TLR-Induced Inflammation in Cystic
Fibrosis and Non-Cystic Fibrosis Airway
Epithelial Cells
This information is current as
of June 14, 2017.
Catherine M. Greene, Tomás P. Carroll, Stephen G. J. Smith,
Clifford C. Taggart, James Devaney, Siobhan Griffin, Shane
J. O'Neill and Noel G. McElvaney
J Immunol 2005; 174:1638-1646; ;
doi: 10.4049/jimmunol.174.3.1638
http://www.jimmunol.org/content/174/3/1638
Subscription
Permissions
Email Alerts
This article cites 59 articles, 32 of which you can access for free at:
http://www.jimmunol.org/content/174/3/1638.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2005 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
References
The Journal of Immunology
TLR-Induced Inflammation in Cystic Fibrosis and Non-Cystic
Fibrosis Airway Epithelial Cells1
Catherine M. Greene,2* Tomás P. Carroll,* Stephen G. J. Smith,† Clifford C. Taggart,*
James Devaney,* Siobhan Griffin,* Shane J. O’Neill,* and Noel G. McElvaney*
C
ystic fibrosis (CF)3 is an autosomal recessive inherited
disorder characterized by mutations in the gene encoding
the CF transmembrane conductance regulator (CFTR)
protein. It is one of the most common lethal hereditary disorders
among Caucasians of European descent. The most frequent mutation in CF is a deletion of phenylalanine at position 508 of the
CFTR protein, the ⌬F508 mutation. This abrogates CFTR channel
function and causes the protein to fold aberrantly and accumulate
within the endoplasmic reticulum (1– 6).
CF is characterized in the lungs by neutrophil-dominated inflammation. IL-8, a member of the CXC chemokine family, is a
potent activator and chemoattractant of neutrophils and has been
shown to be expressed by epithelial cells in response to a variety
of stimuli, including the neutrophil-derived protease, neutrophil
elastase (NE) (7). In CF, IL-8-induced recruitment of additional
*Respiratory Research Division, Department of Medicine, Royal College of Surgeons
in Ireland, Beaumont Hospital, Dublin, Ireland; and †Moyne Institute of Preventive
Medicine, Trinity College, Dublin, Ireland
Received for publication October 31, 2003. Accepted for publication November
15, 2004.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was funded by research grants from Enterprise Ireland (SC/2001/104),
Programme from Research in Third Level Institutes administered by Higher Education Authority, Cystic Fibrosis Association of Ireland, Alpha One Foundation, and
Royal College of Surgeons in Ireland.
2
Address correspondence and reprint requests to Dr. Catherine M. Greene, Respiratory Research Division-Department of Medicine, Royal College of Surgeons in Ireland, Education and Research Centre, Beaumont Hospital, Dublin 9, Ireland. E-mail
address: [email protected]
3
Abbreviations used in this paper: CF, cystic fibrosis; BALF, bronchoalveolar lavage
fluid; CFTR, CF transmembrane conductance regulator; IRF, IFN-regulatory factor;
MALP-2, macrophage-activating lipopeptide-2; NE, neutrophil elastase; Pam3, triacylated lipopeptide; PAO1, P. aeruginosa strain O1; PCM, PAO1-conditioned medium; PI, propidium iodide; TBE, Tris-borate-EDTA; TIR, TLR- and IL-1R-related;
TRIF, TIR domain-containing adaptor inducing IFN-␤; uCpG, unmethylated CpG.
Copyright © 2005 by The American Association of Immunologists, Inc.
neutrophils to the airways results in further release of NE and
additional induction of IL-8 gene expression by bronchial epithelial cells, thereby perpetuating a chronic cycle of respiratory inflammation. A major goal in CF research is the development of
improved therapies to treat pulmonary inflammation associated
with this condition.
A significant factor by which pulmonary inflammation is mediated in CF is Pseudomonas aeruginosa infection. Pseudomonas
Ags can exacerbate pulmonary inflammation in CF by exaggerating proinflammatory gene expression via TLR activation. TLRs
belong to a family of proteins that can recognize and discriminate
a diverse array of microbial Ags (8 –10). Following their activation
by specific factors, TLRs transduce intracellular signals to regulate
proinflammatory gene expression. The first TLR to be identified
was initially termed human or hToll, on the basis of its homology
to the Drosophila Toll protein, which has a role in embryonic
development and immunity in Drosophila melanogaster (11). This
was later renamed TLR4, and is now recognized to be the principal
receptor responsible for transducing the LPS signal intracellularly.
The TLR family currently includes at least 10 human TLRs for
which multiple agonists exist. Briefly, TLR2 is activated by microbial diacylated and triacylated lipopeptides by heterodimerizing
with TLRs 6 and 1, respectively, TLR3 by dsRNA, TLR4 by LPS
(and NE among others), TLR5 by flagellin, and TLR9 by unmethylated CpG (uCpG) dinucelotides (12–21). TLR7 and 8 are activated by ssRNA (22, 23), and specific activators of TLR10 have
yet to be identified. An important and interesting feature of TLR
signal transduction is that a highly conserved pathway is activated
by the different TLRs (24, 25). These receptors signal via a number
of kinases and adaptor proteins, MyD88/Mal or TIR domain-containing adaptor inducing IFN-␤ (TRIF)/TIR domain-containing
adaptor molecule-1, IL-1R-associated kinases, TNFR-associated
factor 6, TGF-␤-activated kinase 1, and I␬B kinases, to activate
NF-␬B and induce expression of NF-␬B-regulated genes. These
0022-1767/05/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Cystic fibrosis (CF) is a genetic disease characterized by severe neutrophil-dominated airway inflammation. An important cause
of inflammation in CF is Pseudomonas aeruginosa infection. We have evaluated the importance of a number of P. aeruginosa
components, namely lipopeptides, LPS, and unmethylated CpG DNA, as proinflammatory stimuli in CF by characterizing the
expression and functional activity of their cognate receptors, TLR2/6 or TLR2/1, TLR4, and TLR9, respectively, in a human
tracheal epithelial line, CFTE29oⴚ, which is homozygous for the ⌬F508 CF transmembrane conductance regulator mutation. We
also characterized TLR expression and function in a non-CF airway epithelial cell line 16HBE14oⴚ. Using RT-PCR, we demonstrated TLR mRNA expression. TLR cell surface expression was assessed by fluorescence microscopy. Lipopeptides, LPS, and
unmethylated CpG DNA induced IL-8 and IL-6 protein production in a time- and dose-dependent manner. The CF and non-CF
cell lines were largely similar in their TLR expression and relative TLR responses. ICAM-1 expression was also up-regulated in
CFTE29oⴚ cells following stimulation with each agonist. CF bronchoalveolar lavage fluid, which contains LPS, bacterial DNA, and
neutrophil elastase (a neutrophil-derived protease that can activate TLR4), up-regulated an NF-␬B-linked reporter gene and
increased IL-8 protein production in CFTE29oⴚ cells. This effect was abrogated by expression of dominant-negative versions of
MyD88 or Mal, key signal transducers for TLRs, thereby implicating them as potential anti-inflammatory agents for CF. The
Journal of Immunology, 2005, 174: 1638 –1646.
