemicals back in
the original container. Never pour anything down the sinks . Never touch chemicals with your bare hands.
The Material Safety Data Sheets (MSDS) provide safety information on each of the chemicals used in the
Department of Biology. They are kept in black boxes at all the entrances to Hurst Hall and in the basement
next to the vending machines.
Use animals or plants humanely – whether they are alive or preserved. (As biologists, we believe this is one
of the most important rules on this list!) They require specific handling procedures. Your instructor will
have a careful plan for handling specimens.
Be careful around Bunsen burners. The flame can be hard to see and it is easy to catch hair or clothing on
fire. Use them only when necessary, and alert everyone around you when one is lit.
Always protect your eyes from any UV light. You should wear goggles or make sure the clear top is down on
the UV light box when observing electrophoresis gels.
Take care when using any scalpels, probes, razor blades, pins, and other sharp objects. If you poke or cut
through your skin, report to the instructor.
Put lab waste in the proper receptacles. Broken or used glass slides go into the box labeled “glass waste”.
There are special sharps containers for razor blades and needles/pins. There are also special labeled bottles
for chemical waste. Check with your instructor if you have any questions.
Recycle whenever possible. There are containers for used slides, cover slips, tubes, and plastic ware.
Keep your lab bench area organized and make sure you clean up at the end of lab as described in #15.
This is a courtesy to your instructor and an important safety measure.
Always, wash your hands with soap at the end of the lab period.
BIO-100: Great Experiments in Biology,
Lab Manual
13
What's New in the World of Biology?
BIO-100: Great Experiments in Biology,
Lab Manual
14
Readings/Listenings for Your Weekly Quizzes
For Week 2- Nano, Micro, Milli, Oh My!: Why the Liberal Arts Need the Sciences (and Vice Versa)
For Week 3 – What’s in your Water?: Flint Will Return to Using Detroit’s Water After Findings of Lead in Local
Supply
For Week 4 – What’s in Your Food?: The surprising thing ancient mummies tell us about what to eat
For Week 5 – Testing the 5-Second Rule (week 1): Stop fussing over measles vaccination rates. Start worrying
about flu shots.
For Week 6 – Testing the 5-Second Rule (week 2): PODCAST: Does the five-second rule work?
For Week 7 – Cells and DNA: Your Cells. Their Research. Your Permission?
For Week 8- DNA Manipulation: Louisiana death-row inmate Damon Thibodeaux exonerated with DNA evidence
For Week 9- Personal Genetics: PODCAST: Leaving Your Lamarck
For Week 10- Stimulating Natural Selection: Did good genes help people outlast brutal Leningrad siege?
For Week 11- Neuroscience: Cells, Organ Structure and Function: Are killer whales persons?: The more we learn
about orcas, the more our assumption of innate superiority looks like a presumption
For Week 12- Neuroscience: Using Model Systems to Learn More: Study to seek early signs of damage in NFL
players’ brains
For Week 13: Visit Zoo and Ethograms: Indonesia’s forest fires threaten a third of world’s wild orangutans
BIO-100: Great Experiments in Biology,
Lab Manual
15
Basic Information for Beginner Scientists
BIO-100: Great Experiments in Biology,
Lab Manual
16
The Lab Report and Scientific Writing
Scientists report the findings of their experimental research in a very precise manner that reflects the scientific
method. Usually a paper that is submitted to a science journal is the culmination of many many experiments. But
whether it is a journal article or the lab report on the single experiment you have completed today, the overall
format is the same. It is essentially the written story about an experiment/s.
The writing is broken up into four distinctly labeled sections: Introduction, Materials and Methods, Results, and
Discussion. Each journal has different requirements, but they all have the same basic structure which rarely
changes and consists of the following:
Introduction – This section introduces relevant background information helpful to understanding the
experiment being reported. It should include the purpose of the experiment, why your hypothesis and
prediction are important, and how your hypothesis relates to the background information. This section is
short, usually only one or two paragraphs.
Materials and Methods – The procedures and materials used are described in a few paragraphs.
Results – Charts, graphs, tables, and drawings are the best way to show any data. Make sure each has a
number, a title, and the parts are labeled. There should also be a description for each figure. Observations
belong in this section. However, no interpretations or explanations of the data and observations are
included, just the plain facts here.
Discussion – The Discussion summarizes and connects all the parts together. It is always important to
describe how the information in the Results sections either supports or does not support what was
predicted in the Introduction. The results are interpreted and related to both the hypothesis and
background information. Any problems with the experiments are usually mentioned. Then an alternative
hypothesis or new predictions can be stated and the importance of the findings is stressed. Finally, end with
any conclusions you can draw from your data and the class data (not personal opinions). This section
demonstrates how well you understood the lab.
References – Cite the sources of any background material, including your lab manual and web sites. Three is the
minimum! Never use any quotes in a report or worksheet!!
BIO-100: Great Experiments in Biology,
Lab Manual
17
Tips on Writing a Fantastic Lab Report!
This is a link to a fantastic resource that will get your scientific writing off to a great start. The guidelines in
this resource are consistent with the expectations of this course and our department.
It might also be useful to read some great lab reports and some not so great lab reports – you can find links
to those here.
BIO-100: Great Experiments in Biology,
Lab Manual
18
Common Problems with Lab Reports (read these!)
This is a link to a fantastic resource that will get your scientific writing off to a great start. The guidelines in this
resource are consistent with the expectations of this course and our department.
General:
1. Don’t forget your name, TA name, section and date
2. Use standard borders and 12point fonts
3. Don’t use the title from the manual…it is not specific enough
4. Make the title concise and to the point
Introduction:
1. Reference sources for background information
2. Introduction is not a summary of how the experiment was done
3. Include information that is needed to understand the meaning of the next three sections
4. Don’t explain concepts that are already understood by scientists such as why controls are needed.
5. End your introduction with the hypothesis and If…then prediction (good way to transition into the next section).
Include the information which led you to formulate this hypothesis and prediction.
Materials and Methods:
1. Don’t divide into two sections. And don’t provide a list of materials used!
2. Write brief summary of materials and methods and site the manual instead of writing all the details.
3. Make sure any changes or additions to manual instructions are included.
4. Be as concise as possible without sacrificing clarity.
5. Make sure to use the past tense.
Results:
1. State results in paragraph form but DON’T interpret them.
2. Describe trends in data, factually. (Positive correlation between protein concentration and % absorbance)
3. Explain the reasoning behind more complex calculations.
4. All tables and figures must be numbered. Tables are numbered sequentially in the order in which they are referred to
in the Results section. Any data presented that is not in a table is considered to be a figure. Figures are also labeled
sequentially in the order in which they are referred to in the Results section.
Tables and Graphs:
1. Data may be presented in table form. Each column and row should be appropriately labeled, and the table itself
should have a title. Be sure to include units of measurement in the labels where appropriate.
2. Graphs are used primarily to reveal trends that would not be obvious in tabular form. Each X and Y axis must be
labeled appropriately and the units should be given. When plotting data on a graph, indicate each data point clearly with
a symbol such as a filled-in or open circle or square. If there are two or more plots on a single graph, use two different
symbols to indicate the data points and include a clearly labeled legend showing which symbol represents which plot.
3. Other data, such as micrographs, pictures or drawings must also be labeled. They are considered to be figures, as are
graphs, and must have a legend briefly describing the figure, including the organism, scale and any other appropriate
information.
Discussion:
1. Begin with brief summary of background information and purpose of the experiments.
BIO-100: Great Experiments in Biology,
Lab Manual
19
2. Include a brief (1-2 sentences) summary of results and hypothesis.
3. Did data support hypothesis? Explain why or why not.
4. Be thorough when explaining sources of error (human and equipment). How did they affect the experiments and how
can they be fixed or minimized?
5. Interpret meaning and importance of results. How results could be used by others or in future experiments (what
have they contributed to science). Explain how experiments apply to “real world” issues, problems, or concerns
References:
1. Cite as shown in introduction.
2. Don’t use direct quotes.
3. Don’t footnote. Include a references section at the end of the lab report or worksheet.
BIO-100: Great Experiments in Biology,
Lab Manual
20
A Primer on the Metric System
Every experiment or procedure in the scientific laboratory is dependent upon techniques of measurement and
quantitation. Therefore every student should be aware of some of the ways in which various things are measured. The
system of measurement in the scientific community is the metric system. This was introduced by Stevin in the 16th
century, and has been the standard in most of the world since then. The major exceptions have been the Englishspeaking countries which, not surprisingly, use the English system. The scientific laboratory is one of the few places in
the USA where the use of the metric system is universal. The reason for this is two-fold: first, it is the worldwide
standard, which makes communication between scientists much easier, and second, its units and their conversions are
much more practical and convenient. The basic units of this system are the gram (the unit of weight), the meter (the
unit of length) and the liter (the unit of volume). Sub and super divisions of all of these are named by using the Latin
prefixes, as follows:
MEGA – 1,000,000 times the unit
KILO – 1000 times the unit
HECTO – 100 times the unit
DEKA – 10 times the unit
THE UNIT ITSELF (gram, meter, liter, or bases)
DECI – 1/10 of the unit
CENTI – 1/100 of the unit
MILLI – 1/1000 of the unit
MICRO – 1/1,000,000 of the unit
NANO – 1/1,000,000,000 of the unit
PICO – 1/1,000,000,000,000 of the unit
FEMTO – 1/1,000,000,000,000,000 of the unit
For example, the unit of distance is the meter, which is a little longer than the yard in English units. To measure the
distance from one city to another, the Kilometer (1000 times the meter) is used. (It is about 400 Kilometers from New
York City to Washington, D.C.) However, in the laboratory, this unit is much too large to be conveniently used, so the
units most used here are the centimeter (1/100th of the meter) and the millimeter (1/1000 of the meter). However, if the
microscope is being used, even the millimeter is too large, and the micrometer (1/1,000,000 of the meter) is the basic
unit of measurement when using this instrument.
One of the great advantages of this system is the ease with which conversions can be made. For example, using pure
water as the standard, one liter of water (a volume) weighs one kilogram. Furthermore, the liter is defined as 1000
cubic milliliters, each of which is a cube one millimeter on each side. In this way, the three units of measurement
(weight, volume and length) can be converted.
BIO-100: Great Experiments in Biology,
Lab Manual
21
Exercise I: An Introduction to the Scientific Method & Informational
Literacy
Learning Objectives
Be able to list the basic steps of the scientific method
Be able to formulate a hypothesis and prediction about an experiment
Be able to apply the scientific method to question in biology and in your own discipline
Be able to find and cite appropriate sources that strengthen your argument and support your
conclusions
Read more about the Process of Science and The Scientific Method in your textbook:
Concepts of Biology – The Scientific Method
BIO-100: Great Experiments in Biology,
Lab Manual
22
Introduction
Scientific Method History
We hear about the scientific method and most assume this is a modern thought process that only today’s scientists
use. In fact there have been gifted individuals over the ages that have used inductive reasoning, that is,
observations and experiences about the world around us, to set up creative experiments. The results of these
experiments as well as intelligent deductive reasoning have led to amazing discoveries.
Key Takeaways
The scientific method is simply a way in which knowledge is obtained:
When an initial observation, from any source, is made, then a question is posed.
A testable hypothesis is developed that will hopefully shed some light on an answer to
the question. Then a prediction is made based on the hypothesis.
An experiment is developed from the prediction.
The experiment is performed; the outcome observed and compared to the prediction
and hypothesis in step #2. Were the results what was predicted? Do they support or not
support the hypothesis?
The analysis of the experimental outcome may cause the hypothesis to be altered or
new predictions to be developed. Then new experiments can be performed.
An Introduction to the Scientific Method
by Frank Wolfs, University of Rochester
(adaptations to the original by Meg Bentley)
Introduction to the Scientific Method
The scientific method is the process by which scientists, collectively and over time, endeavor to construct an
accurate (that is, reliable, consistent and non-arbitrary) representation of the world.
Recognizing that personal and cultural beliefs influence both our perceptions and our interpretations of natural
phenomena, we aim through the use of standard procedures and criteria to minimize those influences when
developing a theory. As a famous scientist once said, “Smart people (like smart lawyers) can come up with very
good explanations for mistaken points of view.” In summary, the scientific method attempts to minimize the
influence of bias or prejudice in the experimenter when testing an hypothesis or a theory.
I. The scientific method has four steps
Observation and description of a phenomenon or group of phenomena.
Formulation of an hypothesis to explain the phenomena.
Use of the hypothesis to predict the existence of other phenomena, or to predict quantitatively the results of
new observations.
Performance of experimental tests of the predictions by several independent experimenters and properly
performed experiments.
If the experiments bear out the hypothesis it may come to be regarded as a theory or law of nature (more on the
BIO-100: Great Experiments in Biology,
Lab Manual
23
concepts of hypothesis, model, theory and law below). If the experiments do not bear out the hypothesis, it must
be rejected or modified. What is key in the description of the scientific method just given is the predictive power
(the ability to get more out of the theory than you put in) of the hypothesis or theory, as tested by experiment. It is
often said in science that theories can never be proved, only disproved. There is always the possibility that a new
observation or a new experiment will conflict with a long-standing theory.
II. Testing hypotheses
As just stated, experimental tests may lead either to the confirmation of the hypothesis, or to the ruling out of the
hypothesis. The scientific method requires that an hypothesis be ruled out or modified if its predictions are clearly
and repeatedly incompatible with experimental tests. Further, no matter how elegant a theory is, its predictions
must agree with experimental results if we are to believe that it is a valid description of nature. In biology, as in
every experimental science, “experiment is supreme” and experimental verification of hypothetical predictions is
absolutely necessary. Note that the necessity of experiment also implies that a theory must be testable. Theories
which cannot be tested, because, for instance, they have no observable ramifications do not qualify as scientific
theories.
If the predictions of a long-standing theory are found to be in disagreement with new experimental results, the
theory may be discarded as a description of reality, but it may continue to be applicable within a limited range of
measurable parameters.
We are all familiar with theories which had to be discarded in the face of experimental evidence. In the field of
astronomy, the earth-centered description of the planetary orbits was overthrown by the Copernican system, in
which the sun was placed at the center of a series of concentric, circular planetary orbits. Later, this theory was
modified, as measurements of the planets motions were found to be compatible with elliptical, not circular, orbits,
and still later planetary motion was found to be derivable from Newton’s laws.
Error in experiments have several sources. First, there is error intrinsic to instruments of measurement. Because
this type of error has equal probability of producing a measurement higher or lower numerically than the “true”
value, it is called random error. Second, there is non-random or systematic error, due to factors which bias the
result in one direction. No measurement, and therefore no experiment, can be perfectly precise.
III. Common Mistakes in Applying the Scientific Method
As stated earlier, the scientific method attempts to minimize the influence of the scientist’s bias on the outcome of
an experiment. That is, when testing an hypothesis or a theory, the scientist may have a preference for one
outcome or another, and it is important that this preference not bias the results or their interpretation. The most
fundamental error is to mistake the hypothesis for an explanation of a phenomenon, without performing
experimental tests. Sometimes “common sense” and “logic” tempt us into believing that no test is needed. There
are numerous examples of this, dating from the Greek philosophers to the present day.
Another common mistake is to ignore or rule out data which do not support the hypothesis. Ideally, the
experimenter is open to the possibility that the hypothesis is correct or incorrect. Sometimes, however, a scientist
may have a strong belief that the hypothesis is true (or false), or feels internal or external pressure to get a
specific result. In that case, there may be a psychological tendency to find “something wrong”, such as systematic
effects, with data which do not support the scientist’s expectations, while data which do agree with those
expectations may not be checked as carefully. The lesson is that all data must be handled in the same way.
Another common mistake arises from the failure to estimate quantitatively systematic errors (and all errors).
There are many examples of discoveries which were missed by experimenters whose data contained a new
phenomenon, but who explained it away as a systematic background. Conversely, there are many examples of
alleged “new discoveries” which later proved to be due to systematic errors not accounted for by the
“discoverers.”
In a field where there is active experimentation and open communication among members of the scientific
community, the biases of individuals or groups may cancel out, because experimental tests are repeated by
different scientists who may have different biases. In addition, different types of experimental setups have
different sources of systematic errors. Over a period spanning a variety of experimental tests (usually at least
several years), a consensus develops in the community as to which experimental results have stood the test of
BIO-100: Great Experiments in Biology,
Lab Manual
24
time.
IV. Hypotheses, Theories and Laws
In many science disciplines, the words “hypothesis,” “model,” “theory” and “law” have different connotations in
relation to the stage of acceptance or knowledge about a group of phenomena.
An hypothesis is a limited statement regarding cause and effect in specific situations; it also refers to our state of
knowledge before experimental work has been performed and perhaps even before new phenomena have been
predicted. To take an example from daily life, suppose you discover that your car will not start. You may say, “My
car does not start because the battery is low.” This is your first hypothesis. You may then check whether the lights
were left on, or if the engine makes a particular sound when you turn the ignition key. You might actually check
the voltage across the terminals of the battery. If you discover that the battery is not low, you might attempt
another hypothesis (“The starter is broken”; “This is really not my car.”)
A scientific theory or law represents an hypothesis, or a group of related hypotheses, which has been confirmed
through repeated experimental tests. Theories in physics are often formulated in terms of a few concepts and
equations, which are identified with “laws of nature,” suggesting their universal applicability. Accepted scientific
theories and laws become part of our understanding of the universe and the basis for exploring less wellunderstood areas of knowledge. Theories are not easily discarded; new discoveries are first assumed to fit into the
existing theoretical framework. It is only when, after repeated experimental tests, the new phenomenon cannot be
accommodated that scientists seriously question the theory and attempt to modify it.
VI. Conclusion
The scientific method is intricately associated with science, the process of human inquiry that pervades the
modern era on many levels. While the method appears simple and logical in description, there is perhaps no more
complex question than that of knowing how we come to know things. In this introduction, we have emphasized
that the scientific method distinguishes science from other forms of explanation because of its requirement of
systematic experimentation. We have also tried to point out some of the criteria and practices developed by
scientists to reduce the influence of individual or social bias on scientific findings. Further investigations of the
scientific method and other aspects of scientific practice may be found in the references listed below.
VII. References
1. Wilson, E. Bright. An Introduction to Scientific Research (McGraw-Hill, 1952).
2. Kuhn, Thomas. The Structure of Scientific Revolutions (Univ. of Chicago Press, 1962).
3. Barrow, John. Theories of Everything (Oxford Univ. Press, 1991).
BIO-100: Great Experiments in Biology,
Lab Manual
25
Procedure
Brainstorm Questions you have about Biology
We will begin the course with students generating a list of biology related topics that they are interested in or
want to learn more about. Spend a couple minutes coming up with a three questions/topics/areas that you want to
learn more about — write these in the area below:
Your TA will ask you to share your interests and questions with the entire class and you will generate a list of
topics on the board. Are there topics that everyone has an interest in? Are there topics that are related to your
major? Are there topics you have never heard about?
As a class, select two topics that the majority of lab members want to know more about. Please share your opinion
during this stage since these questions will be the basis for the subsequent exercise – write down the topics that
your class chose to address:
Find Legitimate Sources that Help to Address these Questions
One of the most important objectives we have for you in this class (and in college!) is for you to be able to identify
and select appropriate resources. The major types of acceptable scientific resources are:
Popular Press Articles: Articles written by non-researchers for a general audience. They avoid or clearly
define jargon and have few references.
Trade Articles: Articles written for a specific industry. They generally describe technical innovations for use
in that industry rather than original data from controlled experiments.
Primary Research Articles (Scholarly): Articles that report original data and experiments. They are peerreviewed. They include technical information on how experiments were performed. They are written by
experts and contain jargon. They include lots of references to other primary research articles.
Review Articles (Scholarly): Review papers are like mini-textbooks: they are a synthesis of years of work
published in primary research articles. They span many experiments, and are used to update the field.
Other Resources You May Encounter
Short papers that highlight new and exciting experimental results.
Editorials, usually from the editors of journals, note larger changes in a scientific field or comment on
major events.
Online databases store and/or annotate raw scientific data.
Instructions from a product manufacturer or supplier.
Conference proceedings, white papers and dissertations are unpublished and un-peer reviewed data
that can guide your thinking.
Working with your lab group, identify keywords to find resources related to the topic that the class decided on.
Use these keywords in a Google Search. Record the top three hits/articles/URLs that you think are relevant to this
topic. After your record these, examine each one more carefully – categorize it into popular press, trade article,
review article, research article or something else. Try using these same keywords in a Google Scholar search and
then in a Web of Science search.
Whenever we are looking for resources they need to be good ones. The following four questions are useful in
asking yourself about any resources you find. Get into the habit of asking yourself these ‘mantra’ questions about
anything you read, in any class, and you will be on the right path. Using the “mantra” questions, decide whether
you would or would not use certain resources that you found above.
Is this resource relevant/useful/pertinent?
Is this resource accurate/unbiased/authoritative?
Is this resource verifiable/trustworthy?
Is this resource current/timely?
Is there a difference in the usefulness of articles found in Web of Science versus Google Scholar versus Google?
