Oncogene (1999) 18, 4515 ± 4521
ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $12.00
http://www.stockton-press.co.uk/onc
Human POMp75 is identi®ed as the pro-oncoprotein TLS/FUS: both
POMp75 and POMp100 DNA homologous pairing activities are
associated to cell proliferation
Pascale Bertrand1,2,4, Alexandre T Akhmedov2,4,5, Fabien Delacote1, Antoine Durrbach3 and
Bernard S Lopez*,1,2
1
CEA, DSV, DRR, CNRS UMR 217, 60-68 av. du GeÂneÂral Leclerc, BP6, 92265, Fontenay aux Roses, France; 2Institut Curie,
Section de Biologie, 26 rue d'Ulm, 75231 Paris Cedex 05, France; 3Groupe Hospitalier Bichat-Claude Bernard, 46 rue Henri
Huchard, 75877 Paris Cedex 18, France
We have previously developed an assay to measure DNA
homologous pairing activities in crude extracts: The
POM blot. In mammalian nuclear extracts, we detected
two major DNA homologous pairing activities:
POMp100 and POMp75. Here, we present the puri®cation and identi®cation of POMp75 as the pro-oncoprotein TLS/FUS. Because of the pro-oncogene status of
TLS/FUS, we studied in addition, the relationships
between cell proliferation and POM activities. We show
that transformation of human ®broblasts by SV40 large
T antigen results in a strong increase of both POMp100
and TLS/POMp75 activities. Although detectable levels
of both POMp100 and TLS/POMp75 are observed in
non-immortalized ®broblasts or lymphocytes, ®broblasts
at mid con¯uence or lymphocytes stimulated by
phytohaemaglutinin, show higher levels of POM activities. Moreover, induction of di€erentiation of mouse F9
line by retinoic acid leads to the inhibition of both
POMp100 and TLS/POMp75 activities. Comparison of
POM activity of TLS/FUS with the amount of TLS
protein detected by Western blot, suggests that the POM
activity could be regulated by post-translation modi®cation. Taken together, these results indicate that
POMp100 and TLS/POMp75 activitites are present in
normal cells but are connected to cell proliferation.
Possible relationship between cell proliferation, response
to DNA damage and DNA homologous pairing activity
of the pro-oncoprotein TLS/FUS are discussed.
Keywords: TLS/FUS; DNA homologous pairing; cell
proliferation; recombination
Introduction
DNA homologous pairing (DHP), a central step in
homologous recombination, is implicated in fundamental processes such as chromosome pairing (Roeder,
1990; Kleckner, 1996), gene inactivation (Rossignol
and Faugeron, 1994), initiation of some replication
processes (Formosa and Alberts, 1986; Malkova et al.,
1996) and DNA repair (Friedberg et al., 1995).
*Correspondence: BS Lopez
4
The ®rst two authors contributed equally to this study
5
Current address: Basel Institute for Immunology, Grenzacherstrasse
487 Postfach, CH-4005 Basel, Switzerland
Received 1 April 1999; revised 29 June 1999; accepted 29 June 1999
The RecA protein from Escherichia coli represents
the paradigm for DHP proteins. In vivo its role in
mutagenesis, DNA repair and recombination is well
documented. In vitro, RecA protein is able to pair
single stranded DNA (ssDNA) with double stranded
DNA (dsDNA) in a homology dependent manner (for
review see Roca and Cox, 1990; Radding, 1991; West,
1992; Kowalczykowski and Eggleston, 1994). Besides
the RecA protein, the bacterial RecO and RecT
proteins are also able to promote in vitro D-loop
formation, the ®rst DNA heteroduplex intermediate
formed between recombining DNA (Luisi-DeLuca,
1995; Noirot and Kolodner, 1998). In eukaryotes the
situation gains in complexity. The Saccharomyces
cerevisiae ScRad51 protein displays structural and
biochemical similarities with RecA protein (Aboussekhra et al., 1992; Basile et al., 1992; Shinohara et al.,
1992; Sung, 1994). However, S. cerevisiae possesses
three other recA homologues: RAD55, RAD57 (Kans
and Mortimer, 1991; Lovett, 1994) and the meiosis
speci®c DMC1 (Bishop et al., 1992). In mammalian
cells, the situation seems to be even more complex.
