610
Chiang Mai J. Sci. 2012; 39(4)
Chiang Mai J. Sci. 2012; 39(4) : 610-622
http://it.science.cmu.ac.th/ejournal/
Contributed Paper
Preparation and Performance Test of a Simplified
Screen-Printed Carbon Electrode for Use as a
Chronoamperometric Transducer in Genosensor
Low Kim Fatt [a], Kritsanaporn Chuenrangsikul [b], Patsamon Rijiravanich [b],
Werasak Surareungchai [b] and Chan Yean Yean*[a]
[a] Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains
Malaysia, Kubang Kerian 16150, Kelantan, Malaysia.
[b] School of Bioresources and Technology, King Mongkut’s University of Technology Thonburi,
Bangkhuntien, Bangkok 10150, Thailand.
*Author for correspondence; e-mail: [email protected]
Received: 22 August 2011
Accepted: 24 June 2012
ABSTRACT
In this work, a simplified two-electrode configuration metal-free screen-printed
carbon electrode (2-MFSPCE) was fabricated in-house and electrochemically evaluated.
The electrode performance of the 2-MFSPCE was preliminary characterized with
ferricyanide by using cyclic voltammetry (CV). The electroactivity of TMB (3,3’,5,5’tetramethylbenzidine) substrate on 2-MFSPCE was studied before the development of a
Horseradish peroxidase (HRP) enzyme-based electrochemical genosensor detection
platform for specific 40 mer-synthetic target DNA sequence from food-borne pathogen,
Vibrio cholerae lolB gene. The CV results showed that the electron transfer/conductivity on
2-MFSPCE was highly consistent and stable without any significant shifting. In addition,
there was good electrochemical reproducibility that all individual 2-MFSPCE (within
and between batches of fabrication) showed relative low variation in electroanalysis.
A detection potential (reduction potential) of -0.1 V was empirically determined on
2-MFSPCE for enzymatic product from HRP/TMB catalytic reaction. By using
two-step sandwich-type hybridization strategy, the chronoamperometric analysis of the
enzyme-based electrochemical genosensor with 2-MFSPCE as transducer bestowed a
detection limit of 5 fM of target sequence. The encouraging results obtained from the
electrochemical characterization and the well response in electrochemical genosensor study
indicating the feasibility of this 2-MFSPCE to use as a low-cost disposable electrode in
electrochemical sensor application.
Keywords: two-electrode configuration, metal-free screen-printed carbon electrode,
enzyme-based electrochemical genosensor, sandwich-typed hybridization
1. INTRODUCTION
Biosensors are self-contained integrated
devices that use a biological recognition
element (e.g., nucleic acids, antibodies, cells,
enzymes or aptamers) that is in direct spatial
Chiang Mai J. Sci. 2012; 39(4)
contact with a transduction element, to
interact with the compound of interest.
The interaction or recognition event is
then converted into a measurable analytical
signal.
Genosensors are DNA-based biosensors
that exploit immobilized single-stranded
DNA (ssDNA) or DNA probes as the
biological recognition elements to detect the
presence of complementary target DNA
sequences through the formation of DNA
probe-target hybrids [1].
Although there are many genosensor
transduction methods that are based on
optical [2], piezoelectric [3] or electrochemical
[4, 5] principles, the latter method has
properties that make it superior to others.
Electrochemical biosensors are noted for their
rapid and sensitive detection (independent
of sample turbidity), ease of manipulation,
inexpensive cost, and their compatibility
with mass fabrication and miniaturization
technologies. All these features make them a
promising option for point-of-care
diagnosis. The first electrochemical genosensor
was introduced at 1993 by Millan and
Mikkelsen [6].
There is currently intensive demand
for disposable screen-printed electrode
(SPE) particularly in applications related to
development of the electrochemical biosensor
[7]. Uneconomic use of commercialized
SPE in biosensor research and the need in
industry for novel products has led many
researches in this field of study to use
SPE made in-house for the development of
prototype biosensors; such SPE is cheaper
to produce and researchers have the ability
to manipulate the SPE configuration
according to their own need. Therefore,
the in-house production of SPE is an
appropriate choice for research and
commercial purposes.
In contrast to conventional three-
611
electrode SPE that with metal elements
(gold, silver, platinum, etc.) as the reference
and/or counter electrode, in this study a
simplified two-electrode configuration
metal-free screen-printed carbon electrode
(2-MFSPCE) consisting of a carbon working
electrode and a carbon combined reference
and counter electrode was made in-house.
The use of carbon ink has advantage of
high chemical inertness, which makes it
compatible with the use of strong chemical
reagents and means that a range of working
potential can be applied on the electrode
surface. In addition, the simplified design of
2-MFSPCE makes it simple and quick to
make, thus decreasing its production costs.
The two-electrode configuration also
enables small size electrodes to be made,
which will significantly reduce the sample
volume required.