BIO-100: Great Experiments in Biology,
Lab Manual
26
Select one article that your group found that is the “most worthy” of using as a resource to address the class
question. Explain how you found this article, what type of article it is, and how you decided it was worthy using
the mantra questions above. Next, select the least worthy article and tell the class about it.
Using the Scientific Method
In your group, design an experiment that addresses the following question “Do GMO foods affect the health of
humans?” Remember to devise a hypothesis (a true/false statement), a prediction (an if/then statement), and
describe what type of data you will collect in your experiment.
BIO-100: Great Experiments in Biology,
Lab Manual
27
Exercise II: Nano, Micro, Milli, Oh My!
BIO-100: Great Experiments in Biology,
Lab Manual
28
Introduction
Learning Objectives
Learn how to use a microscope
Learn how to use a pipettor
Learn about the units used in scientific research
Part I. The Compound/ Light Microscope
We look through the lens system of a microscope to view objects that are only micrometers in size. The compound
microscope consists of many parts (Figure 1). The microscope magnifies or increases the virtual size of an object,
and also increases the resolution (the ability of a lens to recognize two adjacent objects as discrete entities). The
greater the resolving power of the microscope, the greater the sharpness or clarity of objects being viewed.
Figure 1. The Compound Microscope
Here is a video that will give you some more information about the compound/ light microscope.
http://www.jove.com.proxyau.wrlc.org/video/843/major-components-of-the-light-microscope
BIO-100: Great Experiments in Biology,
Lab Manual
29
Figure 2. Screen shot of video
Part II. Micropipetting
The micropipettor is a tool used to transfer small amounts of liquid. Because they are on the micro-scale, these
are generally used to transfer volumes ranging from 1µL to 1000µL (i.e. 1mL). Micropipettors (sometimes called
“Pipetmen”) come in several sizes that are capable of pipetting different ranges of volumes.
Figure 3. The Micropipette
The table below lists the variable micropipettors you may encounter in this course and the range of volumes
they can transfer.
Table 1. Micrpipette sizes and volume ranges
Name
Range
P20
0.5-20µL
BIO-100: Great Experiments in Biology,
Lab Manual
30
P100
10-100µL
P200
20-200µL
P1000
200-1000µL
Figure 4. How to use a pipette
Figure 5. The two stops of a pipette
Here is a link to a video describing the micropipettor in more detail.
http://www.jove.com.proxyau.wrlc.org/science-education/5033/an-introduction-to-the-micropipettor
BIO-100: Great Experiments in Biology,
Lab Manual
31
Figure 6. Screen shot from video
Part III. The Metric System
Modern biology is performed on a very tiny scale. You have probably heard the term “nano” technology. This is
performing chemical, biological or physical reactions on the nano-scale 10-9 i.e. one-billionth of a liter, gram or
meter! Remember the liter is the basic unit for volume, the gram for mass, and the meter for measuring length. In
this class we will rarely work on a scale that small but several times we will work with the milli-scale (10-3) or the
micro-scale (10-6). Each of these metric scales will be used interchangeably so you need to be comfortable
converting from micro to milli and back again.
To start, let’s look at volumes. A liter is close to the volume of a quart in the English system. Milli is denoted by
“m” and is 1/1000 of a liter. Ten milliliters is about a teaspoon of liquid. Micro is written as “µ” and this unit is
1/1000 of a milliliter. You can barely see a microliter of liquid.
One milliliter is 1/1000 of a liter and is the same as 1×10-3 and .001 of a liter. There are 1000 milliliters in a liter.
So 1 microliter is 1×10-6 and .000001 of a liter. There are 1000 microliters in a milliliter and 1,000,000 in a liter.
You can convert back and forth keeping track of the decimal point and adjusting the zeros.
Table 2. Units of the Metric System
Quantity
Unit
Abbreviation
Length
Meter
m
Mass (solid)
Gram
g
Volume (Liquid)
Liter
L
Temperature
Degree Celsius
°C
Time
Second
s
These standard units can be subdivided, for example meter can be divided into 1000 parts which are called
millimeters. Fractions of these units are standard and presented in Table 3.
Table 3. Prefix
BIO-100: Great Experiments in Biology,
Lab Manual
32
Prefix
Symbol
Value
Kilo
k
10³
Centi
c
10–²
Milli
m
10–³
Micro
μ
10-6
Nano
n
10-9
BIO-100: Great Experiments in Biology,
Lab Manual
33
Procedure
Part I. Making Observations (on anything!)
A huge part of the study of Biology, or any science discipline, is observation. If you spend 5-10 minutes observing
a situation then you can collect significant qualitative, and even quantitative data. Observation can be the basis for
your development of a testable hypothesis, a prediction and an experiment.
As a class, spend 5 minutes making observations of this video showing dolphins interacting with each other and
humans. As you watch, write down any interesting observations you make. Write these down to share with your
fellow classmates. – you will also include these on your first cash out assignment
Part II. The Compound Microscope
The compound microscope consists of two lenses. The objective lenses are mounted on the nosepiece. The
ocular lens is housed in the eyepiece. The light source is at the base of the microscope. Light passes through the
disc diaphragm and is focused onto the specimen, which is held fixed in place on a slide on the mechanical
stage. There are four objective lenses – the nosepiece can be turned to put any of these four in place. The
scanning objective magnifies four-fold or 4X, the low power objective magnifies 10X, the high power objective
magnifies 40X, and the oil immersion lens (which you will not use) magnifies 100X. The ocular lens in our
microscopes magnifies a sample 10 fold. Therefore, the total magnification of a microscope equals the
magnification of the objective lens times the ocular lens magnification. The coarse and fine focus knobs move
the stage and specimen relative to the objective lens and bring the specimen into focus. These microscopes are
parfocal. This means that when an objective is changed, the specimen should stay in focus.
Figure 1. The Compound Microscope
BIO-100: Great Experiments in Biology,
Lab Manual
34
The instructor will demonstrate how to use the microscope including how to turn it on, how to mount the slide on
the stage, how to adjust the light intensity, how to adjust the eye-pieces, and how to focus with the three different
objective lenses.
1. Observe a preserved tick slide with your naked eye and measure it with a ruler. Record its size in
millimeters ______ (mm). Mount the slide on the microscope stage and examine it with the 4X objective
lens. Bring the specimen into focus using the 4X scanning objective. When viewed through the
microscope, is the tick right-side up or upside down? When you move the stage, does the image in the
microscope move in the same direction as the stage? The microscope field of view is the distance
across the viewing area. If the magnification is increased, then the field of view is decreased. Can you
observe the entire “tick” with 4X, 10X, 40X objective lenses? Why or why not?
2. The depth of focus will be demonstrated with a slide of three colored threads. Move the slide so that
you the intersection of the three threads is in the center of the field of view at 4X. Bring the threads into
focus slowly with the coarse adjustment and then the fine adjustment. Determine the order of colored
threads (top = _____, middle = _____, and bottom = _____). Repeat this with the 10X and 40X objectives.
Which objective has the greatest depth of field?
3. Observe a prepared slide of human blood called. It is stained so that the red blood cells are pink and
nuclei in the white blood cells are blue. Focus on the red blood cells that make up 95-98% of the cells in
this sample. What is unusual about these cells? Do they have nuclei? There is only about one white blood
cell per 100 to 200 red blood cells so you have to hunt for them. White blood cells are also round, usually
a little larger than the red blood cell and have a very distinct blue nucleus.
Did You Know?
Do you see anything else in this blood smear? This blood is infected with a unicellular organism called a
trypanosome, which causes African Sleeping Sickness and Chagas’ Disease. Apparently later in life, Charles
Darwin was affected by this disease and suffered fatigue, irregular fever, and heart damage. Trypanosomes are
common in the tropics where they are carried by flying insects like mosquitoes that transmit the disease to
humans.
4. Draw a picture of this sample with all three types of cells.
Part III. The Micropippettor
The micropipettor is used to transfer small amounts of liquid. Because they are on the micro-scale, these are
generally used to transfer volumes ranging from 1µL to 1000µL (i.e. 1mL). Micropipettors come in several sizes
that are capable of pipetting different ranges of volumes. The table below lists the variable micropipettors you
may encounter in this course and the range of volumes they can transfer.
Table 1. Pipetteman and Their Ranges
Name
Range
P20
0.5-20µL
P100
10-100µL
P200
20-200µL
P1000
200-1000µL
You will also use fixed volume micropipettors. The volumes on these instruments cannot be adjusted but they
BIO-100: Great Experiments in Biology,
Lab Manual
35
are just as accurate as the variable pipettes. In Biology 100 lab, we have fixed micropipettors for 10, 25, and
100µL.
Micropipettes transfer very small volumes. Thus precision must be used when working with them. Once you have
the hang of it, you will be able to pipette very quickly. However, in the beginning you will need to watch what you
are doing.
How to Use a Micropipettor
Figure 2. How to hold a micropipettor
1. Hold the pipette as shown in the image Figure 2.
2. Add a plastic pipette tip onto the end of the micropipette. Tips are changed between each sample or
liquid to prevent contamination. Never use a micropipette without a clear plastic tip on the end!
3. Using your thumb, gently push down the plunger until you feel resistance. Hold your thumb steady at
that point of resistance!
4. Keeping the plunger at this position, place the micropipettor tip beneath the surface of the liquid to
be drawn up. Don’t let the tip touch the bottom of the vessel, but ensure that no air is drawn up.
5. Slowly release pressure on the plunger and allow it to return to the starting position. Do this
carefully, as liquid can shoot up into the tip and body of the micropipette. If bubbles appear in the tip,
return the liquid to the container by pushing all they way down on the plunger and start again (you may
need to change to a dry tip).
6. As you are learning to pipette, always watch the liquid enter the pipette tip. Depending on the volume
you are pipetting, you may see only a small amount of liquid in the pipette tip. We are working on the
micro-scale, 1×10-6.
7. To expel the liquid, hold the micropipette so that the end of the tip is inside a vessel you want to
deliver it to. When delivering smaller volumes into another liquid, you may need to put the end of the tip
beneath the surface of the liquid (remember to change the tip afterwards if you do this to save
contaminating stock). For smaller volumes you may also need to hold the tip against the side of the
container.
8. To remove the last drop of liquid from the tip, push the plunger past the point of resistance. If
delivering into a liquid, remove the tip from the liquid before releasing the plunger.
9. Practice micropipetting with the blue liquids on the lab bench.
BIO-100: Great Experiments in Biology,
Lab Manual
36
A Note on Concentrations
Much of biology seems like pipetting clear liquids into other clear liquids. However, will a substance that is
10ng/µL yield the same reaction as a substance that is 100ng/µL? No, because there is 10x more reactive material
in the second solution. Therefore it is always important to keep in mind the mass of a substance. In biology, we
generally measure in grams, micrograms (µg or 1X10-6g) or nanograms (ng or 1X10-9g). Thus, when using liquids
we refer to concentration, which is the mass per volume. For example, when we perform DNA analysis we will
typically include 2µL of a 10ng/µL sample. How much DNA have we added then? If 1µL = 10ng, then 2µL = 20ng.
Performing a Titration
Finally, we will put our understanding of the metric system and pipetting skills into action by doing a simple
titration. Titration is a method to determine how much of a substance (volume, concentration or mass) is in a
solution. In this case we will figure out how much NaOH (sodium hydroxide) is in an unknown solution. Each lab
pair will receive a flask of solution that contains a phenolphthalein indicator. Phenolphthalein is pink in a basic
solution, such as NaOH, and becomes clear in an acidic solution. Follow the steps below to determine the amount
of NaOH in the starting solution.
1. Obtain a flask with phenolphthalein in NaOH and place it on the magnetic stirrer.
2. Add a stir bar to the flask and turn on the magnetic stirrer.
3. Using the P1000 micropipettor, add 2 mL of HCl solution to the flask. Record this number below.
4. Now, you will add HCl to the flask until the solution becomes clear. Using a P100 or a P200
micropitpettor, add HCl in 100µl increments. Keep track of how much HCl you have added.
5. Record the volume of HCl it took to turn and keep the solution clear.
6. Use the table to determine how many mLs of NaOH were in the original solution.
Table 2. Titration Calculations
1
# of 1mL aliquots HCL
2
# of 100µL aliquots HCL
3
Total mLs of HCL = mLs of starting NaOH
Part IV. The Metric System and Scientific Units
Scientists use the Metric System to measure units such as size, weight and temperature. Table 3 shows the most
common units used in a laboratory.
Table 3. The Metric System
Quantity
Unit
Symbol
Length
Meter
m
Mass (solid)
Gram
g
Volume (Liquid)
Liter
L
BIO-100: Great Experiments in Biology,
Lab Manual
37
Temperature
Degree Celsius
°C
Modern biology is often performed on a very tiny scale so scientists need to be able to convert between large and
small units.
One milliliter is 1/1000 of a liter and is the same as 1×10-3 and .001 of a liter. There are 1000 milliliters in a liter.
So 1 microliter is 1×10-6 and .000001 of a liter. There are 1000 microliters in a milliliter and 1,000,000 in a liter.
You can convert back and forth keeping track of the decimal point and adjusting the zeros.
Put the following into order starting with the biggest: 1.555μL, 1mL, 0.5L
Complete the following table. Remember 1mL is 1000 times larger than 1μL.
Table 4. Converting Between mL and μL
mL (milliliters)
µl (microliters)
2.5
34
43
0.9
1657
34500
0.067
100
0.5
BIO-100: Great Experiments in Biology,
Lab Manual
38
Assignment - Cash Out
Assignment – Cash Out (10 points)
Focus the microscope on a prepared slide using both the 4x and 10x objectives (4pts)
List three observations from your observation exercise (dolphin video or quad) (3pts)
Pipette the following volumes of water: (3pts)
75µl
22µl
115µl
BIO-100: Great Experiments in Biology,
Lab Manual
39
Exercise III: What's In Your Water?
We take for granted the water we use to brush our teeth, wash our clothes, and keep our lawns green. However,
water is a very limited resource on the planet earth and we all need to conserve and protect our sources of water
from pollution. Today you will learn how the levels of chemicals (natural and added) are measured in different
sources of water.
Assignment: Lab Report
BIO-100: Great Experiments in Biology,
Lab Manual
40
Introduction
Learning Objectives
In this laboratory you will learn:
To identify what factors can contribute to water quality
To use negative and positive controls to validate experimental results
To use laboratory techniques to test for the presence of pollutants in our water
To use Excel to create a graph of your results from your experiments
To find other sources of information on water quality
Water is a very special chemical that all life depends on. It makes up about 60% of the human body mass and our
cells and organ systems are dependent on its unique characteristics. It is an important solvent, which means that
many things can dissolve into it. For example, salts like sodium chloride easily dissolve. It is also neutral and
naturally has a pH of 7, but when other chemicals are present the pH can change. So when you drink a bottle of
water and the company advertises that it is mountain spring water, how clean do you think that is? Are all waters
alike?
Every human requires shelter, food, and water for survival. These are provided to us from agricultural products,
metals and salts, petroleum, trees, and water, which are defined as natural resources. As populations grow, so
do their needs for these materials. Many researchers believe that in the next twenty years over half the world’s
population will have a shortage of potable or drinkable water. Despite the fact that 75% of the surface of earth is
covered in water, 97% is salt water in the oceans and another 2% is frozen in glaciers, leaving us with less than
1% to use. Scientists hope to develop methods to obtain water with desalination techniques, but in the meantime
we have to take care of our water.
Obviously the ocean water has more sodium chloride in it then is safe for us to drink. Are there also differences
between tap water and bottled water? It turns out that many things are present in our water and there can be
tremendous variation from one water sample to the next. Here are some of the chemicals that can be found in
water and how they affect the quality of water:
1. Iron This chemical element can sometimes be found at high levels in well water because the iron in rocks
dissolves into rainwater as it seeps deeper and deeper into the earth. It is not unhealthy but high levels can
discolor the water making it appear reddish-brown, and it can also discolor the food that is cooked in this water.
2. Phosphate The natural source of phosphates are eroding rocks but now phosphates are artificially produced
and are a common component of fertilizers. They are a requirement for life but, again, too much phosphate in our
waterways is a cause of pollution.
3. Chlorine This is a powerful oxidizing chemical used to kill microorganisms in our drinking water. The level of
microorganisms must be controlled so our water is safe to drink. However, this means that significant levels of
this chemical are found in our waterways and since microorganisms are an important part of ecosystems this can
be a concern.
4. Ammonia This chemical is very toxic and the human body will immediately convert it to urea for excretion.
Simpler animals such as fish just release it directly into the water where it gets diluted. But in fish tanks with
unchanged water, it can accumulate and kill the fish. Ammonia is also used in fertilizer, animal feed production,
and certain kinds of manufacturing. So high levels can turn up in our water supplies. It can also be an indication
of fecal contamination.
BIO-100: Great Experiments in Biology,
Lab Manual
41
5. Calcium and Magnesium These are both positive ions of minerals and their concentrations are what
determine the “hardness” or “softness” of water. Water that has a low concentration is soft and a high
concentration is hard. Soft water requires less soap to produce lather and generally it has a lower pH. It can
actually be corrosive if the pH is too low. Water around DC is hard and this can cause a build-up of calcium
deposits in pipes and in bathtubs.
6. pH This is the measure of how acidic or basic water can be. Low pH indicates acid conditions and you may have
heard about acid rain in the news. Plants and animals are sensitive to acid rain, as well as water that is very basic
and has a high pH. pH 7 is the neutral pH that is best for most living organisms.
7. Nitrates & Nitrites Living organisms require a source of nitrogen and they must have it in the form of nitrate.
Nitrates are converted to nitrites, which in turn are converted to nitrogen gas. However, since this chemical is
found in fertilizers that are dumped on our lawns and farmlands, the levels of nitrates and nitrites can accumulate
especially in water. Nitrates are one of the primary water pollutants because when it rains, the nitrates are
washed out of our yards and fields to drain into rivers, lakes, streams, and eventually the oceans. If there are lots
of nitrates in the water, algae will grow and use up all the oxygen so fish and larger animals cannot survive.
8. Oxygen Oxygen can dissolve in water at different concentrations depending on temperature, mixing, and the
presence of photosynthesizing organisms. Living organisms including those that live in water require oxygen.
There are now large areas of the Chesapeake Bay, for example, that are oxygen depleted as a result of pollution
from nitrates and phosphates. Nothing can survive in these waters.
As you can see from the list above, water can vary chemically from one source to the next. In addition to
chemicals, living organisms can also be in drinking water. For example, bacteria are everywhere in our
environment but most are not harmful (pathogenic). One class of bacteria that is considered a problem if it gets
into our water systems is the Enterobacteria. This group includes coliforms and specifically E. coli, which can
cause disease. Clean drinking water is treated and ideally clear of these particular types of bacteria.
Toxins in potential sources of water can also harm us in a process called bio-accumulation. This is because
species including bacteria, algae, protists, invertebrates, plants, fungi and animals are part of the food chains that
exist in natural waterways. In addition, all living things expend some energy in the activities of life, and much of
this energy is lost as heat. The efficiency of energy transfer from one trophic level to the next is only about 10%.
So getting back to toxins in the water, the primary producers and primary consumers may assimilate toxins from
the pond. This was the case with mercury poisoning in the Great Lakes. The mercury had been in the lake
sediments and eventually it got into the fish supply and then we, in turn, ate the poisoned fish. The problem is
magnified because as the toxins are transferred from one trophic level to the next, they are concentrated and
become even more toxic to the organism. This is the bio-accumulation or biologic magnification (Figure 1). So
we need to be concerned about water pollution in natural rivers and lakes in addition to our drinking water.
Figure 1. Bioaccumulation or biomagnification. The
accumulation of a chemical (in this case the + signs)
accumulates as the trophic level increases from I to IV.
BIO-100: Great Experiments in Biology,
Lab Manual
42
For more on the properties of water visit the corresponding chapter in the Concepts of Biology text:
Concepts of Biology – Water
For more information about water quality and testing visit this website.
https://water.usgs.gov/edu/waterquality.html
To learn more about the Environmental Protection Agency and their policies on water quality in our area visit this
website.
http://www.epa.gov/reg3wapd/index.htm
There are many ways to test the quality of water and you will perform some of these tests today. There will be
many different sources of water including DC tap water, distilled water and Deer Park water. You will assay for
the presence of many different chemicals and record your results.
BIO-100: Great Experiments in Biology,
Lab Manual
43
Procedure
Precious Natural Resource: Water
The class will be divided into groups and each will analyze a water sample – groups will test the same water
sample in a series of assays. First, make observations on the water sample, including the appearance and odor.
Record these observations. Based on this information and the source of the water, make a hypothesis and
prediction about the characteristics and/or quality of this water sample. Then each group will perform the assays
on their water sample and record the results in Table 1; determine the oxygen content and record those values in
Table 2; and assess the presence of bacteria for Table 3.
Stations are set up for each test with positive and negative control solutions for:
iron
phosphate
ammonia
magnesium/calcium
chlorine
The positive control has the substance being tested and the negative control (distilled water) does not. You
must compare the results for your sample with the positive and negative controls at each station to determine if
that substance is present in your water sample. This means you will set up three tubes at each station: your water
sample, a positive control and a negative control. The reagents and procedures for each test will be organized at
stations around the room.