Indeed, a growing number of Rad51 homologues are
reported. They include: RAD51, HsREC2/RAD51B,
RAD51C, RAD51D, XRCC2 and XRCC3 (Shinohara
et al., 1993; Yoshimura et al., 1993; Albala et al., 1997;
Rice et al., 1997; Dosanjh et al., 1998; Pittman et al.,
1998; Cartwright et al., 1998). Additionally, a human
Dmc1 protein able to promote in vitro D-loop
formation has been reported (Li et al., 1997).
Mammalian RAD51 protein has developed new
functions since, in contrast with recA in bacteria and
with ScRAD51 in yeast, it is an essential gene probably
involved in cell proliferation (Tsuzuki et al., 1996;
Yamamoto et al., 1996). Human Rad51 protein has
also been described as interacting with tumor
suppressor proteins such as p53, Brca1 and Brca2
(Sturzbecher et al., 1996; Buchhop et al., 1997; Scully
et al., 1997; Mizuta et al., 1997; Marmorstein et al.,
1998).
Facing this extreme complexity and both structural
homologues and enzymatic activities redundancy, the
biochemical screen for new DHP activities in
mammalian cells constitutes a possible complementary
approach. However, this approach has often been
compromised by the presence of exonuclease activities
that can lead to artefacts (Kaslan and Heyer, 1994).
We have developed an in vitro assay to measure DNA
homologous pairing activities on nitrocellulose membranes: the POM (Pairing On Membrane) blot
(Bertrand et al., 1993). The main characteristics of
TLS/POMp75 DNA pairing activity in cell proliferation
P Bertrand et al
4516
the RecA-mediated pairing reaction are conserved
under the POM blot conditions (Bertrand et al.,
1993, 1995). In mammalian nuclear extracts, the assay
has revealed two major homologous pairing activities,
displayed by proteins of apparent molecular weight of
100 kDa (POMp100) and 75 kDa (POMp75). An
important characteristic of these proteins is that they
are able to promote stable DNA plectonemic joint
formation without requiring associated exonuclease
activity (Akhmedov et al., 1995). Recently, POMp100
activity has been reported to be increased in extracts
from Fanconi anemia cells, a hereditary syndrome
associated with cancer predisposition, hypersensitivity
to DNA interstrand crosslinks and genome instability
(Thyagarajan and Campbell, 1997). Human POMp75
(HsPOMp75) activity is also increased in Ataxia
Telangiectasia (AT) cells (manuscript in preparation),
a hereditary syndrome associated with cancer predisposition, cell cycle defects, increased sensitivity to
ionizing radiation and a high level of spontaneous
homologous recombination (Meyn, 1993; Luo et al.,
1996).
In the present study, we describe the puri®cation of
POMp75 and its identi®cation as the human prooncogene TLS (also named FUS). TLS (Translocated
in LipoSarcomas) is a member of a family of genes,
that include the Ewing sarcoma (EWS) gene and
hTAF(II)68 associated to TFIID and RNA polymerase II (Bertolotti et al., 1996). In sarcomas or
leukemias, chromosomal translocation of TLS or
EWS with speci®c partners creates fusion oncoproteins (Delattre et al., 1992; Crozat et al., 1993;
Rabbitts et al., 1993; Ichikawa et al., 1994).
However, despite intense investigations, little is
known about the function of the cellular genes
(Ron, 1997). Our results suggest a new role for
TLS: promotion of DNA homologous pairing. In
addition, considering TLS is a pro-oncogene and the
possible role for the major DHP protein, Rad51 in
cell proliferation, we have analysed the relationship
between the DHP activity of TLS/POMp75 and cell
proliferation.
that they all belong to the human TLS/FUS protein
(Crozat et al., 1993; Rabbitts et al., 1993).
To con®rm this result, we performed two additional
experiments. First, TLS was immunoprecipitated from
nuclear extract with the monoclonal anti-TLS 4H11
antibody (Zinzsner et al., 1997). HsPOMp75 activity is
recovered in the TLS immuno-conjugate as POMp100
is not (Figure 2a). Thus the monoclonal anti-TLS
antibody speci®cally recognizes the POMp75 activity.
Second, the cDNA encoding TLS has been cloned in a
GST-fusion bacterial expression vector. In bacteria
transfected with the fusion construct, both anti-GST
and anti-POMp75 antibodies (raised against the
protein puri®ed here) recognize a peptide with a
molecular weight corresponding to the fusion GSTTLS protein (Figure 2b).