The aims of this current study were to
characterize and explore electrochemically
the possibility of using this simplified
2-MFSPCE for the development of a
DNA-based electrochemical detection
platform. The lolB gene of the food-borne
pathogen, Vibrio cholerae was used as model
of investigation. This sequence of gene is
highly conserved within Vibrio cholerae
species, which enables this organism to be
discriminated from other Vibrio species
and enteric bacteria [8].
2. MATERIALS AND METHODS
2.1 Materials
All DNA sequences used in this
study were synthesized by First BASE
Laboratories Sdn Bhd (Selangor, Malaysia)
using phosphoramidite chemistry and
provided in lyophilized form. Reconstitutions,
stock aliquots (20 μM) and working solutions
were made in type 1 ultrapure water (UPW)
and stored at - 20°C. The DNA sequences
were as follows:
612
- Capture probe (biotinylated), 20 mer:
• (Biotin) 5’ ATGAATGCTCTCGTA
CGTCG 3’
- Synthetic target, 40 mer:
• 5’GAGTGACTTGGTGTGATTG
CTGGCAGTAGGCGACGTACG
A 3’
- Non cognate, 40 mer:
• 5’ACATTGACGGGTTGTAGCG
GTGCGGTGGCACAACCTGC
CA 3’
- Detection probe (Digoxegenin-labeled)
, 20 mer:
• 5’ GCAATCACACCAAGTCACTC
3’ (Dig)
Potassium ferricyanide, K 3Fe(CN) 6
was purchased from MERCK (Darmstadt,
Germany). Potassium chloride (KCl),
ExtrAvidin ® ,1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride
(EDC), N-hydroxysuccinimide (NHS),
bovine serum albumin (BSA) and
ethanolamine chloride were purchased
from Sigma (Missouri, USA). Ready-touse TMB (3,3’,5,5’-tetramethylbenzidine)
substrates and Horseradish peroxidase-linked
anti-Digoxigenin antibody (anti-DIG-HRP)
were purchased from Promega (Wisconsin,
Figure 1. Configuration of 2-MFSPCE.
Chiang Mai J. Sci. 2012; 39(4)
USA) and Roche (Mannheim, Germany),
respectively. The working solutions for all
reagents mentioned above were prepared
using UPW that was obtained from
PURELAB Option Q-7BP MK 1 purification
system (ELGA, Lane End, UK).
2.2 Apparatus
All electroanalytical measurements
were performed using μAUTOLAB (III)
electrochemical potentiostat/galvanostat
(Eco Chemie, Utrecht, The Netherlands)
with controlling software GPES version
4.9. The 2-MFSPCE was fabricated using a
semi-automated screen-printing machine
(model 248.CERD, DEK, Zurich,
Switzerland) and its structure is shown in
Figure 1.
First, carbon ink type 145 (MCA
Services, Meldreth, UK) mixed with the
solvent propylene glycol diacetate (Aldrich,
Wisconsin, USA) in a 5:1 ratio (w/w) was
screen-printed onto a plain sheet of printing
substrate (PVC sheets, 150 mm × 200 mm)
to give an array of 24 screen-printed
electrodes with each consisting of two
carbon electrodes with the same composition.
An insulating layer (a mixture of dielectric
Chiang Mai J. Sci. 2012; 39(4)
ink and solvent) was then screen-printed
over the sheet of printing substrate containing
the two carbon electrodes to define one area
for electrical contact and another as a sensing
area; the latter consisted of a working
electrode (with area 1.5 mm × 3.5 mm) and a
combined reference and counter electrode
(with area 2 mm × 3.5 mm). There were 2030 sheets of 2-MFSPCEs printed in each
batch. After screen-printing, the 2-MFSPCEs
sheets were cured overnight in an oven at 55°C
and then allowed to cool at room
temperature. Individual 2-MFSPCEs were
obtained by cutting them from the printing
substrate.
2.3 Electrochemical Characterization of
2-MFSPCE
The electrochemical performance of the
fabricated 2-MFSPCE was assessed by
cyclic voltammetry (CV) using K3Fe(CN)6
with KCl as supporting electrolyte. First,
2-MFSPCE was pre-washed by applying
100 ml of UPW onto the sensing area
(covering both the electrode surfaces) and
leaving for at least 2 min to make the
electrode surfaces wet and more hydrophilic.
The UPW was then pipetted off and
without allowing the electrode surfaces
to dry, 50 ml of a freshly prepared 1 mM
K3Fe(CN)6/0.1 M KCl solution was deposited
onto the sensing area. The CV analysis was
begun with the potential ramped (staircase,
5mV step potential) from 0.6 to -0.6 V and
then reversed back to 0.6 V for a cycle; with
a scan rate of 50 mV/s.
