Journal of Biogeography (J. Biogeogr.) (2009)
ORIGINAL
ARTICLE
Phylogeography of the ground squirrel
subgenus Xerospermophilus and
assembly of the Mojave Desert biota
Kayce C. Bell1 , David J. Hafner2, Philip Leitner3 and Marjorie D. Matocq4*
1
Department of Biological Sciences, Idaho State
University, Pocatello, ID 83209, USA,
2
Museum of Southwestern Biology, University
of New Mexico, Albuquerque, NM 87131,
USA, 3Endangered Species Recovery Program,
California State University-Stanislaus, Fresno,
CA 93722, USA and 4Department of Natural
Resources and Environmental Science,
University of Nevada, Reno NV 89512, USA
ABSTRACT
Aim The Mohave ground squirrel (Xerospermophilus mohavensis) is one of a
few endemic species of the Mojave Desert of south-western North America.
We describe phylogeographic patterns within this species and its sister taxon
(Xerospermophilus tereticaudus) and test hypotheses concerning their biogeographical history using genetic signatures of stable versus expanding
populations. We compare these patterns with those of other Mojave species to
evaluate the role of vicariance in producing phylogeographic structure during the
assembly of the Mojave Desert biota.
Location The Mojave Desert and adjacent desert regions of south-western North
America.
Methods Complete cytochrome b gene sequences of X. mohavensis (46 individuals representing 11 localities) and X. tereticaudus (38 individuals representing
14 localities) were analysed using Bayesian methods to infer phylogenetic
relationships. Genetic signals of stable or expanding populations were examined
based on the distribution of recent mutations and pairwise differences, as well as
with a coalescent-based approach.
Results The two species are reciprocally monophyletic and may have diverged
in response to the late Pliocene–early Pleistocene uplift of the Transverse
Ranges and Mojave block. Little phylogeographic structure is evident within
X. mohavensis, but there is a signature of northern expansion from a presumably
full-pluvial refugium in the Mojave River basin. Four geographic subgroups are
evident within X. tereticaudus, and there is a signature of northern expansion
from a presumably full-pluvial refugium in the Sonoran coastal plains. Roughly
congruent phylogeographic patterns are found within five arid-adapted taxa,
indicating a strong element of vicariance during the assembly of the generally
transitional Mojave Desert biota.
*Correspondence: Marjorie D. Matocq,
Department of Natural Resources and
Environmental Science, University of Nevada,
Reno, NV 89512, USA.
E-mail: [email protected]
Present address: Department of Zoology,
Denver Museum of Nature and Science, Denver,
CO 80205, USA.
ª 2009 Blackwell Publishing Ltd
Main conclusions We present a preliminary model for the historical assembly
of the Mojave Desert biota that indicates a strong vicariant element producing
autochthonous lineages (including X. mohavensis) that diverged during the major
geological and climatic events of the last 5 Myr. Phylogeographic partitioning
within the Mojave Desert underscores the necessity of immediate conservation
measures for this unique and fragile arid ecosystem that is locked between two
large metropolitan population centres and is the target of continued adverse
environmental impact.
Keywords
Conservation biogeography, mitochondrial DNA, Mojave Desert, phylogeography, south-western North America, Spermophilus, Xerospermophilus
mohavensis, Xerospermophilus tereticaudus.
www.blackwellpublishing.com/jbi
doi:10.1111/j.1365-2699.2009.02202.x
1
K. C. Bell et al.
INTRODUCTION
The Mojave Desert, encompassing some 140,000 square kilometres of southern California and adjacent Nevada and
Arizona (Fig. 1), is considered the smallest of the five regional
deserts of south-western North America, which range from the
cold, northern Great Basin through the cool Mojave to the
warm, southern Peninsular, Sonoran and Chihuahuan deserts
(see summary of boundaries in Hafner & Riddle, in press). The
Mojave Desert is included with the Sonoran and Peninsular
deserts in the Tropical–Subtropical Desert ecoregion (Bailey,
1997). Whereas the other four regional deserts are characterized by their having a large number of endemic arid-adapted
plants and animals, the Mojave is notable in its low number
of endemic species. Similarly, the boundaries of the Mojave
Desert are predominantly climatic (owing to elevation,
latitude, frost and seasonal rainfall pattern) rather than being
marked by obvious geomorphological barriers or filter-barriers
(Axelrod, 1983; Hafner & Riddle, in press). Recent studies
of the biota of the three warm, southern regional deserts,
particularly of the arid-adapted rodents, have clearly delineated
transitional areas between the core regional areas (Riddle et al.,
2000a; Hafner & Riddle, 2005; Riddle & Hafner, 2006). For
example, the Coloradan subregion (=Colorado Desert) of
southern California and the adjacent San Felipe subregion of
north-eastern Baja California possess a heightened biodiversity
that is a mixture of Mojave, Peninsular and Sonoran elements,
and the Chihuahuan subregion (the portion of the Chihuahuan Desert north of the Rı́o Conchos, which is geographically
Figure 1 Current distribution of the regional deserts of North
America (dark shading) and intervening transitional areas (light
shading; Hafner & Riddle, in press). Inset: major geographic
features of the Mojave Desert during the Last Glacial Maximum,
indicating fluvial-lacustrine systems (redrawn based on Smith &
Street-Perrott, 1983). Stars indicate locations of the former
Antelope basin (west) and Phelan Peak basin (east).
2
larger than the Mojave Desert) possesses a nearly even mixture
of Sonoran and Chihuahuan desert rodent taxa (Hafner &
Riddle, in press). Consequently, it is reasonable to question the
validity of recognizing the Mojave on the same level as the
other four regional deserts, as opposed to a transitional region
between the Great Basin, Peninsular and Sonoran deserts.
Axelrod (1983) defined the Mojave Desert as a climatic
transition from the high-elevation, cold, winter-rain Great
Basin Desert to the low-elevation, warm, summer-rain Sonoran Desert (including the Peninsular Desert of Hafner &
Riddle, 1997). Axelrod (1983) envisioned the current biotic
associations within the Mojave Desert as resulting from the
Pliocene uplift of the Mojave block, which cooled the region,
forcing some warm-adapted elements to the south, allowing
some cool-adapted elements to immigrate from the north, and
producing a smooth transition of biotic associations. Hafner
(1981) and Hafner & Riddle (1997) emphasized this transitional nature of the Mojave by showing the strong influence of
the Great Basin and Sonoran deserts (respectively) on the
Mojave Desert in terms of Simpson’s (1960) similarity index:
1.00 and 0.93 for arid-adapted reptiles; 0.75 and 0.70 for aridadapted mammals. Finally, only three endemic species are
recognized for the Mojave Desert: the perennial Joshua tree
(Yucca brevifolia), which is the most visible indicator of the
Mojave flora; the Mojave fringe-toed lizard (Uma scoparia), an
endangered species that is narrowly adapted to sand dune and
ramp habitat (Trépanier & Murphy, 2001); and the Mohave
ground squirrel, Xerospermophilus mohavensis (Merriam,
1889), which since 1971 has been at the centre of a controversy
between urban development and desert conservation (summarized in Hafner, 1998).
In their taxonomic revision of the Holarctic ground squirrel
genus Spermophilus, Helgen et al. (2009) elevated the former
subgenus Xerospermophilus [which included only X. mohavensis and its sister species, Xerospermophilus tereticaudus (Baird,
1858)] to full generic status, and included within the genus two
species formerly included within the subgenus Ictidomys [the
sister species Xerospermophilus spilosoma (Bennett, 1833) and
Xerospermophilus perotensis (Merriam, 1893)]. We restrict our
analysis to the sister species X. mohavensis and X. tereticaudus,
the western peripheral members of the genus, which occur in
the Sonoran and Mojave deserts, west of the Sierra Madre
Occidental (X. tereticaudus was unintentionally omitted from
the distribution map, see figure 11 in Helgen et al., 2009). The
other two sister species, X. spilosoma and X. perotensis, occur
generally east of the Sierra Madre Occidental. Hereafter, we
refer to all species formerly included in the genus Spermophilus
(now divided into eight genera, following Helgen et al., 2009)
as ‘Spermophilus (sensu lato)’.
Our goals are: (1) to evaluate phylogeographic relationships
within Xerospermophilus mohavensis and its sister taxon, the
round-tailed ground squirrel, X. tereticaudus; (2) to compare
available phylogeographic patterns, particularly among the
three endemic species, within the Mojave Desert relative to
neighbouring arid regions (Great Basin, Peninsular and
Sonoran deserts); and (3) to develop a preliminary assessment
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
Phylogeography of Xerospermophilus
of the impact of vicariance leading to phylogeographic
structure as an alternative to an otherwise smooth transitional
pattern across the Mojave Desert. We use mitochondrial DNA
(mtDNA) cytochrome b (cyt b) sequence data to reconstruct
the evolutionary history and estimate the time of divergence of
the two sister species of Xerospermophilus. We further assess
their phylogeographic history by examining the spatial distribution of genetic signals of expansion and stability across
populations. Finally, we estimate the extent of mitochondrial
introgression between the species by comparing mtDNA
variation with previous nuclear assignment of individuals that
appear to be hybrids (based on allozymic, karyotypic and
morphometric data; Hafner & Yates, 1983; Hafner, 1992).
MATERIALS AND METHODS
Specimens examined
A total of 44 individuals of X. mohavensis from 11 localities, and
36 individuals of X. tereticaudus from 14 localities were
sampled, including skin biopsies and hair clips from 45 live
animals (without vouchers) and 22 museum specimens, and 13
frozen samples of liver tissue (Appendix 1). These included
samples from throughout the distribution of both species
(Fig. 2). We included three individuals purported to be hybrids
between X. mohavensis and X. tereticaudus based on a combination of allozyme, karyotypic and morphometric data (MSB
53442, MSB 53443, MSB 53420; see Appendix 1 for museum
abbreviations; Hafner & Yates, 1983; Hafner, 1992).
We obtained additional sequences from GenBank for
X. mohavensis (AF157928, AF157925), X. tereticaudus (AF157941,
AF157940) and selected outgroups: X. spilosoma AF157911; X.
perotensis AF157948; Poliocitellus franklinii (Sabine, 1822)
AF157894; and Urocitellus townsendii (Bachman, 1839)
AF157949. Outgroups were selected based on relationships
Figure 2 (a) Distributions of Xerospermophilus mohavensis (dark shading) and Xerospermophilus tereticaudus (light shading), and
locations of samples used in this study.
Localities numbered as in Appendix 1. (b)
Enlargement of inset in (a) showing details of
sample sites in the Mojave Desert and additional records of X. mohavensis (small black
dots) and X. tereticaudus (small white dots;
redrawn based on Hafner, 1992). Dotted lines
indicate the outline of the Mojave River fluvial-lacustrine system and the Pleistocene
Lake Le Conte (current location of Salton
Sea).