TLS/FUS activity has been described to be
important for the growth factor independence of
BCR/ABL transformed cells (Perrotti et al., 1998).
We thus examined the DHP activity displayed by TLS
in di€erent conditions known to modulate cell
proliferation.
Transformation of ®broblasts with SV40 large T antigen
stimulates POM activities
We have analysed the POM activities in three di€erent
primary ®broblast strains and in their corresponding
SV40 transformed derivatives (Figure 3a).
It has been reported previously that POM activities
were undetectable in non immortalized cells (Thyagarajan et al., 1996). We show here that at least two
di€erent strains of ®broblasts (AS3 and 1BR) exhibit
detectable POMp100 and TLS/POMp75 activities
(Figure 3a). However, in the SV40 transformed cell
lines, POMp100 and TLS/POMp75 activities are
Results
Identi®cation of POMp75 as TLS/FUS
Using the POM blot assay, we have previously
characterized a 75-kDa DHP activity (POM75) in
human nuclear extracts, that does not require an
association with exonuclease activity to pair homologous DNA (Akhmedov et al., 1995). To identify the
POM75 protein, we fractionated protein extracts by
column chromatography and screened for the POM75
activity by using the POM blot assay on each
chromatography fraction (see Materials and methods). As shown in Figure 1a, POMp75 activity eluted
with a polypeptide of an apparent 75-kDa molecular
weight.
The puri®ed HsPOMp75 was additionally resolved
on a long SDS ± PAGE gel and the band containing the
protein was excised and used to raise polyclonal
antibody against POMp75 and to perform microsequencing of POMp75. Microsequencing yielded four
peptides (Figure 1b). A search of the database revealed
Figure 1 (A) Puri®cation of HsPOMp75 from HeLa cell nuclei.
Aliquots of peak fraction from each step were analysed by SDS ±
PAGE followed by coomassie staining (left panel) and by POM
assay (right panel). HsPOMp75 co-puri®ed with a polypeptide of
an apparent of 75-kDa molecular weight (Fractions II, IIIb, IV).
IIIb corresponds to the ¯ow through and IIIa to one eluted
fraction from the DEAE column. HsPOMp75 was resolved on a
long 9% SDS ± PAGE. Pure HsPOMp75 polypeptide was excised
and microsequenced. (B) Peptide sequences of HsPOMp75,
numbers correspond to amino acid residues in TLS sequence
(Crozat et al., 1993; Rabbitts et al., 1993)
TLS/POMp75 DNA pairing activity in cell proliferation
P Bertrand et al
stimulated. Quanti®cation of pairing activities in
primary and SV40-transformed ®broblasts cell lines
indicates a ninefold increase for POMp100 and a
®vefold for POMp75 in AS3wt2 compared to AS3.
Similar di€erences are observable between 1Br and
1Br-SV. The di€erence is more pronounced between
Jacquot-SV and Jacquot since we do not detect POM
activity in the Jacquot ®broblast strain (Figure 3a).
When comparing the activities by POM blot (Figure
3a) to the amount of TLS protein detected by Western
blot (Figure 3b), it appears that the POM activity is
not directly related to the amount of TLS protein. This
Figure 2 Identi®cation of POMp75 as TLS/FUS. (A) POM blot:
anti-TLS antibody can immuno-precipitate POMp75 activity in
human nuclear extracts. HNE: HeLa nuclear extract. PC:
Preclear. IP-TLS: immunoprecipitation with anti-TLS antibody
(see Materials and methods) (B) Western-blot: Anti-POMp75
antibodies recognize TLS expressed in bacteria. Bacteria containing either the GST-TLS fusion (+) or the empty expression
vector (7) were induced with IPTG. Protein extracts were
analysed by Western blot with the anti-GST antibody (left
panel) or the anti-POMp75 antibody (right panel)
Figure 3 (A) Stimulation of POM activities by SV40 transformation. (B) Western blot using an anti-TLS antibody. AS3, Jacquot,
1BR: non-transformed human ®broblasts. AS3wt2, Jacquot-SV,
1BR-SV: corresponding SV40-transformed ®broblasts
indicates that some post-translation regulation may
stimulate the POM activity of TLS protein. Other types
of immortalized cells (HeLa, L-cells, F9) show high
level of POM activities, comparable to those observed
in SV40 transformed ®broblasts. This suggests that the
increase in POM activities is a common response to cell
immortalization. One possible explanation is that the
strong increase in POM activities is related to an
increase in cell proliferation which is a common
characteristic of transformed cell lines.