2.4 Electrochemical Study of TMB on
2-MFSPCE
2.4.1 Voltammetric study of TMB
The CV analysis of TMB (50 μl in
volume on sensing area of 2-MFSPCE)
was performed at a scan rate of 50 mV/s.
An initial pretreatment potential of -1.8 V
613
was applied for 30 sec; the CV was then
scanned (staircase, 5mV step potential)
from potential of -1.8 V to 1.8 V and
reversed back to -1.8 V.
2.4.2 Chronoamperometric Study of
HRP/TMB Reaction
One microliter of HRP solution
(anti-DIG-HRP) was added to a 20 μl of
TMB on sensing area of 2-MFSPCE. The
mixture was gently mixed using a pipette and
subjected to 5 sec incubation at 0 V standby
potential followed by chronoamperometry
measurement at -0.1 V for 60 sec with an
interval time of 0.2 sec. The current value at
the end of the measurement period was
recorded for data analysis.
2.5 Electrochemical Genosensor Study
on 2-MFSPCE
An enzyme-based electrochemical
genosensor was set up using 2-MFSPCE
with schematic plan shown at Figure 2.
Initially, ExtrAvidin® (10 μl, 0.05 mg/ml,
10 min) was coated onto the sensing area of
2-MFSPCE after surface activation using
EDC/NHS covalent agent (10 μl, a mixture
of 0.2 M EDC and 0.05 M NHS, 10 min),
followed by treatment with ethanolamine
chloride (50 μl, 1 M, pH 8.5, 10 min in dark)
and BSA (50 μ l, 3% w/v, 10 min). A
sandwich-typed hybridization strategy
using a pair of DNA probes (1 μM of
capture probe and 1 μM of detection probe)
was employed for specific detection of
synthetic target sequence. The sandwich-type
hybridization of target sequence was a
two-step strategy in which the capture
probe (10 μl, 20 min) was firstly immobilized
onto the ExtrAvidin®-coated sensing area to
form a biorecognition layer on 2-MFSPCE
and subsequently, the target sequence-detection
probe hybrid (10 μl, 20 min) that was
prepared in PCR tube was deposited onto
614
Chiang Mai J. Sci. 2012; 39(4)
Figure 2. Schematic diagram for an enzyme-based electrochemical genosensor on a
2-MFSPCE.
the biorecognition layer. The hybridization redox peaks observed after each cycle of
event was tagged with antiDig-HRP (5 μl, CV scanning and if all the ten cyclic
750 mU/ml containing 0.025% of BSA, voltammograms were superimposed on
10 min) and a 20 μl of TMB was subsequently each others, they were all similar with little
deposited onto the sensing area, gently variation between them (data not shown).
mixed using a pipette and subjected to This experiment was carried out on five
chronoamperometry measurement with randomly selected 2-MFSPCEs and the
mean values of ∆Ep (peak separation
procedure as described in section 2.4.2.
All experiments detailed in Sections 2.3, potential values) and Ipc/Ipa (cathodic/
2.4 and 2.5 were carried out at room anodic peak current) from ten cycles of
CV scanning for each 2-MFSPCE are shown
temperature.
in Table 1. The low RSD values of ∆Ep and
Ipc/Ipa for each 2-MFSPCE ranging
3. RESULTS AND DISCUSSION
3.1 Electrochemical Characterization of from 0.97% to 3.16% and 0.59% to 1.73%,
respectively, indicate that the electron transfer/
2-MFSPCE
2-MFSPCEs were made in-house and conductivity on 2-MFSPCE was consistent
their electroactivities were characterized and stable along the electroanalysis.
The use of a two-electrode configuration
by studying their CV behavior towards
with combined reference and counter
K3Fe(CN)6 redox species.
electrode in the 2-MFSPCE could have a
3.1.1 Stability of Electron Transfer/ disadvantage in that it is difficult to control
the potential between the working and
Conductivity
The K 3Fe(CN) 6/KCl solution was reference electrodes. However, it was shown
scanned for ten cycles on individual in this study the electron transfer/conductivity
2-MFSPCE to study the stability of electron on 2-MFSPCE was consistent without any
transfer. There were a pair of well-defined significant shifting throughout the CV
Chiang Mai J. Sci. 2012; 39(4)
scanning in cycles, indicating that there is
a good, stable control of the potential
between both electrodes of the 2-MFSPCE.
Table 1. Mean values of ∆Ep and Ipc/Ipa
from CV analysis of 1 mM K3Fe(CN)6/0.1
M KCl on five randomly selected 2MFSPCEs. All mean values are calculated
from the ten CVs that were scanned for each
2-MFSPCE.