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
(a)
described in Harrison et al. (2003). Animals collected during
the course of this study were treated in a humane manner
following procedures approved by the American Society of
Mammalogists (Gannon et al., 2007) and Idaho State
University’s Institutional Animal Care and Use Committee.
Molecular techniques
We extracted whole genomic DNA using QIAGEN DNeasy
extraction kits (QIAGEN Inc., Valencia, CA, USA) and the
standard animal tissue protocol. For hair and degraded
samples we used a modified protocol wherein we heated the
elution buffer to 55 C prior to elution, and incubated samples
on the extraction membrane for 5 min prior to centrifugation
to release DNA from the membrane. For liver and ear punch
samples we amplified cyt b (1140 bp) in two fragments with
the primers MVZ 05/Spermo 06 (Smith & Patton, 1993;
Eddingsaas et al., 2004) and Spermo 07/MVZ 14 (Smith &
Patton, 1993; Eddingsaas et al., 2004). We amplified the target
regions in 25-lL reactions including 2.5 lL of 10· polymerase
chain reaction (PCR) buffer (including 1.5 mm MgCl2),
1.0 lm of each primer, 0.2 lm of dNTPs, 0.125 lL of Taq
polymerase and 4.4 lL of H2O, with the following thermocycler settings: initial denaturation at 95 C for 30 s, then 37
cycles of 95 C for 15 s, 46 C for 15 s, 72 C for 10 s, and a
final extension at 72 C for 3 min, on a DNA Engine PTC-200
thermocycler (purchased from MJ Research, now Bio-Rad,
Hercules, CA, USA). Because of their degraded nature, we
typically amplified museum skin and hair samples in five
fragments using the primers listed in Table 1, with the same
amplification protocol as described above.
Polymerase chain reaction products were visualized on a 1%
agarose gel stained with ethidum bromide and cleaned using
the QIAGEN QIAquick PCR purification kit (QIAGEN Inc.).
Cleaned PCR products were cycle-sequenced with the
(b)
3
K. C. Bell et al.
Table 1 Primers used in the amplification of cytochrome b (cyt b). Positions are given for the heavy and light strands of Spermophilus
(sensu lato) cyt b.
Position
Primer name
Sequence (5¢–3¢)
Annealing temperature (C)
Heavy*
192 Light
170 Heavy
395 Light
374 Heavy
668 Light
615 Heavy
930 Light
914 Heavy
Light*
MVZ05
Xsper01
Xsper02
Xsper03
Xsper04
Spermo06
Xsper05
Xsper06
Xsper07
MVZ14
CGAAGCTTGATATGAAAAACCATCGTTG
GAGAAGGCTGTTATAGTATCA
CTGATACTATAACAGCCTTCT
CATAGCCTATGAAAGCTGTGGC
GCCACAGCTTTCATAGGCTATG
TATGGGTGAAAGGGRAYTTTATCTGA
CAAATAACCCTTCAGGCCTTG
GATAAGTGGAGAAGCGG
CCGTCTTCTCCACTTATC
GGTCTTCATCTYHGGYTTACAAGAC
46
45
46
46
45
*MVZ05 begins at position 24 of the tRNA-GLU preceding cyt b, and MVZ14 begins at position 66 of the tRNA-THR following cyt b.
above-mentioned primers and ABI Big Dye 3.7 following
standard protocols, and analysed on an ABI 3100 automated
sequencer (Applied Biosystems Inc., Foster City, CA, USA) at
the Molecular Research Core Facility at Idaho State University.
Sequences were aligned and checked by eye with Sequencher
4.1.2 (Gene Codes Corporation, Ann Arbor, MI, USA) and
translated in MacClade 4.08 (Maddison & Maddison, 2005).
All data were submitted to GenBank (GenBank accession
numbers FJ965312–FJ965335).
Phylogenetic analyses
We used maximum likelihood-based, Bayesian inference
(BI, Larget & Simon, 1999) to infer phylogenetic relationships
of mtDNA lineages. We polarized the dataset with X.
spilosoma, X. perotensis, U. townsendii and P. franklinii, all
closely related sister taxa (Harrison et al., 2003). We evaluated
the fit of various models of molecular evolution to our data
using the Akaike information criterion (Akaike, 1974) in the
program Modeltest 3.7 (Posada & Crandall, 1998). We
executed BI analyses in MrBayes 3.1.2 (Ronquist & Huelsenbeck, 2003) under the GTR + C model (Rodrı́guez et al., 1990;
Yang, 1994). We ran BI analyses for 10,000,000 generations
using the default temperature (0.2) with four Markov chains
per generation, sampling trees every 1000 generations. We
assessed nodal support (i.e. posterior probability, PP) by the
frequency of recovered clades sampled after the stable equilibrium (Huelsenbeck & Ronquist, 2001).
Population analyses
To examine regional history within the distribution of each
species, we subdivided our samples into four spatial groupings
within each species, largely representing north, south, east and
west. Groups within X. tereticaudus were based on regionally
distinct subclades, whereas X. mohavensis groups were based
on relative spatial proximity and our knowledge of suitable
habitat connectivity (or lack thereof). However, a formal
habitat suitability analysis has not been conducted for
X. mohavensis so we view our regional subdivisions as
4
exploratory. We estimated Fu’s FS (Fu, 1997) in Arlequin
3.11 (Excoffier et al., 2005) for regional groupings of sampling
localities. Fu’s FS distinguishes between genetic signals of stable
or expanding populations by testing for departures from the
Wright–Fisher model of neutrality in genetic data (Fu, 1997).
Negative FS-values result from an excess of rare alleles from
recent mutations and suggest population expansion or selection, whereas positive FS-values suggest stable populations.
Although selection cannot be ruled out with negative
FS-values, FS is a powerful test for detecting population
expansion (Fu, 1997).
To examine further the demographic history of regional
groupings of populations within both species, we compared
the mismatch distribution of cyt b sequences against the
expected distributions under two models of expansion: (1)
pure demographic expansion, wherein a stationary population
experiences a sudden increase; and (2) spatial expansion,
wherein the range of a population increases (Ray et al., 2003),
using Arlequin 3.11 (Excoffier et al., 2005). A unimodal
mismatch distribution is consistent with population expansion
(Rogers & Harpending, 1992), a bimodal distribution may
suggest spatial expansion with low gene flow among populations (Ray et al., 2003), and a multimodal distribution suggests
relative stability (Rogers & Harpending, 1992). For regional
groupings conforming to a sudden expansion model with a
unimodal distribution, we estimated the timing of expansion
using s (an index of time since expansion in units of
mutational time; Excoffier et al., 2005) and the following
equation: t = s /2lT, where t is the time of expansion, l is the
mutation rate (taken as 2.13 · 10)5 per million years following
Harrison et al., 2003) and T is the generation time (Nunney &
Elam, 1994), estimated as 2 years.
Finally, we used a coalescent-based approach to examine the
demographic history of these species across the landscape. We
used a Metropolis–Hastings genealogy sampling approach as
implemented in the software program fluctuate 1.3 (Kuhner
et al., 1998) to simultaneously estimate theta (Q) and the
population growth rate (g). In each run we used 10 short
chains with sampling increments of 10 and 1000 steps per
chain followed by 10 long chains with sampling increments of
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
Phylogeography of Xerospermophilus
10 and 20,000 steps per chain. Run parameters included
transition/transversion ratios estimated from the entire set of
unique haplotypes within each species (8 for X. mohavensis
and 19 for X. tereticaudus), empirical base frequencies, one
category of substitution rates, an initial theta of 1.0, and
population sizes that were allowed to change. Three replicate
runs per regional group were conducted from different seed
numbers to check for convergence of estimates.
RESULTS
Phylogenetic and regional history of X. mohavensis
and X. tereticaudus
Eight unique haplotypes were found within X. mohavensis,
with seven polymorphic sites and an average pairwise sequence
divergence of 0.21%. The clade formed by X. tereticaudus
consisted of 19 unique haplotypes, with 41 polymorphic sites
and an average pairwise sequence divergence of 0.92%.
Translation of the cyt b sequences reveals very few intraspecific
replacements in either ingroup taxon. Of the 380 residues, two
show amino acid substitutions in X. mohavensis, and seven do
so in X. tereticaudus. Within X. mohavensis, both amino acid
substitutions are between valine and isoleucine, which
are functionally similar amino acids with neutral side chains.
Both substitutions in X. mohavensis and five of the seven in
X. tereticaudus are considered conservative changes in the
BLOSUM62 matrix (Henikoff & Henikoff, 1992; Cargill et al.,
1999). Both substitutions in X. tereticaudus that result in what
are considered functionally non-conservative changes occur at
positions that are variable across our ingroup and outgroup
taxa. As such, the majority of DNA substitutions are silent, and
those that lead to amino acid substitutions are considered
functionally conservative or seem to occur at particularly
variable positions within our dataset.
The phylogenetic reconstruction recovers a reciprocally
monophyletic relationship between X. mohavensis and
X. tereticaudus (PP ‡ 0.99; Fig. 3). Within X. mohavensis, there
is little support for structure across the current range, suggesting
high levels of ongoing gene flow across the range or recent
expansion across large portions of the current distribution, or
both. In our sample of X. tereticaudus, there is strong support for
four subclades: (1) Mojave; (2) Peninsular; (3) Northern
Sonoran; and (4) Southern Sonoran. The Mojave and Peninsular
Figure 3 Bayesian phylogenetic reconstruction of relationships within Xerospermophilus
based on unique cytochrome b sequences.
Nodal support (posterior probability · 100)
is displayed above or next to the branches
of major clades only. Locality numbers
noting the distribution of particular
haplotypes correspond to those in Fig. 2 and
Appendix 1.
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
5
K. C. Bell et al.
10.1 ka, and in the northern region of X. tereticaudus at
17.02 ka. Neither model of expansion could be rejected for the
western region of X. mohavensis, and the mismatch distribution for this group was bimodal, suggesting that this may be an
area of population expansion from multiple historical sources
with low gene flow among demes (Ray et al., 2003). Concordant with an interpretation of population expansion in the
northern and western regions of both species are the strongly
positive g-values for these regions, whereas the southern
regions of both species exhibit g-values indicative of relative
stability (i.e. standard deviations encompassing zero growth;
Table 2). The growth parameter is known to show an upward
bias (Kuhner et al., 1998), but even using a conservative
approach of interpreting positive growth if g > 3 SD(g)
following Lessa et al. (2003), the northern and western
portions of these distributions appear to have experienced
relatively recent expansion in comparison to the more
southern portions of the current distributions.
subclades form a well-supported group (PP = 0.99) to the
exclusion of both Sonoran subclades. In addition, the Southern
Sonoran subclade appears to be basal to the remaining
X. tereticaudus, and the Northern Sonoran subclade appears to
be sister to the Mojave and Peninsular subclades. This general
ladderized structure provides some signal of northern movement from an ancestral Sonoran distribution.