Procedure
Start by adding 0.5 mls of your water sample to six microcentrifuge tubes. Label the tubes for each of the tests.
Move around all the stations and complete the tests. Record the results in the worksheet table.
Station 1. Iron
Positive Control = Ferrous Chloride; Negative Control = Distilled Water
Using a clean pipet, add 5 drops of sulfuric acid to each sample in the microcentrifuge tubes. Close the lid
and shake well.
Using the scoop provided, place a very small scoop of ammonium thiocyanate crystals into the
microcentrifuge tubes. Close the lid on the tube and shake well
The formation of an orange or dark purple solution is a positive indicator for the presence of iron.
Record your results for this test in the appropriate space in Table 1. writing either (+) to indicate the
presence of iron or (-) to indicate the absence of iron.
Station 2. Phosphate
Positive Control = Sodium Phosphate; Negative Control = Distilled Water
Using a clean pipet, add 5 drops of sulfuric acid to each sample in the microcentrifuge tubes. Close the lid
and shake well.
Using a clean pipet, add 2 drops of ammonium molybdate to the sample in the microcentrifuge tube. Close
the lid on the tube and shake well.
Using a clean pipet, add 5 drops of ascorbic acid to the sample in the microcentrifuge tube. Close the lid on
the tube and shake well. Wait ONLY 1 MINUTE for the reaction to take place.
The formation of a yellow solution is a positive indicator for the presence of phosphate. A colorless or pale
BIO-100: Great Experiments in Biology,
Lab Manual
44
blue solution indicates no phosphate.
Immediately record your results for this test in the appropriate space in Table 1. writing either (+) to
indicate the presence of phosphate or (-) to indicate the absence of phosphate.
Station 3. Chlorine
Positive Control = 1% Chlorine Bleach; Negative Control = Distilled Water
Using a clean pipet, add 3 drops of O-Tolidine to the samples in the microcentrifuge tubes. Close the lid on
the tube and shake well.
The formation of a reddish-brown color is a positive indicator for the presence of chloride. Light tan or
yellow is negative.
record your results for this test in the appropriate space in Table 1. writing either (+) to indicate the
presence of chlorine or (-) to indicate the absence of chlorine.
Station 4. Ammonia
Positive Control = Ammonium Chloride; Negative Control = Distilled Water
Using a clean pipet, add 5 drops of potassium hydroxide (KOH) to the samples in the microcentrifuge tubes.
Close the lid on the tube and shake well.
Using a clean pipet, add 3 drops of Nessler reagent to the samples in the microcentrifuge tubes. Close the
lid but DO NOT SHAKE!!
The formation of a dark orange precipitate is a positive indicator for the presence of ammonia.
Record your results for this test in the appropriate space in Table 1. writing either (+) to indicate the
presence of ammonia or (-) to indicate the absence of ammonia.
Station 5. Calcium and Magnesium (Hard and Soft Water Station)
Positive Control = Magnesium Chloride & Calcium Chloride; Negative Control = Distilled Water
Using a clean pipet, add 5 drops of ammonium hydroxide to the samples in the microcentrifuge tubes. Close
the lid on the tube and shake well.
Using a clean pipet, add 2 drops of the indicator solution, Eriochrome Black T, to the samples in the
microcentrifuge tubes. Close the lid and shake well. The solution should be pink at this point.
Using the pipet provided, add 5 drops of EDTA to the tube. Close the lid on the tube and shake the tube
well.
If color changes to blue then the water is soft (low level of metal ions) if the water stays pink then it is hard
and has high levels of metal ions.
Record your results for this test in the appropriate space in Table 1. writing either (+/pink) to indicate high
levels of metal ions or (-/blue) to indicate low levels of metal ions.
Station 6. pH and Presence of Nitrates
There are no positive or negative controls for this station.
6A: Determining pH of Water Sample
Pipette 0.5mL of your water sample into a microfuge tube.
Add 2 drops of universal indicator to the sample.
Close the lid and shake the tube well.
Compare the pH of your sample by comparing it to the color.
BIO-100: Great Experiments in Biology,
Lab Manual
45
6B: Determining levels of Nitrates
Pipette 0.5mL of your water sample into a microfuge tube.
Add 2 drops Nitrate Test Solution Bottle #1 of the sample in the microfuge tube.
Close the tube and invert several times to mix.
Vigorously shake Nitrate test tube solution #2 for 30 seconds
Add 2 drops Nitrate test solution bottle #2 to the sample microfuge tube.
Close the tube and vigorously shake for 1 minute. Wait 5 minutes.
Compare the color of your sample to the color chart.
Station 7. Dissolved Oxygen
The levels of dissolved oxygen (DO) can vary greatly from one water sample to another. The amount of oxygen that
can be dissolved in water is affected by temperature and the pressure of the atmosphere. Organisms in water are
dependent on DO and the DO levels can indicate the degree of pollution. You will use the Winkler method to
determine the amount of dissolved oxygen in the water sample. Titration is a chemical measurement method and
in the Winkler assay the amount of thiosulfate that is required to observe a color change is directly related to the
amount of oxygen in the water sample. MnSO4 solution and alkali-iodide-azide solution are added first to tie up
the oxygen so the levels do not change when the water is transported to the lab. Starch is added later as the color
indicator so you can see how much sodium thiosulfate to add. Finally, the mls of thiosulfate added is directly
correlated to the amount of oxygen in the water and this value is converted to parts per million (ppm) oxygen.
In this case, ppm is equal to the number of oxygen molecules per million total molecules in a sample.
The instructor will do steps 1 through 5 to preserve the dissolved oxygen. We will use 50 ml water samples.
Add 166 microliters of MnSO4 solution.
Add 166 microliters of alkali-iodide-azide solution.
Invert several times to mix, thereby allowing a brown precipitate to form.
Let the precipitate settle to at least half of the bottle/test tube volume.
Everyone observe the brown precipitate!! The TA will carefully micropipet 166 microliters sulfuric acid into
the sample tube. Shake the tube to dissolve the brown precipitate.
Pour the 50 ml sample into a 250 ml Erlenmeyer flask.
Use a p1000 pipet to slowly add in 1ml of sodium thiosulfate.
Add 3 drops of starch solution and mix. The sample should now turn to a darker brown color. If the solution
does not turn color, the oxygen content was exceedingly low and the solution has been titrated. Stop here.
Continue adding sodium thiosulfate in 100µL (0.1ml) amounts. The brown may disappear but when you mix,
it comes back. You must continue until the brown does not come back. Keep track of the amount added. Use
the Table in the worksheet to record amounts.
Determine the total amount of sodium thiosulfate added in steps 7 and 9. For the 50 mls sample we are
working with, 1ml of added sodium thiosulfate is equal to 6 ppm or 6mg/L oxygen. So multiply the number
of mls of sodium thiosulfate added by 6 to get the total ppm. Show your work in Table 3.
Coliscan is a commercial system that tests for the presence of Enterobacteriae in water samples. The patented
media included to two color producing chemicals, one for the detection of the enzyme glucuronidase (produced
by E. coli strains but not by general coliforms) and one for the detection of galactosidase (produced by all
coliforms, including E. coli). Thus, if coliform colonies are present a pink pigment will color the colonies. If E. coli
(a specific type of coliform) is present, there will be bluish-purple colored colonies. The Coliscan system was set
up by the instructor prior to class. Observe the plate and note the numbers/colors of the resulting colonies in
Table 2.
BIO-100: Great Experiments in Biology,
Lab Manual
46
Here is an example of a Coliscan plate. Each colored dot
represents a bacteria that is present in the sample. The
color of the bacteria signifies whether it is an E. coli or
something else.
BIO-100: Great Experiments in Biology,
Lab Manual
47
Assignment - Lab Report
Water Quality Lab Report
Make sure each of the bold parts below are used as section headings in your lab report. The writing should be in a
12 font double-spaced and should not be longer than four pages (not including the tables).
Title: (3 pts for name and title info)
Introduction: (7 pts)
In one large paragraph include the following:
Use references and provide three pieces of background information on the quality of water is characterized.
Clearly state the hypothesis and prediction about your water sample.
Use one or two sentences to connect your background information with the importance of your hypothesis
and your prediction for the experiment.
Materials and Methods (5 pts)
Make a statement about positive and negative controls in the assays. Describe generally how the assays and
oxygen titration were done. Describe what Coliscan Easygel is and what it identifies.
Results (10 pts)
Include a description of the water sample and the source of the water. Describe the color changes involved in the
oxygen titration.
The following data tables are worth 10 points in your lab report.
Table 1 Water Sample Results
Chemical
Positive
Control
Negative
Control
Sample
1_____
2
_____
3
_____
4
_____
5
_____
6
_____
Iron
Phosphate
Chlorine
Ammonia
Calcium
Magnesium
pH
Nitrites (ppm)
Nitrates (ppm)
BIO-100: Great Experiments in Biology,
Lab Manual
48
ppm O2
Table 2 Presence of Bacteria
Sample: _______
# colonies/ plate
# E. coli (dark blue/ purple colonies)
# Other colifoms (pink/ red colonies)
# of other bacteria (green colonies)
Table 3 Dissolved Oxygen Calculations
Sample: __________
# 1mL aliquots of thiosulfate before starch
# 100µL aliquots of thiosulfate after starch
Total mL thiosulfate ppm oxygen
Discussion (12 pts)
Summarize some ways in which the properties of water can be affected by the environment. How did this
influence your hypothesis and prediction?
Describe how the results supported or did not support the hypothesis and your prediction. Refer to data
from the Results to do this. You may also need to explain why results were inconclusive. Make sure to
include the importance of positive and negative controls.
Which types of tests done today (color changes, dip stick, and oxygen titration) are qualitative and which
are quantitative and why?
Describe any problems with observing and quantifying the assays, oxygen titration, and coliform bacteria
colony growth on the different plate.
If water is clear and smells fresh can you consider it safe to drink? Give two reasons why or why not, based
on this lab exercise.
Look up information on the Clean Water Act that congress established in 1972. Why do you think it is
important?
In a couple of sentences, write a conclusion about the importance of safe drinking water in terms of what
you learned from this experiment and your research on this topic.
References (at least 3 outside references, don’t forget to cite in the text) (3 pts)
BIO-100: Great Experiments in Biology,
Lab Manual
49
Exercise IV: What's In Your Food?
BIO-100: Great Experiments in Biology,
Lab Manual
50
Introduction
Macromolecules In Your Food
Learning Objectives
To learn the four major macromolecules that make up all cells
To understand that the food we consume is composed of cells and the four different macromolecules
To conduct qualitative laboratory tests to determine the macromolecules in food
Macromolecules: Nucleic Acids, Proteins, Carbohydrates and Lipids
All cells share a common chemical composition because they are built from the same four basic types of
biochemical macromolecules: nucleic acids, proteins, carbohydrates, and lipids. These biochemical
macromolecules are made up of smaller, monomeric subunits which are linked together by strong covalent
bonds to form polymers. For example, DNA is composed of millions of nucleotides covalently linked together, and
amino acids are linked together to form proteins. In the case of lipids, glycerol and fatty acids are combined.
Complex carbohydrates are composed of many, smaller non-reducing sugars (Table 1).
Macromolecules are the building blocks of cells, but are also a source of nutrition and energy. Unicellular
protozoa and multicellular animals consume macromolecules as nutrients. Because all naturally occurring food is
comprised of cells, or the product of cells, most food items in the grocery store will contain nucleic acids, proteins,
carbohydrate, and fats. Every organism uses enzymes to digest these macromolecules into their smaller
monomeric units.
While all cells are made of the same basic materials, the levels of each macromolecule can vary from cell to cell. In
fact, measuring macromolecule levels can help us to understand the function of a specific cell type. To accomplish
this, several colorimetric biochemical assays have been developed to identify the type of macromolecules
present in a sample (Table 1). Today you will perform assays to determine the presence of macromolecules in an
unknown food extract. You will assay an unknown food extract in four different assays and then deduce what type
of food extract you have. Your TA will provide you with a list of potential foods. (Note: If you have any type of
severe food allergy, please let your TA know as soon as possible)
Table 1: Biochemical Macromolecule Summary
Macromolecule
Monomeric Subunit
Examples of Macromolecule
Assay
Carbohydrates
Monosaccharides
Starch, glycogen, sucrose, fructose
Lugol Iodine’s
Lipids
Glycerol, fatty acids
Triglycerides, fats, oils, phospholipids
Sudan IV
Nucleic Acids
Nucleotides
DNA, RNA
Diphenylamine
Proteins
Amino acids
Enzymes, structural proteins
Biuret
Control Samples and Variables in Experimental Design
Assays test for the presence of specific molecules in two types of samples: unknown samples and control
BIO-100: Great Experiments in Biology,
Lab Manual
51
samples. The unknown sample is one that we are interested in learning more about, and so its properties are
unknown to us. In this lab, the unknown sample is the food extract that you will test in multiple different assays.
A control sample is a sample that we know something about. For example, the Sudan IV Assay determines whether
a sample contains lipids — therefore, a control sample is vegetable oil. Vegetable oil would be a positive control
sample, because it will test positive in the Sudan IV assay. Negative controls are samples that do not contain
the macromolecule we are testing for, and give a negative result. Positive and negative control samples are
essential for confirming whether an assay is working properly. Only if the positive and negative control samples
behave correctly in the assay, can we trust the results about an unknown sample. For each of the different assays
you perform today, there will be a positive control sample, a negative control sample, the unknown sample, and a
water-only control. Water-only controls are also a type of negative control sample in these assays.
All experiments have control variables, dependent variables, and independent variables. Control variables are
variables that could affect the results but are held constant or controlled for each sample. For example, the
volume of each reagent in an assay is controlled, so the total volume for each sample is identical. This means that
any difference between samples is not due to differences in volume. Other control variables include temperature
and pH. As you saw last week, dependent variables are the variables that are measured in an experiment and an
independent variable is the condition or substance that you, the scientist, alter in the experiment. In today’s
assay, the independent variable is the unknown sample and the dependent variable is the color change (because
color indicates the presence of a particular macromolecule).
Did You Know?
In 1747, James Lind performed what is considered to be one of the first clinical trials on sailors suffering from
scurvy. In his experiment, Lind divided 12 sailors, all suffering from scurvy, into six groups of two. Each group
received the same diet with supplementation of barley water, sulfuric acid, cider, vinegar, saltwater or oranges
and lemons. After one week, only the sailors receiving the citrus fruits were fit for duty. Because Lind performed a
controlled experiment with one independent variable, he was able to conclude that something in citrus fruits was
responsible for curring scurvy. This something turned out to be Vitamin C, an essential nutrient that acts as a
cofactor for enzymes that build connective tissue.
Quantitative vs. Qualitative Results
The assays we will use today produce qualitative results. They are qualitative because they produce a color that
is described using subjective terms, like reddish, yellowish, clear or brown, as in the figure below. Qualitative data
is reported in a table because words are required to describe it. Quantitative data is reported as a specific value
or number. Quantitative data can be graphically represented and some assays can produce both qualitative and
quantitative results. Today, you will use the Biuret Assay to detect levels of protein in your unknown food sample.
In this assay, the intensity of the purplish/blue color is directly related to the amount of protein present.
Qualitatively, high protein concentrations can be described as dark blue or purple. The intensity of the color can
also be measured quantitatively using a spectrophotometer to measure absorbance (A).
BIO-100: Great Experiments in Biology,
Lab Manual
52
Procedure
Procedure Summary:
Choose an unknown sample. This will be your unknown sample for every colorimetric assay in lab today.
Visit each station and follow the protocol for performing the assays. Make careful observations and record
the results in the tables.
At each station, you must determine which samples are the positive and negative controls. To do this, you
will need to think about what macromolecule(s) these controls contain.
Using the Biuret Assay and the spectrophotometer, measure the absorbance of known concentrations of
ovalbumin protein samples (Table 6).
Using the Biuret Assay and the spectrophotometer, measure the absorbance of your unknown food extract
(Table 5).
Lugol’s Iodine Assay for Polysaccharides
Lugol’s iodine (which is the iodine you get at the pharmacy) stains complex carbohydrates, also called
polysaccharides. However, Lugol’s iodine stains different polysaccharides differently. Plant starches will turn
purplish/black, animal glycogen turns rusty brown, and plant cellulose will turn dark brown.
Table 1: Lugol’s Iodine Assay for Polysaccharides
Tube #
Sample Tested
1
Unknown Food Extract
2
2% Glucose
3
2% Glycogen
4
2% Soluble Starch
5
Distilled Water
Sample Type
(unknown, positive
or negative control)
Observed
Result/Color
Conclusions
Sudan IV Assay for Lipids
Lipids are composed of glycerol and 1-3 fatty acids. A lipid composed of three fatty acids is a triglyceride. Animal
fats, such as lard, are triglycerides that are solid at room temperature; vegetable oils are triglycerides that are
liquid at room temperature. Sudan IV is a dye that is soluble only in lipids. When Sudan IV dissolves into a solvent
in which it is soluble (like a lipid), it turns bright red!
Table 2: Sudan IV Assay for Lipids
Tube #
Sample Tested
1
Unknown Food Extract
BIO-100: Great Experiments in Biology,
Lab Manual
Sample Type
(unknown, positive or
negative control)
Observed
Result/Color
Conclusions
53
2
Vegetable Oil
3
10% Karo Syrup
4
Distilled Water
negative
Diphenylamine Assay for DNA
The nucleotide is the monomeric subunit for both deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Each
nucleotide consists of a phosphate group, a pentose sugar, and either a guanine, adenine, cytosine, or thymine
base. RNA is a single stranded molecule, and each ribonucleotide has a phosphate group, with a five carbon ribose
sugar and either guanine, adenine, cytosine, or a uracil base. Only DNA can be detected using a diphenylamine
reagent. Under acidic conditions and heat, diphenylamine turns blue in the presence of DNA.
Table 3: Diphenylamine Assay for DNA
Tube #
Sample Tested
1
Unknown Food Extract
2
DNA
3
Ovalbumin
4
Distilled Water
Sample Type
(unknown, positive or
negative control)
Observed
Result/Color
Conclusions
negative
Benedict’s Assay for Reducing Sugars (Monosaccharides)
Monosaccharides are simple sugars composed of carbon, hydrogen, and oxygen in a ratio of 1:2:1. Glucose,
galactose and fructose are examples of monosaccharides. Two covalently linked monosaccharides form a
disaccharide. Table sugar or sucrose is a disaccharide of glucose and fructose; lactose or milk sugar is a
disaccharide of glucose and galactose; maltose is a disaccharide of glucose and glucose. Polysaccharides such as
cellulose, starch, and glycogen are large carbohydrates composed of hundreds of covalently linked
monosaccharides. Carbohydrates are reducing sugars when they possess a free carbonyl group such as the
aldehyde (-CH=0) in glucose, or the keto (-C=O) in fructose. Monosaccharides are reducing sugars but
disaccharides and polysaccharides are not because of their glycosidic linkage blocks the carbonyl group. Reducing
sugars are detected with Benedict’s reagent because these sugars can reduce this agent. The Benedict’s reagent
is blue but will change to light yellow in the presence of a low concentration of reducing sugar, to yellow/orange in
medium concentrations, and red in high concentrations.
Table 5: Benedict’s Test for Reducing Sugars (Monosaccharides)
Tube #
Test Solution
Sample Type
(+ or – control)
1
Unknown
?
2
2% Sucrose
3
2% Glucose
BIO-100: Great Experiments in Biology,
Lab Manual
Predicted
Result/ Color
Color Observed
54
4
2% Soluble Starch
5
Distilled Water
–
Biuret Assay for Proteins
Amino acids are the monomeric subunits of proteins and polypeptides. Each amino acid contains at least one
amino group (-NH) and one carboxyl (-COOH) or acid group. The Biuret reagent reacts with the amino group of
the amino acid. Amino acids are linked to one another by a peptide bond to form protein chains of various lengths.
Short chains are pink in the Biuret Assay, and longer polypeptides are violet. A pink/violet color is considered a
positive result in the Biuret Assay.
Using the Spectrophotometer
Set up your samples according to the Biuret protocol. During the 5 minute incubation, prepare the
spectrophotometer (spec for short) and the “blank”. Make sure the spec is on and the wavelength is set to 550nm.
Make a “blank” sample that contains 5mL of water. Place this “blank” into the spec and make sure that it is flush
with the bottom of the holder. Once the “blank” is set properly, gently close the lid and press the 0%T/A button.
After a few seconds, the panel should read 0.000 A. This action “zeroes” the machine and is equivalent to zeroing
a scale. After you zero the machine, you are ready to start reading your samples. Insert the sample tubes one at a
time and record the absorbance values in the tables below. The absorbance value is directly proportional to the
concentration of the protein in the solution. The higher the absorbance (A), the higher the protein concentration
(i.e., because more protein is in the test tube, more of the 550nm light is absorbed).