The Journal of Immunology
1639
intracellular signaling molecules represent key inhibitory targets
for therapeutic drug design.
Patterns of TLR expression have been studied in many different
tissues and cell types; however, until recently, TLR expression and
function in airway epithelial cells (26, 27), particularly CF airway
epithelial cells, remained largely unexplored (28). Furthermore,
the contribution of so-called nonimmune epithelial cells to the inflammatory response in the CF lung deserves more detailed investigation. Therefore, given that there are a number of potential TLR
agonists in the CF lung (e.g., NE, Pseudomonas lipopeptides, LPS,
and DNA), we decided to evaluate TLR expression in CF airway
epithelial cells, to use these cells as a model to determine the
contribution made by CF epithelium to inflammation in the CF
lung, and evaluate the potential of TLR-specific inhibitors to ameliorate the inflammatory response of CF airway epithelial cells.
Materials and Methods
Cell culture and treatments
TLR mRNA analysis
Total RNA was isolated from 1 ⫻ 106 cells using TRI reagent (SigmaAldrich). Contaminating DNA was removed using DNase 1 treatment. For
RT-PCR, 1 ␮g of total RNA was reverse transcribed into cDNA with an
oligo(dT)15 primer using first strand cDNA synthesis kit (Roche). The integrity of RNA extraction and cDNA synthesis was verified by PCR by
measuring the amounts of GAPDH cDNA in each sample using GAPDHspecific primers to generate a 211-bp product. PCR mixtures contained 2.5
mM MgCl2, 1.25 U of Taq polymerase, 0.2 mM dNTPs (Promega), and 50
Laser-scanning cytometry
Cells (2 ⫻ 104) were grown in eight-well chamber slides (Nunc), washed
with PBS-0.5% BSA, Fc blocked for 15 min at room temperature with 2%
BSA (Sigma-Aldrich), then labeled with anti-TLR primary Abs (goat antihuman TLR1, TLR3, TLR5, and TLR6 (Santa Cruz Biotechnology);
mouse IgG2A anti-human TLR2.1 (eBioscience); mouse IgG2A antihuman TLR4 (Serotec); mouse IgG1 anti-human TLR6 (Alexis Biochemicals); or mouse IgG1 anti-human TLR9 (Imgenex)) for 30 min at 4°C.
Following three washes, cells were incubated with 10 ␮g/ml FITC-labeled
secondary Ab (anti-goat IgG or anti-mouse F(ab⬘)2 (DakoCytomation)).
Cells were counterstained with propidium iodide (PI) (Molecular Probes),
and laser-scanning cytometry (Compucyte) was used to quantify cell surface TLR expression, as previously described (17). FITC and PI cellular
fluorescence of at least 3 ⫻ 103 cells were measured. TLR expression was
quantified using CompuCyte software on the basis of integrated green fluorescence. CD14 expression was quantified using a PE-conjugated mouse
anti-human CD14 IgG2A Ab (DakoCytomation), and PE cellular fluorescence was measured in all cells. ICAM-1 expression was quantified using
an FITC-conjugated anti-human ICAM-1 Ab (R&D Systems). Appropriate
goat, mouse IgG2A, or mouse IgG1 isotype controls (R&D Systems) were
prepared for all samples.
Cytokine protein production
Cells (1 ⫻ 105) were left untreated or stimulated with lipopeptide
(MALP-2 or Pam3), LPS, uCpG, control DNA, PMA, TNF-␣, CF bronchoalveolar lavage fluid (BALF), PCM, or vehicle controls, as indicated. In
some experiments, cells were pretreated with actinomycin D (10 ␮g/ml) or
TLR2.1 (eBioscience) (5 ␮g/ml) for 1 h before agonist treatment. IL-8 and
IL-6 protein concentrations in the cell supernatants were determined by
sandwich ELISA (R&D Systems). All assays were performed in duplicate
or triplicate a minimum of three times.
CF BALF
BALF was collected from individuals with CF (n ⫽ 7) following informed
consent using a protocol approved by Beaumont Hospital Ethics Committee (32). Samples were filtered through gauze and centrifuged at 1000 ⫻ g
for 10 min, and cell-free supernatants were aliquoted and stored at ⫺80°C.
Antigenic NE levels and NE activity were calculated in pooled BALF, as
previously described (33, 34). LPS levels were quantified using the QCL
1000 Limulus amebocyte lysate assay (Cambrex). Pseudomonas DNA was
detected in individual BALF samples by PCR using PAO1-specific gene
primers for fliC (forward, 5⬘-GAACTGACCCGTATCTCCGA-3⬘ and reverse, 5⬘-GTCAATGGTCTCGTATGGCGT-3⬘, product 111 bp) and lasB
(forward, 5⬘-CGAACCCGGTCTAAAGTTCA-3⬘ and reverse, 5⬘-CAAG
TGATTGACGCAGGCTA-3⬘, product 103 bp). Thermocycling conditions
were 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s,
and 72°C for 30 s. A final extension step of 72°C for 10 min was performed. Products were resolved on 1.5% TBE agarose gels containing 0.5
␮g/ml ethidium bromide (Sigma-Aldrich), and images were captured using
the GeneGenius Gel Documentation and Analysis System (Syngene).
Table I. TLR gene-specific primers
Gene (Accession no.)
TLR2
(U88878)
TLR4
(U88880)
TLR6
(AB020807)
TLR9
(AB045180)
Primers (5⬘33⬘)
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
Forward:
Reverse:
CCTACATTAGCAACAGTGACCTAC
ATCTCGCAGTTCCAAACATTCCA
AGATGGGGCATATCAGAGC
CCAGAACCAAACGATGGAC
GTTCTCCGACGGAAATG
GCACTCAATCCCAAG
ATGGGTTTCTGCCGC
GAAGAGATGCCGCAGG
Bases
Product Size (bp)
323–346
822– 800
446 – 464
945–927
148 –164
551–517
145–159
438 – 423
477
481
383
293
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
CFTE29o⫺ and CFBE41o⫺ cells are ⌬F508 homozygous tracheal and
bronchial epithelial cell lines, respectively. The 16HBE14o⫺ is a non-CF
human bronchial epithelial cell line. These were obtained as a gift from D.
Gruenert (University of Vermont, Burlington, VT) (29 –31). The cells were
cultured on coated plates (fibronectin) (1 mg/ml; Sigma-Aldrich), collagen
(Vitrogen 100, 2.9 mg/ml; Cohesion Technologies), and BSA (1 mg/ml;
Sigma-Aldrich) in Eagle’s MEM (Invitrogen Life Technologies) supplemented with 10% FCS, 1% L-glutamine, and 1% penicillin/streptomycin
(Invitrogen Life Technologies). Twenty-four hours before agonist treatment, cells were washed with serum-free Eagle’s MEM and placed under
serum-free conditions or in serum containing 1% FCS for LPS or macrophage-activating lipopeptide-2 (MALP-2) stimulations. Human myelomonocytic U937 cells (European Collection of Cell Culture) were cultured in RPMI 1640 containing 10% FCS, 1% L-glutamine, and 1%
penicillin/streptomycin (Invitrogen Life Technologies), and were maintained at 37°C in a humidified atmosphere of 5% CO2. Agonist treatments
were performed in serum-free or 1% FCS conditions, as appropriate.
