610 Chiang Mai J. Sci. 2012; 39(4) Chiang Mai J. Sci. 2012; 39(4) : 610-622 http://it.science.cmu.ac.th/ejournal/ Contributed Paper Preparation and Performance Test of a Simplified Screen-Printed Carbon Electrode for Use as a Chronoamperometric Transducer in Genosensor Low Kim Fatt [a], Kritsanaporn Chuenrangsikul [b], Patsamon Rijiravanich [b], Werasak Surareungchai [b] and Chan Yean Yean*[a] [a] Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia, Kubang Kerian 16150, Kelantan, Malaysia. [b] School of Bioresources and Technology, King Mongkut’s University of Technology Thonburi, Bangkhuntien, Bangkok 10150, Thailand. *Author for correspondence; e-mail: [email protected] Received: 22 August 2011 Accepted: 24 June 2012 ABSTRACT In this work, a simplified two-electrode configuration metal-free screen-printed carbon electrode (2-MFSPCE) was fabricated in-house and electrochemically evaluated. The electrode performance of the 2-MFSPCE was preliminary characterized with ferricyanide by using cyclic voltammetry (CV). The electroactivity of TMB (3,3’,5,5’tetramethylbenzidine) substrate on 2-MFSPCE was studied before the development of a Horseradish peroxidase (HRP) enzyme-based electrochemical genosensor detection platform for specific 40 mer-synthetic target DNA sequence from food-borne pathogen, Vibrio cholerae lolB gene. The CV results showed that the electron transfer/conductivity on 2-MFSPCE was highly consistent and stable without any significant shifting. In addition, there was good electrochemical reproducibility that all individual 2-MFSPCE (within and between batches of fabrication) showed relative low variation in electroanalysis. A detection potential (reduction potential) of -0.1 V was empirically determined on 2-MFSPCE for enzymatic product from HRP/TMB catalytic reaction. By using two-step sandwich-type hybridization strategy, the chronoamperometric analysis of the enzyme-based electrochemical genosensor with 2-MFSPCE as transducer bestowed a detection limit of 5 fM of target sequence. The encouraging results obtained from the electrochemical characterization and the well response in electrochemical genosensor study indicating the feasibility of this 2-MFSPCE to use as a low-cost disposable electrode in electrochemical sensor application. Keywords: two-electrode configuration, metal-free screen-printed carbon electrode, enzyme-based electrochemical genosensor, sandwich-typed hybridization 1. INTRODUCTION Biosensors are self-contained integrated devices that use a biological recognition element (e.g., nucleic acids, antibodies, cells, enzymes or aptamers) that is in direct spatial Chiang Mai J. Sci. 2012; 39(4) contact with a transduction element, to interact with the compound of interest. The interaction or recognition event is then converted into a measurable analytical signal. Genosensors are DNA-based biosensors that exploit immobilized single-stranded DNA (ssDNA) or DNA probes as the biological recognition elements to detect the presence of complementary target DNA sequences through the formation of DNA probe-target hybrids [1]. Although there are many genosensor transduction methods that are based on optical [2], piezoelectric [3] or electrochemical [4, 5] principles, the latter method has properties that make it superior to others. Electrochemical biosensors are noted for their rapid and sensitive detection (independent of sample turbidity), ease of manipulation, inexpensive cost, and their compatibility with mass fabrication and miniaturization technologies. All these features make them a promising option for point-of-care diagnosis. The first electrochemical genosensor was introduced at 1993 by Millan and Mikkelsen [6]. There is currently intensive demand for disposable screen-printed electrode (SPE) particularly in applications related to development of the electrochemical biosensor [7]. Uneconomic use of commercialized SPE in biosensor research and the need in industry for novel products has led many researches in this field of study to use SPE made in-house for the development of prototype biosensors; such SPE is cheaper to produce and researchers have the ability to manipulate the SPE configuration according to their own need. Therefore, the in-house production of SPE is an appropriate choice for research and commercial purposes. In contrast to conventional three- 611 electrode SPE that with metal elements (gold, silver, platinum, etc.) as