Average pairwise sequence divergence (uncorrected) between X. mohavensis and X. tereticaudus was 3.99% (3.6–
4.28%). Based on two representatives of each species, Harrison
et al. (2003) estimated the pairwise divergence between the
taxa to be 4.13%, reflecting a time of divergence of 1.7 Ma
(95% credibility limit 0.9–2.9). Using the rate of Harrison
et al. (2003) but our slightly revised level of divergence, we
estimate the divergence between X. mohavensis and X. tereticaudus to have occurred c. 1.6 Ma, during the early Pleistocene, with a margin of error allowing for timeframes in the late
Pliocene to the mid-Pleistocene (roughly 1–3 Ma).
With regard to hybridization between the two taxa, each
individual, including three identified as backcross individuals
based on allozyme and karyotypic data (Hafner & Yates, 1983),
had a cyt b sequence consistent with the original morphological identification to species at the time of collection. As such,
we find no evidence for mitochondrial introgression between
the two species.
Fu’s FS-values were positive for the southern regions of both
X. mohavensis and X. tereticaudus (Table 2), whereas the
northern regions of both species showed significantly negative
values (P < 0.02). Both demographic and spatial expansion
models are rejected for the southern regions of both species
(P < 0.05) as well as for the eastern region of X. tereticaudus
(northern Sonoran sites 8 and 10, Fig. 2); neither model is
rejected (P > 0.05) in the northern and western regional
groupings within either species. The northern region of
X. mohavensis and the western and northern regions of
X. tereticaudus all show unimodal mismatch distributions
and low raggedness indices. The southern regions of both
species were characterized by multimodal mismatch distributions and high raggedness indices. Using s we estimate the time
of population expansion in the northern region of X. mohavensis at 11.74 ka, in the western region of X. tereticaudus at
DISCUSSION
Palaeobotany, historical geology and
palaeohydrology of the Mojave Desert
Axelrod (1983) summarized the evolutionary history of the
North American desert flora as a gradual accumulation of
ancient species from surrounding environmental associations,
a process that began in the early Cenozoic and that involved an
explosive geographic expansion into vast regional deserts only
recently, particularly since the Pliocene (c. 5 Ma). Although
initial fragmentation of these developing regions undoubtedly
took place during Miocene or Pliocene times, until recently it
was assumed that the species-level divergence of regional
vertebrate lineages was coincident with the glacial–interglacial
cycles of the late Pleistocene (e.g. Orr, 1960; Savage, 1960;
Findley, 1969; Hubbard, 1974; Morafka, 1974; Schmidly et al.,
1993). It is now clear that lineage divergence among many
regional vertebrates (as well as among plants and invertebrates;
Nason et al., 2002; Hurtado et al., 2004; Sissom & Hendrixson,
2005), particularly those of the southern warm deserts
(Peninsular, Sonoran and Chihuahuan), began with Miocene
Table 2 Diversity measures for pooled localities of Xerospermophilus mohavensis and Xerospermophilus tereticaudus. Localities correspond
to those in Fig. 2 and Appendix 1. Asterisks indicate significance at the P = 0.02 level. Error estimates are given as standard deviations (SD).
Pooled group
Localities
FS
Gene diversity
Raggedness
index
s
Mismatch
distribution
Theta
X.
X.
X.
X.
X.
X.
X.
X.
15, 16, 17
18, 19, 23
21
20, 22, 24, 25
1–7, 9
13, 14
8, 10
11, 12
)2.065*
)0.154
–
2.080
)3.056*
)0.858
)0.973
2.750
0.66
0.54
0
0.54
0.78
0.60
0.93
0.70
0.15
0.33
–
0.79
0.08
0.24
0.35
0.83
1.0
2.55
–
2.58
1.45
0.86
4.65
11.26
Unimodal
Bimodal
–
Multimodal
Unimodal
Unimodal
Multimodal
Multimodal
0.007
0.005
–
0.0005
0.0268
0.0012
0.0123
0.0037
6
mohavensis N
mohavensis W
mohavensis E
mohavensis S
tereticaudus N
tereticaudus W
tereticaudus E
tereticaudus S
± 0.12
± 0.13
±
±
±
±
±
0.012
0.07
0.022
0.012
0.022
g
± 0.003
± 0.001
±
±
±
±
±
0.0002
0.0044
0.0002
0.0056
0.0013
8130 ± 1236
7297 ± 1005
–
)554 ± 1034
6650 ± 475
6082 ± 1518
947 ± 302
)29 ± 156
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
Phylogeography of Xerospermophilus
geological and climatological events (e.g. Hafner & Riddle,
2005; Lindell et al., 2005, 2006; Riddle & Hafner, 2006).
In contrast to the history of the southern warm deserts, that
of the Mojave may have been dominated by more recent
events, particularly those of the late Pleistocene glacial–
interglacial cycles. Axelrod (1983) maintained that woodrat
(Neotoma) middens ranging in age from > 40 to 9 ka indicate
that piñon–juniper woodlands dominated the region, covering
lower slopes and extending into bordering basins, and that
Larrea did not arrive in the Mojave until 9 ka (see also Wells &
Berger, 1967; Wells & Hunziker, 1976; Wells, 1977; Hunter
et al., 2001). As such, the current composition of the Mojave
flora has probably been in place for only 8–11 ka (Thorne,
1986).
The basin-and-range topography of the largely internally
drained Mojave Desert includes a great variety of landforms,
from desert mountains to aeolian dunes. The topography has
resulted from extreme tectonic activity along the San Gabriel
fault of the San Andreas fault system (along the Transverse
Ranges) and the Garlock fault (at the southern margin of the
Sierra Nevada), and widespread but less extreme block-faulting
within the largely intact Mojave block (Cox et al., 2003).
The middle Miocene landscape of the Mojave region was
once flat lowland draining to the Pacific Ocean via the ancestral
Mojave River. Between 9 and 4 Ma, two aquatic barriers
constricted or severed terrestrial contact between the Mojave
region and the Peninsular and Sonoran regions: marine
inundation of the Salton Trough (Ingle, 1974; Boehm, 1984),
and a series of lakes that sequentially spilled over, eventually
linking the Colorado River with the Gulf of California (the
Bouse ‘Embayment’ of Lucchitta, 1979; Buising, 1990; but see
Spencer & Pearthree, 2001, 2005, for the more recent, freshwater
interpretation). A through-flowing Colorado River developed
by 5.3 Ma, simultaneously cutting the Grand Canyon and filling
the mouth of the Salton Trough with sediment. By 4 Ma, this
sediment had isolated the Salton Trough from the Gulf, and
land connectivity was returned to its present form.
Intensified uplift of the Sierra Nevada and Transverse
Ranges c. 5 Ma (Norris & Webb, 1990) resulted in the
formation of rain shadows, blocking prevailing storm tracks
from the Pacific Ocean, and uplift of the Mojave block
resulted in a cooler climate. Access of the ancestral Mojave
River to the Pacific Ocean was blocked by the San Bernardino
Mountains (the south-eastern section of the Transverse
Ranges), and its flow was reversed. As the Transverse Ranges
continued rapid uplift, they shed increasing amounts of
alluvium into two major basins formed along the trough at
the margin of the south-west-sloping Mojave block. The
Antelope basin (Mabey, 1960; Cox et al., 2003) now lies
c. 245 m beneath the land surface, filled with sediment shed
from the San Gabriel Mountains (the north-western section
of the Transverse Ranges). The Phelan Peak basin, along the
San Bernardino Mountains, was rapidly filled by the reversed
flow of the Mojave River. Accumulated sediments shed by the
San Bernardino Mountains first divided the Phelan Peak
basin into two smaller basins (the Victorville basin and
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
Lucerne valley). The Mojave River filled the Victorville basin
1.2–1.0 Ma, and then overcame the southward-inclined
palaeoscape after c. 0.5 Ma to begin its slow advance across
the face of the Mojave block at an average rate of
c. 15 m ka)1 (Cox et al., 2003). Overflow of the basin was
the result of both increased arching along the San Andreas
fault, which accelerated sedimentation, and increased regional
precipitation after c. 140 kyr of relative drought (Smith et al.,
1997).
The Mojave River continued advancing across the Mojave
region, filling playas and shifting its flow into different basins
in response to continued regional block-faulting and erosion
(Cox et al., 2003; Wells et al., 2003). At about the same time
(c. 0.5 Ma), local block-faulting isolated the Mojave and
Amargosa river basins (Sharp & Glazner, 1997). The Mojave
River probably attained its current path only about 20 ka,
and alternated between a continuous fluvial-lacustrine system
and complete desiccation with the waxing and waning of
pluvial–interpluvial periods (Wells et al., 2003). During the
Last Glacial Maximum, an extensive fluvial-lacustrine system
was a dominant feature of the current Mojave Desert (Smith
& Street-Perrott, 1983). This continuous system originated
in the headwaters of the Transverse Ranges (Mojave River
system) and the Sierra Nevada (Owens Lake system),
encircling the north-western Mojave (Fig. 1). A generally
continuous water flow in this system during the Last Glacial
Maximum reached levels of 6–11 times modern flow rates;
interconnecting rivers and most pluvial lakes dried during a
severe regional drought 6–5 ka. These same shifts in fluvial
and lacustrine stands provided shifting sources of sediment
for aeolian dynamics. Higher vegetative cover and sediment
storage during periods of greater precipitation restricted
sediment availability and led to periods of stability of aeolian
deposits and soil formation (Lancaster & Tchakerian, 2003).
Towards the end of the Pleistocene, when the Mojave region
was somewhat drier than it is today (Spaulding et al., 1994),
vegetative cover decreased, fluvial-lacustrine systems were
desiccated, and aeolian construction was accelerated by the
increased sediment supply.
Mojave Desert phylogeography
Compared with the number of studies addressing phylogenetic
and phylogeographic relationships among taxa in the southern
warm deserts (e.g. Riddle et al., 2000a; Hafner & Riddle, 2005;
Riddle & Hafner, 2006), there are relatively few addressing
relationships among Mojave Desert taxa, including those
among the three endemic species. Lamb et al. (1989) examined
mtDNA haplotype complements among desert tortoises
(Gopherus agassizii), whose distribution straddles the Colorado
River. Mulcahy et al. (2006) reported mtDNA haplotype
variation among horned lizards (Phrynosoma) of the ‘Colorado
Desert’ (a transitional region between the Mojave, Peninsular
and Sonoran deserts; Hafner & Riddle, in press). Studies
related to the three endemic species (Y. brevifolia, U. scoparia
and X. mohavensis) are summarized below.