Mean ± SD (%RSD)
Ipc/Ipa
Electrode
∆Ep(mV)
1
2
3
4
5
239.10±5.587
(2.337)
239.60±6.257
(2.612)
257.70±2.497
(0.969)
278.50±3.689
(1.325)
229.50±7.246
(3.157)
1.065±0.008
(0.718)
1.051±0.006
(0.588)
1.055±0.007
(0.643)
1.044±0.011
(1.060)
1.051±0.018
(1.726)
3.1.2 Redox Behavior of Ferricyanide on
2-MFSPCE
The CV analysis of the benchmark
redox species, ferricyanide, on the 2-MFSPCE
produced well-defined redox peaks (data not
shown) with the Ipc/Ipa value remaining
near unity (~1) (Table 1) as expected for
reaction of reversible species on electrodes.
Nonetheless, the ∆Ep of the ferricyanide
redox process on the 2-MFSPCE ranged
from 229.50 ± 7.246 mV to 278.50 ± 3.689
mV (Table 1), which are significantly
different from the ideal Nernstian value of
57 mV for a single-electron transfer redox
process. This suggests that the redox
behavior of ferricyanide on the 2-MFSPCE
is quasi-reversible [9].
To characterize the electrode reaction of
ferricyanide on the 2-MFSPCE, a K3Fe(CN)6/
KCl solution was analyzed by CV on
2-MFSPCE with a scan rate that varied from
615
5 to 250 mV/s (Figure 3(a)). According to
Randle-Sevcik relationship [10], it is reasonable
to say that the reduction of ferricyanide to
ferricyanide {Fe(CN)63- + e- → Fe(CN)64- } on
the working electrode surface of 2-MFSPCE
is under diffusion control [11], as there is a
linear relationship between Ipc (cathodic
peak current) and the square root of the
scan rate as shown in Figure 3(b).
For a reversible redox process with a
high rate of electron transfer at the electrode
surface, the peak potential values (Ep) and
Ipc/Ipa (=1) are independent of the scan rate
and the ∆Ep will be equal to 57 mV. In this
study, the mean Ipc/Ipa for all scan rates was
1.075 ± 0.072, which is almost equal to unity
and meets the requirement for a reversible
redox process on the electrode surface.
The ∆Ep, however, is far from ideal and
increases with a higher scan rate (Figure 3),
indicating the process is limited by electron
transfer kinetics [12]. There are many
possible reasons for the poor electron
transferability. The most probable one is that
the 2-MFSPCE has relatively reduced surface
roughness with low amount of exposed
edge plane-like sites/defects, which alone
determine the process of electron transfer
on graphite electrodes [10]. The reduced
surface roughness might be due to the
polymeric binder (most are insulating
materials) used in carbon ink formulation
occupies the gaps between graphite particles,
subsequently leading to slow electron
transfer rates [13]. Another possible reason
for the slow electron transfer rate is the
resistive properties of the carbon ink that
was used as conducting material for the
electrodes and conducting path of the
2-MFSPCE [14].
An experiment was conducted to
compare the 2-MFSPCE’s electroactivity with
a commercial carbon SPE that was used in
previous work [15]. The commercial carbon
Chiang Mai J. Sci. 2012; 39(4)
Ipc(-l, μA)
Current (μA)
616
Potential (V)
(a)
(sc an rate)1/2(mV/s)1/2
(b)
Figure 3. (a) Cyclic voltammograms for a 1 mM K3Fe(CN)6/0.1 M KCl solution on
2-MFSPCE at different scan rate (1-7): 5, 10, 50, 100, 150, 200 and 250 mV/s, respectively.
(b) Correlation between Ipc and the square root of scan rate.
SPCE has a conventional three-electrode
configuration and with Ag/AgCl ink
screen-printed as the conducting paths for
all the three carbon electrodes. The ∆Ep
values (n=5) for 2-MFSPCE and commercial
carbon SPE were 227.62 ± 10.356 mV
(RSD 4.55%) and 248.60 ± 11.971 mV
(RSD 4.82%), respectively; where as the
Ipc/Ipa values were 1.062 ± 0.024 (RSD
2.27%) and 1.315 ± 0.234 (RSD 17.82%),
respectively. The 2-MFSPCE exhibited
better electroactivity in which the ∆Ep and
Ipc/Ipa have a lower RSD and were closer
to the values of an ideal reversible redox
process.
3.1.3 Reproducibility of 2-MFSPCE
The 2-MFSPCE in this study was
made in batches of 20-30 sheets of printing
substrate, with each sheet comprising
24 individual 2-MFSPCEs. In terms of
sensors development, reproducibility is one
of the main problems, especially when
components made in-house are used.
Therefore, the reproducibility of 2-MFSPCE
within and between batches was explored
by CV analysis of a K3Fe(CN)6/KCl solution
and the results obtained are shown in Table 2.
The non-parametric Kruskal-Wallis statistical
test (for both the within and between batch
evaluations) demonstrates that the P values for
Ipc, Ipa (anodic peak current), Epc (cathodic
peak potential), Epa (anodic peak potential),
∆Ep and Ipc/Ipa from both evaluations were
more than the significance level stipulated.