the reference and/or counter electrode, in this study a simplified two-electrode configuration metal-free screen-printed carbon electrode (2-MFSPCE) consisting of a carbon working electrode and a carbon combined reference and counter electrode was made in-house. The use of carbon ink has advantage of high chemical inertness, which makes it compatible with the use of strong chemical reagents and means that a range of working potential can be applied on the electrode surface. In addition, the simplified design of 2-MFSPCE makes it simple and quick to make, thus decreasing its production costs. The two-electrode configuration also enables small size electrodes to be made, which will significantly reduce the sample volume required. The aims of this current study were to characterize and explore electrochemically the possibility of using this simplified 2-MFSPCE for the development of a DNA-based electrochemical detection platform. The lolB gene of the food-borne pathogen, Vibrio cholerae was used as model of investigation. This sequence of gene is highly conserved within Vibrio cholerae species, which enables this organism to be discriminated from other Vibrio species and enteric bacteria [8]. 2. MATERIALS AND METHODS 2.1 Materials All DNA sequences used in this study were synthesized by First BASE Laboratories Sdn Bhd (Selangor, Malaysia) using phosphoramidite chemistry and provided in lyophilized form. Reconstitutions, stock aliquots (20 μM) and working solutions were made in type 1 ultrapure water (UPW) and stored at - 20°C. The DNA sequences were as follows: 612 - Capture probe (biotinylated), 20 mer: • (Biotin) 5’ ATGAATGCTCTCGTA CGTCG 3’ - Synthetic target, 40 mer: • 5’GAGTGACTTGGTGTGATTG CTGGCAGTAGGCGACGTACG A 3’ - Non cognate, 40 mer: • 5’ACATTGACGGGTTGTAGCG GTGCGGTGGCACAACCTGC CA 3’ - Detection probe (Digoxegenin-labeled) , 20 mer: • 5’ GCAATCACACCAAGTCACTC 3’ (Dig) Potassium ferricyanide, K 3Fe(CN) 6 was purchased from MERCK (Darmstadt, Germany). Potassium chloride (KCl), ExtrAvidin ® ,1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS), bovine serum albumin (BSA) and ethanolamine chloride were purchased from Sigma (Missouri, USA). Ready-touse TMB (3,3’,5,5’-tetramethylbenzidine) substrates and Horseradish peroxidase-linked anti-Digoxigenin antibody (anti-DIG-HRP) were purchased from Promega (Wisconsin, Figure 1. Configuration of 2-MFSPCE. Chiang Mai J. Sci. 2012; 39(4) USA) and Roche (Mannheim, Germany), respectively. The working solutions for all reagents mentioned above were prepared using UPW that was obtained from PURELAB Option Q-7BP MK 1 purification system (ELGA, Lane End, UK). 2.2 Apparatus All electroanalytical measurements were performed using μAUTOLAB (III) electrochemical potentiostat/galvanostat (Eco Chemie, Utrecht, The Netherlands) with controlling software GPES version 4.9. The 2-MFSPCE was fabricated using a semi-automated screen-printing machine (model 248.CERD, DEK, Zurich, Switzerland) and its structure is shown in Figure 1. First, carbon ink type 145 (MCA Services, Meldreth, UK) mixed with the solvent propylene glycol diacetate (Aldrich, Wisconsin, USA) in a 5:1 ratio (w/w) was screen-printed onto a plain sheet of printing substrate (PVC sheets, 150 mm × 200 mm) to give an array of 24 screen-printed electrodes with each consisting of two carbon electrodes with the same composition. An insulating layer (a mixture of dielectric Chiang Mai J. Sci. 2012; 39(4) ink and solvent) was then screen-printed over the sheet of printing substrate containing the two carbon electrodes to define one area for electrical contact and another as a sensing area; the latter consisted of a working electrode (with area 1.5 mm × 3.5 mm) and a combined reference and counter electrode (with area 2 mm × 3.5 mm). There were 2030 sheets of 2-MFSPCEs printed in each batch. After screen-printing, the 2-MFSPCEs sheets were cured overnight in an oven at 55°C and then allowed to cool at room temperature. Individual 2-MFSPCEs were obtained by cutting them from the printing substrate. 