7
K. C. Bell et al.
Yucca brevifolia
Three species of perennial plants dominate the Mojave flora:
Joshua tree (Y. brevifolia), creosote bush (Larrea tridentata)
and white bursage (Ambrosia dumosa). Creosote bush is a
relative newcomer to the desert, appearing only during the last
9 kyr (Axelrod, 1979; Van Devender & Spaulding, 1979), but
its northern distributional limit at the 1373-m contour marks
the boundary between the Great Basin and Mojave Desert as
defined by Shreve (1942). Bursage is found throughout the
western United States. Only the Joshua tree is truly endemic to
the Mojave, and it requires both winter rainfall and a winter
freeze in order to bloom (Loik et al., 2000). Pellmyr et al.
(2007) determined that Y. brevifolia is the single representative
of the section Clistocarpa within a polytomy of three sections
of the genus, and so appears to be an ancient lineage with no
clear sister taxon. Pellmyr & Segraves (2003) hypothesized that
yucca moths (Tegeticula), which are the exclusive pollinators of
Y. brevifolia, diverged in response to the Bouse ‘Embayment’
c. 6.5 Ma (Lucchitta, 1979; Buising, 1990; Spencer & Pearthree,
2005). Smith et al. (2008) found a similar divergence date for
chloroplast DNA haplotype-defined clades within Y. brevifolia,
but indicated two disparate dates for divergence of the two
species of Tegeticula (c. 5.7 and 1.14 Ma) based on two
mitochondrial genes. The Bouse Embayment has been implicated as a causal vicariant agent in at least one rodent lineage
(Chaetodipus baileyi versus Chaetodipus rudinoris; Riddle et al.,
2000b) and within desert tortoises (Gopherus agassizi) spanning the Colorado River (Lamb et al., 1989). Jones (1995)
similarly attributed genetic fragmentation in Phrynosoma
platyrhinos to the Bouse Embayment, whereas Mulcahy et al.
(2006, p. 1822) considered fragmentation within Phrynosoma
mcallii to be much more recent, perhaps resulting from
‘Pleistocene avulsions of the [Colorado] river’, and Patton
et al. (2007) similarly considered divergence within transColorado River woodrats (Neotoma) to have been more recent
(early Pleistocene, 1.6 Ma). Smith et al. (2008) found no
genetic evidence to support reciprocal monophyly of the two
species proposed by Lenz (2007) to represent the two
morphologically distinct forms of Y. brevifolia pollinated by
the different species of Tegeticula (Y. brevifolia and Yucca
jaegariana), but found three distinct geographic clades
(Fig. 4a). The Pan-Colorado clade spans the former distribution of the Bouse Embayment, whereas the Central Mojave
clade (closely corresponding to the distribution of X. mohavensis) and the Northeast clade are linked (but not at a
statistically significant level; see Smith et al., 2008).
Uma scoparia
Trépanier & Murphy (2001) demonstrated that U. scoparia is
specifically distinct from the complex of Uma notata and Uma
inornata (contra Adest, 1978) based on analysis of two
mitochondrial genes. Murphy et al. (2006) related species
divergence of U. scoparia from the other Uma to the Bouse
Embayment. They further hypothesized that diversification
8
(a)
(b)
(c)
(d)
Figure 4 (a) Distribution of Yucca brevifolia (shading) and
included clades (after Smith et al., 2008). Solid lines indicate
significant nodal support for clades; the dashed line lacks significant nodal support. Morphological groups proposed as separate
species by Lenz (2007) are indicated by filled circles (Y. brevifolia,
pollinated by Tegeticula synthetica) and open circles (Yucca
jaegariana, pollinated by Tegeticula antithetica). One site in the
Northeast clade included both forms (half-filled circle).
Distribution of the Bouse Formation (9–4 Ma) is indicated by
solid black. (b) Distribution of Uma scoparia (dark shading), Uma
inornata (light shading north-west of the Salton Sea), and Uma
notata (remaining light shading), indicating major clades (symbols
as in Murphy et al., 2006: stars, Amargosa River lineage; filled
circles, extinct populations; remaining symbols, lineages within the
Mojave River lineage). Outlines of the Mojave River and Amargosa
River drainage basins are indicated by dashed lines. (c) Distribution and samples of Xerospermophilus mohavensis (dark shading,
filled circles) and Xerospermophilus tereticaudus (light shading,
open circles), and clades within X. tereticaudus (see text).
(d) Distribution of Chaetodipus penicillatus and included clades
(after Jezkova et al., 2009): open circles, Sonoran lineage; closed
circles, clades within the Mojave lineage; half-filled circles,
mixtures of Southern Mojave and Sonoran haplotypes.
within U. scoparia began with the isolation of the Mojave River
and Amargosa River basins (owing to the orogenic development of the Mojave Desert c. 0.5 Ma), and that diversification
within the Mojave River basin lineage was the result of shifting
aeolian dynamics during the climatic oscillations of the later
Pleistocene.
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
Phylogeography of Xerospermophilus
Xerospermophilus mohavensis
The Mohave ground squirrel occupies only the cooler, higherelevation north-western corner of the region (Hall, 1981;
Gustafson, 1993). Hafner & Yates (1983) confirmed the specific
status of X. mohavensis apart from its sister species X. tereticaudus, finding limited hybridization along their narrow zone of
contact, which is remarkably congruent with the former Mojave
River fluvial-lacustrine lakes system within the Mojave Desert.
Hafner & Yates (1983) identified three individuals at two sites
(localities 5 and 24 in Fig. 2b) that possessed mixtures of
otherwise diagnostic alleles, and may have resulted from
hybridization at a single, highly disturbed site (locality 24).
Hafner (1992) analysed the cranial morphology of Xerospermophilus in the region and concluded that the interspecific
boundary has remained stable for c. 10 kyr, despite the disappearance of a continuous aquatic barrier at least 6 ka. Hafner
(1992, pp. 774–776) further hypothesized that X. mohavensis
may have speciated in allopatry in a ‘small, isolated desert
refugium in the extreme north-western Mojave Desert’ (circumscribed by the Sierra Nevada, Transverse Ranges and the
Mojave River fluvial-lacustrine system), and that the stability of
the zone of contact resulted from the ‘low vagility of both species;
incorporation of rare immigrants from the alternate species via
introgressive hybridization; [and/or] extreme competition following the unlikely event of populations of both species
becoming established in the same locality’. However, Hafner
(1992) noted that average values of genetic variation within
populations were not atypically low (which would be expected as
a result of low vagility, high inbreeding, and/or isolation).
Subsequently, Harris & Leitner (2005) showed that the dispersal
distance within juvenile X. mohavensis was at least equal to that
of other species of Spermophilus (sensu lato), reasonably
eliminating that explanation for contact-zone stability.
Sequence divergence between X. mohavensis and X. tereticaudus (3.99%) falls within the broad range of divergence that
characterizes other recognized Spermophilus (sensu lato) species (1–18%; Harrison et al., 2003), suggesting that the species
were isolated from one another long enough to achieve
reciprocal monophyly and have not experienced high levels of
gene flow since coming into secondary contact. Although
Hafner & Yates (1983) found evidence of limited introgressive
hybridization along 60 km of the Mojave River wash, the
species have distinct chromosomal complements (X. mohavensis, 2n = 38; X. tereticaudus, 2n = 36), cranial morphology
(Hafner, 1992), and allozyme complements. We found no
evidence for mitochondrial introgression. Our findings
(Fig. 4c) indicate that X. mohavensis diverged from X. tereticaudus c. 1.6 Ma, both long after the Bouse Embayment’ (9–
4 Ma) and (contrary to Hafner, 1992) significantly before the
development of a continuous Mojave River fluvial-lacustrine
system (0.5 Ma). A more likely causal vicariant mechanism
appears to be rapid uplift of the Transverse Ranges at the close
of the Pliocene, and isolation of the Antelope and Phelan Peak
basins in the immediate rain shadow of the San Gabriel and
San Bernardino Mountains (respectively; Figs 1 & 5).
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
The fossil record of X. mohavensis and X. tereticaudus is
limited to isolated teeth (assigned to X. tereticaudus) associated with woodrat middens from Yuma County in southwestern Arizona, dated at 8150 ± 260 yr bp (Mead et al.,
1983), and maxillary and mandibular fragments and teeth
from the Daggett-Yermo area along the Mojave River wash
(Goodwin & Reynolds, 1989; Fig. 5d). The latter records
‘could represent large X. tereticaudus or small X. mohavensis’
(Goodwin & Reynolds, 1989, p. 510), and indicate that
Xerospermophilus was probably absent from this site prior to
10,900 yr bp. Goodwin & Reynolds (1989, p. 511) generalized
the absence of Xerospermophilus from the Daggett-Yermo site
as reflecting ‘its general absence from the central Mojave
Desert during the latest Pleistocene’ but indicated that the
‘subgenus likely maintained a presence to the south and
east…in the Colorado River Valley’. We hypothesize that the
western corner of the Mojave Desert, in the immediate
rainshadow of the San Gabriel Mountains (and Transverse
Ranges in general), also served as an arid refugium for Mojave
Desert taxa during the late Pliocene and during Pleistocene
full-pluvials. Rodent fossils are not known from the Antelope
basin (now buried beneath alluvium) or the extreme western
corner of the Mojave Desert. Populations of X. mohavensis and
X. tereticaudus may have occurred north-west and south-east
(respectively) of the Mojave River but not in the immediate
vicinity of Daggett-Yermo during pluvial maxima.
Population analyses indicate that the immediate rainshadow
of the San Gabriel Mountains may have sheltered refugial
populations of X. mohavensis during pluvial maxima. Longterm population stability is indicated at the southern end of
the species’ distribution based on a positive FS-value, a g-value
not significantly different from 0, rejection of expansion
models, and a multimodal mismatch distribution with a high
raggedness index. In contrast, a significantly negative Fu’s
FS-value in the northern portion of the range of X. mohavensis,
together with a positive g-value, lack of rejection of the
expansion models, a unimodal mismatch distribution, and a
low raggedness index suggest expansion into this region
c. 11.7 ka. Alternatively, we cannot eliminate the possibility
that a signature of population stability in this northern region
may have been erased through more recent population
bottlenecks or extinction/recolonization events associated with
this species’ response to drought. Local population extinctions
may be particularly common in X. mohavensis because during
extended periods of drought they do not produce offspring
(Best, 1995; Harris & Leitner, 2004).