This indicates that all the null hypotheses
could not be rejected and that the values of
Ipc, Ipa, Epc, Epa, ∆Ep and Ipc/Ipa for
2-MFSPCE from respective evaluations are
not significantly different from each other.
Therefore, there is good reproducibility
for 2-MFSPCE within and between batches.
Having ascertained their reproducibility,
the 2-MFSPCE was used for further studies
in anticipation of producing accurate and
reliable sensing platforms.
3.2 Electrochemical Study of TMB on
2-MFSPCE
3.2.1 Voltammetric study of TMB on
2-MFSPCEs
Screen-printed electrodes with different
structural designs, electrode materials and
electrode curing methods will have dissimilar
electrochemical performances. Therefore,
the electroactivity of TMB on 2-MFSPCE
was studied.
In the presence of TMB and hydrogen
peroxide (H2O2), HRP enzyme will catalyze
the oxidation of TMB with H2O2 being
Chiang Mai J. Sci. 2012; 39(4)
617
Table 2. Reproducibility of 2-MFSPCE.
Within-batch evaluationa
Ipc
Ipa
Epc
(-1, μA)
(μA)
(-1,V)
Epa
(V)
P valuec
0.139
Ipc/Ipa
∆Ep
(EPA-EPC)
(mV)
b
Overall (n = 9)1.620±0.115 1.512±0.111 0.129±0.008 0.111±0.011 239.556±19.603 1.072±0.031
RSD (%)
7.126
7.362
6.598
10.280
8.183
2.864
0.141
0.151
0.236
Between-batch evaluationd
Ipc
(-1, μA)
Ipa
(μA)
Epc
(-1,V)
Epa
(V)
P valuec
0.027
0.033
0.034
0.209
0.132
Ipc/Ipa
∆Ep
(EPA-EPC)
(mV)
e
Overall (n = 9)1.669±0.151 1.575±0.147 0.128±0.014 0.111±0.012 238.778±25.553 1.061±0.027
RSD (%)
9.053
9.315
10.741
11.051
10.701
2.511
0.027
0.031
0.837
2-MFSPCEs from different sheets of printing substrate from a batch of screen-printing
All data are given as mean ± SD obtained from nine 2-MFSPCEs (three random 2-MFSPCEs
were selected from three different sheets of printing substrate, respectively)
c
Kruskal-Wallis statistical tests. The significance level is 0.025
d
2-MFSPCEs from three different batches of screen-printing
e
All data are given as mean ± SD obtained from nine 2-MFSPCEs (three random 2-MFSPCEs
were selected from three batches of screen printing, respectively)
a
b
reduced (oxidizing agent) [16, 17]. This
yields colored oxidized TMB products,
which
are
measurable
using
spectrophotometry or an electrochemical
analytical method. The latter approach
provides more rapid and sensitive detection.
To detect the oxidized TMB products
(which are proportional to the HRP catalytic
activities) chronoamperometrically, a
reduction potential (detection potential) was
determined. With the reduction potential
applied, the oxidized TMB products were
reduced and the current produced measured.
TMB is a molecule with redox properties
and this behavior is easily recorded using
CV electroanalytical methods. The reduction
potential for oxidized TMB can be estimated
from the resulting cyclic voltammogram
obtained.
Within the CV potential window,
there was a pair of well-defined redox peaks
observed in the range of -0.8 to 0.8 V as
shown in Figure 4(a). At the scan rate of
50 mV/s, the Ipc, Ipa, Epc, Epa, ∆Ep and
Ipc/Ipa values on different 2-MFSPCE
(n = 3) were -3.256 ± 0.027 μA (RSD 0.81%),
3.278 ± 0.070 μA (RSD 2.15%), -0.073 ± 0.003
V (RSD 3.97%), 0.083 ± 0.003 V (RSD
3.46%), 156 ± 0.00 mV (RSD 0.00%) and
0.994 ± 0.016 (RSD 1.64%), respectively.
The low RSD values indicate the good
reproducibility of the results.
The effect of different scan rates
ranging from 10-200 mV/s on the CV
behavior of TMB was investigated using
2-MFSPCE and the results are shown in
Figure 4(a). The Ipc was found to increase
with increasing scan rate and the plot of
618
values of Ipc versus square root of the scan
rates yielded a linear relationship (data not
shown) with a correlation coefficient, r of
0.973, indicating a diffusion-controlled
electrode process [11, 18, 19].
Chiang Mai J. Sci. 2012; 39(4)
3.2.2 Chronoamperometric Study of
HRP/TMB Reaction
The CV analysis detailed in Section 3.2.1
revealed that the Epc for the TMB on
2-MFSPCE to be -0.073 ± 0.003 V. A
Figure 4. (a) Cyclic voltammograms for a 50 μl of TMB solution on 2-MFSPCE at
different scan rate (1-6): 10, 25, 50, 75, 100 and 200 mV/s. (b) Chronoamperometry
analysis of the HRP-TMB reaction with a reduction potential of -0.1 V on 2-MFSPCE.