Diacylated lipopeptide from Mycoplasma fermentans (MALP-2 (S-(2,3bis acyloxypropyl)-cysteine-GNNDESNISFKEK)) (Alexis Biochemicals),
triacylated lipopeptide (palmitoyl-Cys((RS)-2,3-di((palmitoyloxy)-propyl)-Ala-Gly-OH) (Pam3; Bachem), P. aeruginosa LPS (Sigma-Aldrich),
uCpG (5⬘-TCGTCGTTTTGTCGTTTTGTCGTT-3⬘) or control GpG (5⬘CTGGTCTTTCTGGTTTTTTTCTGG-3⬘) phosphodiester or phosphorothioate-modified oligonucleotides (MWG Biotec), PMA (Sigma-Aldrich),
human rTNF-␣ (R&D Systems), polymixin B, and actinomycin D (SigmaAldrich) were used, as indicated. P. aeruginosa strain 01 (PAO1) was a gift
from R. Hancock (University of British Columbia, Vancouver, British
Columbia, Canada). PAO1-conditioned medium (PCM) was prepared by
filter sterilizing culture supernatants from 72-h PAO1 trypticase soy broth
cultures.
pmol each of TLR2, TLR4, TLR6, and TLR9 gene-specific primers (Table
I). Thermocycling conditions were 95°C for 5 min, followed by 35 cycles
of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. A final extension step
of 72°C for 10 min was performed. Control PCR using an RNA template
failed to generate any products. Multiplex PCR were also performed to
detect GAPDH, TLRs 1–5, and CD14 using the Cytoxpress Multiplex PCR
Human Signaling Gene Set 1 kit (BioSource International; QHM0172),
according to the manufacturer’s instructions. Products were resolved on
1.5% Tris-borate-EDTA (TBE)-agarose gels containing 0.5 ␮g/ml
ethidium bromide (Sigma-Aldrich), and images were captured using the
GeneGenius Gel Documentation and Analysis System (Syngene).
1640
TLRs AND CF AIRWAY EPITHELIAL CELLS
Transfection and reporter gene studies
Transfections were performed into cells (1 ⫻ 10 ) with TransFast Reagent
(Promega) in a 1:1 ratio, according to the manufacturer’s instructions, using 100 ng of NF-␬B5-linked luciferase reporter plasmid and 200 ng of
either pCDNA3.1 (Invitrogen Life Technologies) or a ⌬MyD88 expression
plasmid (35, 36) or pDC304 or a Mal P/H expression vector (a gift from A.
Bowie, Dublin, Ireland) (37). ⌬MyD88 contains only a functional TIR
domain and lacks the death domain required for downstream signaling,
while Mal P/H is a dominant-negative version of Mal with a Pro125His
point mutation in box 2 of the TIR domain. Uniform transfection efficiencies were achieved by initially optimizing transfection conditions using a
constitutive luciferase expression vector, pGL3-control (Promega). Cells
were then supplemented with additional growth medium for 24 h at 37°C
before being left untreated or stimulated, as indicated. Cells were lysed
with reporter lysis buffer (Promega), and reporter gene activity was quantified by luminometry (PerkinElmer Wallac Victor2, 1420 multilabel
counter) using the Promega luciferase assay system, according to the manufacturer’s instructions.
5
Statistical analysis
Results
TLR expression by CF and non-CF airway epithelial cells
CFTE29o⫺ and 16HBE14o⫺ cells were assessed for GAPDH,
CD14, TLR1– 6, and TLR9 RNA expression by RT-PCR (Fig. 1).
Similar TLR and CD14 RNA expression profiles were also seen in
CFBE41o⫺ cell lines (data not shown).
TLR1– 6, TLR9, and CD14 cell surface protein expression was
assessed in CFTE29o⫺ and 16HBE14o⫺ cells using laser-scanning
microscopy. Cell surface TLRs1–5 and TLR9, but not TLR6, were
detected by microscopy on both the CFTE29o⫺ and 16HBE14o⫺
cell lines (Fig. 1). Both airway epithelial cell lines also expressed
Diacylated and triacylated lipopeptide, LPS, and uCpG
dinucleotides induce IL-8 expression from CFTE29o⫺ cells
The effect of TLR2/6, TLR2/1, TLR4, and TLR9 agonists on IL-8
protein production in CFTE29o⫺ cells was assessed. Diacylated
lipopeptide (MALP-2) dose dependently induced IL-8 expression
from CFTE29o⫺ cells after 24 h at 4, 40, and 400 ng/ml ( p ⱕ
0.05). Triacylated lipopeptide (Pam3) and LPS also induced IL-8
expression from CFTE29o⫺ cells after 24 h at doses of 1, 10, and
50 ␮g/ml ( p ⱕ 0.05) (Fig. 2A). uCpG DNA induced IL-8 expression from CFTE29o⫺ cells only after 48 h at 10 and 100 ␮g/ml
( p ⱕ 0.05). However, uCpG did significantly increase IL-8 expression from myelomonocytic U937 cells at both 24 and 48 h
(83 ⫾ 2 vs 120 ⫾ 19 and 106 ⫾ 4 pg/ml IL-8 for control vs uCpG
(30 ␮g/ml) at 24 and 48 h, p ⱕ 0.05). Both phosphodiester- and
phosphorothioate-modified uCpG DNA induced similar effects;
however, phosphodiester-containing oligonuceotides were used
because high concentrations of phosphorothioate-containing oligonucleotides can induce CpG-independent effects (38). The lipopeptide effect was inhibited by pretreatment with a TLR2-neutralizing Ab (Fig. 2B); the LPS effect was inhibited by polymixin
B (Fig. 2C); a control oligonucleotide that did not contain uCpG
dinucelotides failed to increase IL-8 expression from CFTE29o⫺
(Fig. 2D); and all effects were blocked by pretreatment with actimomycin D (Fig. 2E) ( p ⱕ 0.05). PCM could also dose dependently increase IL-8 expression from CFTE29o⫺ cells at 24 h at
doses of 1, 5, or 10% (v/v) (132 ⫾ 13 vs 201 ⫾ 20, 342 ⫾ 75,
and 452 ⫾ 44 pg/ml IL-8 for control vs 1, 5, or 10%, respectively, p ⱕ 0.05).
FIGURE 1. TLR expression by CFTE29o⫺ and 16HBE14o⫺ cells. TLR RNA and protein expression were assessed in CFTE29o⫺ (A) and 16HBE14o⫺
(B) cells by RT-PCR and laser-scanning microscopy, respectively. Total RNA was extracted from 1 ⫻ 106 cells, reverse transcribed into cDNA, and used
as a template in PCR using gene-specific primers. Products were electrophoresed in 1.5% TBE agarose gels containing 0.5 ␮g/ml ethidium bromide and
visualized under UV. For fluorescence microscopy, cells (2 ⫻ 104) were grown in chamber slides, Fc blocked, and labeled with anti-TLR (1– 6, 9) and
anti-CD14 (solid) or isotype control Abs (clear) and fluorophore-conjugated detection Abs. Assays were performed in duplicate.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Data were analyzed with GraphPad Prism 3.0 software package (GraphPad). Results are expressed as mean ⫾ SE, and were compared by MannWhitney U test. Differences were considered significant when the p value
was ⱕ0.05.
only low levels of CD14 on the surface. Western blotting of membrane fractions also detected TLR2, TLR4, TLR5, and TLR9 expression in both cell lines (data not shown).