POM activities are stimulated in proliferating cells
If POM activities are correlated to cell proliferation,
the state of con¯uence of primary ®broblasts should
in¯uence the extent of these activities. This may explain
why in some respects no POM activities were detected
in extracts from primary ®broblasts (Thyagarajan et
al., 1996).
Thus we compared POM activities in extracts from
cells harvested at mid con¯uence (i.e. proliferating
cells) to ones extracted from cells harvested at high
con¯uence, i.e. in a quiescent state (Figure 4). AS3
®broblasts harvested at mid con¯uence show a twofold
increase in POM activity compared to extracts from
quiescent cells. These results suggest that both POM
activities are correlated to the proliferation status of
the cells.
To con®rm this interpretation, we examined the
POM activities in lymphocytes from peripheral blood
after treatment with PHA, a high ecient mitogen
stimulator. POMp100 and TLS/POMp75 are both
clearly detected in non stimulated lymphocytes,
con®rming their activity in non-immortalized cells
(Figure 5). After addition of PHA, a twofold
stimulation for POMp100 and a sevenfold stimulation
for TLS/POMp75 are detected (Figure 5, left panel).
The amount of TLS protein measured by Western blot
(Figure 5, right panel) is not directly correlated to the
extent of POM 75 activity. These results support the
hypothesis that POM activities are regulated by posttranslation regulation and are increased in proliferating
cells.
Figure 4 Con¯uence inhibits POM activities. Histograms show
the measurement of POM activities by PhosphorImager. C:
con¯uent cell culture; NC: half-con¯uent cell culture. The
®broblasts strain was AS3
4517
TLS/POMp75 DNA pairing activity in cell proliferation
P Bertrand et al
4518
Di€erentiation inhibits POM activities
Induction of di€erentiation leads to an arrest of cell
proliferation. Therefore, if POM activities are linked to
cell proliferation, induction of di€erentiation should
inhibit these activities.
The F9 line (or EC) is a mouse teratocarcinoma line
that can be induced to di€erentiate by addition of
Retinoic Acid (Strickland et al., 1980). In the presence
of retinoic acid, POM activities show an eightfold
decrease for both POMp100 and POMp75 (Figure 6,
left panel). cAMP alone does not induce di€erentiation
per se, but potentiates the e€ect of retinoic acid.
Consistent with this, treatment of F9 cells with cAMP
alone has no e€ect on POM activities, while double
treatment with retinoic acid plus cAMP results in a
more pronounced inhibition (13-fold for POMp100
and 60-fold for POMp75) than treatment with retinoic
acid alone (Figure 6, left panel). Di€erentiation
induction also leads to a decrease in the amount of
TLS protein detected by Western blot (Figure 6, right
panel). However the e€ect is much more pronounced
on the activity than on the amount of protein (compare
Figure 6, left and right panel).
Moreover, POM activities are also inhibited (ninefold for POMp100 and ®vefold for POMp75) in HL60
cells, 48 h after treatment with DMSO, a differentiation inducer for this cell line (data not shown). These
results indicate that both POMp100 and TLS/POMp75
Figure 5 PHA stimulates POM activities in lymphocytes from
peripheral blood (left panel). Western blot using an anti-TLS
antibody (right panel). Lymphocytes from peripheral blood were
grown in absence (mock) or in presence of 5 mg/ml PHA during
48 h
Figure 6 Induction of di€erentiation inhibits POM activities in
mouse F9 line (left panel). Western blot using an anti-TLS
antibody (right panel). Cells were treated with cAMP, retinoic
acid (Ret. Ac.) or both reagents (Ret. Ac.+cAMP). 0=mock
treated control cells
activities are inhibited by activating di€erentiation.
These results also con®rm that both POMp100 and
TLS/POMp75 activities are associated with cell
proliferation.