One microliter of anti-DIG-HRP with different concentration ranging from 0-187.5 mU/ml
was added to 20 μl TMB. Mean ± SD (n = 3).
potential value of -0.1 V which is higher
than -0.073 ± 0.003 V was applied as the
reduction potential in chronoamperometry
protocol and was expected to causes
immediate and complete reduction of any
oxidized TMB products generated from
HRP catalytic reaction at the working
electrode surface. A low analytical potential
value (-0.1 V in this study) was applied to avoid
any interfering signal during measurement.
Chronoamperometry experiments were
conducted to analyze the electroactivity of
the HRP-TMB reaction on 2-MFSPCE
by using -0.1 V as the detection potential
(reduction potential). Figure 4(b) shows the
results obtained. The absence of HRP in the
reaction produced negligible background
current signal and increased accordingly
(r = 0.9955) with the presence of different
concentration of HRP in the range of 0-187.5
mU/ml. The well response of 2-MFSPCE
to different concentration of HRP indicating
the 2-MFSPCE has no problem in potential
control and detection of current signal.
3.3 The Set-up of Enzyme-Based
Electrochemical Genosensor Using
2-MFSPCE
In this study, the sandwich-type double
hybridization using two DNA probes with
20 mer in length conferred a high specificity
for the detection of target sequence. All
DNA sequences used in this study were
designed based on the Vibrio cholerae lolB
gene.
Initially, ExtrAvidin® was coated onto
the EDC/NHS-activated sensing area
(covering both the electrode surfaces of
2-MFSPCE), followed by treatment
with ethanolamine chloride and BSA as
described in Section 2.4.2. ExtrAvidin® is a
deglycosylated biotin-binding protein
prepared from egg white avidin. It is an
excellent alternative to avidin and streptavidin
because it has fewer non-specific binding
properties compared with avidin and is
cheaper than streptavidin [20]. The
immobilization of ExtrAvidin® onto the
electrode surfaces was occurred by two
Chiang Mai J. Sci. 2012; 39(4)
mechanisms: (1) covalent binding through
the EDC/NHS activated carboxyl groups
on the electrode surfaces, and (2) passive
adsorption onto the electrode surfaces [21].
In this study, the biorecognition layer was
formed on both the working and combined
reference and counter electrodes to increase
the number of recognition elements for
detection of target DNA sequence; this
consequently improved the sensitivity of the
experiment.
Three different strategies of sandwichtype hybridization were investigated. In a
one-step sandwich-type hybridization
strategy, all three components [capture probe,
synthetic target sequence and detection
probe] were mixed together in a 0.5 ml PCR
tube with a concentration of 1 μM, 0.5 μM
and 1 μM, respectively. The reaction mixture
was incubated for 1 h at room temperature.
The hybrid formed was then deposited
onto the ExtrAvidin® coated layer on both
the electrode surfaces of 2-MFSPCE and
incubated for 20 min at room temperature.
Non-binding components were then washed
off the electrode surfaces using washing
buffer. The biotin from the hybrid interacted
with the ExtrAvidin ® at the electrode
surfaces.
By contrast, in a two-step sandwich-type
hybridization strategy, 1 μM of biotinylated
capture probe was first immobilized by
incubation for 20 min at room temperature
onto the ExtrAvidin ®-coated electrode
surfaces to form a biorecognition layer.
The synthetic target sequence-detection
probe hybrid was then prepared in PCR
tube with a concentration of 0.5 μM and
1 μM, respectively; and incubated for 1 h
at room temperature. The hybrid was then
deposited onto the biorecognition layer of
both electrode surfaces of the 2-MFSPCE
and incubated for 20 min at room
temperature.
619
Lastly, in a three-step sandwich-type
hybridization strategy, the capture probe,
synthetic target sequence and detection
probe were prepared individually in PCR
tubes with a concentration of 1 μM, 0.5 μM
and 1 μ M, respectively, and deposited
sequentially onto the ExtrAvidin®-coated
layer on both electrode surfaces of the
2-MFSPCE. Each DNA component on the
electrode surfaces was incubated for 20 min
and the unbound sequence was removed by
washing buffer before proceeding to the
next stage.
The hybrids from all these three
strategies were then tagged with anti-DIGHRP, followed by chronoamperometry
analysis with 20 μl of TMB. A background
signal using UPW containing no target
sequence was used as a negative control
and results are shown in Figure 5. After
comparison, there was no significant
difference in results of the three strategies,
however, the two-step sandwich-type
hybridization method showed the most
reproducible results with the lowest RSD
values, and therefore chosen for the
procedures that followed.