The spectrophotometer you will use to
measure Absorbance (A)
Table 5: Biuret Assay for Proteins
Tube
#
Sample Tested
1
Unknown Food
Extract
Sample Type
(unknown,
positive or
negative
control)
BIO-100: Great Experiments in Biology,
Lab Manual
Observed
Result/Color
Absorbance
(A) (at
550nm)
Conclusions
55
2
Unknown Food
Extract
(NO BIURET!)
3
2% Soluble
Starch
4
Distilled Water
control for
turbidity of food
extract
negative
Table 6: Absorbance (A) for Known Ovalbumin Standards.
Tube #
Concentration of Known
Protein Samples
5
0.05 mg/ml ovalbumin
6
0.1 mg/ml ovalbumin
7
0.5 mg/ml ovalbumin
8
1 mg/ml ovalbumin
9
2 mg/ml ovalbumin
Observed
Result/Color
Absorbance
(A) (at
550nm)
To calculate the actual protein concentration of your unknown food extract, you will generate a standard curve
using known concentrations of the protein, ovalbumin. To prepare this standard curve you will graph the (A)
values on the Y axis against the protein concentration on the X axis (data from Table 5). Next, draw a “best fit”
line through the points making sure to include 0, 0. This line of best fit is used to determine the concentration of
protein in your unknown sample. To do this, find the absorbency value for the unknown sample on the Y axis, draw
a horizontal line until you reach the standard curve best of fit line, then drop a vertical line down to the X axis.
Where this line crosses the X axis is the protein concentration of your unknown sample.
Before you use the standard curve to determine protein concentration of your unknown, a correction for the
turbidity of your unknown sample must be made. To correct for turbidity, subtract the absorbance of the unknown
sample without Biuret reagent (tube #2) from the absorbance of the unknown sample with the Biuret reagent
(tube #1). This will give you the absorbency value due to protein and not turbidity. Use this corrected value to
determine the protein concentration on the standard curve.
Quantifying the amount of a macromolecule like protein, or vitamins, or minerals in different foods is a big part of
food science. What do you think about quality control and safety issues in the food industry after doing this
experiment today?
BIO-100: Great Experiments in Biology,
Lab Manual
56
Assignment - Cash Out
Assignment – Cash Out (10 points)
Which unknown food extract did you test? A / B / C / D
Macromolecule
Did your unknown test positive or negative? (1
point/assay)
Carbohydrates (Monosaccharides)
Carbohydrates (Polysaccharides)
Lipids
DNA
Protein Concentration (using standard curve)
mg/mL
Using the data table above, make a conclusion about the identity of your unknown food extract? In your
answer, include both positive and negative data to support your conclusion – (5 points)
BIO-100: Great Experiments in Biology,
Lab Manual
57
Exercise V: Testing the 5-Second Rule (Week 1)
How was Anton van Leeuwenhoek able to discover microorganisms in the 1600s? This inventor of the microscope
was open to all possibilities and curious about a world of organisms he could not see. He also understood the
scientific method. You will use this same approach to set up an experiment. This experiment will be your own
creation and will be based on the 5 Second Rule. In other words, do you think a piece of food that drops on the
floor is safe to eat if it is picked up within 5 seconds? This lab will also provide an introduction to experimental
variables, how to formulate a hypothesis and prediction, statistical analysis, and the structure for writing
scientifically.
This laboratory will last 2 weeks.
Assignment: Cash out assignment for week 1 and lab report for week 2.
BIO-100: Great Experiments in Biology,
Lab Manual
58
Introduction
Testing the 5-Second Rule
Learning Objectives
to culture and characterize the bacteria that are present on surfaces all around us!
to provide an explanation for why only some bacteria make humans sick
to explain how population density, population movement, virulence, and vaccination rates affect the
movement of a contagious disease through a human population
to set up an experiment to test assumptions associated with the 5-second rule
Microbiology
Antony van Leeuwenhoek is considered the father of microbiology. He had access to magnifying glasses by which
he made many observations that allowed him to hypothesize that there were living organisms smaller than the
human eye could see. He predicted: If a stronger magnifying instrument can be developed, then we will be able to
see tiny living organisms and learn more about their characteristics. Leeuwenhoek did not simply make
observations; he set up experiments with hypotheses and predictions to learn more about how organisms
functioned. His detailed results showed others how to use the scientific method to become experimental
biologists.
The lab exercises today will introduce you to the microbiology, or the science of very small, or microscopic
organisms. These small organisms include bacteria, viruses, protozoa, and fungi – but we will focus on bacteria.
Microorganisms are ubiquitous – they can survive in the Hot Springs of Yellowstone, to the inside of your stomach,
to the surface of your lab bench. They resemble many of the primitive unicellular organisms which were the first
forms of life on Earth about 3-4 billion years ago. Microorganisms that can cause disease in animals or man are
primarily bacteria with the exception of a few fungi, some single cell eukaryotes, and some invertebrates.
However, most microorganisms are not infectious and do not cause disease – they are neutral. Viruses also cause
disease, but since they are dependent on their hosts to replicate and do not grow, viruses are not considered living
by most biologists.
Bacteria are probably the most common microorganism and this will be demonstrated in the experiment you will
set up today. Individual bacteria average about 10 micrometers in size and the human eye can only see something
as small as a frog’s egg (about 1000 micrometers) so bacteria cannot be visualized without a microscope.
However, there is a way to detect the presence of bacteria without a microscope! A sample of bacteria can be put
on a special sterilized medium called agar. If the agar has all the necessary nutrients, then the bacteria will grow
and divide over and over again in the same spot on the agar surface, and their millions will form a visible colony.
The colony morphology is unique to a particular species. There are many types of agar media but the most
common is nutrient agar. Nutrient agar is a very rich medium with minerals, vitamins, and a source of
carbohydrates and nitrogen. Many species of bacteria will grow on this medium. The nutrient agar is prepared
and poured into plates aseptically, which means that there are no living cells inside the plate or on the agar.
Aseptic technique uses sterile media and procedures to minimize contamination from unwanted species.
BIO-100: Great Experiments in Biology,
Lab Manual
59
Examples of agar plates without colonies!
So with a little knowledge of microbiology, we can move on to setting up an experiment. Using inductive
reasoning, we might consider the 5 second food drop rule to be true. A piece of food dropped on a floor is safe to
eat if it is picked up within 5 seconds. How can we set up an experiment to test the validity of the 5 second food
drop rule? The place to start is with a hypothesis and here are a few that could be considered based on our
inductive reasoning. Try to think of other examples.
Microorganisms on floors are safe to eat.
There are no microorganisms on the floor.
In 5 sec. or less there is not enough time for microorganisms to stick to food.
Each of these hypotheses is a little different but what is important is that each is testable. And, they can also be
rejected if there is evidence to show that they are not true (they are falsifiable). Finally, reasonable predictions
can be made and experiments developed based on these hypotheses.
Remember as scientists you must also consider all the variables. Variables are the items or conditions that could
affect the outcome of an experiment. Make a list of the factors that might affect the cleanliness of dropped food
(time on the floor, food texture, etc.) A good experiment will be based on testing one of these variables and
controlling for the rest. Make sure you understand which is the independent variable you, the scientist,
manipulate as opposed to the dependent variable you observe. In this case, use your deductive reasoning
abilities to narrow your experience to a single experiment you would make a prediction about. All other variables
would be remain unchanged so, for example, the type of food tested would be the same and the method measuring
bacterial growth would have to be the same (controlled variables). Last, but not least, there should be an
experimental control which in this case would be the exact same food but not dropped on the floor!
So, what sticks to food when it drops on the floor? What types of organisms are on the floor, on furniture, our
clothes, our bodies, etc? Bacteria, viruses, fungi, single cell protists, and even tiny insects or invertebrates are
everywhere and collectively we know them as microorganisms. Most of the organisms that will stick on food are
prokaryotic and from the Domain Bacteria but we can also pick up Fungi. Fungi are eukaryotic organisms from
the Domain Eukaryote and they include molds that grow on food like bread or spoil fruit even in our refrigerators.
Many of these organisms will grow on nutrient agar plates however sometimes we can never perfectly copy the
conditions required of some bacteria and these are very difficult to grow. For example, marine microorganisms
will not grow on nutrient agar because they require a higher salt concentration. Different types of bacteria have
very different nutritional requirements. An endless number of nutrients can be added to any agar medium to test
for these requirements. Also, a particular species of bacteria can be selected by using an agar medium that is
either enriched with special added nutrients or has components that inhibit the growth of other types of bacteria.
Finally, differential media are used to distinguish bacteria species because the colonies develop with very
distinct morphologies on this type of agar.
Blood agar is a special agar medium that contains sheep blood and is used to isolate staphylococci, streptococci,
and pneumococci. Some of these species are pathogenic because they produce a toxin that lyses red blood cells or
are hemolytic – they are identified on the blood agar plate because they create a halo of hemolysis (see plate
below). The incidence of hemolytic streptococci carriers is 10% to 75% of the population and up to 90% of hospital
workers! DO NOT open these agar plates when bacteria are growing on them! Today you will set up an
experiment with both nutrient agar and blood agar plates.
BIO-100: Great Experiments in Biology,
Lab Manual
60
An example of blood agar plate showing alpha, beta and
gamma hemolysis.
To learn more about bacteria read the corresponding text from Concepts of Biology: Concepts of Biology –
Prokaryotes
BIO-100: Great Experiments in Biology,
Lab Manual
61
Procedure
WEEK 1
PART I EPIDEMIOLOGY AND STATISTICS
Today you will also use a simulation to learn more about how a few viruses and even fewer bacteria cause disease
and how disease spreads in a population. This is the science of epidemiology. The focus will be on the
characteristics of disease and the value of vaccines as determined with statistical analysis. Diseases spread
primarily by contact either through blood, air, skin, feces, and water. In this age of global travel, disease
transmission can be quick especially in high density areas such as cities.
This exercise provides a means to compare the imaginary disease, Kold, similar to the common cold; with
Impfluenza, which resembles an influenza outbreak. Again, you will see the importance of controlling different
variables. If we hypothesize that increased population density increases the spread of disease then our prediction
might be…… If high population density correlates with increased spread of disease, then in cities disease will
spread faster than in rural areas. Can we do this experiment in real life? NO! However, there are many types of
computer simulations that allow scientists to study how variables affect the spread of disease. In the simulation
today, we can change the population density (or vaccination or movement) and collect the results. This is an
excellent way to study experimental variables as they come into play in the spread of these diseases and what
factors diminish their effects.
If the simulations doesn’t load within this book, you may visit the simulation in a new browser window
athttp://www.learner.org/courses/envsci/interactives/disease/disease.html.
Disease Simulation
Simulation 1: The Virgin Field
Select “the virgin field” meaning that in this simulation humans have no immunity to the disease. In this
first run-through, assume that the population does not move around the field much (this is an example of a
controlled variable); they interact with their neighbors, but do not travel long distances. Make sure the
settings are for virgin field, the disease “Kold”, with a population density of medium and population
mixing of low. Run the simulator to 100 days (click on Run button) and record the results in Table 1. Use
the “hand” feature over the graph lines to read exact numbers. Then repeat two more times.
Table 1. Disease Simulation Results: Kold
BIO-100: Great Experiments in Biology,
Lab Manual
62
Simulation 2: Virulence (Use Lesson 2 Vaccination)
Change the Lesson to Vaccination and we’ll look at a different disease, “Impfluenza”. This disease has a
more virulent microorganism which means that it causes more serious disease symptoms. Note how long
individuals remain contagious, the transmission rate, and the death rate associated with this
disease. Compare these with the details for the “Kold”. Next, run the simulator three times for
“Impfluenza” using medium population density, low population mixing and no countermeasures. Record the
data.
Table 2. Disease Simulation Results: Impfluenza
BIO-100: Great Experiments in Biology,
Lab Manual
63
Simulation 3: Vaccination (Use Lesson 2 Vaccination Again)
In this step we’ll look at the effects of vaccinating a certain percentage of the population against
Impfluenza. This represents a real-life scenario, where the country vaccinates a certain portion of its
population against the expected influenza strains for that year. Change the tableau in the upper right
corner of the simulator from Virgin to Vaccine.
Predict how many people will get sick, develop immunity or die with a vaccination rate of 10% and record
on the top of Table 3.
Run the simulator three times and record your data. Compare these results to the Table 2 results. Then
change the vaccination rate to 25% and then 50% and run the simulator. We can see that the vaccine
reduces the number of sick days and deaths. But how large a percentage of the population would have to
be immunized in order to bring the sick days per capita to 0.1 or less per capita and also reduce deaths to 0
and thus be significant. We can use statistical analysis to better understand these results.
Table 3. Disease Simulation Results: Impfluenza Vaccination
BIO-100: Great Experiments in Biology,
Lab Manual
64
There are many ways to compare the two populations (samples). We can just observe the two sets of numbers
qualitatively and decide if they are similar or not. We could also determine the means by adding up all the values
in each population set and then dividing by the total number of values (n). Even though the means are concrete
numbers, they are still not the best way to analytically compare two populations. The best method is to use a
statistical test that objectively determines if two populations are different. The T-Test is a standard test used to
examine if one characteristic differs between two populations. For example, are the heights in one population
BIO-100: Great Experiments in Biology,
Lab Manual
65
different from the heights in a second population? In this vaccination experiment we will be comparing each of the
vaccination rates to a population that is not vaccinated. So we will have three categories of two population
samples each and will use the number of sick days in Table 4 and the number of deaths in Table 5. We want to see
vaccinating a higher percentage of the population will significantly protect the population.
The T-test measures the variance of two data sets around their means to determine if there is a difference
between the two data sets. Scientists want to be 95% certain that any difference in a characteristic between two
groups is not due to chance. The Graphpad website program calculates a T value for the populations and then
converts the T-test value to p (probability). If we look at a graph of both populations with the fitness values on the
x axis and the number values on the y axis, the degree of overlap indicates how similar or different the two
populations are. If less than 5% of the values are overlapping then the two populations are considered to be
significantly different for the factor studied. In other words the calculated p from the T test must be lower than
0.05. If p is lower then 0.05 then we can say the two populations are significantly different. The higher
the p, the more similar the two populations.
Graphpad provides other information but we are just focusing on the means, the p (probability that the two
populations are different), and whether the p is low enough to determine that the difference is significant. This
information will go into Table 4.
Performing a T-test
You will be using a web-based program to test for statistical differences between population sets you are
examining. Use the website GraphPad.com: http://www.graphpad.com/quickcalcs/ttest1.cfm. This website should
be available in the bookmark bar labeled “T-test.” Your instructor will show you what the site should look like.
GraphPad’s T-test
Make the following selections before entering your data:
select “Enter up to 50 rows”
enter data
choose “unpaired t test”
click on “Calculate Now” button (you should now see a different window)
When you are ready to input the next set of data, click on the back button, clear the form and start again. First use
the number of sick days to calculate significant differences due to vaccination. Put the results in Table 4. Then
repeat with the number of deaths and put the results in Table 5.
PART II THE 5 SECOND RULE EXPERIMENT
Make a hypothesis and prediction based on the 5-second rule. Focus on testing a single variable when you
develop your hypothesis and prediction.
Each pair will get 1 nutrient agar and 1 blood agar plate. The plates can be divided in half so that two
samples can be plated. Control bologna and gummy bear plates will be set up by your TA.
Label the agar plates on the agar side and around the periphery of the plate – include your initials, the date
and the treatment.
Make an experimental plan and get it checked by your TA. You can sample with bologna or gummy bears.
You can test any surface you want. Please remember to control your variables! For example, you can sample
with the bologna by removing a piece with sterile forceps and then place it on the test surface like the floor
or couch. Count to 5 seconds and pick it up. It is best if you keep holding an edge with the forceps. Then
place the surface that touched the floor or couch on the agar surface for 5 seconds. Place the top back on
the Petri dish and throw the bologna away. You must repeat this procedure for each of the two types of agar
– nutrient and blood. If you use the gummy bears, then take one from the Petri dish with the forceps and
place it on the test surface for 5 seconds. Carefully pick it up and streak the agar surface with the side of
the gummy bear that was on the floor or couch. Quickly close the Petri dish and throw the gummy bear
away. Again, repeat this procedure for the second type of agar. Use Table 5 to help organize your methods.
BIO-100: Great Experiments in Biology,
Lab Manual
66
After your TA checks your plan, do your food sampling and place the inoculated plates in a dedicated place
for your class section. All the plates will be incubated at room temperature until the next lab period.
It is possible that a few of the bacteria that grow and form colonies on these agar plates could cause
disease, so the petri plates should always be kept closed. The majority of bacteria do not cause disease. So
how do we get sick and why does it seem like families and friends will acquire diseases from each other?
Scientists have found that the greatest transfer of bacteria is via the hands. Remember to wash your hands!
Figure 1. Nutrient agar plate
Figure 2. Blood agar plate
Five Second Rule Experiment Week I
Table 4. Microbiology Experiment Setup
Plate #
Agar type
1 one half
Nutrient
1 other half
Nutrient
2 one half
Blood
BIO-100: Great Experiments in Biology,
Lab Manual
Food type
Surface
Time
67
2 other half
Blood
3 Control (Instructor)
Nutrient
gummy bear, bologna
none
none
4 Control (Instructor)
Blood
gummy bear, bologna
none
none
BIO-100: Great Experiments in Biology,
Lab Manual
68
Assignment - Cash Out
Assignment – Cash Out (10 points)
Simulation 1: The Virgin Field. Answer the following based on Table 1
1. Do you get the same exact results each time? How do the results compare with each other? (1pt)
Simulation 2: Virulence. Answer the following question based on Table 2
2. Notice that Impfluenza, unlike Kold has a death rate. How does death toll change how people react to the
disease? (1pt)
Simulation 3: Vaccination. Answer the following questions based on Table 3.
3. In Table 3, which percentage of the vaccinated population makes the greatest difference in terms of sick
days? In terms of deaths? (1pt)
4. Describe what a T-test is and when you would use it (1pt)
Table 5. T-test Results for Vaccinations Affecting Sick Days (3 pts)
Category
Means
‘p’
Significant/ Not
significant
‘p’
Significant/ Not
significant
No vaccination compared with 10% population vaccination
No vaccination compared with 25% population vaccination
No vaccination compared with 50% population vaccination
Table 6. T-test Results for Vaccinations Affecting Deaths (3 pts)
Category
Means
No vaccination compared with 10% population vaccination
No vaccination compared with 25% population vaccination
No vaccination compared with 50% population vaccination
BIO-100: Great Experiments in Biology,
Lab Manual
69
Testing the 5-Second Rule (Week 2)
BIO-100: Great Experiments in Biology,
Lab Manual
70
Procedure
Five Second Rule, Week Two
PART I OBSERVING MICROORGANISMS
Bacteria, viruses, fungi, single cell protists, and even tiny insects or invertebrates are everywhere and collectively
they are called microorganisms. Are they prokaryotic or eukaryotic cells and what does that mean? The simplest
cells are prokaryotic cells as exemplified by all types of bacteria. Prokaryotes are classified into either the
Domain Bacteria or the Domain Archaea consisting of the bacteria which survive in the most extreme
conditions of Earth (high salt, high and low temperatures, etc.). Prokaryotes are very simple cells, do not have any
organelles, and are very small. All other cells are eukaryotic, and have membrane bound organelles including a
nucleus that prokaryotic cells lack. Microorganisms are usually considered to be single cell organisms but there
are some very tiny insects or invertebrates that are multicellular and are made up of eukaryotic cells.
Observe the eukaryotic organism, Volvox. You will make a wet mount of this living organism by placing a
drop of culture into a depression slide. Then observe with the 4X and then 10X objectives. Volvox is one of
the simplest, multicellular, eukaryotic organisms. It is photosynthetic and a member of the green algae
group. It consists of cells that are held together in an organized gelatinous matrix. Observe the thousands
of spiked cells making up a sphere. Most cells are vegetative and a few are selectively reproductive. The
fact that there are reproductive cells and also that the Volvox sphere has an anterior and posterior pole of
cells indicates the very primitive beginnings of cell specialization.
Volvox!
One of the most common and oldest ways to classify bacteria is based on morphology and this includes
characteristics like cell shape and cell arrangements. There are three basic shapes: bacillus is rod-shaped,
coccus is spherical, and spirillum is a twisted spiral. Sometimes bacteria will group together in distinct
pairs or chains and this factor can also be used to identify species. Another way to classify different bacteria
is based on staining characteristics. The most common stain for identifying bacteria is the Gram stain.
Some bacteria stain blue with the gram stain and are considered gram positive and others stain pink and
are gram negative. Whether a species is gram positive or negative is dependent on the structure of their
cell wall. As you know, all bacteria must be observed with a microscope because they range in size from 1
to 10 microns. Find the stained areas of the slide with the 4X objective but you will have to use the 10 and
40X objectives to see the cells. The three stained areas contain samples of bacillus, coccus, and spirillum
shaped bacteria.