A positive FS-value, a g-value not significantly different from
0, rejection of expansion models, and a multimodal mismatch
distribution with a high raggedness index for the southern
populations of X. tereticaudus indicate that this species,
adapted to lower-elevation, hotter deserts, was apparently
restricted to full-glacial refugia in the Sonoran coastal plains.
Significantly negative Fu’s FS, positive g-values, lack of
rejection of the models of expansion, and unimodal distributions with low raggedness indices in the western and northern
reaches of the range of X. tereticaudus suggest recent expansion
9
K. C. Bell et al.
(a)
(b)
(c)
(d)
(e)
(f)
Figure 5 Preliminary model for the assembly of the Mojave Desert biota, based on phylogeographic analyses of five arid-adapted taxa:
(a) distribution of taxa prior to the elevation of Transverse Ranges and formation of the through-flowing Colorado River (9–4 Ma);
(b) isolation of taxa in the Antelope and Phelan Peak basins following elevation of Transverse Ranges (4–2 Ma); (c) fragmentation of taxa
in developing regional basins (2–0.5 Ma); (d) isolation in arid refugia during pluvial maximum; (e) secondary contact following the Last
Glacial Maximum (6 ka–today); and (f) boundary of the Mojave Desert and regional features today. Abbreviations for taxa and clades:
Y.b., Yucca brevifolia (after Smith et al., 2008), Central Mojave (CM), Northeastern (NE) and Pan-Colorado (PC); T.a., Tegeticula
antithetica; T.s., Tegeticula synthetica; U.i., Uma inornata; U.n., Uma notata; U.s., Uma scoparia (after Murphy et al., 2006), Amargosa River
clade (AR), Bouse-Rice clade (BR), Cadiz-Amboy clade (CA), Mojave River Sink clade (MR) and Palen-Dale clade (PD); X.m., Xerospermophilus mohavensis; X.t., Xerospermophilus tereticaudus (this study), Mojave (M), Peninsular (P) and Sonoran (S); C.p., Chaetodipus
penicillatus (after Jezkova et al., 2009), Mojave (M), Mojave north (MN), Mojave west (MW), Mojave south (MS) and Sonoran (S). Solid
star in (d) indicates the location of fossils (< 12.8–9 ka) assigned to the subgenus Xerospermophilus sp.? (Goodwin & Reynolds, 1989); open
star indicates the location of fossils (8150 ± 260 yr bp) assigned to X. tereticaudus (Mead et al., 1983).
into these areas c. 17–10 ka. Following the return of warmer,
drier interpluvials, the two species probably regained contact
along the Mojave River fluvial-lacustrine system.
The diet of X. mohavensis may provide additional support
for an autochthonous history in the northern section of the
Mojave Desert. Mohave ground squirrels depend on the foliage
of certain chenopod shrubs, particularly winterfat (Krascheninnikovia lanata) and spiny hopsage (Grayia spinosa), both
early and late in their active season and especially during
drought years (P. Leitner, pers. obs.). Both of these shrub
species reach their south-western margins in the Mojave
Desert, and neither occurs south of the Salton Trough (http://
plants.usda.gov; accessed November 2008).
Chaetodipus penicillatus
Jezkova et al. (2009) report a similar phylogeographic pattern
within the desert pocket mouse (Chaetodipus penicillatus),
10
which is restricted to open, sandy habitat in the warm North
American regional deserts. Like fringe-toed lizards (Uma) and
X. tereticaudus (and several other arid-adapted rodents),
C. penicillatus has barely entered the Baja California peninsula,
and has failed to reach the Peninsular Desert proper (beginning at 30N latitude). Jezkova et al. (2009, p. 316) determined
that divergence of the Sonoran and Mojave clades (Fig. 4d)
occurred c. 0.5 Ma owing to ‘climatic oscillations of the
Pleistocene’, and may result from isolation on opposite sides of
the Gila River (similar to the hypothesized divergence of the
Phrynosoma mcallii–platyrhinos–goodei complex; Mulcahy
et al., 2006). They indicate significant phylogeographic structure within the Mojave clade, including a Southern Mojave
clade that is intermixed with Sonoran haplotypes and is
diverged from two related clades: a Northern Mojave clade
roughly corresponding to the Northeast and Amargosa River
basin clades of Y. brevifolia and U. scoparia (respectively) and a
Western Mojave clade that corresponds to X. mohavensis, the
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
Phylogeography of Xerospermophilus
Central Mojave clade of Y. brevifolia, and the Mojave River
basin clade of U. scoparia (Fig. 4). Ecological niche models for
the Western Mojave clade during the Last Glacial Maximum
indicate two potential full-glacial refugia: along the northern
rim of the Gulf of California and in restricted basins of the
Mojave Desert (Jezkova et al., 2009).
Preliminary model for assembly of a Mojave Desert
biota
Species compositions of communities across the Mojave
Desert clearly reflect in large part the intermixing of elements
from colder (Great Basin) and warmer (Peninsular and
Sonoran) deserts. At the same time, comparison of phylogeographic structures among a sample of insect, plant, reptile
and mammalian taxa clearly indicates strong structuring
within Mojave Desert lineages. Moreover, it is evident that
such structuring need not be accompanied by species-level
distinctions (e.g. C. penicillatus). This latter point underscores
the argument of Riddle & Hafner (1999) that reliance on
currently recognized species is often unreliable in the identification of the fundamental evolutionary and geographical
units necessary for biogeographical interpretations. It also
indicates the potential for finding significant phylogeographic
structure within other species that appear to be continuously
and homogeneously distributed throughout the Mojave and
neighbouring deserts.
Combining the postulated dates for species and population
divergences within Y. brevifolia, its obligate pollinator Tegeticula, Uma, Xerospermophilus and C. penicillatus provides an
opportunity to develop a preliminary model for the historical
assembly of the Mojave Desert biota. We present this model
(Fig. 5) for testing by phylogenetic analysis of other aridadapted taxa that occur in the Mojave Desert. Beginning with
a generalized ‘Mohavia’ (sensu Axelrod, 1950, 1958) prior
to 9 Ma, ancestral forms of more mesic-adapted taxa
(Y. brevifolia, Tegeticula and Uma) were distributed along the
northern edge of a developing Gulf of California, whereas
more xeric-adapted forms (Xerospermophilus and C. penicillatus) were restricted to the warm Sonoran coastal plains.
Development of the Colorado River (resulting in the Bouse
Formation) isolated north-western forms (Fig. 5a) sometime
during 9–4 Ma, leading to speciation in Tegeticula and Uma
and to the divergence of Mojave from Pan-Colorado clades of
Y. brevifolia. The retreat of the Bouse Embayment and
desiccation of the ancient Salton Sea with the development
of a through-flowing Colorado River (and the resulting
sedimentary damming of the Salton Trough) allowed northwestern dispersal of Xerospermophilus and C. penicillatus.
Accelerated uplift of the Sierra Nevada, Transverse Ranges
and Mojave block at the close of the Pliocene (4–2 Ma) forced
warm-restricted forms to the south and left cooler-adapted
forms in basin refugia in the rain shadow of the Transverse
Ranges (Fig. 5b), leading to speciation of X. mohavensis. The
return of more mesic conditions and continued local blockfaulting in the Mojave block, forming the current basin
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
topography and completing the Mojave River fluvial-lacustrine
system (2–0.5 Ma), fragmented populations into the major
Mojave River, Amargosa River and Salton basins (Fig. 5c) and
may have initiated divergence between Mojave and Sonoran
C. penicillatus in the vicinity of the Gila River (Mulcahy et al.,
2006; Jezkova et al., 2009). During the intensified pluvial–
interpluvial cycles of the later Pleistocene (< 0.5 Ma; Fig. 5d),
species of Tegeticula dispersed along continuous corridors of
Y. brevifolia, perhaps resulting in change in floral morphology
of the pollinated plant. The Coachella Valley fringe-toed lizard
(U. inornata) diverged from the Sonoran species (U. notata) in
the Salton basin; and Mojave, Peninsular, and Sonoran clades
of X. tereticaudus diverged, as did clades of the Mojave
C. penicillatus and the Mojave River basin U. scoparia. As
warmer, drier conditions followed the Last Glacial Maximum
(Fig. 5e), the Sonoran form of C. penicillatus spread into
northern Baja California and the southern Mojave Desert, and
populations of X. mohavensis and X. tereticaudus spread north
from southern refugia within their respective ranges.
Conservation implications
The Mojave Desert is caught between two of the largest
population centres in the United States: as of July 2007, the
Greater Los Angeles metropolitan area was the second largest
in the nation, and the Las Vegas Valley metropolitan area was
ranked 36th, but was the fastest growing area (at +33.5% since
2000) in the nation (http://www.census-est2007-pop-chg.html;
accessed 21 November 2008). This arid ecosystem has been
subjected to growing urban development surrounding both
metropolitan centres, as well as to human impact associated
with recreational off-road vehicle use (first documented by
Stebbins, 1974a,b), military training operations (Webb &
Wilshire, 1983), nuclear weapons testing and nuclear waste
disposal programmes (e.g. the Nevada Test Site), and intensive
use of water resources. Despite the creation of the Mojave
National Preserve and Death Valley National Park, conflicts
between human impact and desert conservation continue to
intensify. Notable special-status species include the desert
tortoise (G. agassizii; Berry, 1997), the Mojave fringe-toed
lizard (U. scoparia; Jennings & Hayes, 1994), and the Mohave
ground squirrel (X. mohavensis; Gustafson, 1993; Hafner,
1998). In 1980, the US Bureau of Land Management established the Desert Tortoise Research Natural Area in Kern Co.,
California, as an Area of Critical Environmental Concern
(Berry, 1997), and in 1990 the Mojave population was listed by
the US Fish and Wildlife Service as threatened. The desert
tortoise has been at the centre of bitter debate between urban
developers and conservationists in the Las Vegas Valley, and
Murphy et al. (2006) noted that historical populations of
U. scoparia nearest the Los Angeles metropolitan area have
been extirpated. The California Department of Fish and Game
(CDFG) currently lists X. mohavensis as threatened (CDFG,
2005), and it has recently been petitioned for federal listing.
Relictual species restricted to dwindling freshwater and
riparian habitat are similarly at risk (e.g. desert pupfish,
11
K. C. Bell et al.
Cyprinodon spp., Martin & Wilcox, 2004; Mojave River vole,
Microtus californicus mohavensis, and Amargosa River vole,
Microtus californicus scirpensis, Rado & Rowlands, 1984).
Recognition of the phylogeographic partitioning of
components of the Mojave Desert biota with relatively ancient
(2–5 Ma) autochthonous lineages, rather than a relatively
homogeneous region of smooth transition between northern
(Great Basin) and southern (Peninsular and Sonoran)
elements, underscores the need to conserve the embattled
components of a unique and fragile arid ecosystem.