Discussion
Using the POM blot assay, we described previously
two DNA homologous pairing activities in mammalian
nuclear extracts: POMp100 and POMp75. Interestingly, neither POMp100 nor POMp75 require associated exonuclease activities to promote homologous
pairing (Akhmedov et al., 1995). In this study, we show
that the cellular form of the pro-oncoprotein TLS/FUS
is identical to POMp75. TLS/FUS is a RNA (Zinszner
et al., 1997) and a DNA binding protein (Perrotti et
al., 1998). We show here that the DHP activity
exhibited by TLS/FUS (POMp75) varies as a function
of cell proliferation in di€erent cell types: from
di€erent tissues (transformed or primary ®broblasts,
lymphocytes, embryonic cells), from di€erent mammalian species (human, mouse). However, the comparison
of the amount of TLS protein measured by Western
blot and DHP activities detected by POM blot,
suggests a post translation modi®cation of TLS,
regulating its DHP activity. TLS has been shown to
be a target of the kinase c-Abl that could represent a
good candidate for the regulation of TLS activity on
the DNA (Perrotti et al., 1998). In contrast to what has
been published previously (Thyagarajan et al., 1996),
we clearly detect both POMp100 and TLS/POMp75
activities in non immortalized ®broblasts, the level of
these activities depending on the state of con¯uence of
the cells. This observation was con®rmed by the
unambiguous detection of POMp100 and TLS/
POMp75 activities in non immortalized lymphocytes.
Fibroblasts transformed by SV40 display a strong
stimulation of POM activities. These results are
con®rmed by the stimulation of POM activities by
the mitogen activator PHA in human non-immortalized lymphocytes. We also show that induction of
di€erentiation leads to the inhibition of POM activities.
Taken together, the results show that both POMp100
and TLS/POMp75 activities are associated with cell
proliferation. Therefore, the state of con¯uence is
important when comparing POM activities in extracts
of primary ®broblasts. It cannot be excluded that TLS
is associated to cell proliferation via its role in RNA
processing. Indeed, TLS, EWS and TAF(II)68 have
been described to be associated with the transcription
machinery TFIID and the RNA polymerase II
(Bertolotti et al., 1996). However since DNA-repair
and recombination proteins can interact with the RNA
polymerase II (Maldonado et al., 1996), it is not
known whether TLS plays two di€erent roles (one in
RNA processing and the other in DNA metabolism) or
whether the two functions are connected. Interestingly,
it has been shown that RecA protein displays anity
for RNA (Golub et al., 1992).
Rad51, the major eukaryotic DHP protein, has also
been reported to be associated with cell proliferation
(Tsuzuki et al., 1996; Yamamoto et al., 1996) and
Rad51 devoid chicken cells accumulate chromosome
breaks during the G2/M phase leading to cell death
(Sonoda et al., 1998). This raises the question of how
TLS/POMp75 DNA pairing activity in cell proliferation
P Bertrand et al
DHP activities can participate in cell proliferation. One
hypothesis relies on the fact that strand exchange of
homologous DNA is associated with some particular
replication events in bacteria (Hong et al., 1996),
phages or virus (Formosa and Alberts, 1986; Bortner et
al., 1993). Also, in both prokaryotes and eukaryotes,
one of the post replication repair processes uses DNA
strand exchange (for review see Friedberg et al., 1995).
More speci®cally, replication initiated by strand
exchange at a double strand break site has been
described in yeast; some of these events requiring a
pathway independent of RAD51 (Malkova et al.,
1996). Finally, a role for Rad51 during replication in
mammalian cells has been discussed elsewhere
(Edelmann and Kucherlapati, 1996).
In sharp contrast with the simple annealing of two
complementary ssDNA, DHP is a more complex
process, during which a search for homology takes
place on one duplex DNA partner. This reaction
requires highly specialized proteins and allows the
repair of breaks in the DNA (Meselson and Radding,
1975; Szostak et al., 1983). In yeast, this process is
involved in chromosome pairing during meiosis and in
resistance to radiation, both processes involving the
repair of DNA double strand breaks (Roeder, 1990;
Kleckner, 1996). The relevance of the DHP activity for
TLS/FUS may be attested to by the phenotype of the
null mutant mice. Indeed, TLS7/7 mice exhibit
enhanced radiation sensitivity and male sterility due
to chromosome pairing defects during meiosis (D Ron,
personal communication). Interestingly, phosphorylation by c-Abl stimulates the DNA binding activity of
TLS (Perrotti et al., 1998), which is on the other hand
a prerequisite for DHP. Indeed, c-Abl is expressed at
high levels in spermatocytes, cABL7/7 mice exhibit
defects of spermatogenesis (Kharbanda et al., 1998);
and c-Abl is activated by ionizing radiation (Kharbanda et al., 1995). Taken together, these observations
suggest that the DHP activity of TLS/FUS/POMp75
may be modulated by c-Abl, in response to DNA
damage. In contrast, phosphorylation by c-Abl
inactivates the DHP activity of HsRad51 (Yuan et
al., 1998). Because of this antagonistic e€ect, it is
tempting to speculate that RAD51 and TLS could
represent alternative DHP pathways. Work is in
progress to address this question.