The Journal of Immunology
1641
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 2. Diacylated and triacylated lipopeptides, LPS, and uCpG dinucelotides induce IL-8 expression from CFTE29o⫺ cells. CFTE29o⫺ cells (1 ⫻
105/ml) were left untreated (⫺) or stimulated with increasing doses (⫹, ⫹⫹, ⫹⫹⫹) of A, diacylated lipopeptide (MALP-2 at 4, 40, and 400 ng/ml) or Pam3
or LPS (both at 1, 10, or 50 ␮g/ml) for 24 h or uCpG DNA (at 1, 10, or 100 ␮g/ml) for 48 h. Levels of IL-8 in supernatants were measured by ELISA,
and values are expressed as picograms per milliliter (ⴱ, p ⱕ 0.05). Assays were performed in triplicate a minimum of three times. The graph depicts a
representative experiment. The effects of B, a TLR2-neutralizing Ab or isotype control Ab (5 ␮g/ml, 1 h); C, polymixin B (1 ␮g/ml); D, a control
oligonucleotide, uGpG (100 ␮g/ml, 48 h); and E, actinomycin D (10 ␮g/ml, 1 h) were also evaluated and compared with Pam3 or LPS (10 ␮g/ml for 24 h)
or uCpG (100 ␮g/ml for 48 h) (ⴱ, p ⱕ 0.05). F, 16HBE14o⫺ cells (1 ⫻ 105) were left untreated or stimulated with Pam3 (10 ␮g/ml) or LPS (10 ␮g/ml)
for 24 h or uCpG DNA for 48 h (100 ␮g/ml). Levels of IL-8 in supernatants were measured by ELISA, and values are expressed as relative IL-8 (ⴱ, p ⱕ
0.05). Assays were performed in triplicate and are representative of at least three separate experiments.
Similar to their effects in CFTE29o⫺ cells, triacylated lipopeptide, LPS, and uCpG also increased IL-8 protein production from
16HBE14o⫺ cells ( p ⱕ 0.05) (Fig. 2F). Diacylated lipopeptide
failed to increase IL-8 (or IL-6) expression from 16HBE14o⫺ cells
after 24 h (data not shown). The relative amounts of IL-8 induced
by 16HBE14o⫺ and CFTE29o⫺ cells were similar, although the
CFTE29o⫺ cells expressed higher levels of IL-8 basally and following agonist treatment than the16HBE14o⫺ cells.
1642
IL-6 and ICAM-1 expression are increased by lipopeptides, LPS,
and uCpG DNA in CFTE29o⫺ cells
Diacylated and triacylated lipopeptides, LPS, and uCpG DNA, but
not a control oligonucleotide, induced IL-6 expression from
CFTE29o⫺ cells similar to TNF-␣ after 48 h (data not shown, p ⱕ
0.05) (Fig. 3A). As before, these effects were blocked by polymixin
B or actimomycin D, as appropriate ( p ⱕ 0.05, Fig. 3B). PCM (1%
v/v) also increased IL-6 production from CFTE29o⫺ cells compared with untreated cells after 24 h (259 ⫾ 34 vs 386 ⫾ 12 pg/ml
IL-6 for control vs PCM, p ⱕ 0.05).
Expression of the adhesion molecule ICAM-1 on CFTE29o⫺
cells was quantified in response to 48 h of stimulation with lipopeptide, LPS, uCpG, or TNF-␣ (Fig. 3C). All agonists significantly up-regulated ICAM-1 compared with unstimulated control
cells ( p ⱕ 0.05).
⌬MyD88 inhibits lipopeptide-, LPS-, and CF BALF-induced
NF-␬B reporter gene expression in CFTE29o⫺ cells
⌬MyD88 and ⌬Mal inhibit lipopeptide-, LPS-, and CF
BALF-induced IL-8 protein expression in CFTE29o⫺ cells
IL-8 protein production by CFTE29o⫺ cells was also measured in
response to stimulation with lipopeptide, LPS, CF BALF, or PMA
for 18 h. Each of these agonists significantly increased IL-8 protein
production ( p ⬍ 0.05) compared with untreated cells (Fig. 6).
Overexpression of ⌬MyD88 or an inactive mutant of the MyD88
adaptor protein Mal, Mal P/H, inhibited the lipopeptide, LPS, and
CF BALF ( p ⬍ 0.05), but not the PMA-induced effects.
Discussion
Inflammation in the CF lung is a neutrophil-dominated event; however, the epithelium plays an important role by regulating neutro-
phil recruitment, and therefore contributes significantly to the
overall inflammatory response within the lung. In light of the current intensive research in the area of TLRs and general widespread
interest in innate immunity, we thought it was timely to investigate
in more detail innate immune responses of CF airway epithelial
cells, in particular those activated by specific TLRs.
TLRs represent a major arm of the innate immune system. Their
principal role is to recognize and discriminate microbial components and mount a rapid protective inflammatory response (8 –25).
TLR function has been most widely studied in immune cells to
date; however, given their broad tissue distribution, it is likely that
TLRs fulfill their known roles in other cell types as well. In this
study, we have evaluated the roles of specific TLRs in CF airway
epithelial cells, in particular those relevant to key proinflammatory
agents present in the CF lung. Our studies found that TLRs1–5 and
TLR9 are expressed on the surface of CF and non-CF tracheal and
bronchial epithelial cell lines. Others have reported similar findings in 16HBE14o⫺ cells and primary CF nasal polyp tissue in
culture (28); however, it has been reported that TLR4 is not surface
expressed on BEAS-2B and A549 airway epithelial cells (27), suggesting heterogeneity of TLR expression exists between different
airway epithelial cell types. Although mRNA for TLR6 was
present in all of the epithelial cell types examined, we failed to
detect TLR6 protein expression; nonetheless, the CFTE29o⫺ cells
were responsive to the TLR2/6 agonist MALP-2. Interestingly,
MALP-2 failed to induce a response in the non-CF cell line, suggesting that MALP-2 responsiveness may be enhanced in cells
with impaired CFTR and raises the question of whether TLR2 may
be a modifier gene for CF. Many studies have proposed the linkage
between mutations in CFTR and other genetic loci (40), and it is
possible that mutations in CFTR and TLR genes could be linked
given the important role of TLR agonists in CF lung disease. The
enhanced MALP-2 responsiveness of the CF cell line compared
with non-CF cells could also be due to the less tight junctions of
CF airway epithelial cells, thus enabling MALP-2 to access additional TLR2 proteins on the basolateral surface of the CFTE29o⫺
cells (30). Alternatively, the differential responses observed may
be due to tissue specificity given that CF cell line tested was derived from trachea, whereas the non-CF cell line was bronchial
derived. Differential responses in these two cell types have been
documented in the past (41). Our finding that TLR9 is expressed
on the surface of epithelial cells is in contrast to studies performed
using macrophages in which TLR9 was found to be localized to
endosomes and shown to become activated following internalization of uCpG DNA (42). Similar to a previous report, we found
that expression of CD14 by CF and non-CF airway epithelial cells
was low (27).