CONCLUSIONS
Our analysis of mtDNA haplotypes within X. mohavensis
and X. tereticaudus confirms the reciprocal monophyly of the
two sister species. We found no evidence for mitochondrial
introgression, even in three individuals previously identified
as resulting from backcrossing based on nuclear data. Our
estimated dating of species divergence (1.6 Ma) significantly
pre-dates the hypothesized causal impact of the Mojave River
fluvial-lacustrine system (< 0.5 Ma; Hafner, 1992), and instead
implicates the late Pliocene uplift of the Transverse Ranges
in effecting the isolation of incipient forms. In addition to
phylogeographic partitioning within X. tereticaudus, we found
evidence for recent population expansion from southern
(presumably glacial maximum) refugia in both species in their
respective ranges: X. mohavensis from the Mojave River basin,
and X. tereticaudus from the Sonoran coastal plains.
Comparison with available phylogeographic studies of other
Mojave taxa, including two other endemic species, revealed a
history of phylogeographic partitioning within the Mojave
beginning > 5 Ma and associated with major tectonic and
climatic events. Resulting autochthonous lineages, combined
with a north–south transitional mixture of Great Basin and
warm-desert (Peninsular and Sonoran) elements, have led to
the assembly of a unique Mojave Desert biota with intact
geographic components that are largely associated with the
major drainage basins of the region (Mojave River, Amargosa
River, Colorado River and Salton basins).
ACKNOWLEDGEMENTS
We thank the many members of our field crew who helped in
sample collection, including J. Bender. The Molecular Research
Core Facility at Idaho State University processed sequence
samples in part with equipment obtained through a National
Science Foundation Major Research Instrumentation grant
(DBI-0521641). Major funding for this project was provided
by the California Department of Fish and Game, which also
provided collection permits. Additional funding was provided
by the Desert Tortoise Preserve Committee and by the
Endangered Species Recovery Program at California State
University, Stanislaus. The Department of Biological Sciences
at Idaho State University funded a portion of this research.
Several United States military installations (China Lake Naval
Air Weapons Station, Edwards Air Force Base, Fort Irwin,
12
Marine Corps Air Ground Combat Center) and the US Bureau
of Land Management provided access to many of the
collecting sites. The Museum of Southwestern Biology,
Natural History Museum of Los Angeles County, and the
New Mexico Museum of Natural History provided additional
samples.
REFERENCES
Adest, G. A. (1978) The relations of the sand lizards Uma,
Callisaurus and Holbrookia (Sauria: Iguanidae): an electrophoretic study. PhD Thesis, University of California, Los
Angeles, CA.
Akaike, H. (1974) A new look at the statistical model identification. IEEE Transactions on Automatic Control, 19, 716–
723.
Axelrod, D. I. (1950) Evolution of desert vegetation in western
North America. Carnegie Institute of Washington Publications, 590 VI, 215–306.
Axelrod, D. I. (1958) Evolution of the Madro-Tertiary geoflora. Botanical Review, 24, 433–509.
Axelrod, D. I. (1979) Age and origin of Sonoran Desert
vegetation. Occasional Papers, California Academy of
Sciences, 132, 1–74.
Axelrod, D. I. (1983) Paleobotanical history of the western
deserts. Origin and evolution of deserts (ed. by S. G. Wells
and D. R. Haragan), pp. 113–129. University of New Mexico
Press, Albuquerque, NM.
Bailey, R. G. (1997) Ecoregions of North America. USDA Forest
Service, Miscellaneous Publication 1548, Ecosystem Management Analysis Center, United States Department of
Agriculture Forest Service, Fort Collins, CO.
Berry, K. H. (1997) The Desert Tortoise Recovery Plan:
an ambitious effort to conserve biodiversity in the Mojave
and Colorado deserts of the United States. Proceedings:
Conservation, Restoration, and Management of Tortoises and
Turtles – An International Conference (ed. by J. Van Abbema), pp 430–440. New York Turtle and Tortoise Society
and WCS Turtle Recovery Program, New York.
Best, T. L. (1995) Spermophilus mohavensis. Mammalian
Species, 509, 1–7.
Boehm, M. C. (1984) An overview of the lithostratigraphy,
biostratigraphy, and paleoenvironments of the Late Neogene
San Felipe marine sequence, Baja California, Mexico.
Geology of the Baja California Peninsula (ed. by V. A. Frizzell
Jr), Vol. 39, pp. 253–265. Society of Economic Paleontologists and Mineralogists, Pacific Section, Los Angeles, CA.
Buising, A. V. (1990) The Bouse Formation and bracketing
units, southeastern California and western Arizona: implications for the evolution of the proto-Gulf of California and
the lower Colorado River. Journal of Geophysical Research,
95, 20,111, 20,132.
Cargill, M., Altshuler, D., Ireland, J., Sklar, P., Ardlie, K., Patil,
N., Lane, C. R., Lim, E. P., Kalyanaraman, N., Nemesh, J.,
Ziaugra, L., Friedland, L., Rolfe, A., Warrington, J., Lipshutz,
R., Daley, G. Q. & Lander, E. S. (1999) Characterization of
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
Phylogeography of Xerospermophilus
single-nucleotide polymorphisms in coding regions of
human genes. Nature Genetics, 22, 231–238.
CDFG (2005) The status of rare, threatened, and endangered
plants and animals of California 2000–2004. California
Department of Fish and Game (CDFG), Sacramento, CA.
Cox, B. F., Hillhouse, J. W. & Owen, L. A. (2003) Pliocene and
Pleistocene evolution of the Mojave River, and associated
tectonic development of the Transverge Ranges and Mojave
Desert, based on borehole stratigraphy studies and mapping
of landforms and sediments near Victorville, California.
Paleoenvironments and paleohydrology of the Mojave and
southern Great Basin deserts (ed. by Y. Enzel, S. G. Wells
and N. Lancaster), pp. 1–42. Geological Society of America
Special Paper 368, Boulder, CO.
Eddingsaas, A. A., Jacobsen, B. K., Lessa, E. P. & Cook, J. A.
(2004) Evolutionary history of the Arctic ground squirrel
(Spermophilus parryii) in Nearctic Beringia. Journal of
Mammalogy, 85, 601–610.
Excoffier, L., Laval, G. & Schneider, S. (2005) Arlequin ver. 3.0:
An integrated software package for population genetics data
analysis. Evolutionary Bioinformatics Online, 1, 47–50.
Findley, J. S. (1969) Biogeography of southwestern boreal and
desert mammals. Contributions in mammalogy (ed. by J. K.
Jones), pp 113–128. University of Kansas Miscellaneous
Publications of the Museum of Natural History No. 51,
Lawrence, KS.
Fu, Y.-X. (1997) Statistical tests of neutrality of mutations
against population growth, hitchhiking and background
selection. Genetics, 147, 915–925.
Gannon, W. L., Sikes, R. S. & Animal Care and Use Committee
of the American Society of Mammalogists (2007) Guidelines
of the American Society of Mammalogists for the use of wild
mammals in research. Journal of Mammalogy, 88, 809–823.
Goodwin, H. T. & Reynolds, R. E. (1989) Late Quaternary
Sciuridae from low elevations in the Mojave Desert, California. Southwestern Naturalist, 34, 506–512.
Gustafson, J. R. (1993) A status review of the Mohave ground
squirrel (Spermophilus mohavensis). Nongame Bird and
Mammal Report, 93–99, State of California. Department of
Fish and Game, Sacramento, CA.
Hafner, D. J. (1981) Evolution and historical zoogeography
of antelope ground squirrels, genus Ammospermophilus
(Rodentia: Sciuridae). PhD Thesis, University of New Mexico, Albuquerque, NM.
Hafner, D. J. (1992) Speciation and persistence of a contact
zone in Mojave Desert ground squirrels, subgenus Xerospermophilus. Journal of Mammalogy, 73, 770–778.
Hafner, D. J. (1998) Spermophilus mohavensis Merriam 1889.
Mohave ground squirrel. North American rodents: status
survey and conservation action plan (ed. by D. J. Hafner,
E. Yensen and G. L. Kirkland Jr), pp. 47–49. IUCN/SSC
Rodent Specialist Group, IUCN, Cambridge, UK.
Hafner, D. J. & Riddle, B. R. (1997) Biogeography of Baja
California Peninsular Desert mammals. Life among the
muses: papers in honor of James S. Findley (ed. by T. L. Yates,
W. L. Gannon and D. E. Wilson), pp 39–65. Special PubJournal of Biogeography
ª 2009 Blackwell Publishing Ltd
lication No. 3, Museum of Southwestern Biology, University
of New Mexico, Albuquerque, NM.
Hafner, D. J. & Riddle, B. R. (2005) Mammalian phylogeography and evolutionary history of northern Mexico’s deserts. Biodiversity, ecosystems, and conservation in northern
Mexico (ed. by G. Ceballos, J. L. Catron and R. S. Felger), pp.
225–245. Oxford University Press, New York.
Hafner, D. J. & Riddle, B. R. (in press) Boundaries and barriers
of North American warm deserts: an evolutionary perspective. Palaeogeography and palaeobiogeography: biodiversity in
space and time (ed. by P. Upchurch, A. McGowan and C.
Slater). National Institute for Environmental Science,
Cambridge, UK.
Hafner, D. J. & Yates, T. L. (1983) Systematic status of the
Mojave ground squirrel, Spermophilus mohavensis (subgenus
Xerospermophilus). Journal of Mammalogy, 64, 397–404.
Hall, E. R. (1981) The mammals of North America. John Wiley
and Sons, Inc., New York.
Harris, J. H. & Leitner, P. (2004) Home-range size and use of
space by adult Mohave ground squirrels, Spermophilus
mohavensis. Journal of Mammalogy, 85, 517–523.
Harris, J. H. & Leitner, P. (2005) Long-distance movements of
juvenile Mohave ground squirrels, Spermophilus mohavensis.
Southwestern Naturalist, 50, 188–196.
Harrison, R. G., Bogdanowicz, S. M., Hoffman, R. S., Yensen,
E. & Sherman, P. W. (2003) Phylogeny and evolutionary
history of the ground squirrels (Rodentia: Marmotinae).
Journal of Mammalian Evolution, 10, 249–275.
Helgen, K. M., Cole, F. R., Helgen, L. E. & Wilson, D. E. (2009)
Generic revision in the Holarctic ground squirrel genus
Spermophilus. Journal of Mammalogy, 90, 270–305.
Henikoff, S. & Henikoff, J. G. (1992) Amino acid substitution
matrices from protein blocks. Proceedings of the National
Academy of Sciences USA, 89, 10915–10919.
Hubbard, J. P. (1974) Avian evolution in the aridlands of
North America. Living Bird, 12, 155–196.