2.3 Electrochemical Characterization of 2-MFSPCE The electrochemical performance of the fabricated 2-MFSPCE was assessed by cyclic voltammetry (CV) using K3Fe(CN)6 with KCl as supporting electrolyte. First, 2-MFSPCE was pre-washed by applying 100 ml of UPW onto the sensing area (covering both the electrode surfaces) and leaving for at least 2 min to make the electrode surfaces wet and more hydrophilic. The UPW was then pipetted off and without allowing the electrode surfaces to dry, 50 ml of a freshly prepared 1 mM K3Fe(CN)6/0.1 M KCl solution was deposited onto the sensing area. The CV analysis was begun with the potential ramped (staircase, 5mV step potential) from 0.6 to -0.6 V and then reversed back to 0.6 V for a cycle; with a scan rate of 50 mV/s. 2.4 Electrochemical Study of TMB on 2-MFSPCE 2.4.1 Voltammetric study of TMB The CV analysis of TMB (50 μl in volume on sensing area of 2-MFSPCE) was performed at a scan rate of 50 mV/s. An initial pretreatment potential of -1.8 V 613 was applied for 30 sec; the CV was then scanned (staircase, 5mV step potential) from potential of -1.8 V to 1.8 V and reversed back to -1.8 V. 2.4.2 Chronoamperometric Study of HRP/TMB Reaction One microliter of HRP solution (anti-DIG-HRP) was added to a 20 μl of TMB on sensing area of 2-MFSPCE. The mixture was gently mixed using a pipette and subjected to 5 sec incubation at 0 V standby potential followed by chronoamperometry measurement at -0.1 V for 60 sec with an interval time of 0.2 sec. The current value at the end of the measurement period was recorded for data analysis. 2.5 Electrochemical Genosensor Study on 2-MFSPCE An enzyme-based electrochemical genosensor was set up using 2-MFSPCE with schematic plan shown at Figure 2. Initially, ExtrAvidin® (10 μl, 0.05 mg/ml, 10 min) was coated onto the sensing area of 2-MFSPCE after surface activation using EDC/NHS covalent agent (10 μl, a mixture of 0.2 M EDC and 0.05 M NHS, 10 min), followed by treatment with ethanolamine chloride (50 μl, 1 M, pH 8.5, 10 min in dark) and BSA (50 μ l, 3% w/v, 10 min). A sandwich-typed hybridization strategy using a pair of DNA probes (1 μM of capture probe and 1 μM of detection probe) was employed for specific detection of synthetic target sequence. The sandwich-type hybridization of target sequence was a two-step strategy in which the capture probe (10 μl, 20 min) was firstly immobilized onto the ExtrAvidin®-coated sensing area to form a biorecognition layer on 2-MFSPCE and subsequently, the target sequence-detection probe hybrid (10 μl, 20 min) that was prepared in PCR tube was deposited onto 614 Chiang Mai J. Sci. 2012; 39(4) Figure 2. Schematic diagram for an enzyme-based electrochemical genosensor on a 2-MFSPCE. the biorecognition layer. The hybridization redox peaks observed after each cycle of event was tagged with antiDig-HRP (5 μl, CV scanning and if all the ten cyclic 750 mU/ml containing 0.025% of BSA, voltammograms were superimposed on 10 min) and a 20 μl of TMB was subsequently each others, they were all similar with little deposited onto the sensing area, gently variation between them (data not shown). mixed using a pipette and subjected to This experiment was carried out on five chronoamperometry measurement with randomly selected 2-MFSPCEs and the mean values of ∆Ep (peak separation procedure as described in section 2.4.2. All experiments detailed in Sections 2.3, potential values) and Ipc/Ipa (cathodic/ 2.4 and 2.5 were carried out at room anodic peak current) from ten cycles of CV scanning for each 2-MFSPCE are shown temperature. in Table 1. The low RSD values of ∆Ep and Ipc/Ipa for each 2-MFSPCE ranging 3. RESULTS AND DISCUSSION 3.1 Electrochemical Characterization of from 0.97% to 3.16% and 0.59% to 1.73%, respectively, indicate that the electron transfer/ 2-MFSPCE 2-MFSPCEs were made in-house and conductivity on 2-MFSPCE was consistent their electroactivities were characterized and stable along the electroanalysis. The use of a two-electrode configuration by studying their CV behavior towards with combined reference and counter K3Fe(CN)6 redox species. electrode in the 2-MFSPCE could have a 3.1.1 Stability of Electron Transfer/ disadvantage in that it is difficult to control the potential between the working and Conductivity The K 3Fe(CN) 6/KCl solution was reference electrodes. However, it was shown scanned for ten cycles on individual in this study the electron transfer/conductivity 2-MFSPCE to study the stability of electron on 2-MFSPCE was consistent without any transfer. There were a pair of well-defined significant shifting throughout the CV Chiang Mai J. Sci. 2012; 39(4) scanning in cycles, indicating that there is a good, stable control of the potential between both electrodes of the 2-MFSPCE. Table 1. Mean values of ∆Ep and Ipc/Ipa from CV analysis of 1 mM