PART II: ANALYZING 5 SECOND DROP RESULTS
There will be many types of growth on the nutrient and blood agar petri plates from your experiment. Anything
observed on the agar will be either bacterial, consisting of well-defined colonies, or fungi with diffuse and fuzzy
looking growth. Most of these organisms will be benign but there is always a chance one or two could be
pathogenic
Many species of the bacteria Streptococcus and Staphlococcus are associated with human disease. Streptococcus
BIO-100: Great Experiments in Biology,
Lab Manual
71
causes strep throat and Staphlococcus aureas is commonly found on the skin. Extremely pathogenic forms of
Staphlococcus include the MRSA strains that are resistant to antibiotics and can be very toxic. Hemolysin is one
type of exotoxin that Streptococcus and Staphlococus bacteria produce. Hemolysin destroys red blood cells in a
process called hemolysis. You may recall that the samples from the 5 sec drop experiment were plated on both
nutrient agar and a second red agar containing sheep red blood cells. The blood agar will allow you to identify any
bacteria species that have hemolysin. Here are the basic types of hemolysis:
Alpha hemolytic: small, translucent colonies. These colonies are less than a millimeter in diameter and have a
greenish zone surrounding them. This type of organism produces alpha hemolysin, which partially destroys the
red blood cells in the agar. Streptococcus pneumoniae and mitis are in this group. They can be found in abscessed
teeth, infected sinuses, and subacute bacterial endocarditis.
Beta hemolytic: small, translucent colonies. Streptococcus pyogenes produces beta hemolysin which breaks
down the red blood cells and their hemoglobin in the blood agar. This action produces a clear zone around the
colonies of these organisms. “Strep throat”, scarlet fever and puerperal fever are caused by this highly pathogenic
species.
Beta hemolytic: large opaque colonies. Staphlococci colonies may be yellow, orange, or white and at least two
millimeters or more in diameter. The medium around the colonies is clear due to the break down of the red blood
cells.
Gamma hemolytic: Any colonies that form on blood agar but do not cause any type of hemolysis.
Figure 1. Blood agar plate
Five Second Rule Experiment Week 2
Table 7. Five second Rule Experiment Results
Plate #
Total #
colonies
# of different colony
types
based on
morphology
Additional results
morphological types
& growth patterns (i.e..
hemolysis)
Nutrient agar one half
Nutrient agar other half
Blood agar one half
Blood agar other half
Nutrient agar Control
Blood agar Control
BIO-100: Great Experiments in Biology,
Lab Manual
72
Examine the growth on your experimental agar plates and use the hand-outs to help describe the colonies.
You may observe individual colonies or a “lawn” of growth. (When there are too many colonies, they grow
together and form a lawn). Calculate both the total number of colonies and the different types of colonies
present. Draw pictures of the growth on the plates and describe them as well. Use tables such as Table 6 to
organize your results. Modify this table so it best fits your experimental results or add an additional table.
Analyze the types of hemolytic colonies from the 5-second drop blood agar plates. You may decide to put
these results in a separate table. Again, count the total number of colonies and the number of different
hemolytic and non hemolytic (gamma) types.
Note there are two basic ways of studying the results of an experiment: qualitative, and quantitative. You
might look at your agar plates and one half may be covered with a growth and the other half may have ten
different colonies. You might assume that there were more microorganisms on the side of the plate covered
with growth and this would be a qualitative result that is more subjective than analytical. In science, we
believe more in results that our quantitative because there tends to be less bias. For example, the growth
covered side could have been produced by a single fungus and the 10 colonies could represent ten different
bacteria. Most of the time, having the quantitative numerical data gives more validity to the conclusions
we want to make from an experiment. So make sure you do a thorough job examining the colonies on the
plates and entering your data in the tables.
BIO-100: Great Experiments in Biology,
Lab Manual
73
Assignment - Lab Report
Make sure each of the bold parts below are used as section headings in your lab report. The writing should be in a
12 font double-spaced and should not be longer than two to three pages (not including the tables).
Scientific Methodology: 5 Second Rule Experiment Lab Report
Title (3 pts for name and creative title)
Introduction (7 pts)
In one paragraph include the following:
Use references and provide three pieces of background information on the general
characteristics of bacteria.
Then clearly state the hypothesis and prediction of your 5 sec drop experiment.
Use one or two sentences to connect your background information with the importance of
your hypothesis and your prediction for the experiment.
Materials and Methods (5 pts)
Include Table 4
In a few sentences describe exactly how sampling was done for Part III and the conditions of
incubation
Results (20 pts)
Results of Part II: Include the total number of colonies, and total number of different types of
colonies that grew on each of the agar plates if possible.
Include Table 7, Hemolysis results table, and/or any other tables
Include drawings or photos
Describe what the bacterial growth looked like on each of the plates in general terms in a paragraph
and make sure to refer back to your drawings or photos.
Discussion (12 pts)
Summarize the purpose of the 5 second rule experiment based on background information that you
researched and read in two sentences.
Describe how the results supported or did not support your hypothesis and prediction. Refer to data
from the results to do this. You may also need to explain why results were inconclusive. Don’t forget
to compare the experimental plates to the controls (1-2 paragraphs).
Describe any problems with observing and quantifying the bacteria colony growth on the different
plates in a sentence or two.
How do you think the properties of the food you tested affected this experiment? What other factors
affected the results of this experiment? If you could repeat your experiment, what would you change
or improve? (three sentences total)
Different species of bacteria have growth requirements that are specific to their needs. The needs
vary greatly because bacteria grow everywhere from the hot springs of Yellowstone to even snow.
Based on this perspective, do you think the same types of bacteria grew on the nutrient agar as the
blood agar, why or why not? Do you have any proof of this from your experiment? Explain in a few
sentences.
In a couple of sentences, write a conclusion about the 5 second rule in terms of what you learned
from this experiment.
References (Minimum of 3. Cite them in the text) (3 pts)
BIO-100: Great Experiments in Biology,
Lab Manual
74
Here is an editable version of the Lab Report, which you need to complete the assignment. Use the Google Doc
which
contains
the
tables
depicted
above:
https://docs.google.com/document/d/1iUTtI9s0pam_GE25IhwNCghoBcGBDxDoeFd5pKuZulU/edit?usp=sharing.
Google DOC version of the Lab Report
BIO-100: Great Experiments in Biology,
Lab Manual
75
Exercise VII: Cells and DNA
Today we will examine the characteristics of DNA within cells. The human DNA in a single cell is about 1 meter
long yet only 2 nanometers wide. It is organized into 46 pieces called chromosomes located in the nucleus of the
cell. To visualize DNA, large amounts must be extracted from hundreds of cells. Today you will use your own
cheek epidermal cells to compare methods for counting cells, extracting DNA, and then quantifying DNA.
Assignment: Writing Assignment
BIO-100: Great Experiments in Biology,
Lab Manual
76
Introduction
The Genetic Information in Cells: DNA
Learning Objectives
In this laboratory you will learn:
To view the structure of a cell and identify the location of the genetic material in the cell
To isolate human cheek cells and quantify them using an automated cell counter
To extract and quantify DNA from human cheek cells using a Nanovue spectrometer
To create an excel line graph and perform a linear regression to determine whether there is a
relationship between two sets of data
Figure 1. The Structure of DNA
All cells have a plasma membrane plus genetic material, DNA (deoxyribonucleic acid). Prokaryotic cells
(including all types of bacteria) do not have a nuclear membrane or membrane bound organelles. Their genetic
material consists of a single piece of circular DNA. All other cells are eukaryotic and have membrane bound
organelles. In particular, eukaryotic cells have a nuclear envelope that encircles the genetic material called a
nucleus. The genetic material is divided into one or more linear pieces of DNA called chromosomes. All human
cells have two copies of each of the 23 chromosomes (for a total of 46!); one set comes from the female parent and
one from the male parent.
In this lab, you will observe the nucleus of a human cheek cell and then isolate the DNA from these cells. The
number of cells in each sample will be calculated with an automated cell counter to determine the cell
concentration. The amount of DNA will be assessed with a special spectrophotometer called a Nanovue. The cell
counter and the spectrophotometer are examples of equipment commonly used in research laboratories. The
results of the cell counts and DNA concentrations will be compared statistically to determine a correlation
between cell number and DNA volume.
To read more about DNA in your Concepts of Biology text: Concepts of Biology – DNA
BIO-100: Great Experiments in Biology,
Lab Manual
77
Procedure
You and a partner will collect a sample of human cheek cells to be used during this lab.
One person from each pair will pour 5 mls of drinking water with a little salt (0.85% NaCl) from a capped
test tube into their mouth.
Swirl the water around for at least 30 seconds, mechanically pushing it all over the inside surfaces of your
mouth. The swishing gently removes cells from the inside of the mouth and into the water. The salt in the
water makes the solution osmotically balanced so that the cells will not shrink or burst.
Spit the salt water plus cheek cells into a 50 ml blue capped test tube.
Part I Visualize Human Cheek Epidermal Cells
1. Make a wet mount of the cheek cell preparation you just made for observation with the compound
microscope. Place one drop of the cell sample on a slide. Place a drop of 1% methylene blue on top of the
drop of cells. Then put a cover slip over the drop. If the cover slip is sliding around, soak up residual liquid
with a kimwipe.
2. Find the sample with the scanning objective in place. Look around the sample and find an area with many
cells that are stained (but not too dark). Then use the low power objective of the microscope to observe the
size and shape of the cells.
3. Use the 40X objective to observe the organelles of the cells. Both students of each pair will observe the
nucleus and other cellular structures. Draw a diagram of a cell that is well stained and spread out. Make
sure to label the parts of the cell (membrane, nucleus etc).
In the space above, draw a picture of the cell at 40X objective
Part II Determine the number of human cheek cells in the sample
Count the cells in the sample (before you extract the DNA) using an automated cell counter. The counter uses
optics and image analysis to differentiate between live and dead cells so that counts are made on only the living
cells.
You will add Trypan blue dye to the cell sample. This dye stains dead cells while live cells exclude the stain.
Mix 10 µl of the cell sample with 10 µl of the trypan blue in a small tube.
Then use 10 µl to load the special slide.
The slide will fit gently into the top of the machine. The cell counter has been calibrated for the size of the
cheek cells but it still needs to be focused. This can be done with the Zoom feature and the dial on the right
side of the machine.
Then just push the “count cells” button and the total number of cells per ml is given as well as the number
of living and dead cells.
BIO-100: Great Experiments in Biology,
Lab Manual
78
Enter the total number of cells in your 5 ml sample in Table 1.
Part III DNA Isolation from a calculated number of human cheek epidermal cells
Now that you know the number of cells in your sample, return to the DNA analysis.
Add 10 drops of 10% sodium lauryl sulfate solution to the 50 mL tube of cells. This is the chemical found in
most shampoos. Read the list of chemicals in a typical shampoo and you will see that it contains sodium
lauryl sulfate.
Gently invert the tube a few times to mix the cell-soap solution. The detergent breaks down and dissolves
the outside cell membranes first and then the nuclear membranes. The contents of the cells and nucleus
will combine with the salt solution. The DNA released into the solution will cause it to become more viscous.
Obtain a microcentrifuge tube and look at the markings on the sides of the tube.
Use a dropper to fill the microcentrifuge tube with your DNA mix to the 1 ml mark. Use another dropper to
carefully fill the tube almost to the top with cold 95% alcohol. Do not mix.
The alcohol will sit on top of the salt-cell mixture. The DNA will start to precipitate out of solution at the
interface and it will look like tiny white strands. After carefully observing the interface, invert the tube so
the alcohol and water phases will mix. More DNA should precipitate into a white clump.
Now measure the DNA in your sample using the Nanovue spectrophotometer to measure the micrograms
(µg) of DNA in the sample. Nucleic acids including DNA, absorb light in a specific pattern. DNA absorbs
ultraviolet light at a wavelength of 260 nm. In a spectrophotometer like the nanovue, a sample is exposed to
ultraviolet light at 260 nm, and a photo-detector measures the light that passes through the sample. The
more light absorbed by the sample, the higher the nucleic acid concentration in the sample. The Nanovue
correlates the amount of light absorbed to the concentration of the absorbing molecule (DNA). After the
machine is zeroed with water, the instructor will put 2 µl of each student sample on the Nanovue. The
sample is measured in µg per ml. Since there was a total of 5 mls then this value should be multiplied by 5
to get the total amount of DNA in the sample. These results will go into Table 1.
The purpose of this experiment is to determine if there is a correlation of between the number of cheek cells
observed and the amount of DNA extracted. As part of your assignment you will compute a linear regression using
the data in Table 1.
To compute the regression enter the data from the column “Total cells with cell counter” and “Total
Nanovue quantity of DNA(µg)” into two excel columns.
Highlight the data, including column titles and create an XY scatter plot.
Once the graph is created highlight or click on a point in your graph.
Right click and an option for “Add Trendline” will appear. In the trendline window, make sure the “Type” is
linear and under “Options” select “Display Equation on Chart”.
Click OK and your trendline with its equation will appear on your graph.
This is the correlation between the number of cells and the amount of DNA extracted. *Note excel functions vary
by edition, Mac/PC. You may need to ask your instructor, classmate or google for assistance with your particular
edition.
Table 1 Comparing Cell and DNA Measurements
Class sample
Total cells with cell counter
BIO-100: Great Experiments in Biology,
Lab Manual
Total Nanovue quantity of DNA (µg) (y axis)
79
Assignment - Writing Assignment
Assignment – Writing Assignment (30 points)
Read
the
following
http://genomemag.com/why-is-this-99-home-dna-kit-causing-such-an-uproar/#.VWiRLofSfzQ.
article:
In 1-2 pages, summarize the article’s main thesis and conclusions. Address the following questions in your
assignment:
How could the information in your genome benefit an individual?
What are some of the ethical considerations that occur when sequencing your whole genome?
What are the implications of inaccurate genome sequencing?
What are some of the negative implications of knowing your susceptibility to developing a disease?
Why did Angelina Jolie have a double mastectomy? Was she 100% sure she would develop breast
cancer?
Your grade will be based on whether you accurately and thoroughly covered the major topics covered in the
article, addressed the above questions, cited references appropriately, and wrote precisely and effectively.
You can have a fellow student give feedback but please make sure your words are your own!
For more information on genome sequencing, you can visit https://www.23andme.com
BIO-100: Great Experiments in Biology,
Lab Manual
80
Exercise VIII: The Information in DNA
The unique molecular structure of DNA allows scientists to manipulate genetic information and move genes or
portions of inherited material from one species to another. This week you will study DNA structure, restriction
enzymes, and electrophoresis. You act as a forensic scientist and use these tools to compare DNA samples
collected at a hypothetical crime scene and solve a crime. The pros and cons of using genetic engineering
techniques will be discussed.
Assignment: Cash Out Assignment
BIO-100: Great Experiments in Biology,
Lab Manual
81
Introduction
DNA Manipulation
Learning Objectives
In this two-week laboratory you will learn:
To describe the structure of DNA
To use tools used in forensics and genetic engineering to cut DNA strands in specific sites
To separate DNA strands based on size using gel electrophoresis
To compare DNA strand size to samples obtained from a hypothetical crime scene and identify the
prime suspect in the crime!
DNA is such an integral part of our world that we forget it has been only about 60 years since its relevance to
inheritance and genetics was identified (1952). At that time, James Watson and Francis Crick figured out the 3dimensional form of the molecule from research results provided by many other scientists. At the same time,
Rosalind Franklin generated X-ray crystallography information about the molecule. Watson and Crick published
the structure of the molecule in 1953 in the British journal Nature (volume 171: 737-738). Here is what they knew:
The basic DNA structure was helical.
The strands were made up of 4 smaller molecules called
nucleotides.
Each nucleotide was made up of a phosphate group, a
deoxyribose sugar, and a base.
There were four different nucleotides because there were
four different bases: adenine, guanine, cytosine, and
thymine.
Adenine nucleotides always equaled the number of thymine
nucleotides.
Guanine nucleotides always equaled the number of cytosine
nucleotides.
Here are some
direct quotes
from the article:
“…This (DNA)Figure 1. DNA Structure
structure has
two
helical
chains each
coiled round the
same axis…Both
chains follow
right handed
helices…the two
chains run in
opposite
directions. ..The
bases are on the
inside of the
helix and the
BIO-100: Great Experiments in Biology,
Lab Manual
82
Figure 2. Watson & Crick by their model of DNA
phosphates on
the outside…The
novel feature of
the structure is
the manner in
which the two
chains are held
together by the
purine
and
pyrimidine
bases… The
(bases)
are
joined together
in pairs, a single
base from one
chain being
hydrogenbonded to a
single base from
the other chain,
so that the two
lie side by
side…One of the
pair must be a
purine and the
other
a
pyrimidine for
bonding
to
occur. …Only
specific pairs of
bases can bond
together. These
pairs
are:
adenine (purine)
with thymine
(pyrimidine),
and guanine
(purine) with
cytosine
(pyrimidine).”
Here is some more information on DNA and the discovery of its structure.
http://www.nobelprize.org/educational/medicine/dna_double_helix/readmore.html
In short, DNA is a long double stranded molecule of four nucleotides bonded one after another. In prokaryotic
cells (bacteria), double stranded DNA forms a single circular chromosome. In eukaryotic cells (fungi, plants,
animals), long strands of double stranded DNA reside in the nuclei and form structures called chromosomes.
Genes are segments of DNA that provide the information necessary for the cell to synthesize a specific protein,
such as an enzyme or a structural protein. It is the sequence or order of the nucleotides that determines how
genes function.
Part II Virtual DNA Manipulation
Genetic engineering uses specialized tools and techniques to analyze DNA sequences, produce DNA clones and
create new gene combinations. Some tools of biotechnology are naturally occurring components of cells. For
example, bacteria make restriction enzymes to protect themselves from viruses because this type of enzyme cuts
“foreign” DNA at specific places. A particular restriction enzyme will always recognize the same sequence
BIO-100: Great Experiments in Biology,
Lab Manual
83
in any strand of DNA. Genetic engineers co-opt the action of restriction enzymes to cut DNA at specific points
called recognition sites. The enzyme will break or cut the bonds between base pairs holding the DNA together.
For example, EcoRI is a restriction enzyme that recognizes the following base sequence:
5’ G A A T T C 3’
3’ C T T A A G 5’
If EcoRI is mixed with a sample of DNA, it will cut the DNA at any point where the GAATTC sequence
appears! Anywhere! The restriction enzyme works by separating the hydrogen bonds holding the two strands of
double stranded DNA together at this specific sequence site and then it breaks the covalent bonds between
nucleotides. So, EcoRI would cut the DNA in the following way (covalent bond cuts are “/”):
5’ G / A A T T C 3’
3’ C T T A A / G 5’
When the enzyme cuts as shown, then the ends of the separated double stranded DNA would look like this. Note
that …. represents a continuation of the DNA beyond the location of this restriction site.
….G A A T T C….
….C T T A A G….
This is a challenging concept, so here is a video that might help you better understand restriction enzymes:
http://www.jove.com/science-education/5070/restriction-enzyme-digests
Figure 3. Screen shot from JOVE video
Every cell in the human body (except eggs and sperm) has 46 pieces of DNA called chromosomes, totaling six
billion nucleotide pairs. Some of this DNA encodes about 25,000 genes worth of information but the rest of the
DNA does not code for anything and is free to mutate. Over hundreds of thousands of years of evolution, the DNA
between genes and at the ends of chromosomes has extensively mutated. Thus, there are no two humans with the
same DNA sequences unless they are identical twins. If two DNA samples are different, they will have different
nucleotide sequences and respond to restriction enzymes in different ways. If the same enzyme is used on the two
different DNA samples, the number and the sizes of the resulting DNA fragments will vary, resulting in
restriction fragment length polymorphisms (RFLPs). The products of restriction enzyme digests can be run
on electrophoresis gels to determine the sizes of the DNA fragments.
Law enforcement agencies and legal professions use RFLPs and other genetic variations to perform DNA typing.
Applications include:
Screening for criminals
BIO-100: Great Experiments in Biology,
Lab Manual
84
Identifying victims of mass disasters
Identifying the presence of genes/alleles that predict disease
Part III DNA Manipulation Crime Scene Analysis
Murder at the Hair Salon!!!
Mrs Snip, the owner of Salon ‘Curl up and Dye’ was found dead this morning on the floor of her hair salon
apparently strangled!
The Crime scene and Evidence
Mrs Snip had 5 customers the day the crime was committed and she hadn’t yet cleaned up after the last one
before she was mudered. Her 5 customers were: Mr Axe, Miss Bugsy, Mrs Capone, Mr Dexter & Mrs Eye.
We have a hair sample from the crime scene and one from each of the suspects, from which DNA has been
extracted. You will incubate the DNA samples with a mixture of two restriction enzymes: EcoR1 and Pstl, to enable
the enzymes to cut the DNA in specific sites that are unique to each DNA sample. Next week you will then use gel
electrophoresis to separate the DNA samples by size and be able to identify which of the 5 suspects DNA sample
matches the one that was found at the crime scene and therefore was Mrs Snips’ murderer!!
Gel Electrophoresis
Gel electrophoresis is a technique used to separate DNA fragments by size. We will use gel electrophoresis to
compare the size of the DNA fragments from the crime scene and our 5 suspects.
http://www.jove.com/science-education/5057/dna-gel-electrophoresis
Figure 1. Screen shot from JOVE video
BIO-100: Great Experiments in Biology,
Lab Manual
85
Procedure
DNA Manipulation
Part I Manipulating DNA for Crime Scene Investigation
A crime has been committed and you have obtained DNA samples from the crime scene and 5 suspects. You will
use restriction enzymes and gel electrophoresis to identify which suspect the crime scene DNA belongs to. You
will work in groups for this part of the lab.