Huelsenbeck, J. P. & Ronquist, F. R. (2001) MrBayes: Bayesian
inference for phylogeny. Biometrics, 17, 754–756.
Hunter, K. L., Betancourt, J. L., Riddle, B. R., Van Devender, T.
R., Cole, K. L. & Spaulding, W. G. (2001) Ploidy race
distributions since the Last Glacial Maximum in the North
American desert shrub, Larrea tridentata. Global Ecology and
Biogeography, 10, 521–533.
Hurtado, L. A., Erez, T., Castrezana, S. & Markow, T. A. (2004)
Contrasting population genetic patterns and evolutionary
histories among sympatric Sonoran Desert cactophilic
Drosophila. Molecular Ecology, 13, 1365–1375.
Ingle, J. C., Jr (1974) Paleobathymetric history of Neogene
marine sediments, northern Gulf of California. The geology of peninsular California (ed. by G. Gastil and J. Lillegraven), pp. 121–138. Guidebook 49 of the Pacific Section,
American Association of Petroleum Geologists and Society
of Economic Paleontologists and Mineralogists, Los Angeles,
CA.
Jennings, M. R. & Hayes, M. P. (1994) Amphibian and reptile
species of special concern in California. California Depart13
K. C. Bell et al.
ment of Fish and Game, Rancho Cordova, CA. Available at:
http://www.dfg.ca.gov/hcpb/info/herp_ssc.pdf.
Jezkova, T., Jaeger, J. R., Marshall, Z. L. & Riddle, B. R. (2009)
Pleistocene impacts on the phylogeography of the desert
pocket mouse (Chaetodipus penicillatus). Journal of Mammalogy, 90, 306–320.
Jones, K. B. (1995) Phylogeography of the desert horned lizard
(Phrynosoma platyrhinos) and the short-horned lizard
(Phrynosoma douglassi): Patterns of divergence and diversity.
PhD Thesis, University of Nevada, Las Vegas, NV.
Kuhner, M. K., Yamato, J. & Felsenstein, J. (1998) Maximum
likelihood estimation of population growth rates based on
the coalescent. Genetics, 149, 429–434.
Lamb, T., Avise, J. C. & Gibbons, J. W. (1989) Phylogeographic
patterns in mitochondrial DNA of the desert tortoise
(Xerobates agassizi), and evolutionary relationships among
the North American gopher tortoises. Evolution, 43, 76–87.
Lancaster, N. & Tchakerian, V. P. (2003) Late Quaternary
eolian dynamics, Mojave Desert, California. Paleoenvironments and paleohydrology of the Mojave and southern Great
Basin deserts (ed. by Y. Enzel, S. G. Wells and N. Lancaster),
pp. 207–230. Geological Society of America Special Paper
368. Geological Society of America, Boulder, CO.
Larget, B. & Simon, D. (1999) Markov chain Monte Carlo
algorithms for the Bayesian analysis of phylogenetic trees.
Molecular Biology and Evolution, 16, 750–759.
Lenz, L. W. (2007) Reassessment of Yucca brevifolia and
recognition of Y. jaegariana as a distinct species. Aliso, 24,
97–104.
Lessa, E. P., Cook, J. A. & Patton, J. L. (2003) Genetic footprints of demographic expansion in North America, but not
Amazonia, during the late Quaternary. Proceedings of the
National Academy of Sciences USA, 100, 10331–10334.
Lindell, J., Méndez-de la Cruz, F. R. & Murphy, R. W. (2005)
Deep genealogical history without population differentiation: discordance between mtDNA and allozyme divergence
in the zebra-tailed lizard (Callisaurus draconoides). Molecular phylogenetics and Evolution, 36, 682–694.
Lindell, J., Ngo, A. & Murphy, R. W. (2006) Deep genealogies
and the mid-peninsular seaway of Baja California. Journal of
Biogeography, 33, 1327–1331.
Loik, M. E., Huxman, T. E., Hamerlynck, E. P. & Smith, S. D.
(2000) Low temperature tolerance and cold acclimation for
seedlings of three Mojave Desert Yucca species exposed to
elevated CO2. Journal of Arid Environments, 46, 43–56.
Lucchitta, I. (1979) Late Cenozoic uplift of the southwestern
Colorado Plateau and adjacent lower Colorado River region.
Tectonophysics, 61, 63–95.
Mabey, D. R. (1960) Gravity survey of the western Mojave
Desert, California. United States Geological Survey Professional Paper, 361-D, 51–73.
Maddison, D. R. & Maddison, W. P. (2005) MacClade: analysis
of phylogeny and character evolution. Sinauer, Sunderland,
MA.
Martin, A. P. & Wilcox, J. L. (2004) Evolutionary history of
Ash Meadows pupfish (genus Cyprinodon) populations
14
inferred using microsatellite markers. Conservation Genetics,
5, 1566–1621.
Mead, J. I., van Devender, T. R. & Cole, K. L. (1983) Late
Quaternary small mammals from Sonoran Desert packrat
middens, Arizona and California. Journal of Mammalogy,
64, 173–180.
Morafka, D. J. (1974) A biogeographical analysis of the
Chihuahuan Desert through its herpetofauna. PhD Thesis,
University of Southern California, Los Angeles, CA.
Mulcahy, D. G., Spaulding, A. W., Mendelson, J. R., III &
Brodie, E. D., Jr (2006) Phylogeography of the flat-tailed
horned lizard (Phrynosoma mcallii) and systematics of the
P. mcallii–platyrhinos mtDNA complex. Molecular Ecology,
15, 1807–1826.
Murphy, R. W., Trépanier, T. L. & Morafka, D. J. (2006)
Conservation genetics, evolution and distinct population
segments of the Mojave fringe-toed lizard, Uma scoparia.
Journal of Arid Environments, 67, 226–247.
Nason, J. D., Hamrick, J. L. & Fleming, T. H. (2002) Historical
vicariance and postglacial colonization effects on the evolution of genetic structure in Lophocereus, a Sonoran Desert
columnar cactus. Evolution, 56, 2214–2226.
Norris, R. M. & Webb, R. W. (1990) Geology of California, 2nd
edn. John Wiley and Sons, New York.
Nunney, L. & Elam, D. R. (1994) Estimating the effective
population size of conserved populations. Conservation
Biology, 8, 175–184.
Orr, R. T. (1960) An analysis of the Recent land mammals.
Systematic Zoology, 9, 171–179.
Patton, J. L., Huckaby, D. G. & Álvarez-Castañeda, S. T. (2007)
The evolutionary history and a systematic revision of
woodrats of the Neotoma lepida group. University of
California Publications in Zoology, 135, 1–411.
Pellmyr, O. & Segraves, K. A. (2003) Pollinator divergence
within an obligate mutualism: two yucca moth species
(Lepidoptera; Prodoxidae: Tegeticula) on the Joshua tree
(Yucca brevifolia; Agavaceae). Annals of the Entomological
Society of America, 96, 716–722.
Pellmyr, O., Segraves, K. A., Althoff, D. M., Balcázar-Lara, M.
& Leebens-Mack, J. (2007) The phylogeny of yuccas.
Molecular Phylogenetics and Evolution, 43, 493–501.
Posada, D. & Crandall, K. A. (1998) MODELTEST: testing
the model of DNA substitution. Bioinformatics, 14, 817–818.
Rado, T. A. & Rowlands, P. G. (1984) A small mammal survey
and plant inventory of wetland habitats in Amargosa Canyon
and Grimshaw Lake areas of critical environmental concern.
Unpublished report, United States Department of the
Interior, Bureau of Land Management, Barstow, CA.
Ray, N., Currat, M. & Excoffier, L. (2003) Intra-deme molecular diversity in spatially expanding populations. Molecular
Biology and Evolution, 20, 76–86.
Riddle, B. R. & Hafner, D. J. (1999) Species as units of analysis
in ecology and biogeography: time to take the blinders off.
Global Ecology and Biogeography, 8, 433–441.
Riddle, B. R. & Hafner, D. J. (2006) A step-wise approach
to integrating phylogeographic and phylogenetic bioJournal of Biogeography
ª 2009 Blackwell Publishing Ltd
Phylogeography of Xerospermophilus
geographic perspectives on the history of a core North
American warm desert biota. Journal of Arid Environments,
66, 435–461.
Riddle, B. R., Hafner, D. J., Alexander, L. F. & Jaeger, J. R.
(2000a) Cryptic vicariance in the historical assembly of a
Baja California Peninsular Desert biota. Proceedings of the
National Academy of Sciences USA, 97, 14438–14443.
Riddle, B. R., Hafner, D. J. & Alexander, L. F. (2000b)
Comparative phylogeography of Bailey’s pocket mouse
(Chaetodipus baileyi) and the Peromyscus eremicus species
group: historical vicariance of the Baja California Peninsular Desert. Molecular Phylogenetics and Evolution, 17,
161–172.
Rodrı́guez, F., Oliver, J. L., Marin, A. & Medina, J. R. (1990)
The general stochastic model of nucleotide substitution.
Journal of Theoretical Biology, 142, 485–501.
Rogers, A. R. & Harpending, H. C. (1992) Population growth
makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution, 9, 552–569.
Ronquist, F. & Huelsenbeck, J. P. (2003) MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics,
19, 1572–1574.
Savage, J. M. (1960) Evolution of a peninsular herptofauna.
Systematic Zoology, 9, 184–212.
Schmidly, D. J., Wilkins, K. T. & Derr, J. N. (1993) Biogeography. Biology of the Heteromyidae (ed. by H. H. Genoways
and J. H. Brown), pp. 319–356. Special Publication No. 10,
American Society of Mammalogists. Allen Press, Lawrence,
KS.
Sharp, R. P. & Glazner, A. F. (1997) Geology underfoot in Death
Valley and Owens Valley. Mountain Press Publishing
Company, Missoula, MT.
Shreve, F. (1942) The desert vegetation of North America.
Botanical Review, 8, 195–246.
Simpson, G. G. (1960) Notes on the measurement of faunal
resemblance. American Journal of Science, 258A, 300–311.
Sissom, W. D. & Hendrixson, B. E. (2005) Scorpion biodiversity and patterns of endemism in northern Mexico.
Biodiversity, ecosystems, and conservation in Northern Mexico
(ed. by G. Ceballos, J. L. Catron and R. S. Felger), pp. 122–
137. Oxford University Press, New York.
Smith, C. I., Godsoe, W. K. W., Tank, S., Yoder, J. B. &
Pellmyr, O. (2008) Distinguishing coevolution from
covicariance in an obligate pollination mutualism: asynchronous divergence in Joshua tree and its pollinators.
Evolution, 62, 2676–2687.