K3Fe(CN)6/0.1 M KCl on five randomly selected 2MFSPCEs. All mean values are calculated from the ten CVs that were scanned for each 2-MFSPCE. Mean ± SD (%RSD) Ipc/Ipa Electrode ∆Ep(mV) 1 2 3 4 5 239.10±5.587 (2.337) 239.60±6.257 (2.612) 257.70±2.497 (0.969) 278.50±3.689 (1.325) 229.50±7.246 (3.157) 1.065±0.008 (0.718) 1.051±0.006 (0.588) 1.055±0.007 (0.643) 1.044±0.011 (1.060) 1.051±0.018 (1.726) 3.1.2 Redox Behavior of Ferricyanide on 2-MFSPCE The CV analysis of the benchmark redox species, ferricyanide, on the 2-MFSPCE produced well-defined redox peaks (data not shown) with the Ipc/Ipa value remaining near unity (~1) (Table 1) as expected for reaction of reversible species on electrodes. Nonetheless, the ∆Ep of the ferricyanide redox process on the 2-MFSPCE ranged from 229.50 ± 7.246 mV to 278.50 ± 3.689 mV (Table 1), which are significantly different from the ideal Nernstian value of 57 mV for a single-electron transfer redox process. This suggests that the redox behavior of ferricyanide on the 2-MFSPCE is quasi-reversible [9]. To characterize the electrode reaction of ferricyanide on the 2-MFSPCE, a K3Fe(CN)6/ KCl solution was analyzed by CV on 2-MFSPCE with a scan rate that varied from 615 5 to 250 mV/s (Figure 3(a)). According to Randle-Sevcik relationship [10], it is reasonable to say that the reduction of ferricyanide to ferricyanide {Fe(CN)63- + e- → Fe(CN)64- } on the working electrode surface of 2-MFSPCE is under diffusion control [11], as there is a linear relationship between Ipc (cathodic peak current) and the square root of the scan rate as shown in Figure 3(b). For a reversible redox process with a high rate of electron transfer at the electrode surface, the peak potential values (Ep) and Ipc/Ipa (=1) are independent of the scan rate and the ∆Ep will be equal to 57 mV. In this study, the mean Ipc/Ipa for all scan rates was 1.075 ± 0.072, which is almost equal to unity and meets the requirement for a reversible redox process on the electrode surface. The ∆Ep, however, is far from ideal and increases with a higher scan rate (Figure 3), indicating the process is limited by electron transfer kinetics [12]. There are many possible reasons for the poor electron transferability. The most probable one is that the 2-MFSPCE has relatively reduced surface roughness with low amount of exposed edge plane-like sites/defects, which alone determine the process of electron transfer on graphite electrodes [10]. The reduced surface roughness might be due to the polymeric binder (most are insulating materials) used in carbon ink formulation occupies the gaps between graphite particles, subsequently leading to slow electron transfer rates [13]. Another possible reason for the slow electron transfer rate is the resistive properties of the carbon ink that was used as conducting material for the electrodes and conducting path of the 2-MFSPCE [14]. An experiment was conducted to compare the 2-MFSPCE’s electroactivity with a commercial carbon SPE that was used in previous work [15]. The commercial carbon Chiang Mai J. Sci. 2012; 39(4) Ipc(-l, μA) Current (μA) 616 Potential (V) (a) (sc an rate)1/2(mV/s)1/2 (b) Figure 3. (a) Cyclic voltammograms for a 1 mM K3Fe(CN)6/0.1 M KCl solution on 2-MFSPCE at different scan rate (1-7): 5, 10, 50, 100, 150, 200 and 250 mV/s, respectively. (b) Correlation between Ipc and the square root of scan rate. SPCE has a conventional three-electrode configuration and with Ag/AgCl ink screen-printed as the conducting paths for all the three carbon electrodes. The ∆Ep values (n=5) for 2-MFSPCE and commercial carbon SPE were 227.62 ± 10.356 mV (RSD 4.55%) and 248.60 ± 11.971 mV (RSD 4.82%), respectively; where as the Ipc/Ipa values were 1.062 ± 0.024 (RSD 2.27%) and 1.315 ± 0.234 (RSD 17.82%), respectively. The 2-MFSPCE exhibited better electroactivity in which the ∆Ep and Ipc/Ipa have a lower RSD and were closer to the values of an ideal reversible redox process. 