Setting up a DNA Restriction Enzyme Digest
Each group will obtain a microcentrifuge tube containing two restriction enzymes, EcoRI/PstI, labeled ENZ,
place on ice.
Each group will receive a set of microcentrifuge tubes containing suspect and crime scene DNA as follows:
CS (crime scene)
A (Mr Axe)
B (Miss Bugsy)
C (Mrs Capone)
D (Mr Dexter)
E (Mrs Eye)
Pipet 10 μl of enzyme mix (ENZ) into the very bottom of each tube. Use a fresh tip to transfer the ENZ
sample to each tube. Pipet up and down carefully to mix well.
Tightly cap the tubes and mix the components by gently flicking the tubes with your finger. If a
microcentrifuge is available, pulse- spin in the centrifuge to collect all the liquid in the bottom of the tube.
Otherwise, gently tap the tube on the table top.
Incubate the tubes for 45 min at 37°C .
Part II DNA Structure – 2D Model
Use two dimensional paper nucleotides to put together a model of double stranded DNA. See how nucleotides fit
together and form a sequence of base pairs. The term base pair is used to define one pair of complementary
nucleotides in the two complementary strands of DNA. The adenine nucleotide (A) pairs or binds to thymine (T)
nucleotide and guanine (G) binds with cytosine (C).
Your TA will give you an envelope containing 10 paper nucleotides. Create one strand that is 5 nucleotides long;
BIO-100: Great Experiments in Biology,
Lab Manual
86
the sequence does not matter! Use the remaining nucleotides to build a complementary strand of DNA.
Remember! the two strands of nucleotides run in opposite directions. Once complete, you will have a stretch of
DNA that is 5 base pairs long.
It is hard to imagine that four simple nucleotides can provide the information for all the functions of every type of
cell. However, if each student group writes the sequence of their five base pair DNA on the board, you will see
that each sequence will be different. This is because there are over 1000 sequences those 5 nucleotides could
produce. Entire genes are made up of many more base pairs than 5, with the average around 1000 base pairs
long. Each gene has a constant unique sequence that provides the cell with ability to make a specific protein.
Many of the protein products are enzymes that carry out the functions of the cell but others are involved in
regulation of those functions. In addition each gene is always found at the same position on a particular
chromosome in a cell.
Part III Manipulating DNA for Biotechnology
Next we will use restriction enzymes to compare two DNA sequences. RFLP patterns created from cuts with three
different restriction enzymes will be analyzed in two linear DNA sequences.
The first DNA sequence is is the 84 nucleotides long and the 5’ to 3’ strand sequence is given below (the first
nucleotide is 1, second is 2, etc. to 84). Imagine this is a sequence from the Crime Scene!
CGGGTCTCAAAGAATTCCAGAGCTCAATTGGATCCTCCCGGGACCACCCCCGTTCCAATATGAATTCGGCATCCAAGCT
TGCGG
The
second
is
also
an
84
nucleotide
DNA
sequence
from
Suspect
B.
AAGCTTCCATGTATTGCAGAGAAGCAGTACACGGAAAATTTACATTATAAGGAGGAATTCTTAAAGCTTGCCCCGGGAT
CCTGG
Use the website http://www.restrictionmapper.org/ to determine how the three restriction enzymes below
will cut the two samples of DNA.
Enzyme 1 is Ava II and the recognition site is 5’G/GACC3’
3’CCTG/G5’
Enzyme 2 is Hind III and the recognition site is 5’A/AGCTT3’
3’TTCGA/A5’
Enzyme 3 is BamH1 and the recognition site is 5’G/GATCC3’
3’CCTAG/G5’
2. Make sure the conformation is set to linear. Then select the restriction enzyme AvaII for enzyme 1, HindIII
for enzyme 2, or BamH1 for enzyme 3.
3. Use only one enzyme and one DNA sample sequence at a time! For example, use Ava II and copy and
paste the crime scene DNA into the sequence area of the site. Select virtual digest to get the results on the
next page.
Example site information for Crime Scene DNA and enzyme 1: AvaII
Length 5′ Enzyme
5′
Base
3′ Enzyme
3′
Base
Sequence
43
AvaII
42
none
84
42:GACCACCCCCGTTCCAATAT
GAATTCGGCATCCAAGCTTGCGG:84
41
none
1
AvaII
41
1:CGGGTCTCAAAGAATTCCAG
AGCTCAATTGGATCCTCCCGG:41
BIO-100: Great Experiments in Biology,
Lab Manual
87
The first column on the left gives the base pair size of the pieces generated from any restriction enzyme cuts. The
third column gives the first position of the fragment and the 5th column give the last position of the fragment. Use
this information to fill in Table 1 in the worksheet. Then repeat with the other two enzymes. Do this again with the
three enzymes and the Suspect B sequence and fill in Table 2.
Restriction Enzymes
The restrictionmapper program was used to compare enzymes #1, #2, and #3 recognition site sequences to the
entire sequences from two DNA sequences. This program determines where each enzyme would cut the two
samples of DNA. Fill in the information in Table 1 for the first piece of DNA and Table 2 for the second piece of
DNA. Remember some enzymes may not cut at all and some will cut more than once!
Table 1 Crime Scene DNA RFLPs
Restriction Enzyme (RE)
# of RE recognition
sites
# sequence 1 RFLPs
Sequence 1 RFLP sizes
(nts)
1: AvaII (example)
1
2
41, 43
2: HindIII
3: BamH1
Table 2 Suspect B DNA RFLPs
Restriction Enzyme (RE)
# of RE recognition
sites
# sequence 2 RFLPs
Sequence 2 RFLP sizes
(nts)
1: AvaII
2: HindIII
3: BamH1
Part IV Sizing Up DNA with Gel Electrophoresis
Gel electrophoresis is a technique used to compare samples of DNA. The gels are prepared from agarose, which
can be melted and cast like Jello®. The prepared gels have wells at one end where DNA samples are loaded. Then
an electric current is applied across the gel. DNA is negatively charged and will move towards a positive pole.
Pieces of DNA will separate in the gel based on their size. Smaller pieces move faster through the gel than larger
ones. If there are thousands of pieces of DNA that are all the same size then one can visualize a band of DNA in
the gel when it is stained.
Today we will analyze the results of a restriction digest using gel electrophoresis. The DNA digested was that of 5
suspects and one sample found at a crime scene. Thus, the samples are as follows:
A DNA standard with many known sizes of DNA pieces
Crime scene sample
Suspect A
Suspect B
Suspect C
Suspect D
Suspect E
Each student will have an opportunity to load a well in the gel. Then the electric current will be turned on and the
gel will run for about 30 – 45 minutes to separate the different size pieces of DNA into viewable bands. Your
BIO-100: Great Experiments in Biology,
Lab Manual
88
instructor will show you how to estimate the size of each DNA fragment based on how far each band has migrated
from the original wells.
Add 5ul loading dye to each of your 6 samples.
Practice loading a gel. Water with blue loading dye will be supplied. The loading dye has 0.02%
bromophenol blue in 60% sucrose to make the samples sink into the wells of the electrophoresis gels. The
dye allows one to visualize how fast the electric current is moving the samples in the real gel. The 25
microliter micropipets are used to load the samples. Be very careful when adding the sample to the gel with
the micropipet. If one goes too deep, a hole will be made in the gel. Go too shallow and the sample will
squirt out of the well. Your instructor will demonstrate.
Next make a map of the 8-well gel and indicate which lane the crime scene samples will be loaded into.
Load 10ul of standard DNA ladder and 20ul of each of your 6 samples into the gel. Your instructor will turn
on the electrical current and the gel will be run at 100 volts.
After about 35 minutes, the electrophoresis gel is removed and placed on a UV illuminator so the DNA
bands can be visualized. Observe and measure how far each DNA band migrated from the loading wells.
Remember each band is made up of thousands of pieces of the same size DNA. Record this information.
Wear safety goggles when viewing the gel on the transilluminator unless the illuminator has a cover.
Compare the band pattern from the crime scene sample to the suspects DNA bands. To determine the sizes
of the DNA from all the samples, one must compare the distance the sample DNA’s traveled to the control
ladder DNA. Each band of the control DNA signifies an increase of about 100bp of DNA. Thus, the bottom
band of the ladder is about 100bp and the top band is about 1000bp. Compare the distance each sample
traveled to the distance the ladder traveled to estimate the size of the DNAs in each sample. Record your
results in question 5 of the cashout assignment.
BIO-100: Great Experiments in Biology,
Lab Manual
89
Assignment - Cash Out
Assignment – Cash Out (10 points)
Draw your gel electrophoresis results on the “gel” below – The lanes are labeled for you. MW stands for
molecular weight, CS is crime scene, and the suspects are labeled A-E (6 points)
Who done it!? Using the bands on the gel above, conclude whose DNA matches identically that found at
the scene of the crime? Defend your answer by referring to specific lanes and band patterns in the gel. (4
points)
BIO-100: Great Experiments in Biology,
Lab Manual
90
Exercise IX: Personal Genetics
All living things resemble their parents, but each individual has a combination of traits which make it unique.
Genes and the environment determine how traits are expressed in an organism. Genes are passed from the
parents of one generation to the progeny of the next. The passing of genetic information from parent to offspring
is called heredity, and genetics is the scientific study of how genes are inherited. Today you will learn more
about how your traits are inherited.
Assignment: Writing Assignment on an Inherited Disease
BIO-100: Great Experiments in Biology,
Lab Manual
91
Introduction
Personal Genetics
Learning Objectives
In this class you will learn
The difference between a gene, an allele, phenotype and genotype
How to draw a punnet square and how to use it to predict probability of inheriting a trait
How dominant and recessive alleles are passed on and expressed by a person
How to read a pedigree and use it to formulate ideas as to a pattern of inheritance
The Czechoslovakian monk Gregor Mendel, known as “The Father of Genetics”, is credited with discovering the
basic laws of inheritance. He was the first to correctly deduce, from breeding experiments, how genes (units of
genetic information that make up chromosomal DNA) are transferred from one generation to the next in the
gametes (eggs and sperm). We know that every individual has two copies of every gene because there are two
sets of chromosomes – one from each parent when the egg and sperm fuse. In addition, genes for a particular trait
can come in different forms called alleles. For example, the albino allele of corn is a recessive form a gene that is
responsible for the formation of the pigment chlorophyll. Plants that have no chlorophyll will be very pale yellow
or white. Thus, green and white plants provide a simple means of identifying alleles in a population.
However, there are additional complications because we know each organism has two alleles for each gene. If the
two alleles are the same then this individual is said to be homozygous. If the two copies are different, the
offspring is heterozygous. An allele that is recessive, like the albino corn plant allele, will not be expressed in
the heterozygote because the green allele is dominant. The phenotype (how the gene alleles affects the
organism) of the plant will be green. The genotype is the actual gene alleles present in the organism regardless of
how they are expressed. It is important to note, that just because a trait is recessive it is not necessarily rare or
disadvantageous. An example is the human blood-types. Type O is recessive, however, in the United States, having
type O is common and does not negatively impact one’s health.
A breeding experiment that tracks how a single gene is inherited is called a monohybrid cross. Mendel
performed such crosses to define patterns of inheritance and to devise statistical analyses for genetics problems.
Using elementary rules of probability he interpreted the outcomes of his genetic crosses. First you will study
these rules and then see how they can be applied to a genetic cross.
A video showing an overview of genetics and disease:
http://www.jove.com/science-education/5543/an-overview-of-genetics-and-disease
Rules of Probability
The probability of a specific outcome is 1 divided by the total number of outcomes possible.
A coin has two sides, and therefore one spin can have two outcomes ‑ heads or tails. The probability
of either is 1 divided by 2, or 1/2. There are 52 cards in a deck so the probability of picking any one
card 1/52. We assume that these processes are all honest ‑ that they are truly random.
The second law of probability explains the chances of two independent random events occurring
within a given time frame. If we want to know the probability of getting two heads after two coins
BIO-100: Great Experiments in Biology,
Lab Manual
92
are thrown, then we ask “what is the probability of the first coin showing heads AND the second coin
also showing heads”. When there are two events with specific outcomes connected by the word
AND, then the total probability is the product of the individual probabilities. In the case of
the coins, the probability of heads is 1/2 for each coin. Therefore the total probability for two heads
is: 1/2 X 1/2 = 1/4If two coins are thrown an infinite number of times, 25% of the trials will result in
two heads.
Another law concerning two independent events considers the probability of alternative
outcomes. For example, if you are playing the card game, blackjack, you might want to know the
probability of winning by picking another card. In order to win, the additive total of the cards drawn
has to be 21 or under (the closer to 21 without going over, the better). So if you pick an 8 and then a
10…. you can stay at or under 21 only if your third card is either an ace (equals 1), 2, or 3. Since
there are four sets or suits of cards in a deck of 52 cards, you would have four possibilities out of 52
(minus two cards previously picked) for picking an ace, four for picking a 2, and four for picking a 3.
This would provide 12 possibilities for winning and each has a 1/(52-2 = 50) chance of coming up in
a deck of cards. So the total probability of picking one of these “winning” cards would be the sum of
the 12 possibilities, which would equal 12/50. Note: face cards equal 10 in this game.
The easiest way to learn about inheritance and probability is to start with a monohybrid cross between two
parents, one parent is homozygous recessive and the other homozygous dominant for a particular gene. That is,
one parent has two recessive alleles and one parent has two dominant alleles. A punnett square is a
diagrammatic tool that can be used to predict the outcome of a genetic cross. It is based on the laws of
probability. The punnett square is simply a box with four smaller boxes. Mendel’s Law of segregation tells us
that each gamete may only contain a single allele for each gene because there is only one set of chromosomes per
gamete. The possible alleles from the mother are placed above each of the two boxes of the punnett square as
shown below. The two possible alleles from the father are placed along the left side of two boxes. The probability
of receiving any of these alleles is placed next to each. The squares in between represent the four possible
progeny outcomes. The probability of each offspring outcome is the product of each parent allele’s probability.
A Punnett Square
♀ Parent Allele 1
♀ Parent Allele 2
♂ Parent Allele 1
♂ Parent Allele 2
The resulting offspring are placed in the respective boxes so that the genotypes and phenotypes can be
determined.
If we go back to the corn plant example, we can make a cross between a purebred green plant and purebred
albino (purebred means the plants have been selectively cultivated over many generations so we know they are
homozygous). This first cross is called a parental cross. In this case, the dominant allele is represented by an
uppercase letter (G for green) and the recessive is the lowercase letter (g for albino). The corn plants in front of
you the offspring of a Gg x Gg cross. 20 F2 corn seeds were planted in each of the flats on the lab tables – count
the green and albino plants.
How many green and how many albino corn plants do we expect to see based on the punnett square above?
___ albino ___green.
How many did you actually count? _____albino _____ green.
BIO-100: Great Experiments in Biology,
Lab Manual
93
Procedure
Part I. Human Genetics Problems
There are 46 chromosomes in each human cell (exception: the gametes which have half – 23) and the
chromosomes have about 24,000 different genes. All these genes are very complex and they work in many
different ways. Some of the genes affect the regulation of other genes, some genes are never used by a cell, and
many must function with other genes to produce a certain trait. However, there are known examples of human
genes with simple dominant and recessive alleles that can be examined as monohybrid crosses.
You will work in groups to analyze the following problems in lab using the punnett square.
1. Cystic Fibrosis (CF) is a gene allele which severely affects the function of the lungs. This allele is inherited as
a recessive trait. Individuals who are heterozygous do not have any symptoms. Individuals who carry two copies of
this allele and are homozygous recessive suffer. The lungs contain a thick mucus, which makes them more
susceptible to disease. Individuals with Cystic Fibrosis have shortened life spans.
Sara T. is getting married and wants to check to see if she is carrying the CF gene allele because she is concerned
about passing this gene allele to her children. Her parents were both normal but her uncle on her father’s side
died of CF when he was young. Both of her paternal grandparents were also normal.
What genotypes do Sara’s grandparents have to have? Explain why?
Do a punnett square with Sara’s grandparents gene alleles to illustrate Sara’s uncle genotype and Sara’s
father genotype.
Do you know for sure what Sara’s father’s genotype is?
If Sara’s mother does not have any family history of CF, should Sara bother to see if she has the CF gene
allele? Explain.
2. The condition of sickle cell anemia is recessive and only the homozygous recessive individuals are adversely
affected. Interestingly, heterozygous individuals have increased resistance to malaria. Malaria is caused by a
parasite which infects red blood cells. It seems that the heterozygote’s red blood cells are minimally affected but
are altered enough so that the plasmodium parasite cannot infect the cells. This is one reason why this allele
persists in the population – in the heterozygous state it gives an individual some advantage for survival.
A woman who has the sickle cell condition and man who does not, have a child. They are also worried about
malaria because they are moving to a part of Africa that has this disease. Who in this family should be worried and
who should not? Make a punnett square to demonstrate the child’s vulnerability. A=normal a=sickle cell anemia
allele
3. All newborn babies are tested to see if they have a defective enzyme which cannot break down the amino acid
phenylalanine. If phenylalanine accumulates in the blood then high levels can cause mental retardation. The
condition is called phenylketonuria or PKU. PKU is a recessive allele and only homozygous recessive individuals
are affected.
A family living in a country where PKU testing is not done wanted to know if they should have their baby in the
US. The pregnant mother has a parent who has the PKU condition and the father also has one parent with the
condition. Neither the pregnant mother nor the father has the condition. Draw a punnett square demonstrating
the likelihood that this new baby will inherit PKU and discuss why or why not the parents should have the baby in
the US. K=normal k=PKU allele
BIO-100: Great Experiments in Biology,
Lab Manual
94
4. Huntington’s disorder is a dominant allele. Individuals with one copy of this allele will suffer from progressive
degeneration of the nervous system and premature death. The phenotype or symptoms do not appear until the
affected individual reaches forty years of age. This is after child-bearing age, so people have children before they
know they are carrying the affected gene allele.
A man is very worried about passing the dominant Huntington’s gene allele to his children. If his father has
Huntington’s but his mother has a normal phenotype, and his wife has no history of Huntington’s, does the son
need to be tested for Huntington’s before he has children? Note: homozygous dominant is lethal and a fetus will
not survive. Draw a punnett square representing the man’s father and mother, to determine if the man has a
chance of carrying the Huntington’s gene allele.
What is the probability that the man has Huntingtons? Should he be tested?
If he is positive for the Huntington’s allele, what are the chances he will pass it on to any of his children? Do
a second punnett square to illustrate this cross.
Part II Human Pedigrees
We obviously cannot do genetic experiments with humans and yet all of us are interested in learning how we
inherit traits. Scientists have devised a diagrammatic way to determine how particular traits are inherited over
multiple generations called pedigrees. Today you will learn how to use these diagrams. You will analyze some
authentic human family pedigrees to determine how particular traits are inherited from one generation to the
next. Some of the basic symbols from the list below will be used in your pedigrees. The class will analyze one
pedigree together. Then each group of four students will analyze a pedigree and explain how the affected trait is
inherited to the rest of the class.
Figure 1. An example of a Pedigree
Part III Population Genetics
Sometimes it is easier to study how a gene is inherited by looking at how it is expressed in a large number of
individuals. Population genetics is the study of allele frequencies in a population. It is important to learn about
genetics in terms of populations because we learn how alleles, genotypes, and phenotypes change over time.
Today you examine a few different alleles in the population of humans that are sitting around you. From the
genetics problems you know that some human traits are controlled by a single gene with only two alleles,
dominant and recessive. Dominant and recessive only reflects how the alleles are expressed and not whether one
is stronger or weaker. Plus in most cases, an observed trait results from multiple genes with multiple possible
alleles. In addition, environmental influences affect how traits are expressed. Defining the alleles in a population
BIO-100: Great Experiments in Biology,
Lab Manual
95
not only helps us understand how they are inherited but also defines the extent of variation in alleles for the same
gene. The frequency and variation of gene alleles is the basis for natural selection, which is how species evolve
over many, many generations.
Look at the traits in Table 1 and determine if you have a dominant or recessive phenotype. Then calculate the
frequencies of these traits for the class in Table 2.
Table 1 Individual Traits
Trait
Dominant Form
Recessive Form
hands clasped
left thumb over right
right thumb over left
hair texture
curly
straight
forehead hair
widows peak
straight hairline
chin dimple
present
absent
ear lobes
free
attached
tongue
can roll
cannot roll
ptc taste
taste
no taste
thiourea
taste
no taste
sodium benzoate
taste
no taste
My phenotype
Table 2 Class Data Table
Trait
# students
dominant form
% students
dominant form
# students
recessive form
% students
recessive form
hands clasped
hair texture
forehead hair
chin dimple
ear lobes
tongue
ptc taste
thiourea
sodium benzoate
BIO-100: Great Experiments in Biology,
Lab Manual
96
Think about why some traits have more of the dominant alleles and some have more of the recessive alleles in
your class population. Do you think these patterns would be the same if you analyzed all AU students?