Smith, G. I. & Street-Perrott, F. A. (1983) Pluvial lakes of the
western United States. Late-Quaternary environments of the
United States, Vol. 1 (ed. by H. E. Wright Jr), pp. 190–212.
Longman Group Limited, London, UK.
Smith, G. I., Bischoff, J. L. & Bradbury, J. P. (1997) Synthesis of
the paleoclimatic record from Owens Lake core OL-92.
An 800,000-year paleoclimatic record from Core OL-92,
Owens Lake, southeast California (ed. by G. I. Smith and J. L.
Bischoff), pp. 143–160. Geological Society of America Special Paper 317. Geological Society of America, Boulder, CO.
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd
Smith, M. F. & Patton, J. L. (1993) The diversification of South
American murid rodents: evidence from mitochondrial
DNA sequence data for the akodontine tribe. Biological
Journal of the Linnean Society, 50, 149–177.
Spaulding, W. G., Kowler, P. A. & Anderson, R. S. (1994) A
late Quaternary paleoenvironmental record from the central
Mojave Desert. Off limits in the Mojave Desert (ed. by
R. Reynolds), pp. 56–60. San Bernardino County Museum
Association Special Publication, Redlands, CA.
Spencer, J. E. & Pearthree, P. A. (2001) Headward erosion
versus closed-basin spillover as alternative causes of Neogene capture of the ancestral Colorado River by the Gulf of
California. The Colorado River: origin and evolution (ed. by
R. A. Young and E. E. Spamer), pp. 215–219. Grand Canyon
Association Monograph 12, Grand Canyon, AZ.
Spencer, J. E. & Pearthree, P. A. (2005) Abrupt initiation of the
Colorado River and initial incision of the Grand Canyon.
Arizona Geology, 35, 1–4.
Stebbins, R. C. (1974a) Off-road vehicles and the fragile desert:
part 1. The American Biology Teacher, 36, 203–208.
Stebbins, R. C. (1974b) Off-road vehicles and the fragile desert:
part 2. The American Biology Teacher, 36, 294–304.
Thorne, R. F. (1986) A historical sketch of the vegetation of
the Mojave and Colorado Deserts of the American
Southwest. Annals of the Missouri Botanical Gardens, 73,
642–651.
Trépanier, T. L. & Murphy, R. W. (2001) The Coachella Valley
fringe-toed lizard (Uma inornata): genetic diversity
and phylogenetic relationships of an endangered species.
Molecular Phylogenetics and Evolution, 18, 327–334.
Van Devender, T. R. & Spaulding, W. G. (1979) Development
of vegetation and climate in the southwestern United States.
Science, 204, 701–710.
Webb, R. H. & Wilshire, H. G. (1983) Environmental effects of
off-road vehicles: impacts and management in arid regions.
Springer Verlag, New York.
Wells, P. V. (1977) Postglacial origin of the Chihuahuan Desert
less than 11,500 years ago. Symposium on the Biological
Resources of the Chihuahuan Desert Region (ed. by R. H.
Wauer and D. H. Riskind), pp. 67–83. United States
Department of the Interior, National Park Service Transactions and Proceedings Series No. 3, Washington, DC.
Wells, P. V. & Berger, R. (1967) Late Pleistocene history of
coniferous woodland in the Mohave Desert. Science, 155,
1640–1647.
Wells, P. V. & Hunziker, J. H. (1976) Origin of the creosote
bush (Larrea) deserts of southwestern North America.
Annals of the Missouri Botanical Gardens, 63, 843–861.
Wells, S. G., Borwn, W. J., Enzel, Y., Anderson, R. Y. &
McFadden, L. D. (2003) Late Quaternary geology and
paleohydrology of pluvial Lake Mojave, southern California.
Paleoenvironments and paleohydrology of the Mojave and
southern Great Basin deserts (ed. by Y. Enzel, S. G. Wells and
N. Lancaster), pp. 79–114. Geological Society of America
Special Paper 368. Geological Society of America, Boulder,
CO.
15
K. C. Bell et al.
Yang, Z. (1994) Maximum likelihood phylogenetic estimation
from DNA sequences with variable rates over sites:
approximate methods. Journal of Molecular Evolution, 39,
306–314.
BIOSKETCH
Kayce Bell has a keen interest in phylogeography and is
currently employed in the Department of Zoology at the
Denver Museum of Nature and Science as a research assistant
studying the phylogeography of the genus Tamias and
host–parasite co-evolution.
Author contributions: K.B. collected field samples, collected all
molecular data, conducted data analyses and wrote the initial
draft of this publication as part of her Master’s thesis;
D.H. contributed biogeographical analyses and writing; P.L.
conducted the majority of sample collection, initiated the
study, and provided expertise on the life history of Xerospermophilus throughout; M.M designed the study, obtained
funding, and contributed to data analysis and writing.
Editor: Lawrence Heaney
APPENDIX 1
Specimens and collecting localities (latitude, longitude in
parentheses) of Xerospermophilus mohavensis and X. tereticaudus examined in this study. Field biopsies from live animals are
listed as collector numbers; samples with voucher specimens
deposited in the Museum of Southwestern Biology (MSB), the
University of New Mexico, the New Mexico Museum of
Natural History (NMMNH), or the Natural History Museum
of Los Angeles (LACM) are indicated as either skin clips (S) or
frozen liver samples (T). Sequences downloaded from GenBank are indicated by AF numbers. Principal localities within
each species are shown in bold, are listed in order of locality
number, and are shown in Fig. 2.
Xerospermophilus tereticaudus (n = 38). 1. COYOTE DRY
LAKE: California: San Bernardino Co.; Coyote Dry Lake
(35.035,)116.677), n = 1 (KCB1). 2. FORT IRWIN: California: San Bernardino Co.; Fort Irwin (35.336, )116.501), n = 5
(KCB2, KCB3, KCB4, KCB5, KCB6). 3. TWENTY-NINE
PALMS: California: San Bernardino Co.; Twenty-nine Palms
(34.216, )116.050), n = 4 (KCB7, KCB11, KCB14, KCB15).
4. JOSHUA TREE: California: Riverside Co.; Willow Hole
(33.555, )116.467), n = 5 (KCB39, KCB40, KCB42, KCB45,
KCB46). 5. BARSTOW: California: San Bernardino Co.;
12 mi. N, 13 mi. E Barstow (35.035, )116.872), n = 2 (MSB
53443 [S], 53444 [S]); 3 mi. E Daggett, 2000 ft. (34.862,
16
)116.829), n = 1, (MSB 53449 [S]). 6. AMBOY: California:
San Bernardino Co.; 1 mi. W Amboy, 615 ft. (34.558,
)115.761), n = 2 (MSB 53429 [S], 53432 [S]). 7. LUCERNE
VALLEY: California: San Bernardino Co.; 9.9 mi. E Lucerne
Valley (34.444, )116.790), n = 1 (LACM 75309 [S]).
8. TUCSON: Arizona: Pima Co.; 2 mi. E Tucson, Rillito River
(32.193, )111.148), n = 1 (LACM 19571 [S]); 18 km W
Tucson, Ryan Field (32.222, )111.118), n = 2 (AF157940,
157941). 9. MERCURY: Nevada: Nye Co.; 8 mi. N, 21.75 mi.
W Mercury (36.777, )116.385), n = 1 (LACM 44651 [S]).
10. PUERTO PEÑASCO: Mexico: Sonora; 3.9 mi. NE Puerto
Peñasco (31.357, )113.497), n = 2, (MSB 41667 [S], 41670
[T]). 11. PUNTA CHUECA: Mexico: Sonora; 8 km N, 10 km
E Punta Chueca (29.087, )112.071), n = 1 (MSB 83780 [T]);
8 km N, 7 km E Punta Chueca (29.087, )112.098), n = 2
(MSB 83741 [T], 83742 [T]). 12. NAVOJOA: Mexico: Sonora;
15 km S Navojoa (26.383, )108.650), n = 2 (NMMNH 2702
[T], 2751 [T]). 13. SAN FELIPE: Mexico: Baja California;
11 mi. N, 4 mi. W San Felipe (31.130, )114.949), n = 4 (MSB
40141 [S], 40143 [S], 40144 [S], 40902 [T]). 14. VALLE DE LA
TRINIDAD: Mexico: Baja California; 8 mi. S, 9 mi. E Valle de
la Trinidad (31.251, )115.581), n = 1 (MSB 40284 [S]); 5 mi.
S, 10 mi. E Valle de la Trinidad (31.294, )115.564), n = 1,
(MSB 40906 [S]).
Xerospermophilus mohavensis (n = 46). 15. CACTUS PEAK:
California: Inyo Co.; Cactus Peak (36.078, )117.815), n = 5
(CP2B3E, CP045C, E45, D0A, D47). 16. COSO BASIN:
California: Inyo Co.; Coso Basin (35.921, )117.730), n = 4
(CB6560, 7E30, 5F12, CB533). 17. OLANCHA: California:
Inyo Co.; Olancha (36.282, )118.006), n = 5 (A25G3, A24G4,
B06G2, B13G2, C11G1). 18. FREEMAN GULCH: California:
Kern Co.; Freeman Gulch (35.551, )117.875), n = 6 (FG4,
FG6171, FG4944, 6E2B, 4F36, 4D2E). 19. DESERT TORTOISE NATURAL AREA: California: Kern Co.; Desert Tortoise Natural Area (35.218, )117.887), n = 2 (D6A, 7A05).
20. EDWARDS AIR FORCE BASE: California: Kern Co.;
Edwards Air Force Base (34.926, )117.934), n = 2 (600A,
2801). 21. COOLGARDIE MESA: California: San Bernardino
Co.; Coolgardie Mesa (35.106, )116.956), n = 6 (2918, 4900,
2D74, 5236, 5C7E, 0855). 22. PALMDALE: California: Los
Angeles Co.; Palmdale (34.579, )18.116), n = 2 (LACM 3009
[S], 3010 [S]); 3 mi. W Hi Vista (34.735, )117.831), n = 1,
(LACM 47348 [S]). 23. JOHANNESBURG: California: San
Bernardino Co.; 9 mi. NNE Johannesburg (35.474, )117.590),
n = 8 (MSB 40494 [S], 40495 [S], 40496 [T], 40498 [S], 40499
[T], 40510 [T], AF157925, 157928). 24. HELENDALE: California: San Bernardino Co.; 1.7 mi. N, 1.3 mi. W Helendale,
2600 ft. (34.768, )117.344), n = 2 (MSB 53419 [S], 53420 [S]).
25. KRAMER JUNCTION: California: San Bernardino Co.;
1 mi. N, 1 mi. W Kramer Junction (35.079, )117.303), n = 3
(LACM 74975 [T], 74977 [T], 74978 [T]).
Journal of Biogeography
ª 2009 Blackwell Publishing Ltd