Materials and methods
Reagents
Nitrocellulose membranes Hybond C-super (0.2 and 0.45 mm)
were purchased from Amersham. ATP, ATPgS, dNTPs,
protease inhibitors, Proteinase K, DNA restriction and
modi®cation enzymes were purchased from Boehringer
Mannheim.
DNA
Wild type bacteriophage M13 duplex and ssDNA were
prepared as described (Sambrook et al., 1989). Duplex DNA
was labeled with 32P by ®lling in the 5' protruding ends using
DNA Polymerase I large fragment, as described (Sambrook
et al., 1989).
Plasmids
The HsTLS cDNA was ampli®ed by PCR from a plasmid
containing the TLS cDNA and using primers Lina1
(TAGCCGCTCGAGAACCTAGGACTGCAGGGATCCGCC TCAA AC GATT AT AC CC AA CA AG CA AC CC) and
Lina2 (CTAGCCCAAGCTTCTCGAGGGGGAGCCAGGCTAATTAATACGGCCT) which contain BamHI and XhoI
sites respectively. After digestion, the PCR product was
inserted into pGEX-4T-1 (Pharmacia Biotech) digested with
BamHI/XhoI. The resulting plasmid was named TLS-pGEX
(pBL85) in which TLS is fused to a GST tag.
Bacterial expression
X12blue bacteria (Stratagene) were transformed with pBL85
or pGEX 4T-1. Ten ml of bacteria containing either pBL85
or empty pGEX4T-1 expression vector were grown at 378C in
LB medium to OD=0.25 followed by induction with 0.5 mM
isopropyl b-D-thiogalactoside for 90 min. The cells were
harvested and lysed in Laemmli bu€er (50 ml). The samples
were boiled 5 min and resolved on a 10% SDS ± PAGE gel.
Western immunoblots and immunoprecipitation
For GST ± TLS protein detection, Western blot was
performed using standard methods with a 1/10 000 dilution
of primary anti-POMp75 antibody in TBST bu€er (10 mM
Tris, pH 8/150 mM NaCl/0.05% Tween-20) and revealed
using an ECL Western blotting analysis system (Amersham).
The membrane was stripped by incubation in the stripping
ECL Western blot bu€er (62.5 mM Tris pH 6.7, 2% SDS,
100 mM 2-Mercaptoethanol). After verifying the absence of
signal, the same membrane was incubated 1 h in a 1/2000
anti-GST antibody (Amersham) in TBST bu€er. After
washes the membrane was incubated 1 h in a 1/2500 dilution
of protein G-HRP Conjugate (BioRad) and visualized using
the ECL kit.
To detect the amount of TLS protein in di€erent extracts,
Western blot was performed with a 1/10 dilution of anti-TLS
monoclonal antibody 4H11 previously described (Zinszner et
al., 1997).
For immunoprecipitation, 200 mg of HeLa nuclear extract
was diluted in IP bu€er (25 mM Tris-HCl, pH 7.5, 1 mM
EDTA, 0.5% NP40) and was ®rst incubated 1 h at 48C with
uncoupled-protein G-Sepharose beads (Pharmacia). The
beads were harvested by centrifugation at 2000 r.p.m. for
1 min and the supernatant was then incubated 1 h at 48C
with anti-TLS 4H11 previously coupled on protein GSepharose in IP bu€er+150 mM NaCl. The beads were
washed in IP bu€er containing 150 mM NaCl and 1% NP40.
The proteins bound to protein G-sepharose (from the
preclear: control) and the immunoprecipitated proteins were
eluted in Laemmli bu€er and the activity was analysed by
POM assay.
Puri®cation of HsPOM75
All the puri®cation procedures were performed at 48C.