Activation of TLRs 2/6, 2/1, 4, and 9 by their cognate agonists
induced proinflammatory responses in the CF airway epithelial
cells. Expression of IL-6, IL-8, and ICAM-1, all NF-␬B-regulated
genes, was increased both time and dose dependently following
stimulation with lipopeptides, LPS, or uCpG DNA. MALP-2 is
active at very low concentrations and induced functional responses
at doses of 4 – 400 ng/ml. In contrast, the levels of triacylated lipopeptide and LPS required to induce similar responses were significantly higher, 1–50 ␮g/ml; however, these amounts are physiologically relevant in CF in vivo. In the context of CF, IL-8 is
particularly important, as it is a potent neutrophil chemotactic factor (43). It attracts neutrophils to the inflammatory site, where their
transepithelial passage is facilitated by ICAM-1 (44). uCpG was a
less potent stimulus than lipopeptides or LPS, inducing its effects
at 48 –72 h rather than 24 h poststimulation. This is a cell-specific
phenomenon, as we found that uCpG could strongly induce IL-8
expression in myelomonocytic U937 cells at 24 h.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
BALF isolated from individuals with CF (CF BALF) contains
proinflammatory factors present within the CF lung, including LPS
(39), bacterial DNA, and NE, among others. The seven pooled CF
BALF samples contained 677 endotoxin U/ml, equivalent to 1.4
␮g/ml LPS, and 743 ␮g/ml NE, which had 14.3% activity and is
equivalent to 3.7 ␮M NE. Given that the process of CF BALF
collection involves a 25- to 50-fold dilution of epithelial lining
fluid, these values correspond to ⬃35–70 ␮g/ml LPS and 92–185
␮M NE on the respiratory surface in vivo. PAO1-specific gene
primers were used in PCR to detect the Pseudomonas flagellin
subunit gene, fliC, and the Pseudomonas elastase gene, lasB, in
each CF BALF sample (Fig. 4A). fliC and lasB were detected in
four BALF samples (lanes 1, 2, 4, and 7). We assessed the ability
of CF BALF (10 ␮l) to induce IL-8 protein production from
CFTE29o⫺ cells and compared its effects with those of NE and
LPS alone and in combination (Fig. 4B). Stimulation with both NE
(10 nM) and LPS (10 ␮g/ml) together induced higher levels of
IL-8 production compared with each agonist used alone, and their
combined effects were less than those induced by 10 ␮l of CF
BALF, which contains 37 nM NE and 14 ng of LPS, and many
other proinflammatory factors.
NF-␬B reporter gene expression in CFTE29o⫺ cells was measured in response to stimulation with pooled CF BALF or lipopeptide, LPS, or PMA for 18 h. Each of these agonists significantly
increased NF-␬B reporter gene expression ( p ⬍ 0.05) compared
with untreated cells (Fig. 5). uCpG DNA did not increase reporter
gene expression at 18 h (data not shown). Cotransfection with a
plasmid expressing a signaling-deficient mutant of MyD88, termed
⌬MyD88, inhibited the stimulatory effects of lipopeptide, LPS,
and CF BALF by 40 ⫾ 15, 43 ⫾ 4, and 33 ⫾ 1%, respectively
( p ⬍ 0.05). PMA-induced NF-␬B reporter gene activation was not
inhibited by ⌬MyD88.
TLRs AND CF AIRWAY EPITHELIAL CELLS
The Journal of Immunology
1643
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 3. IL-6 and ICAM-1 expression are increased by lipopeptides, LPS, and uCpG DNA in CFTE29o⫺ cells. A, CFTE29o⫺ cells (1 ⫻ 105/ml) were
left untreated (⫺) or stimulated with increasing doses (⫹, ⫹⫹, ⫹⫹⫹) of diacylated (MALP-2 at 4, 40, and 400 ng/ml) or triacylated (Pam3) lipopeptide
or LPS (1, 10, or 50 ␮g/ml) for 24 h, or uCpG DNA (at 1, 10, or 100 ␮g/ml) for 48 h. Levels of IL-6 in cell supernatants were measured by ELISA, and
values are expressed as picograms per milliliter (ⴱ, p ⱕ 0.05). B, The effects of polymixin B (1 ␮g/ml, as appropriate) and actinomycin D (10 ␮g/ml, 1 h)
on Pam3 (10 ␮g/ml), LPS (10 ␮g/ml), or uCpG (100 ␮g/ml) were also evaluated. C, ICAM-1 expression was quantified on CFTE29o⫺ cells stimulated
with lipopeptide (Pam3), LPS, uCpG DNA (all at 10 ␮g/ml), or TNF-␣ (10 ng/ml) for 48 h. Cells (2 ⫻ 104) were grown in chamber slides, Fc blocked,
and labeled with FITC-conjugated anti-ICAM-1 or an isotype control Ab. Cells were counterstained with PI, and ICAM-1 surface expression was quantified
by laser-scanning microscopy. Assays were performed in duplicate and are representative of at least three separate experiments.
1644
TLRs AND CF AIRWAY EPITHELIAL CELLS
FIGURE 4. Characterization of CF BALF. A, CF BALF samples (10
␮l) were used as template in PCR using PAO1-specific gene primers for
fliC and lasB. The products were electrophoresed on 1.5% TBE agarose
gels containing 0.5 ␮g/ml ethidium bromide and visualized under UV.
Representative gels are shown (n ⫽ 3). B, CFTE29o⫺ cells (1 ⫻ 105/ml)
were left untreated or stimulated with NE (10 nM) or LPS (10 ␮g/ml) alone
or in combination or CF BALF (10 ␮l) for 24 h. Levels of IL-8 in supernatants were measured by ELISA, and values are expressed as relative IL-8
production (ⴱ, p ⱕ 0.05 compared with control).
ulated during biofilm formation (48, 49) and by azithromycin (50),
an antibiotic commonly prescribed to individuals with CF, and, as
such, flagellin may not be a major proinflammatory stimulus in the
CF lung with an established Pseudomonas biofilm.
CF BALF contains a representative sampling of host and pathogen factors present on the epithelial surface of the lung. In addition
to LPS (39), we also detected PAO1 DNA in our CF BALF samples. It has previously been shown that uCpG DNA isolated from
CF sputum induces lower respiratory tract inflammation in an animal model (51); however, the epithelium may not play a major
role in these events given that TLR9-induced responses were relatively weak in the CFTE29o⫺ and 16HBE14o⫺ cells. Viruses and
ssRNA and dsRNA may also be present in CF BALF. These potentially signal via TLRs 3, 7, 8, and 9 (13, 22, 23, 52) (and TLR4,
in the case of respiratory syncitial virus (53)) and are likely to be
A primary aim of this work was to examine whether so-called
nonimmune airway epithelial cells contribute to the inflammatory
response in the CF lung. Given that airway epithelial cells do induce functional TLR responses, it appears that they have an important role in pulmonary inflammation in CF given their immense
surface area. In addition to lipopeptides, LPS, and uCpG DNA, we
also evaluated the proinflammatory properties of PCM and CF
BALF on IL-6 and IL-8 protein production by CFTE29o⫺ cells.