Using the two-step sandwich-type
hybridization strategy, the electrochemical
genosensor formed on the 2-MFSPCE was
challenged with different concentrations of
target sequence and the results shown in
Figure 6(a). The current signals for 0.5 μM,
5 nM, 0.5 pM and 5 fM of target sequence
were higher than the background (UPW)
and with the presence of 1 μM of noncognate synthetic DNA sequence. Thus,
the electrochemical genosensor used in this
study was able to detect amounts as low as
10 μl of 5 fM target sequence (or equal to
6.24 fg, with 40 mer in length). In addition,
there is a linear relationship between the current
signal and ST1 concentration between 5 fM
and 0.5 μM with the following equation:
620
Chiang Mai J. Sci. 2012; 39(4)
Figure 5. The chronoamperometry analysis of an enzyme-based electrochemical genosensor
using three different sandwich-type hybridization strategies on 2-MFSPCE.
Chronoamperometry was performed at 0 V standby potential for 5 sec and followed by
a -0.1 V reduction potential for 60 sec with an interval time of 0.2 sec. Mean ± SD (n =3).
0
Current (-1, nA)
1000.00
764.50
800.00
633.70
600.00
400.00
441.33
226.70
295.00
200.00
0.00
UPW
1.0 μM 0.5 μM 5.0 nM 0.5 pM 5.0 fM
NC
TS
TS
TS
TS
(a)
WE(l).Potential(V)
1066.67
1200.00
-0.02
-0.04
-0.06
-0.08
Potential control at -0.1V
-0.1
20
40
60
Time (s)
(b)
(b)
Figure 6. (a) The chronoamperometry analysis of an enzyme-based electrochemical genosensor
using a two-step sandwich-type hybridization strategy on 2-MFSPCE. Different concentrations
of target sequence (TS) were used to evaluate the genosensor. UPW is the background
signal and NC is a non-cognate sequence. Mean ± SD (n = 3). (b) Potential control (5 sec
incubation at standby potential of 0 V and followed by chronoamperometry measurement
at -0.1 V for 60 sec) during electrochemical genosensor detection of target DNA sequence.
-(y) (nA) = 69.074x + 401.97; r = 0.96
Where x is the log concentration (fM)
of synthetic target; y is the current signal
In order to prove that the deposition of
reagents on the combined reference and
counter electrodes didn’t affect the
maintenance of a constant potential, an
electrochemical genosensor experiment was
repeated using a potentiostat controlling
software-NOVA 1.6 from Eco Chemie
(Utrecht, The Netherlands). This software
allows users to observe the potential applied
during the measurement of current produced
in amperometry analysis. Figure 6(b) shows
the potential control observed during the
chronoamperometry detection of target
DNA sequences on 2-MFSPCE. The
potential applied is stable and constant
along the process of electroanalysis.
Chiang Mai J. Sci. 2012; 39(4)
4. CONCLUSIONS
The current study showed that
2-MFSPCE with a simplified two-electrode
configuration (a carbon working electrode
and a carbon combined reference and
counter electrode), which is cheaper and
easier to be fabricated, can be used
efficiently as a transducer for genosensor
applications. All 2-MFSPCE tested in the
study showed high consistency in terms of
their electron transfer/conductivity,
implying a stable electrode surface
structure and a good stability in controlling
of potential between both electrodes of the
2-MFSPCE. In addition, all individual
2-MFSPCE displayed good reproducibility,
with no significant batch-to-batch variation.
This is an important characteristic that is
essential in electrochemical analyses using
screen-printed electrodes.
The 2-MFSPCE used as HRP enzymebased electrochemical genosensors and
analyzed using chronoamperometry
revealed the lowest detection limit on
2-MFSPCE to be 10 μl of 5 fM synthetic
target sequence (or equal to 6.24 fg, with
40 mer in length). The encouraging
performance of 2-MFSPCE indicates their
suitability for use as a cost-effective
disposable electrode in electrochemical
sensor applications; and with the inherent
favorable characteristics possessed;
2-MFSPCE can be an alternative choice for
researchers with particular needs on SPE.
ACKNOWLEDGEMENTS
The authors thank the research
funding support in form of Research
University (RU) grant (grant no: 1001/
PPSP/813020) from Universiti Sains
Malaysia (USM), Malaysia. In addition,
support from Institute of Postgraduate
Studies (IPS), Universiti Sains Malaysia
(USM) in the form of graduate
621
fellowship for Low Kim Fatt is gratefully
acknowledged.
REFERENCES
[1] Teles F.R.R. and Fonseca L.P., Trends
in DNA biosensors, Talanta, 2008; 77:
606-623.
[2] Endo T., Kerman K., Nagatani N.,
Takamura Y. and Tamiya E., Labelfree detection of peptide nucleic acidDNA hybridization using localized
surface plasmon resonance based
optical biosensor, Anal. Chem., 2005;
77: 6976-6984.