3.1.3 Reproducibility of 2-MFSPCE The 2-MFSPCE in this study was made in batches of 20-30 sheets of printing substrate, with each sheet comprising 24 individual 2-MFSPCEs. In terms of sensors development, reproducibility is one of the main problems, especially when components made in-house are used. Therefore, the reproducibility of 2-MFSPCE within and between batches was explored by CV analysis of a K3Fe(CN)6/KCl solution and the results obtained are shown in Table 2. The non-parametric Kruskal-Wallis statistical test (for both the within and between batch evaluations) demonstrates that the P values for Ipc, Ipa (anodic peak current), Epc (cathodic peak potential), Epa (anodic peak potential), ∆Ep and Ipc/Ipa from both evaluations were more than the significance level stipulated. This indicates that all the null hypotheses could not be rejected and that the values of Ipc, Ipa, Epc, Epa, ∆Ep and Ipc/Ipa for 2-MFSPCE from respective evaluations are not significantly different from each other. Therefore, there is good reproducibility for 2-MFSPCE within and between batches. Having ascertained their reproducibility, the 2-MFSPCE was used for further studies in anticipation of producing accurate and reliable sensing platforms. 3.2 Electrochemical Study of TMB on 2-MFSPCE 3.2.1 Voltammetric study of TMB on 2-MFSPCEs Screen-printed electrodes with different structural designs, electrode materials and electrode curing methods will have dissimilar electrochemical performances. Therefore, the electroactivity of TMB on 2-MFSPCE was studied. In the presence of TMB and hydrogen peroxide (H2O2), HRP enzyme will catalyze the oxidation of TMB with H2O2 being Chiang Mai J. Sci. 2012; 39(4) 617 Table 2. Reproducibility of 2-MFSPCE. Within-batch evaluationa Ipc Ipa Epc (-1, μA) (μA) (-1,V) Epa (V) P valuec 0.139 Ipc/Ipa ∆Ep (EPA-EPC) (mV) b Overall (n = 9)1.620±0.115 1.512±0.111 0.129±0.008 0.111±0.011 239.556±19.603 1.072±0.031 RSD (%) 7.126 7.362 6.598 10.280 8.183 2.864 0.141 0.151 0.236 Between-batch evaluationd Ipc (-1, μA) Ipa (μA) Epc (-1,V) Epa (V) P valuec 0.027 0.033 0.034 0.209 0.132 Ipc/Ipa ∆Ep (EPA-EPC) (mV) e Overall (n = 9)1.669±0.151 1.575±0.147 0.128±0.014 0.111±0.012 238.778±25.553 1.061±0.027 RSD (%) 9.053 9.315 10.741 11.051 10.701 2.511 0.027 0.031 0.837 2-MFSPCEs from different sheets of printing substrate from a batch of screen-printing All data are given as mean ± SD obtained from nine 2-MFSPCEs (three random 2-MFSPCEs were selected from three different sheets of printing substrate, respectively) c Kruskal-Wallis statistical tests. The significance level is 0.025 d 2-MFSPCEs from three different batches of screen-printing e All data are given as mean ± SD obtained from nine 2-MFSPCEs (three random 2-MFSPCEs were selected from three batches of screen printing, respectively) a b reduced (oxidizing agent) [16, 17]. This yields colored oxidized TMB products, which are measurable using spectrophotometry or an electrochemical analytical method. The latter approach provides more rapid and sensitive detection. To detect the oxidized TMB products (which are proportional to the HRP catalytic activities) chronoamperometrically, a reduction potential (detection potential) was determined. With the reduction potential applied, the oxidized TMB products were reduced and the current produced measured. TMB is a molecule with redox properties and this behavior is easily recorded using CV electroanalytical methods. The reduction potential for oxidized TMB can be estimated from the resulting cyclic voltammogram obtained. Within the CV potential window, there was a pair of well-defined redox peaks observed in the range of -0.8 to 0.8 V as shown in Figure 4(a). At the scan rate of 50 mV/s, the Ipc, Ipa, Epc, Epa, ∆Ep and Ipc/Ipa values on different 2-MFSPCE (n = 3) were -3.256 ± 0.027 μA (RSD 0.81%), 3.278 ± 0.070 μA (RSD 2.15%), -0.073 ± 0.003 V (RSD 3.97%), 0.083 ± 0.003 V (RSD 3.46%), 156 ± 0.00 mV (RSD 0.00%) and 0.994 ± 0.016 (RSD 1.64%), respectively. The low RSD values indicate the good reproducibility of the results. The effect of different scan rates ranging from 10-200 mV/s on the CV behavior of TMB was investigated using 2-MFSPCE and the results are shown in Figure 4(a). The Ipc was found to increase with increasing scan rate and the plot of 618 values of Ipc versus square root of the scan rates yielded a linear relationship (data not shown) with a correlation coefficient, r of 0.973, indicating a diffusion-controlled electrode process [11, 18, 19]. Chiang Mai J. Sci. 2012; 39(4) 3.2.2 Chronoamperometric Study of HRP/TMB Reaction The CV analysis detailed in Section 3.2.1 revealed that the Epc for the TMB on 2-MFSPCE to be -0.073 ± 0.003 V. A Figure 4. (a) Cyclic voltammograms for a 50 μl of TMB solution on 2-MFSPCE at different scan rate (1-6): 10, 25, 50, 75, 100 and 200 mV/s. (b) Chronoamperometry analysis of the HRP-TMB reaction with a reduction potential of -0.1 V on 2-MFSPCE. One microliter of anti-DIG-HRP with different concentration ranging from 0-187.5 mU/ml was added to 20 μl TMB. Mean ± SD (n = 3). potential value of -0.1 V which is higher than -0.073 ± 0.003 V was applied as the reduction potential in chronoamperometry protocol and was expected to causes immediate and complete reduction of any oxidized TMB products generated from HRP catalytic reaction at the working electrode surface. A low analytical potential value (-0.1 V in this study) was applied to avoid any interfering signal during measurement. Chronoamperometry experiments were conducted to analyze the electroactivity of the HRP-TMB reaction on 2-MFSPCE by using -0.1 V as the detection potential (reduction potential). Figure 4(b) shows the results obtained. The absence of HRP in the reaction produced negligible background current signal and increased accordingly (r = 0.9955) with the presence of different concentration of HRP in the range of 0-187.5 mU/ml. The well response of 2-MFSPCE to different concentration of HRP indicating the 2-MFSPCE has no problem in potential control and detection of current signal. 3.3 The Set-up of Enzyme-Based Electrochemical Genosensor Using 2-MFSPCE In this study, the sandwich-type double hybridization using two DNA probes with 20 mer in length conferred a high specificity for the detection of target sequence. All DNA sequences used in this study were designed based on the Vibrio cholerae lolB gene. Initially, ExtrAvidin® was coated onto the EDC/NHS-activated sensing area (covering both the electrode surfaces of 2-MFSPCE), followed by treatment with ethanolamine chloride and BSA as described in Section 2.4.2. ExtrAvidin® is a deglycosylated biotin-binding protein prepared from egg white avidin. It is an excellent alternative to avidin and streptavidin because it has fewer non-specific binding properties compared with avidin and is cheaper than streptavidin [20]. The immobilization of ExtrAvidin® onto the electrode surfaces was occurred by two Chiang Mai J. Sci. 2012; 39(4) mechanisms: (1) covalent binding through the EDC/NHS activated carboxyl groups on the electrode surfaces, and (2) passive adsorption onto the electrode surfaces [21]. In this study, the biorecognition layer was formed on both the working and combined reference and counter electrodes to increase the number of recognition elements for detection of target DNA sequence; this consequently improved the sensitivity of the experiment. Three different strategies of sandwichtype hybridization were investigated. In a one-step sandwich-type hybridization strategy, all three components [capture probe, synthetic target sequence and detection probe] were mixed together in a 0.5 ml PCR tube with a concentration of 1 μM, 0.5 μM and 1 μM, respectively. The reaction mixture was incubated for 1 h at room temperature. The hybrid formed was then deposited onto the ExtrAvidin® coated layer on both the electrode surfaces of 2-MFSPCE and incubated for 20 min at room temperature. Non-binding components were then washed off the electrode surfaces using washing buffer. The biotin from the hybrid interacted with the ExtrAvidin ® at the electrode surfaces. By contrast, in a two-step sandwich-type hybridization strategy, 1 μM of biotinylated capture probe was first immobilized by incubation for 20 min at room temperature onto the ExtrAvidin ®-coated electrode surfaces to form a biorecognition layer. The synthetic target sequence-detection probe hybrid was then prepared in PCR tube with a concentration of 0.5 μM and 1 μM, respectively; and incubated for 1 h at room temperature. The hybrid was then deposited onto the biorecognition layer of both electrode surfaces of the 2-MFSPCE and incubated for 20 min at room temperature. 619 Lastly, in a three-step sandwich-type hybridization strategy, the capture probe, synthetic target sequence and detection probe were prepared individually in PCR tubes with a concentration of 1 μM, 0.5 μM and 1 μ M, respectively, and deposited sequentially onto the ExtrAvidin®-coated layer on both electrode surfaces of the 2-MFSPCE. Each DNA component on the electrode surfaces was incubated for 20 min and the unbound sequence was removed by washing buffer before proceeding to the next stage. The hybrids from all these three strategies were then tagged with anti-DIGHRP, followed by chronoamperometry analysis with 20 μl of TMB. A background signal using UPW