PCM contains factors secreted by stationary phase culture of
PAO1, and is highly proinflammatory (45). As well as lipopeptides, LPS, and uCpG DNA, other immunostimulatory factors
present in PCM are likely to include flagellin, pyocyanins, Pseudomonas elastases, and exotoxins. Flagellin, the major structural
component of flagella, is encoded by the fliC gene. Purified rFliC
from Salmonella enteritidis is a potent inducer of cytokine synthesis in macrophages (46), and Salmonella typhimurium flagellin
has been shown to induce IL-8 production by intestinal epithelial
cells (47). Like other members of the TLR family, TLR5 signals
via the same intracellular signaling molecules. In this study, we did
not directly evaluate the proinflammatory effects of PAO1 flagellin
on TLR5-mediated responses because in the CF lung Pseudomonas exists as a biofilm. Flagellin subunit genes are negatively reg-
FIGURE 6. ⌬MyD88 and ⌬Mal inhibit lipopeptide-, LPS-, and CF
BALF-induced IL-8 protein expression in CFTE29o⫺ cells. CFTE29o⫺
cells (1 ⫻ 105) were transfected with pCDNA3.1 or pDC304 (empty vectors), ⌬MyD88, or Mal P/H expression plasmids. Twenty-four hours posttransfection, cells were left untreated or stimulated with lipopeptide (Pam3,
10 ␮g/ml), LPS (10 ␮g/ml), CF BALF (10 ␮l), or PMA (50 ng/ml) for
18 h, and IL-8 protein production in cell supernatants was measured by
ELISA (ⴱ, p ⬍ 0.05). Data are expressed as IL-8 picograms per milliliter.
Assays were performed in duplicate and are representative of at least three
separate experiments.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 5. ⌬MyD88 inhibits lipopeptide-, LPS-, and CF BALF-induced NF-␬B reporter gene expression in CFTE29o⫺ cells. CFTE29o⫺
cells (1 ⫻ 105) were cotransfected with an NF-␬B5-linked luciferase reporter plasmid and either pCDNA3.1 (empty vector) or a ⌬MyD88 expression plasmid. Twenty-four hours posttransfection, cells were left untreated or stimulated with lipopeptide (Pam3, 10 ␮g/ml), LPS (10 ␮g/ml),
CF BALF (10 ␮l), or PMA (50 ng/ml) for 18 h, then lysed, and reporter
gene activity was quantified by luminometry (ⴱ, p ⬍ 0.05). Data are expressed as relative luciferase activity. Assays were performed in duplicate
and are representative of at least three separate experiments.
The Journal of Immunology
Acknowledgments
We are grateful to A. Bowie (Trinity College) for providing pDC304 and
Mal P/H vectors; D. Gruenert (University of Vermont) for the CFTE29o⫺,
CFBE41o⫺, and 16HBE14o⫺ cell lines; and R. Hancock (University of
British Columbia) for P. aeruginosa strain 01.
References
1. Rommens, J. M., M. C. Iannuzzi, B.-S. Kerem, M. L. Drumm, G. Melmer,
M. Dean, R. Rozmahel, J. L. Cole, D. Kennedy, N. Hidaka, et al. 1989. Identification of the cystic fibrosis gene: chromosome walking and jumping. Science
245:1059
2. Riordan, J. R., J. M. Rommens, B.-S. Kerem, N. Alon, R. Rozmahel,
Z. Grzelczak, J. Zielenski, S. Lok, N. Plavsic, J.-L. Chou, et al. 1989. Identification of the cystic fibrosis gene: cloning and characterization of complementary
DNA. Science 245:1066
3. Birrer, P., N. G. McElvaney, A. Rudeberg, C. W. Sommer, C. Liechti-Gallati,
R. Kraemer, R. Hubbard, and R. G. Crystal. 1994. Protease-Antiprotease imbalance in the lungs of children with cystic fibrosis. Am. J. Respir. Crit. Care Med.
150:207.
4. Konstan, M. W., K. A. Hilliard, T. M. Norvell, and M. Berger. 1994. Bronchoalveolar lavage findings in cystic fibrosis patients with stable, clinically mild lung
disease suggest ongoing infection and inflammation. Am. J. Respir. Crit. Care
Med. 150:448.
5. Balough, K., M. McCubbin, M. Weinberger, W. Smits, R. Ahrens, and R. Fick.
1995. The relationship between infection and inflammation in the early stages of
lung disease from cystic fibrosis. Pediatr. Pulmonol. 20:63.
6. Khan, T. Z., J. S. Wagener, T. Bost, J. Martinez, F. J. Accurso, and D. W. Riches.
1995. Early pulmonary inflammation in infants with cystic fibrosis. Am. J. Respir.
Crit. Care Med. 151:939.
7. Nakamura, H., K. Yoshimura, N. G. McElvaney, and R. G. Crystal. 1992. Neutrophil elastase in respiratory epithelial lining fluid of individuals with cystic
fibrosis induces interleukin-8 gene expression in a human bronchial epithelial cell
line. J. Clin. Invest. 89:1478.
8. Takeda, K., T. Kaisho, and S. Akira. 2003. Toll-like receptors. Annu. Rev. Immunol. 21:335.
9. Akira, S. 2003. Mammalian Toll-like receptors. Curr. Opin. Immunol. 15:5.
10. Akira, S. 2003. Toll-like receptor signaling. J. Biol. Chem. 278:38105.
11. Medzhitov, R., P. Preston-Hurlburt, and C. A. Janeway, Jr. 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity.
Nature 388:394.
12. Aliprantis, A. O., R. B. Yang, M. R. Mark, S. Suggett, B. Devaux, J. D. Radolf,
G. R. Klimpel, P. Godowski, and A. Zychlinsky. 1999. Cell activation and apoptosis by bacterial lipoproteins through Toll-like receptor-2. Science 285:736.
13. Alexopoulou, L., A. C. Holt, R. Medzhitov, and R. A. Flavell. 2001. Recognition
of double-stranded RNA and activation of NF-␬B by Toll-like receptor 3. Nature
413:732.
14. Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell,
E. Alejos, M. Silva, C. Galanos, et al. 1998. Defective LPS signaling in C3H/HeJ
and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085.
15. Qureshi, S. T., L. Lariviere, G. Leveque, S. Clermont, K. J. Moore, P. Gros, and
D. Malo. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 4
(Tlr4). J. Exp. Med. 189:615.
16. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda,
and S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are
hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J. Immunol. 162:3749.
17. Devaney, J. M., C. M. Greene, C. C. Taggart, T. P. Carroll, S. J. O’Neill, and
N. G. McElvaney. 2003. Neutrophil elastase up-regulates interleukin-8 via Tolllike receptor 4. FEBS Lett. 544:129.
18. Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett,
J. K. Eng, S. Akira, D. M. Underhill, and A. Aderem. 2001. The innate immune
response to bacterial flagellin is mediated by Toll-like receptor 5. Nature
410:1099.
19. Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto,
K. Hoshino, H. Wagner, K. Takeda, and S. Akira. 2000. A Toll-like receptor
recognizes bacterial DNA. Nature 408:740.
20. Takeuchi, O., S. Sato, T. Horiuchi, K. Hoshino, K. Takeda, Z. Dong,
R. L. Modlin, and S. Akira. 2002. Cutting edge: role of Toll-like receptor 1 in
mediating immune response to microbial lipoproteins. J. Immunol. 169:10.
21. Ozinsky, A., D. M. Underhill, J. D. Fontenot, A. M. Hajjar, K. D. Smith,
C. B. Wilson, L. Schroeder, and A. Aderem. 2000. The repertoire for pattern
recognition of pathogens by the innate immune system is defined by cooperation
between Toll-like receptors. Proc. Natl. Acad. Sci. USA 97:13766.
22. Heil, F., H. Hemmi, H. Hochrein, F. Ampenberger, C. Kirschning, S. Akira,
G. Lipford, H. Wagner, and S. Bauer. 2004. Species-specific recognition of single-stranded RNA via Toll-like receptor 7 and 8. Science 303:1526.
23. Diebold, S. S., K. Tsuneyasu, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004.
Innate antiviral responses by means of TLR7-mediated recognition of singlestranded RNA. Science 303:1529.
24. O’Neill, L. A., and C. Greene. 1998. Signal transduction pathways activated by
the IL-1 receptor family: ancient signaling machinery in mammals, insects, and
plants. J. Leukocyte Biol. 63:650.
25. Bowie, A., and L. A. O’Neill. 2000. The interleukin-1 receptor/Toll-like receptor
superfamily: signal generators for pro-inflammatory interleukins and microbial
products. J. Leukocyte Biol. 67:508.
26. Wang, X., Z. Zhang, J.-P. Louboutin, C. Moser, D. J. Weiner, and J. M. Wilson.
2003. Airway epithelia regulate expression of human ␤-defensin 2 through Tolllike receptor 2. FASEB J. 17:1727.
27. Guillot, L., S. Medjane, K. Le-Barillec, V. Balloy, C. Danel, M. Chignard, and
M. Si-Tahar. 2004. Response of human pulmonary epithelial cells to lipopolysaccharide involves Toll-like receptor 4 (TLR4)-dependent signaling pathways:
evidence for an intracellular compartmentalization of TLR4. J. Biol. Chem.
279:2712.
28. Muir, A., G. Soong, S. Sokol, B. Reddy, M. Gomez, A. Van Heeckeren, and
A. Prince. 2003. Toll like receptors in normal and cystic fibrosis airway epithelial
cells. Am. J. Respir. Cell Mol. Biol. 30:777.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
important in modulating the immune response in the CF lung during viral infection. Another abundant factor present in the CF
BALF was NE, the neutrophil-derived protease that can induce
IL-8 gene expression in bronchial epithelial cells via TLR4 (7, 17).
Given the heterogeneous composition of CF BALF, it is unlikely
that any one single factor is entirely responsible for the proinflammatory properties of CF BALF. Our studies measuring the costimulatory effects of different TLR agonists suggest that different
components within CF BALF may be additive and combine to
induce its potent proinflammatory effects.
We have previously demonstrated that NE-induced IL-8 expression can be inhibited by ⌬MyD88 (54). Building on these studies,
we show in this study that ⌬MyD88 also inhibits NF-␬B-linked
reporter gene expression in CF airway epithelial cells in response
to lipopeptide, LPS, and CF BALF. Furthermore, both ⌬MyD88
and a dominant-negative mutant of its adaptor Mal can abrogate
IL-8 protein production by each of these stimuli, providing direct
evidence of a potential role for these inhibitors as CF therapeutics.
Pulmonary inflammation in CF is characterized by production of
thick inspissated mucus, bacterial colonization, and severe inflammation, and because of this, many of the efforts directed toward
curing CF have targeted the lungs. The results to date with gene
therapy have been disappointing, and now many CF researchers
are considering a multifaceted approach to curing CF, recognizing
that therapies that ameliorate abnormal mucus production, bacterial colonization, and inflammation will almost certainly lead to
improved survival.
In addition to MyD88 and Mal, other TIR domain adaptor proteins exist that function in a MyD88-independent fashion. The
TRIF protein is responsible for eliciting TLR3 response to viruses
and some TLR4 responses to LPS (55, 56). Both TLRs using TRIF
to induce IFN-regulatory factor (IRF)-3 or -7 regulated expression
of genes encoding IFN-␣ and -␤, IFN-␥-inducible protein-10, and
RANTES. Two additional TIR domain-containing adaptors have
been identified in humans, termed TRIF-related adaptor molecule
and sterile ␣ and HEAT-Armadillo motifs (57). TRIF-related
adaptor molecule participates in the TLR4 MyD88-independent
pathway, leading to activation of NF-␬B and IRF-3 and -7,
whereas sterile ␣ and HEAT-Armadillo motifs have yet to be characterized fully. However, it remains to be shown whether targeting
the MyD88-independent signaling pathway represents a therapeutic target for preventing inflammation in CF, as there is no information regarding activation of IRF-3/7, IFN-␣ or -␤, or IFN-␥inducible protein-10 in CF; however, aberrantly low levels of
RANTES are secreted by CF airway epithelial cells, suggesting
that this pathway may be impaired in CF cells (58, 59). Nonetheless, it is clear from this and other studies in our laboratory that
inhibitors based on the TIR domain of MyD88 or its orthologues
could potentially ameliorate pulmonary inflammation induced by
TLR and IL-1R agonists. An important challenge for the future
will be to develop suitable delivery methods for these inhibitors
and determine their compatibility with current conventional CF
therapies.
1645
1646
45. Wehmhoner, D., S. Haussler, B. Tummler, L. Jansch, F. Bredenbruch,
J. Wehland, and I. Steinmetz. 2003. Inter- and intraclonal diversity of the Pseudomonas aeruginosa proteome manifests within the secretome. J. Bacteriol.
185:5807.
46. Moors, M. A., L. Li, and S. B. Mizel. 2001. Activation of interleukin-1 receptorassociated kinase by Gram-negative flagellin. Infect. Immun. 69:4424.
47. Gewirtz, A. T., P. O. Simon, Jr., C. K. Schmitt, L. J. Taylor, C. H. Hagedorn,
A. D. O’Brien, A. S. Neish, and J. L. Madara. 2001. Salmonella typhimurium
translocates flagellin across intestinal epithelia, inducing a proinflammatory response. J. Clin. Invest. 107:99.
48. Sauer, K., and A. K. Camper. 2001. Characterization of phenotypic changes in
Pseudomonas putida in response to surface-associated growth. J. Bacteriol.
183:6579.
49. Prigent-Combaret, C., O. Vidal, C. Dorel, and P. Lejeune. 1999. Abiotic surface
sensing and biofilm-dependent regulation of gene expression in Escherichia coli.