[3] Lucarelli F., Tombelli S., Minunni
M., Marrazza G. and Mascini M.,
Electrochemical and piezoelectric
DNA biosensors for hybridisation
detection, Analytica Chimica Acta,
2008; 609: 139-159.
[4] Lai R.Y., Lagally E.T., Lee S.H., Soh
H.T., Plaxco K.W. and Heeger A.J.,
Rapid, sequence-specific detection of
unpurified PCR amplicons via a
reusable, electrochemical sensor,
Proc. Natl. Acad. Sci. USA., 2006; 103:
4017-4021.
[5] Mix M., Reske T., Duwensee H. and
Flechsig G.U., Electrochemical
detection of asymmetric PCR
products by labeling with osmium
tetroxide, Electroanalysis, 2009; 21:
826-830.
[6] Kerman K., Kobayashi M. and Tamiya
E., Recent trends in electrochemical
DNA biosensor technology, Meas. Sci.
Technol., 2004; 15: R1-R11.
[7] Jubete E., Loaiza O.A., Ochoteco E.,
Pomposo J.A., Grande H. and
Rodr -guez, Nanotechnology: A tool
for improved performance on
electrochemical screen-printed (Bio)
sensors, J. Sens., 2009: 1-13.
622
[8] Lalitha P., Siti Suraiya M.N., Lim
K.L., Lee S.Y., Nur Haslindawaty
A.R., Chan Y.Y., Ismail A.,
Zainuddin Z.F. and Ravichandran M.,
Analysis of lol B gene sequence and its
use in the development of a PCR assay
for the detection of Vibrio cholerae, J.
Microbiol. Methods, 2008; 75: 142-144.
[9] Crew A., Alford C., Cowell D.C.C.
and Hart J.P., Development of a
novel electrochemical immuno-assay
using a screen printed electrode
for the determination of secretory
immunoglobulin A in human sweat,
Electrochim. Acta, 2007; 52: 52325237.
[10] Kadara R.O., Jenkinson N. and
Banks C.E., Characterisation of
commercially available electrochemical
sensing platforms, Sens. Actuator BChem., 2009; 138: 556-562.
[11] Liu C.C., Electrochemical Sensors, 2nd
Edn., The Biomedical Engineering
Handbook, CRC Press LLC, 2000.
[12] Sabzi R.E., Amperometric detection
of nitrite on glassy carbon electrode
modified with cobalt nitroprusside,
Portugaliae Electrochim. Acta, 2007;
25: 383-390.
[13] Grennan K., Killard A.J. and Smyth
M.R., Physical characterizations of a
screen-printed electrode for use in an
amperometric biosensor system,
Electroanalysis, 2001; 13: 745-750.
[14] Morrin A., Killard A.J. and Smyth
M.R., Electrochemical characterization of commercial and home-made
screen-printed carbon electrodes, Anal.
Lett., 2003; 36: 2021-2039.
[15] Yean C.Y., Kamarudin B., Ozkan
D.A., Yin L.S., Lalitha P., Ismail A.,
Ozsoz M. and Ravichandran
M., Enzyme-linked amperometric
electrochemical genosensor assay for
Chiang Mai J. Sci. 2012; 39(4)
the detection of PCR amplicons on a
streptavidin-treated screen-printed
carbon electrode, Anal. Chem., 2008;
80: 2774-2779.
[16] Fanjul-Bolado P., Gonz lez-Garc a M.B. and Costa-Garc -a A.,
Amperometric detection in TMB/
HRP-based assays, Anal. Bioanal.
Chem., 2005; 382: 297-302.
[17] Shakeela S., Ram B.S. and Sekaran
C.B., Application of horseradish
peroxidase mediated oxidative
coupling reaction for the determination of mesalazine, Chiang Mai J.
Sci., 2011; 38(4): 551-559.
[18] Nagappa L.T., Shankar N.P. and
Jaldappagari S., Electrochemical
studies of nevirapine, an anti-HIV
drug, and its assay in tablets and
biological samples, J. Electrochem. Sci.
Eng., 2012; doi: 10.5599/jese.2012.
0008.
[19] Nadiah A.R., Nor Azah Y., Nor
Amirah M.M. and Siti M.M.N.,
Development of electrochemical
sensor for simultaneous determination
of Cd(II) and Hg(II) ion by exploiting
newly synthesized cyclic dipeptide,
Int. J. Electrochem. Sci., 2012; 7: 186196.
[20] Kara P., Erdem A., Girousi S. and
Ozsoz M., Electrochemical detection
of enzyme labeled DNA based on
disposable pencil graphite electrode,
J. Pharm. Biomed. Anal., 2005; 38:
191-195.
[21] Wang Z.H., Viana A.S., Jin G. and
Abrantes L.M., Immunosensor
interface based on physical and
chemical immunoglubulin G
adsorption onto mixed self-assembled
monolayers, Bioelectrochem., 2006;
69: 180-186.