BIO-100: Great Experiments in Biology,
Lab Manual
97
Assignment - Writing Assignment
Assignment – Writing Assignment (30)
Many human genetic disorders result from defective alleles in the population. Some examples were
presented in the genetic problems done in class. Choose an inherited human genetic disorder you have
learned about in lecture, in the media or that is associated with your family. Write a short description about
the disorder and make a punnett square OR a pedigree to demonstrate how the disorder is inherited.
Please include the following:
Pedigree and/or punnett square and description of inheritance pattern (12 pts)
Date when the disorder was first identified and a description of the symptoms (5 pts)
Describe what is known about the (mutant) gene and how it affects humans (5 pts)
Don’t forget to include 3 references! (3 pts)
(This assignment should be no more than 3 pages with figures.)
Some Examples of Inherited Genetic Diseases
Cystic fibrosis
Prader–Willi syndrome
Sickle-cell disease
Tay-Sachs disease
Hemophilia
Phenylketonuria
Huntingtons
Albinism
Canavan disease
Achondroplasia
G6PD deficiency
Krabbe disease
Marfan syndrome
Muscular dystrophy
Neurofibromatosis
Retinoblastoma
Wilsons disease
BIO-100: Great Experiments in Biology,
Lab Manual
98
Exercise X: Simulating Natural Selection
To understand how the process of natural selection relates to evolution two things must be understood. First,
genetic variants exist naturally in populations and are not created by selection. Second, selective pressure
increases the proportion of individuals with traits that improve their ability to survive and reproduce. The
concepts we reviewed in the “Personal Genetics” lab – allele, genotype, and phenotype will be used here to study
how organisms genetically change as a result of selection.
Assignment: Cash Out Assignment
BIO-100: Great Experiments in Biology,
Lab Manual
99
Introduction
Simulating Natural Selection
Learning Objectives
In this lab you will learn
To define terms such as variability, capacity for survival, selective pressure and genetic fitness
How to use the Hardy Weinberg equation to calculate frequencies of an allele in a population
How traits can become more or less prevalent in a population over generations through natural
selection
How to graph allelic and phenotypic frequency
The interactions between organisms and their physical environments are the driving force for evolution via the
process of natural selection. The conditions that have to be met for natural selection to occur are:
Variability – Charles Darwin noted that all species vary, that is, each member of a species varies from all
other members of the same species.
Differential capacity for survival and reproduction – Darwin also observed that the environment and
the conditions under which a species lives favor some individuals over others.
Heritability – the favored individuals have higher fitness. If the traits leading to the higher fitness are
heritable, they will appear more in succeeding generations. This is because individuals with increased
fitness will more likely reproduce and have more progeny.
Examples of variation, differential reproduction and
heredity are shown.
Today you will do an experiment to see how natural selection acts on individual traits in populations. Selection can
be slightly more complicated than simply having the best traits for survival. For example, certain traits can have a
greater selective advantage for individuals in one environment, but may be disadvantageous in another. There are
traits that are neither helpful nor unhealthy and thus, are considered neutral. Neutral traits can remain in the
population if they are not selected for or against. Sometimes even the frequency of neutral traits can change in a
process called gene flow. For example, a founding population is a group that separates from the main
population. If a small number of individuals reach an island and reproduce with others of their species they can be
introducing new traits. A bottleneck effect can also affect frequencies and this occurs when a significant part of
a population disappears. For example, an epidemic could wipe out part of a community. In addition to gene flow,
BIO-100: Great Experiments in Biology,
Lab Manual
100
sometimes the frequency of a trait in a population can change due to random events and this is called genetic
drift. Finally, a new gene trait can appear from a genetic mutation. These are all considered evolutionary
processes in addition to natural selection because they affect the frequencies of traits in a population.
The process of natural selection will be examined using a simulation (so we can control for outside variables) with
colored beads to study how a single gene with two alleles is selected in a population. Studying how single alleles
and traits change in a population over time is often referred to as microevolution. Changing traits in populations
are analyzed in terms of allele frequencies, phenotype frequencies, and genotype frequencies.
Simulating Natural Selection
Godfrey Hardy and Wilhelm Weinberg were two of the first scientists to actually measure how gene allele
frequencies change in populations so they could better understand natural selection and genetic drift. They
extended Mendel’s work on inheritance and Darwin’s ideas about natural selection to develop the field of
population genetics. To measure evolution they came up with a formula for the absence of evolution. This is
called Hardy-Weinberg Equilibrium, and it basically states that the frequencies of alleles in a population will
remain the same over generations unless the forces of selection or genetic drift act to change those frequencies.
The criteria for Hardy-Weinberg are:
No mutations
No immigration or emigrations of individuals
No genetic drift
No sexual selection (all genotypes have equal reproductive success)
No natural selection
The Hardy Weinberg formula provides a means for calculating the frequencies of each allele and thus each
genotype in a single gene system. and is simply p2 + 2pq + q2 = 1. Also, if ‘p’ is the frequency of one allele and ‘q’
is the frequency of the other allele, then both frequencies add up to 1 (p + q = 1). So if a gene has alleles (B) and
(b) there are three possible genotypes: BB, Bb, and bb. In the equation, the (B) allele is represented by (p) and the
(b) allele is represented by (q). Thus, the probability of receiving (B) from both parents is p x p or p2, the
probability of having (b) from both parents is q x q or q2, and the probability of receiving one (B) plus one (b) is
2pq. Allele frequencies will remain the same over time if the population is not evolving. If the frequencies are
found to change over many generations, then one can presume evolution is taking place.
Today you will study the processes of natural selection with a hypothetical gene with co-dominant alleles in a
predatory-prey simulation. There will be three different (colored beads) phenotypes representing the three
genotypes, BB, Bb, and bb, so the frequencies of the two alleles can be determined as well as the phenotype and
genotype frequencies. A black bead will represent the homozygous B genotype, i.e. BB, gray will be heterozygous
i.e. Bb, and the white will be homozygous b genotype. Students are the predators and will pick colored beads
(prey) on different colored backgrounds. The changes in allele and genotype frequencies over 5 generations will
be graphed so that the changes over time are seen. Selection will be driven by the affect of the colored
background on the surviving (prey) bead colors.
To learn more about the patterns of inheritance read the corresponding chapters in the Concepts of Biology Text:
Concepts of Biology – Patterns of Inheritance and here: Concepts of Biology – How Populations Change
BIO-100: Great Experiments in Biology,
Lab Manual
101
Procedure
Part I Simulating Natural Selection
Work in pairs and each pair will select one color of background mat. Make sure to record the color on each of your
data sheets (data sheets will be handed out). Carefully count out 25 black beads + 50 gray beads + 25 white
beads. Use forceps as your talons and consider yourself the predator. The beads represent prey, that is the
individuals in the population. The bead color is determined by a single gene with two alternative alleles, B for
dominant and b for recessive. Each individual has two alleles and the possible individuals represented by colored
beads are as follows:
Genotype Phenotype
BBblack
Bbgray
bbwhite
The total number of alleles in the gene pool = #B alleles + #b alleles = 100 + 100= 200. Notice that this sum
must equal 2x # individuals, since each individual is contributing 2 gametes (alleles) to the gene pool. The letters
p and q are conventionally used to represent the frequency of alleles.The frequency of B (p) = # of B alleles in
the gene pool/ Total # of alleles =100/200 = 0.5
The frequency of b (q) = # of b alleles in the gene pool/ Total # of alleles =100/200 = 0.5
Note that since B and b are the only alleles possible in this example, p + q =1.
Plot these initial allelic frequencies of B and b as Generation 0 on the graph provided in lab.
We can use the p and q frequencies of the alleles in this starting generation to confirm the genotype frequencies.
One way to do that is to complete the Punnett square as shown below:
p = 0.5
q = 0.5
p = 0.5
p2 = 0.25
pq = 0.25
q = 0.5
pq = 0.25
q2 = 0.25
Once again we encounter conventional symbols:
p2 = the frequency of the genotype BB is 0.25.
2pq = the frequency of the genotype Bb is 0.5
q2 = the frequency of the genotype bb is 0.25.
Since these are the only genotypes possible, then p2 + 2pq + q2 =1
Plot these initial genotype frequencies as Generation 0 in a second graph format provided.
BIO-100: Great Experiments in Biology,
Lab Manual
102
These individuals (25 black, 50 gray and 25 white) will now be subject to predation, and you are ready to examine
the effects of natural selection on the relative frequencies of alleles and genotypes in this population.
The Effects of Predation
Follow the instructions listed below for each experimental run.
Mix the black, gray, and white beads in the beaker.
Designate one member of your team to be the predator. This individual will pick up the forceps (which will
serve as “talons”) and then turn his or her back on the remaining preparations.
The remaining team member will be the recorder. Scatter the beads smoothly over the artificial
background.
On a signal from your instructor (who will cut the lights to ensure more realism in the experimental
conditions), the designated predator will turn around, and using the forceps only, remove beads as rapidly
as possible from the painted bubble wrap, dropping them into the beaker, until the signal to STOP is heard
30 seconds later. (Remember, while you are acting as predator try to put yourself in that animal’s place.
Relying only on your sense of sight, you are frantic to seize as many “prey” animals as possible in the time
allotted to feed yourself and your offspring, despite distractions and without yourself becoming someone
else’s meal. The terms “phenotype” and “genotype” have no meaning to you, and you get no points for
digging out a hard-to-spot victim if in the same amount of time you could have seized three others.)
Use the data sheets and follow the instructions for making the calculations described in steps six through
nine below:
Count the number of survivors of each color. Enter these numbers as directed on the data sheet.
Calculate the new values of p and q based on the number of survivors of each color.
The reward for surviving is participation in reproduction to produce the next generation. Set up a
Punnett square and using the new values for p and q, calculate the genotypic frequencies (p2, 2pq
and q2) for the next generation. (Remember, we have assumed random mating and no sexual
selection.)
There are three further simplifying assumptions:
For consistency calculate all frequencies to two decimal places.
Assume that all adults die immediately after mating, so there is no need to account for them in the next
generation.
The carrying capacity of the environment (i.e., the bubble wrap) is 100, and the number of individuals at the
start of each generation is always 100. Therefore, to determine the number of individuals of each genotype
that will present, simply multiply each genotype frequency by 100.
To get ready for the next round of predation, adjust the number of black, gray and white beads to match the
calculations you made in #9c above. Designate one member of your team to pick up the beads necessary for the
next generation. For example if your calculations show that p2 =0.27, 2pq = 0.50 and q2= 0.23, your group will
need to return 2 white beads of the original 25 and pick up 2 new black beads, so you will start the next round
with 27 black, 50 gray and 23 white beads.)
Repeat for 5 total generations. There should be time to run five generations during your lab period.
Graphing your results
Using a graphing program plot the allelic frequency values of p and q on the (Y-axis) against generation number
on the (X-axis). Since p + q = 1 and B and b are the only alleles you have, as the frequency of one allele increases,
the frequency of the other must decrease.
Compose a second graph showing the changes that have occurred in the frequencies of the three genotypes
BB, Bb and bb (i.e. p2 , 2pq, and q2) against the number of generations.
BIO-100: Great Experiments in Biology,
Lab Manual
103
Assignment - Cash Out
Assignment – Cash Out (10 points)
Plot for the frequencies of alleles over 5 generations (2.5 points)
Plot for the frequencies of genotypes over 5 generations (2.5 points)
There are 5 factors that cause microevolution: selection, genetic drift, mutation, migration (gene
flow) and non-random mating. Which one of these factors was the cause of the microevolution in our
lab today? Describe why you chose your answer (2.5 points)
In either a black or white background, if you continued the same predation simulation for 100
generations, do you think that the frequency of the B or b allele (p or q) would go to 0 or 1? Would
one of the alleles ever be eliminated from the gene pool? Why or why not? Cite evidence from your
experiment and the experiments of your classmate. (2.5 points)
BIO-100: Great Experiments in Biology,
Lab Manual
104
Exercise XI: Neuroscience: Organ Structure and Function
The purpose of this lab is to observe the complexity of the nervous system and to learn how scientists are
beginning to understand the processes involved. The nervous system is the body’s network of communication. It
provides the means by which an organism interfaces with the world outside as well as all the cells and organs
inside. Related functions involving learning, reasoning, imagining, and expressing emotions make it by far the
most complex organ system. Today you will learn about some of the anatomy of the human and various animal
brains and learn about techniques to image the human brain.
Assignment: Case Study Presentation – Each group of three students will be assigned a human condition that
they will explain to “medical students” (your class) during the beginning of next week’s lab. This assignment will
be based on what you learn today and some outside research.
BIO-100: Great Experiments in Biology,
Lab Manual
105
Introduction
Neuroscience: Cells, Organ Structure and Function
Learning Objectives
In this lab you will learn
To identify structure and function of the sheep brain
To compare and contrast brain structure between mammalian (human, sheep, rat), avian and reptile
brains
To understand some common clinical tests used in the analysis of brain function
Neuroscience is the study of the cells and organs of the nervous systems. The human nervous system consists of
the central and peripheral nervous systems. The central nervous system includes the brain and spinal cord,
and the cells that connect our arms and legs to the central nervous system are innervated by the peripheral
nervous system. There are also nerve cells that help our organs functioning without our conscious help. This is
known as the autonomic nervous system and is considered part of the peripheral nervous system. For example,
our gastrointestinal system is innervated with a unique set of cells with very distinctive characteristics. See Figure
1.
The brain is the most important organ in the human body and in the bodies of most animals. All other functions,
from the heartbeat, to metabolism, to sleeping are all controlled by the brain. Thus, it is critical that the brain be
given the proper stimulation in the form of nutrition, early childhood learning etc. for optimal development.
Furthermore, the brain must also be protected from physical damage and infection. Much research in scientific
labs, medical facilities, educational institutions and even public policy think-tanks are dedicated to understanding
this vital organ.
Figure 1. The Nervous System
BIO-100: Great Experiments in Biology,
Lab Manual
106
Procedure
Part I: The Sheep Brain
Each group of four students will observe a whole sheep brain. First, examine the exterior of the brain. The brain
can be divided into three parts. 1. Cerebrum, 2. Cerebellum and 3. brain stem and spinal cord. The cerebrum
makes up a large mass of the total brain. Observe the grooves and folds in the cerebrum, which are called gyri
and sulci. This exists in humans and some other animals and serves to increase surface area of the brain, but
manage the size so it can still fit into a skull. Rats for example, do not have gyri and sulci. Consider why this might
be important.
Figure 1. Dorsal view of the sheep brain
Notice that the brain is very symmetrical and consists of two halves called the cerebral hemispheres (left and
right). The hemispheres are separated into left and right by a large groove called the longitudinal fissure. These
hemispheres are linked by the corpus callosum, which you will view later in a sagittal (half cut) of the brain.
Next, observe the cerebellum coordinates many signals coming from the brain and the spinal cord. It influences
cognitive functions such as attention and language, and contributes to our motor abilities in terms of fine
movement, balance, and equilibrium.
Now turn the brain over. Find the long white cords (nerves) that cross at the optic chiasm and are the optic
nerves. Which of the areas of the sheep brain in Figure 3 have to do with the sense of smell? Find out what
functions the other three areas control (pons, pituitary gland, and medulla).
BIO-100: Great Experiments in Biology,
Lab Manual
107
Figure 2. Ventral view of the sheep brain
Brains also can be cut sagitally ( in half between the hemispheres) so you can see the internal parts without
actually dissecting. The brain has been cut in half between the two cerebral hemispheres. Find the corpus
collosum. It consists of myelinated nerve tracts that foster communication between the two cerebral hemispheres.
This function can be observed with a simple test called the Stroop Effect, an experiment we will be doing in Part
III.
Figure 3. Sagittal view of sheep brain.
Table 1. Important Features of the Sheep Brain
Whole Brain – Dorsal
View
Whole Brain – Ventral View
BIO-100: Great Experiments in Biology,
Lab Manual
Half Brain
108
Cerebellum
• movement
• balance
• posture
Brain stem/medulla
oblongata
• breathing
• heart rate
• blood pressure
Gyri/sulci
• Increases surface area
• Present in some mammals
Olfactory bulb
• Smell
• Connects to hippocampus
(learning and memory center)
Pituitary gland
• Endocrine system
• Produces hormones
Optic chiasm
• Vision
• Optic nerves
• X shaped
Parietal lobe
• Cognition
• Information processing
• Visual perception
Hypothalamus
• Sleep
• Food intake
• Endocrine control
Corpus callosum
• Large white matter tract
• Connects left and right hemispheres
Also view from this cut:
• Olfactory bulb
• Cerebellum
• Spinal cord
• Pituitary
• Hypothalamus
• Optic chiasmWrite down 5 physical
characteristics of the sheep brain (for
example: how the brain feels, color(s) of the
brain).
Part II: Comparative Anatomy
Comparative neuroanatomy is the study of comparing and contrasting the brains of many different species.
Many important questions can be asked: 1. What changes occurred in neural organization and function? 2. When
did these changes occur? 3. How and why did they occur? The development of gyrification is an example. Today,
we will be observing the brains from different animals and noting similarities and differences.
Exercise
Please observe the different brains and determine what animal the brain comes from, and
complete the table below
Brain: What animal did this brain come from?
Length: What is the length of each brain (in cm.) from dorsal to ventral?
Gyrifaction: Rate the degree of gyrification of the brain on a scale of 1-5, with 1 being very smooth and 5
being very wrinkly
Posterior/Dorsal: Are the cerebellum and spinal cord posterior to the cerebrum or dorsal to the
cerebrum?
Notable structures: What structure(s) are most noticeable to you in each brain? For example, what
structures take up the most volume?
BIO-100: Great Experiments in Biology,
Lab Manual
109
For each brain, choose the animal that you think it came from and provide justification.Options are: rat,
avian, zebra finch (bird #2), fish, sheep, snake, and human
Table 2. Comparative brain anatomy results
Brain
Length (cm)
Gyrification
Posterior/
Dorsal
Noteable structures
A
B
C
D
E
F
G
Part III: The Stroop Effect
Observe spelled out colors that are colored differently (i.e. RED is colored green). Color identification is controlled
on one side of brain and word recognition on the other. This interference makes it difficult to say the word out
loud, and increases time spent announcing the list.
Figure 4. The Stroop Effect Test
Exercise
You and a partner will time how long it takes to complete the reading of about ten colored words that
are incorrectly colored as compared to ten words colored with the color that is spelled.
Follow this link to try out the Stroop Effect https://faculty.washington.edu/chudler/java/ready.html
Record your results in Table 3. Is there an effect?
Table 3. Stroop test results
Time with correctly colored words
BIO-100: Great Experiments in Biology,
Lab Manual
Time with incorrectly colored words
110
Part IV: How Brain Activity is Analyzed
One of the most exciting advances in neuroscience is the use of different types of imaging to view brain activity.
There is a variety but here are some of the basic types of scanning techniques:
Positron emission tomography (PET) uses short lived radioactivity to produce a three-dimensional image or
picture of functional processes in the brain. A tracer molecule is introduced into the body and homes into specific
sites in the brain. When the material undergoes radioactive decay a positron is emitted, which can be picked up by
the detector. Areas of high radioactivity (red) are associated with brain activity vs low radioactivity (green). Go to
https://www.mcgill.ca/bic/core-facilities/pet-cyclotron.
Figure 5. PET Scan
Functional magnetic resonance imaging, or fMRI, works by detecting the changes in blood oxygenation in
response to neural activity (red areas). If an area of the brain is active, it will be using more oxygen and this type
of scan can identify those areas and thus a specific activity. Go to https://www.mcgill.ca/bic/core-facilities/mri.
Figure 6. fMRI
Computed tomography (CT) scanning builds a picture based on the fact that different areas of the brain will
absorb X-rays to different degrees. Bone and hard tissue absorb x-rays well, air and water absorb very little and
soft tissue is somewhere in between. Thus, CT scans reveal the gross features of the brain but do not resolve its
structure well. Go to http://www.radiologyinfo.org/en/info.cfm?pg=headct
Figure 7. CAT scan
Electroencephalography (EEG) is the measurement of the electrical activity of the brain observed by recording
from electrodes placed on the scalp. The resulting traces are known as an electroencephalogram (EEG) and
represent an electrical signal from a large number of neurons. EEGs are frequently used in experimentation
because nothing has to be put inside the brain. Measuring the electrical activity provides excellent resolution of
brain activity. Go to http://www.nlm.nih.gov/medlineplus/ency/article/003931.htm
BIO-100: Great Experiments in Biology,
Lab Manual
111
Figure 8. EEG
Today, you will be using an EEG to analyze brain waves. We will be monitoring our visual cortex in response to
eyes open and closed in a normal lighted room. Watch the video below to learn about EEG and the brain waves!
Below are the types of brain waves you can identify with EEG.
Figure 9. EEG Brain Waves
Exercises
First, pick 1 volunteer and hook them up to the EEG. Have them open and close their eyes,
alternating every 10 seconds. Record the EEG traces using Figure 9. Record your results in Table 4
Next, design an experiment manipulating one variable and record your results on the table. Some
condition ideas are: reading, mediating, falling asleep,etc. Record your results in Table 5.