J. Bacteriol. 181:5993.
50. Kawamura-Sato, K., Y. Iinuma, T. Hasegawa, T. Yamashino, and M. Ohta. 2001.
Postantibiotic suppression effect of macrolides on the expression of flagellin in
Pseudomonas aeruginosa and Proteus mirabilis. J. Infect. Chemother. 7:51.
51. Schwartz, D. A., T. J. Quinn, P. S. Thorne, S. Sayeed, A. K. Yi, and A. M. Krieg.
1997. CpG motifs in bacterial DNA cause inflammation in the lower respiratory
tract. J. Clin. Invest. 100:68.
52. Lund, J., A. Sato, S. Akira, R. Medzhitov, and A. Iwasaki. 2003. Toll-like receptor 9-mediated recognition of Herpes simplex virus-2 by plasmacytoid dendritic cells. J. Exp. Med. 198:513.
53. Kurt-Jones, E. A., L. Popova, L. Kwinn, L. M. Haynes, L. P. Jones, R. A. Tripp,
E. E. Walsh, M. W. Freeman, D. T. Golenbock, L. J. Anderson, and
R. W. Finberg. 2000. Pattern recognition receptors TLR4 and CD14 mediate
response to respiratory syncytial virus. Nat. Immunol. 1:398.
54. Walsh, D. E., C. M. Greene, T. P. Carroll, C. C. Taggart, P. M. Gallagher, S. J.
O’Neill, and N. G. McElvaney. 2001. Interleukin-8 up-regulation by neutrophil
elastase is mediated by MyD88/IRAK/TRAF-6 in human bronchial epithelium.
J. Biol. Chem. 276:35494.
55. Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo,
O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda, and S. Akira. 2003. Role of
adaptor TRIF in the MyD88-independent Toll-like receptor signaling pathway.
Science 301:640.
56. Fitzgerald, K. A., D. C. Rowe, B. J. Barnes, D. R. Caffrey, A. Visintin, E. Latz,
B. Monks, P. M. Pitha, and D. T. Golenbock. 2003. LPS-TLR4 signaling to
IRF-3/7 and NF-␬B involves the Toll adapters TRAM and TRIF. J. Exp. Med.
198:1043.
57. O’Neill, L. A., K. A. Fitzgerald, and A. G. Bowie. 2003. The Toll-IL-1 receptor
adaptor family grows to five members. Trends Immunol. 24:286.
58. Koller, D. Y., I. Nething, J. Otto, R. Urbanek, and I. Eichler. 1997. Cytokine
concentrations in sputum from patients with cystic fibrosis and their relation to
eosinophil activity. Am. J. Respir. Crit. Care Med. 155:1050.
59. Tabary, O., C. Muselet, S. Escotte, F. Antonicelli, D. Hubert, D. Dusser, and
J. Jacquot. 2003. Interleukin-10 inhibits elevated chemokine interleukin-8 and
regulated on activation normal T cell expressed and secreted production in cystic
fibrosis bronchial epithelial cells by targeting the I␬B kinase ␣/␤ complex.
Am. J. Pathol. 162:293.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
29. Schwiebert, E. M., N. Kizer, D. C. Gruenert, and B. A. Stanton. 1992. GTPbinding proteins inhibit cAMP activation of chloride channels in cystic fibrosis
airway epithelial cells. Proc. Natl. Acad. Sci. USA 89:10623.
30. Cozens, A. L., M. J. Yezzi, L. Chin, E. M. Simon, W. E. Finkbeiner,
J. A. Wagner, and D. C. Gruenert. 1992. Characterization of immortal cystic
fibrosis tracheobronchial gland epithelial cells. Proc. Natl. Acad. Sci. USA
89:5171.
31. Cozens, A. L., M. J. Yezzi, K. Kunzelmann, T. Ohrui, L. Chin, K. Eng,
W. E. Finkbeiner, J. H. Widdicombe, and D. C. Gruenert. 1994. CFTR expression
and chloride secretion in polarized immortal human bronchial epithelial cells.
Am. J. Respir. Cell Mol. Biol. 10:38.
32. Klech, H., and W. Pohl. 1989. Technical recommendations and guidelines for
bronchoalveolar lavage (BAL): report of the European Society of Pneumology
Task Group. Eur. Respir. J. 2:561.
33. Taggart, C., R. J. Coakley, P. Greally, G. Canny, S. J. O’Neill, and
N. G. McElvaney. 2000. Increased elastase release by CF neutrophils is mediated
by tumor necrosis factor-␣ and interleukin-8. Am. J. Physiol. Lung Cell Mol.
Physiol. 278:L33.
34. Wewers, M. D., M. A. Casolaro, S. E. Sellers, S. C. Swayze, K. M. McPhaul,
J. T. Wittes, and R. G. Crystal. 1987. Replacement therapy for ␣1-antitrypsin
deficiency associated with emphysema. N. Engl. J. Med. 316:1055.
35. Muzio, M., J. Ni, P. Feng, and V. M. Dixit. 1997. IRAK (Pelle) family member
IRAK-2 and MyD88 as proximal mediators of IL-1 signaling. Science 278:1612.
36. Muzio, M., G. Natoli, S. Saccani, M. Levrero, and A. Mantovani. 1998. The
human Toll signaling pathway: divergence of nuclear factor ␬B and JNK/SAPK
activation upstream of tumor necrosis factor receptor-associated factor 6
(TRAF6). J. Exp. Med. 187:2097.
37. Fitzgerald, K. A., E. M. Palsson-McDermott, A. G. Bowie, C. A. Jefferies,
A. S. Mansell, G. Brady, E. Brint, A. Dunne, P. Gray, M. T. Harte, et al. 2001.
Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal transduction. Nature 413:78.
38. Hartmann, G., G. J. Weiner, and A. M. Krieg. 1999. CpG DNA: a potent signal
for growth, activation, and maturation of human dendritic cells. Proc. Natl. Acad.
Sci. USA 96:9305.
39. Muhlebach, M. S., and T. L. Noah. 2002. Endotoxin activity and inflammatory
markers in the airways of young patients with cystic fibrosis. Am. J. Respir. Crit.
Care Med. 2002. 165:911.
40. Devaney, J., M. Maher, T. Smith, J. A. Houghton, and M. Glennon. 2003. HFE
alleles in an Irish cystic fibrosis population. Genet. Test 7:155.
41. Walsh, D. E., B. J. Harvey, and V. Urbach. 2000. CFTR regulation of intracellular calcium in normal and cystic fibrosis human airway epithelia. J. Membr.
Biol. 177:209.
42. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser,
K. Heeg, G. B. Lipford, and H. Wagner. 1998. CpG-DNA-specific activation of
antigen-presenting cells requires stress kinase activity and is preceded by nonspecific endocytosis and endosomal maturation. EMBO J. 17:6230.
43. Matsushima, K., and J. J. Oppenheim. 1989. Interleukin 8 and MCAF: novel
inflammatory cytokines inducible by IL 1 and TNF. Cytokine 1:2.
44. Mukaida, N. 2003. Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases. Am. J. Physiol. Lung Cell Mol. Physiol. 284:L566.
TLRs AND CF AIRWAY EPITHELIAL CELLS