containing no target sequence was used as a negative control and results are shown in Figure 5. After comparison, there was no significant difference in results of the three strategies, however, the two-step sandwich-type hybridization method showed the most reproducible results with the lowest RSD values, and therefore chosen for the procedures that followed. Using the two-step sandwich-type hybridization strategy, the electrochemical genosensor formed on the 2-MFSPCE was challenged with different concentrations of target sequence and the results shown in Figure 6(a). The current signals for 0.5 μM, 5 nM, 0.5 pM and 5 fM of target sequence were higher than the background (UPW) and with the presence of 1 μM of noncognate synthetic DNA sequence. Thus, the electrochemical genosensor used in this study was able to detect amounts as low as 10 μl of 5 fM target sequence (or equal to 6.24 fg, with 40 mer in length). In addition, there is a linear relationship between the current signal and ST1 concentration between 5 fM and 0.5 μM with the following equation: 620 Chiang Mai J. Sci. 2012; 39(4) Figure 5. The chronoamperometry analysis of an enzyme-based electrochemical genosensor using three different sandwich-type hybridization strategies on 2-MFSPCE. Chronoamperometry was performed at 0 V standby potential for 5 sec and followed by a -0.1 V reduction potential for 60 sec with an interval time of 0.2 sec. Mean ± SD (n =3). 0 Current (-1, nA) 1000.00 764.50 800.00 633.70 600.00 400.00 441.33 226.70 295.00 200.00 0.00 UPW 1.0 μM 0.5 μM 5.0 nM 0.5 pM 5.0 fM NC TS TS TS TS (a) WE(l).Potential(V) 1066.67 1200.00 -0.02 -0.04 -0.06 -0.08 Potential control at -0.1V -0.1 20 40 60 Time (s) (b) (b) Figure 6. (a) The chronoamperometry analysis of an enzyme-based electrochemical genosensor using a two-step sandwich-type hybridization strategy on 2-MFSPCE. Different concentrations of target sequence (TS) were used to evaluate the genosensor. UPW is the background signal and NC is a non-cognate sequence. Mean ± SD (n = 3). (b) Potential control (5 sec incubation at standby potential of 0 V and followed by chronoamperometry measurement at -0.1 V for 60 sec) during electrochemical genosensor detection of target DNA sequence. -(y) (nA) = 69.074x + 401.97; r = 0.96 Where x is the log concentration (fM) of synthetic target; y is the current signal In order to prove that the deposition of reagents on the combined reference and counter electrodes didn’t affect the maintenance of a constant potential, an electrochemical genosensor experiment was repeated using a potentiostat controlling software-NOVA 1.6 from Eco Chemie (Utrecht, The Netherlands). This software allows users to observe the potential applied during the measurement of current produced in amperometry analysis. Figure 6(b) shows the potential control observed during the chronoamperometry detection of target DNA sequences on 2-MFSPCE. The potential applied is stable and constant along the process of electroanalysis. Chiang Mai J. Sci. 2012; 39(4) 4. CONCLUSIONS The current study showed that 2-MFSPCE with a simplified two-electrode configuration (a carbon working electrode and a carbon combined reference and counter electrode), which is cheaper and easier to be fabricated, can be used efficiently as a transducer for genosensor applications. All 2-MFSPCE tested in the study showed high consistency in terms of their electron transfer/conductivity, implying a stable electrode surface structure and a good stability in controlling of potential between both electrodes of the 2-MFSPCE. In addition, all individual 2-MFSPCE displayed good reproducibility, with no significant batch-to-batch variation. This is an important characteristic that is essential in electrochemical analyses using screen-printed electrodes. The 2-MFSPCE used as HRP enzymebased electrochemical genosensors and analyzed using chronoamperometry revealed the lowest detection limit on 2-MFSPCE to be 10 μl of 5 fM synthetic target sequence (or equal to 6.24 fg, with 40 mer in length). The encouraging performance of 2-MFSPCE indicates their suitability for use as a cost-effective disposable electrode in electrochemical sensor applications; and with the inherent favorable characteristics possessed; 2-MFSPCE can be an alternative choice for researchers with particular needs on SPE. ACKNOWLEDGEMENTS The authors thank the research funding support in form of Research University (RU) grant (grant no: 1001/ PPSP/813020) from Universiti Sains Malaysia (USM), Malaysia. In addition, support from Institute of Postgraduate Studies (IPS), Universiti Sains Malaysia (USM) in the form of graduate 621 fellowship for Low Kim Fatt is gratefully acknowledged. REFERENCES [1] Teles F.R.R. and Fonseca L.P., Trends in DNA biosensors, Talanta, 2008; 77: 606-623. [2] Endo T., Kerman K., Nagatani N., Takamura Y. and Tamiya E., Labelfree detection of peptide nucleic acidDNA hybridization using localized surface plasmon resonance based optical biosensor, Anal. Chem., 2005; 77: 6976-6984. [3] Lucarelli F., Tombelli S., Minunni M., Marrazza G. and Mascini M., Electrochemical and piezoelectric DNA biosensors for hybridisation detection, Analytica Chimica Acta, 2008; 609: 139-159. [4] Lai R.Y., Lagally E.T., Lee S.H., Soh H.T., Plaxco K.W. and Heeger A.J., Rapid, sequence-specific detection of unpurified PCR amplicons via a reusable, electrochemical sensor, Proc. Natl. Acad. Sci. USA., 2006; 103: 4017-4021. [5] Mix M., Reske T., Duwensee H. and Flechsig G.U., Electrochemical detection of asymmetric PCR products by labeling with osmium tetroxide, Electroanalysis, 2009; 21: 826-830. [6] Kerman K., Kobayashi M. and Tamiya E., Recent trends in electrochemical DNA biosensor technology, Meas. Sci. Technol., 2004; 15: R1-R11. [7] Jubete E., Loaiza O.A., Ochoteco E., Pomposo J.A., Grande H. and Rodr -guez, Nanotechnology: A tool for improved performance on electrochemical screen-printed (Bio) sensors, J. Sens., 2009: 1-13. 622 [8] Lalitha P., Siti Suraiya M.N., Lim K.L., Lee S.Y., Nur Haslindawaty A.R., Chan Y.Y., Ismail A., Zainuddin Z.F. and Ravichandran M., Analysis of lol B gene sequence and its use in the development of a PCR assay for the detection of Vibrio cholerae, J. Microbiol. Methods, 2008; 75: 142-144. [9] Crew A., Alford C., Cowell D.C.C. and Hart J.P., Development of a novel electrochemical immuno-assay using a screen printed electrode for the determination of secretory immunoglobulin A in human sweat, Electrochim. Acta, 2007; 52: 52325237. [10] Kadara R.O., Jenkinson N. and Banks C.E., Characterisation of commercially available electrochemical sensing platforms, Sens. Actuator BChem., 2009; 138: 556-562. [11] Liu C.C., Electrochemical Sensors, 2nd Edn., The Biomedical Engineering Handbook, CRC Press LLC, 2000. [12] Sabzi R.E., Amperometric detection of nitrite on glassy carbon electrode modified with cobalt nitroprusside, Portugaliae Electrochim. Acta, 2007; 25: 383-390. [13] Grennan K., Killard A.J. and Smyth M.R., Physical characterizations of a screen-printed electrode for use in an amperometric biosensor system, Electroanalysis, 2001; 13: 745-750. [14] Morrin A., Killard A.J. and Smyth M.R., Electrochemical characterization of commercial and home-made screen-printed carbon electrodes, Anal. Lett., 2003; 36: 2021-2039. [15] Yean C.Y., Kamarudin B., Ozkan D.A., Yin L.S., Lalitha P., Ismail A., Ozsoz M. and Ravichandran M., Enzyme-linked amperometric electrochemical genosensor assay for Chiang Mai J. Sci. 2012; 39(4) the detection of PCR amplicons on a streptavidin-treated screen-printed carbon electrode, Anal. Chem., 2008; 80: 2774-2779. [16] Fanjul-Bolado P., Gonz lez-Garc a M.B. and Costa-Garc -a A., Amperometric detection in TMB/ HRP-based assays, Anal. Bioanal. Chem., 2005; 382: 297-302. [17] Shakeela S., Ram B.S. and Sekaran C.B., Application of horseradish peroxidase mediated oxidative coupling reaction for the determination of mesalazine, Chiang Mai J. Sci., 2011; 38(4): 551-559. [18] Nagappa L.T., Shankar N.P. and Jaldappagari S., Electrochemical studies of nevirapine, an anti-HIV drug, and its assay in tablets and biological samples, J. Electrochem. Sci. Eng., 2012; doi: 10.5599/jese.2012. 0008. [19] Nadiah A.R., Nor Azah Y., Nor Amirah M.M. and Siti M.M.N., Development of electrochemical sensor for simultaneous determination of Cd(II) and Hg(II) ion by exploiting newly synthesized cyclic dipeptide, Int. J. Electrochem. Sci., 2012; 7: 186196. [20] Kara P., Erdem A., Girousi S. and Ozsoz M., Electrochemical detection of enzyme labeled DNA based on disposable pencil graphite electrode, J. Pharm. Biomed. Anal., 2005; 38: 191-195. [21] Wang Z.H., Viana A.S., Jin G. and Abrantes L.M., Immunosensor interface based on physical and chemical immunoglubulin G adsorption onto mixed self-assembled monolayers, Bioelectrochem., 2006; 69: 180-186.
© Copyright 2025 Paperzz