Table 4. EEG Results
Condition
Draw EEG signal
Identify wave from chart
Eyes open
Eyes closed
BIO-100: Great Experiments in Biology,
Lab Manual
112
Table 5. EEG results, design an experiment
Condition
Draw EEG signal
BIO-100: Great Experiments in Biology,
Lab Manual
Identify wave from chart
113
Assignment - Case Study Presentation
Assignment – Case Study Presentation (25 points)
Assignment: Case Study Presentation
You are a doctor and will work with two colleagues (classmates) to diagnose a patient with a set of
symptoms/conditions. The description of the patient and symptoms are provided below. There are 8
possible scenarios that could cause your patient’s symptoms. The possibilities include Epilepsy,
Parkinson’s, Alzheimers, Tourette’s, narcolepsy, methamphetamine addiction, alcohol addiction and rabies.
Patient 1 is a 20-year-old woman who was bitten on the hand by a puppy. Since the injury was a minor
one, she ignored the incident and did not receive any treatment. Nine days after the bite, she had fever,
headache, and malaise. Following this, she developed fluctuating consciousness, with irritability, episodes
of agitation and frequent seizures.
Patient 2 is a 70 year old man who retired from his job as a school teacher five years ago. He lives with his
wife in a small but comfortable home that they have owned for 30 years. In the past few months he could
not find his way home from trips to the grocery store and pharmacy. He had to call his wife. Last week he
ran a red light because he did not remember to stop. After this event, his wife brought him to the doctor’s
office.
Patient 3 is 25 years old and just lost his job. He was depressed even before he lost his job and in the past
few months has left his apartment less and less. His family lives nearby and is very worried about his
anxiety and depression. They do not like his friends and are also suspicious about missing money. Now he
is starting to have some hallucinations, his teeth feel loose, and his skin is looking tanned in spite of rarely
going outside.
Patient 4 is 62 years old. She began to notice a lack of small motor coordination when she was cooking. It
has become more difficult to do simple chores such as cutting up vegetables and now she is noticing a
tremor in her hands when she is still. Her right hand and arm often have a tingling sensation.
Patient 5 is nine years old. He is a very active little boy but in the past few months that activity has been
showing up in very strange ways. He often just makes repetitive weird sounds for no reason. His parents
were getting upset especially when he began making strange jerking behaviors. These behaviors are more
prevalent when he is excited. The pediatrician is calling these repetitive actions “tics” and has identified
them as uncontrollable.
Patient 6 is a 22 year old college student. He has always enjoyed parties with a lot of drinking. The
drinking increased to include the need for a morning pick me up. Eventually his grades suffered, he gained
weight, and started losing touch with his friends.
Patient 7 is an 18 year old freshmen college student. She has been feeling extremely tired. She can fall
asleep in a second and has a terrible time keeping awake in her classes. These symptoms are getting worse
to the point where every muscle in her body is tired and she is very depressed.
Patient 8 is a young woman, 32 years old. In the past three months she describes two episodes where she
felt her brain freeze for a moment or two. She had to stop what she was doing and “catch her breath”. It
was almost as if she lost her memory for a few minutes. Then last week she was making dinner in the
kitchen and the next thing she knew, she was laying on the floor of her kitchen. She doesn’t know what
happened or how she got there. Her doctor tells her she has had two conscious seizures and one
unconscious seizure.
BIO-100: Great Experiments in Biology,
Lab Manual
114
Presentation Guidelines
You and your partners will work together to prepare a 3-5 minute presentation. Each person is responsible
for one slide representing one part of the presentation. Thus, the powerpoint will consist of ONLY 4
SLIDES. Spend approximately 1 minute presenting each slide. Your audience is a medical school class
(your lab section).
Slide 1: Describe the condition whether it is the result of an abused drug or disease.
If a drug is involved, find out what it is commonly used for and the main ingredient(s). If it is a
disease then find out the cause of the disease. (10 pts)
Slide 2: Identify parts of the brain and/or cells targeted.
Briefly describe any cell receptors and neurotransmitters involved. (10 pts)
Slide 3: Use a brain scan to characterize the condition of the patient.
Give a basic overview of mechanism of the drug or disease action and tie in with known behaviors
associated with this drug or condition. Make sure your presentation includes a scan and be able to
describe what type of scan as well as what this scan shows. (10 pts)
Slide 4: References used in the proper bibliographic format (3 pts)
Additional Criterion: Students worked well together and did their research. Presentation well organized
and clear (7 pts)
Check out the following websites for more information
http://www.brainfacts.org/
http://www.ninds.nih.gov/disorders/tourette/detail_tourette.htm
http://www.webmd.com/sleep-disorders/guide/narcolepsy
http://learn.genetics.utah.edu/content/addiction/
BIO-100: Great Experiments in Biology,
Lab Manual
115
Exercise XII: Neuroscience: Using Model Systems to Learn More
The purpose of this lab is to understand neural transmission in the brain, particularly what a neurotransmitter is.
Understanding synaptic transmission allows us to understand how chemicals and drugs interfere with neuron
communication and how it has negative consequences to health, like fetal alcohol syndrome. The use of animal
models helps neuroscientists study disorders and aids in our understanding in how to treat these neurological
disorders in humans.
Assignment: Cash out
BIO-100: Great Experiments in Biology,
Lab Manual
116
Introduction
Neuroscience: Using Model Systems to Learn More
Learning Objectives
In this lab you will learn
To properly handle and observe zebrafish
To quantify aspects of zebrafish behavior
To understand the function of a neurotransmitter
To observe the effect of drugs on zebrafish development
Neurotransmitters are small molecules and mediate how neurons communicate with each other. They are typically
released from the axonal end of one neuron when that neuron is stimulated and then move to the dendritic end of
the next neuron. It then binds to a receptor on the surface of the receiving neuron. This causes the second neuron
to transmit a signal down the length of the cell body and in turn release neurotransmitters at the other end. A
neurotoxin, like lead or botulinum toxin (Botox) prevents this process and can lead to serious disabilities, and
more often death. Watch the video below to see how neurotransmission works and how a neurotoxin works
There are two types of neurotransmitters: stimulatory and inhibitory. Excitatory neurotransmitters increase the
likelihood of more neurotransmitters firing by increasing the likelihood of an action potential. Inhibitory
neurotransmitters do the opposite; they inhibit neurotransmitter synthesis.
Table 1. Excitatory neurotransmitters
Neurotransmitter
Function
Examples
Dopamine
• Movement
• Memory
• Reward
• Sleep
• Attention
• Food, sex, and drugs cause the release dopamine in the
brain
• Parkinson’s disorder is caused by too little dopamine in the
brain
• Caffeine increases dopamine to improve attention
• ADHD medication also increases dopamine
• Can also be inhibitory
Epinephrine
(Adrenaline)
• Increases heart rate
• Increases blood pressure
• Activated during “Fight or Flight”
• Elevated with ADHD
Glutamate
• Memory
• Cognition
• Learning
• Regulates brain
development
• Seizures can be caused by too much glutamate being
produced
• May have a role in many other disorders including: Autism,
Multiple Sclerosis, Parkinson’s Disorder, and neuropathic
pain.
• It is the most abundant excitatory neurotransmitter…it
does a lot!!
Table 2. Inhibitory neurotransmitters
BIO-100: Great Experiments in Biology,
Lab Manual
117
Neurotransmitter
Function
Examples
Serotonin
• Mood
• Sexual desire
• Sleep
• Memory
• Learning
• Temperature regulation
• Some antidepressants increase serotonin levels (SSRI)
• Low levels linked to OCD and anxiety as well.
• Some studies have shown low serotonin levels occur during
early stages of love
GABA
• Motor control
• Vision
• Anxiety
• Some anti-seziure drugs increase GABA levels
• Drugs that increase GABA are also used to treat the
trembling that occurs during Huntington’s disorder.
Most insights into human disease and the role of neurotransmitters are a result of experiments that would be
unethical or unfeasible to perform on humans. Instead we can use animal models to look at the function of genes
or neurotransmitters involved to obtain information on healthy and diseased states.
Zebrafish are ideal animal models. Zebrafish embryos are clear and develop outside of the mother’s body,
allowing scientists to watch an embryo grow into a newly formed fish under a microscope. In the development
span of 2-4 days; at 36 hours, all major organs are formed; at 3 months, it is an adult. Today we will be observing
zebrafish treated with an excitatory or inhibitory neurotransmitter
Figure 1. Zebrafish development from fertilization to 3 months.
BIO-100: Great Experiments in Biology,
Lab Manual
118
Procedures
Today you will observe three groups of zebrafish: 1. Control zebrafish treated with no chemicals, 2. Zebrafish
treated with a stimulatory neurotransmitter, and 3. Zebrafish treated with an inhibitory neurotransmitter.
Exercises
Observe week old zebrafish. You will make comparisons between the neurotransmitter larvae and the
control larvae. After, you will guess which group received the inhibitory neurotransmitter treatment or the
excitatory treatment.
Note differences and fill out table 1.
Startle movement: Obtain a dish of the control zebrafish and one of the two neurotransmitter
treatment dishes. It is easy to see the zebrafish larvae swimming in the petri dishes. First observe
their general movement. Once you have two dishes, jiggle the control dish to startle the larvae and
observe the movements carefully. Then repeat this with the treatment dish and observe the larvae
movements.
Pigmentation: Place the dishes on a white piece of paper and determine if one group is darker than
the other. Melanocytes are the cells responsible for pigmentation and they can be affected by the
neurotransmitters
Length: Putting 1 fish in a depression slide, measure the total length
Heart beat: Because zebrafish are translucent, you can see their heart. Measure the heart rate for
20 at least seconds.
Note any other observations
Control
Group A
Group B
Startle Movement
Pigmentation
Length
Heartbeats/min
Additional observations
BIO-100: Great Experiments in Biology,
Lab Manual
119
Assignment - Cash Out
Assignment – Cash Out (10 points)
For this cash out, you will have to report your data and make a conclusion about which drug you think the
zebrafish you observed were exposed to. A cash out sheet will be made available to you in class.
Your grade will be based on the thoroughness and accuracy of your data, and that you data are consistent
with your conclusion. As long as your rationale, in terms of data and biology, are correct, you will not lose
points for a wrong answer.
BIO-100: Great Experiments in Biology,
Lab Manual
120
Exercise XIII: A Study of Endangered Species at the Zoo
It is important to be able to make good observations in biology because this process can provide essential
information. You will use your observations of two endangered animals at the National Zoo, the information
provided by the zoo, and your own research to decide how and why these animals should be saved. Habitat loss as
a cause for endangerment will be emphasized.
Assignment: Infographic on an Endangered Species and Ethogram Observations
BIO-100: Great Experiments in Biology,
Lab Manual
121
Introduction
A Study of Endangered Species
Learning Objectives
During this lab you will visit the National Zoo and learn the following
To identify two endangered species at the National Zoo and make observations of their habitat at the
Zoo and find information as to their natural habitat
To understand what pressures have lead to these two animals becoming endangered
To write a White Paper and construct an argument supported by evidence to propose protecting or
not one endangered species of your choice
Extinction is a normal part of evolution. Most of the species that have ever existed on Earth are now extinct.
There is not a Tyrannosaurus rex lurking in our forests or a saber tooth tiger in your back yard. The purpose of
today’s lab is to understand how man may be causing a significant and disturbing increase in the rate of species
extinctions. You will learn how this is happening by studying how individual species have become endangered.
Then we humans can better appreciate the ramifications of these changes in terms of how they will decrease
species diversity and negatively impact the ecology of our planet.
The normal rate of extinction is called the background rate. It is not a constant rate and there have been definite
periods in history when mass extinctions have taken place. One such event took place about 65 million years ago
when all the dinosaurs disappeared. In the more recent times, man’s existence has been increasing the rate of
extinctions at least hundred-fold and possibly even a thousand-fold. Tropical deforestation alone is extinguishing
roughly one species every hour, or maybe even one every minute. Peter Raven of the Missouri Botanical Gardens
and former Home Secretary of the National Academy of Sciences (USA) and former President of the American
Association for the Advancement of Science says:
“We are confronting an episode of species extinction greater than anything the world has experienced for the past
65 million years. Of all the global problems that confront us, this is the one that is moving the most rapidly and the
one that will have the most serious consequences. And, unlike other global ecological problems, it is completely
irreversible.”
There are several factors that contribute to the decline in the number of species. One of the most critical is habitat
loss. A habitat is the natural environment where an organisms lives. It is typically a larger area for larger animals
so these animals are usually more affected by habitat loss. However, human population has been increasing at an
exponential rate over the past century and this has been affecting animals both large and small. As there are more
humans, there is obviously a greater need for human housing and food. People around the world have been
destroying forests and plains to make way for crops. Their roads, pipelines, and railways have cut across land and
water to block migratory paths for animals. Normally animals must compete with each other for food and space
resources. Competition for resources limits the numbers of a species (population size). The carrying capacity
of a particular habitat for a particular species is the maximum size of a population that can be supported by the
resources present. No matter where the animals you study today naturally live, they need space and food. As their
habitat is decreased, the competition for these needs increases. Carrying capacity is reached and then the
numbers of animals declines.
Governments working with scientists and conservationists must decide how to help endangered species. How
should available funds be used. Should more wildlife reserves be created to preserve habitats? Should more zoos
with artificial habitats be created? Should money be used to support research into the animal’s reproduction and
BIO-100: Great Experiments in Biology,
Lab Manual
122
survival? These will be some of the questions you will think about as you observe two endangered species at the
National Zoo and determine the factors that have contributed to their decline. Part of your research will require
making careful observations. Making observations for scientific analysis requires thought, patience, and
organizational skills. The Table in this exercise has been developed to help you make observations. Then you will
use additional literature research to learn more about the reasons why your species have become endangered.
BIO-100: Great Experiments in Biology,
Lab Manual
123
Procedure
A Study of Endangered Species
The main entrance to the National Zoo is at 3001 Connecticut Ave. N.W., and the Zoo is open daily from 9:00 AM
to 4:30 PM. Some buildings do not open until 10 AM. There is parking within the Zoo itself, and some available on
surrounding streets. The Metro subway is the best transportation. From the AU/Tenley Circle station take the Red
Line towards Wheaton/Glenmont, get off at the Woodley Park-Zoo station, and then walk north on Connecticut
Ave. to the main entrance on the right. Walk down the sidewalk to the Visitors Center which is on your left. This is
where all the lab sections will meet. You can buy a map at the Visitors Center to help find the animals described in
this exercise. Make sure you bring materials to take notes on your observations. A camera may also be helpful.
You will observe two animals which are endangered. Observe each of your animals for at least 10 minutes!!
Collect any zoo information on the classification and characteristics of the group of animals from which your two
species belongs. Use the Data Collection Tables in the next pages. Note the time of observations, weather, and
approximate temperature. Carefully observe each of the animal’s morphologies, behaviors, and habitats at the zoo.
Pay particular attention to the immediate environment in which the animal is living. Be sure to read and record
any additional information on the zoo signs concerning each animal you observe. It is also very important to talk
with any zookeepers you may encounter.
Support your observations at the Zoo with information on the Orders and Families of the animals observed, which
can be found in the A.U. Library (Reference, Isle 9, QH13 – QL) or in other texts. The internet also has lots of
information – check out the National Zoo site http://nationalzoo.si.edu/default.cfm. Start with the U.S. Fish and
Wildlife website http://www.fws.gov/endangered/wildlife.html and learn about how a species becomes classified as
endangered. Then take a look at the IUCN red list web site at www.iucnredlist.org and http://bagheera.com
Don’t forget to read the expectations for your position paper at the end of this exercise. The list of endangered
animals at the National Zoo is on the last page.
ZOO LAB OBSERVATIONS
Date:
Time of observations:
Weather and approximate temperature:
Give general information on the classification and characteristics of the group of animals from which your two
species belongs.
Complete the tables below using information from the National Zoo, zookeepers, and outside resources (cite
these!).
Observe each of your animals for at least 10 minutes to fill in the following table.
DATA COLLECTION SHEET 1 FOR ENDANGERED SPECIES LAB
Animal 1
Animal 2
common name
genus species name
Phylum, class, order, & family
Structure, size, & orientation of ears, eyes, mouth
skin, fur, scales, & color; camouflage; protection
Appendages – number, type, size, & structure
Any unique physical features
Warm or cold blooded and temp requirements
Types of movements
BIO-100: Great Experiments in Biology,
Lab Manual
124
Behaviors related to eating, hiding, interactions with other members
Evidence of predator defenses
Reproduction behaviors and structures
Evidence of food
HABITAT DATA COLLECTION SHEET 2 FOR ENDANGERED SPECIES LAB
Animal 1
Animal 2
Describe zoo habitat in detail in terms of space, landscape, water, light, etc.
Types of nests or shelter
Natural location in world
BEHAVIOR DATA COLLECTION SHEET 3 FOR ENDANGERED SPECIES LAB (Animal 1)
Time of Observation
Behavior
Time of Observation
0:30
5:30
1:00
6:00
1:30
6:30
2:00
7:00
2:30
7:30
3:00
8:00
3:30
8:30
4:00
9:00
4:30
9:30
5:00
10:00
Behavior
BEHAVIOR DATA COLLECTION SHEET 3 FOR ENDANGERED SPECIES LAB (Animal 2)
Time of Observation
Behavior
Time of Observation
0:30
5:30
1:00
6:00
1:30
6:30
2:00
7:00
2:30
7:30
BIO-100: Great Experiments in Biology,
Lab Manual
Behavior
125
3:00
8:00
3:30
8:30
4:00
9:00
4:30
9:30
5:00
10:00
BIO-100: Great Experiments in Biology,
Lab Manual
126
List of Endangered Animals
Tiger or Sumatran tiger
Panthera tigris
Order Carnivora
Grevy’s zebra
Equus grevyi
Order Perissodactyla
Maned wolf (near zebras)
Chrysocyon brachyurus
Order Carnivora
Ring-Tailed or Ruffed Lemur
Lemur catta
Order Primate
Grand Cayman Iguana
Cyclura nubila lewesi
Order Squamata
Clouded Leopard
Neofelis neofelis
Order Carnivora
Golden Lion Tamarins
Leontopithecus rosalia
Order Primate
Giant elephant or Northern Tree shrew
Rhynchocyon petersi
Order Macroscelidea
Black footed ferret
Mustela nigripes
Order Carnivora
Western Lowland Gorilla
Gorilla gorilla
Order Primate
Orangutan
Pongo borneo
Order Primate
Red Panda
Ailurus fulgen
Order Carnivora
Dama Gazelle
Nanger dama
Order Artiodactyla
Asian Small Clawed Otter
Aonyx cinerea
Order Carnivora
Asian Elephant
Elephas maximus
Order Proboscidea
Cuban Crocodile
Crocodylus rhombifer
Order Crocodilia
Madagascar Giant Day Gecko
Phelsuma grandis
Order Squamata
Madagascar Radiated or Spider Tortoise
Pyxis arachnoids
Order Testudines
Gharial crocodile
Gavialis gangeticus
Order Crocodilia
Scimitar-horned oryx
Oryx dammah
Order Artiodactyla
Prezwalski’s Horse
Equus ferus przewalskii
Order Perissodactyla
Fishing cat
Prionailurus viverrinus
Order Carnivora
Lion
Panthera Leo
Order Carnivora
Whooping crane
Grus Americana
Order Gruiformes
BIO-100: Great Experiments in Biology,
Lab Manual
127
Assignment - Infographic on Your Endangered Species
Assignment – Infographic (75 points)
The final assignment of the semester is a 1 page 17″ x 22″ infographic on your endangered species. This is
an individual assignment. You will present this infographic in class along with all of your other classmates.
(Note: your infographic should be 17″ by 22″, which is really 2×2 8.5″ x 11″ notebook pages. It need not be
a single sheet of paper)
You are required to submit hard copies of your data table sheets that you completed at the zoo. These will
be worth 15 points of your total grade.
What is an infographic? It is a visual image that represents information and data. It includes images and
text. The key is to make it aesthetically appealing while still conveying lots of information! Here is a link to
a whole bunch of examples.
Your infographic should include the following information:
1. Description of the animal, its natural habitat (including geographic region) and how it fits into the
ecosystem within that habitat. You should include any information that you collected at the zoo that is
important to know in order to understand why this animal is now endangered. (For example, pandas are not
great at mating!)
2. Provide numerical evidence that this animal has become endangered and explain the major reasons for
it. Reasons include habitat loss, or collapses in other animal populations.
3. What are the current strategies to save this animal? Provide evidence that they are working (or not
working). What is the animal’s potential for survival? Cite biological or ecological explanations for why or
why not the animal can be saved.
4. Provide the data from your observations. Are you observations consistent with the known behavior of this
animal in its natural habitat? What is the zoo doing right? Wrong? What additional strategies is the zoo
attempting to save this animal? What kind of research is being done on this animal if any?
5. REFERENCES!
6. Pictures that you take of your animal at the zoo!
BIO-100: Great Experiments in Biology,
Lab Manual
128