Nuclear extracts (Fraction I) from 56109 HeLa cells
prepared as described (Dignam et al., 1983) was centrifuged
at 100 000 g for 2 h. The pellet formed was resuspended in
bu€er A (20 mM Tris-HCl (pH 7.5), 2 mM DTT, 10%
glycerol)+100 mM NaCl+6 M urea and loaded onto a
HiTrap SP (5 ml; Pharmacia) column equilibrated with
bu€er A+100 mM NaCl+6 M urea. After washes in same
bu€er, a gradient of 100 ± 600 mM NaCl was developed in
bu€er A+6 M urea. The fractions containing the peak of
HsPOMp75 activity eluted at about 350 mM NaCl were
pooled (Fraction II). This fraction was diluted in bu€er
A+6 M urea, and was loaded onto a DEAE MemSep 1000
(Waters) column, equilibrated with bu€er A+100 mM
4519
TLS/POMp75 DNA pairing activity in cell proliferation
P Bertrand et al
4520
NaCl+6 M urea. The ¯ow-through (Fraction IIIb) was
applied onto a HiTrap Heparin column (1 ml; Pharmacia)
equilibrated in Bu€er A+200 mM NaCl+6 M urea and a
gradient of 250 ± 600 mM NaCl in bu€er A+6 M urea was
applied. The HsPOM75 activity eluted at about 400 mM
NaCl. Fraction IV (pooled fractions) was concentrated on a
Centricon-30 microconcentrator (Amicon) and stored in
small aliquots at 7808C. Fraction IV was resolved on a
long 9% SDS ± PAGE, and the gel containing the 75 kDa
polypeptide was excised and used to raise rabbit polyclonal
antibodies and to performed microsequencing of the protein.
After digestion, peptides were puri®ed on HPLC; sequence
was performed on an ABI 473 sequencer. Microsequence has
been performed in the laboratory of proteins microsequencing at the Pasteur Institute in Paris (analysis no:94G430).
Internal peptide sequences obtained were compared with
EMBL and Swiss Prot databank using Blast program.
Preparation of mammalian nuclear extracts
Nuclei from 2 to 56108 cells were isolated by hypotonic lysis
and nuclear extracts were prepared as described previously
(Lopez and Coppey, 1987).
Pairing on membrane assay (PAGE/POM)
The POM assay was performed as previously described
(Akhmedov et al., 1995). Brie¯y, 15 mg of nuclear extract
were loaded and protein samples were electrophoretically
resolved on SDS-10% polyacrylamide gels with 4% stacking
gels at 48C. After electrophoresis, the polypeptides were
electrophoretically transferred onto nitrocellulose membrane
coated with ssDNA prepared as described previously
(Bertrand et al., 1993; Akhmedov et al., 1995). The
membrane was then incubated in the standard mixture
containing incubation bu€er with 0.6 mM dNTPs, 0.1 mM
ATPgS and 0.5 to 1 mg/ml end-labeled dsDNA with a speci®c
activity of 106 c.p.m./mg. Incubation was carried out for 2 h
at 378C. After incubation, the membrane was treated with
0.1 mg/ml of Proteinase K for 2 h at 508C. The membrane
was then washed with 26SSC, 0.1% SDS at 658C for
15 min. Joint DNA molecules were detected by autoradio-
graphy and quanti®ed using PhosphorImager (Molecular
Dynamics).
Cell culture and induction of cellular di€erentiation
Mammalian ®broblasts strains were grown in MEM medium
supplemented with 10% of FCS. F9 cells were grown in
DMEM medium supplemented with 15% FCS (under 12%
CO2). 108 cells were treated with 0.2 mM retinoic acid for 24 h,
then 1 mM cAMP was added. The cells were grown for 2
additional days. For single treatments, 108 cells were treated
with 0.2 mM retinoic acid alone for 3 days or with cAMP
alone for 2 days. Induction of di€erentiation was con®rmed
by Northern blot analysis of c-myc expression. 108 HL60 cells
were grown in RPMI 1640 medium supplemented with 10%
FCS. HL60 cells were induced to di€erentiate with 1.3%
DMSO during 24 or 48 h. The extracts of the di€erent
treated cells were prepared in parallel.
Isolation of peripheral blood lymphocytes and PHA treatment
Lymphocytes and monocytes were isolated from blood by a
Ficoll gradient. After adherence of the monocytes, the
lymphocytes were maintained for 48 h in RPMI 1640
medium supplemented with 10% FCS in absence or in
presence of 5 mg/ml PHA. The induction of the proliferation
was veri®ed by ¯ow cytometry after BrdU incorporation.
Acknowledgements
This work was supported by ARC and Electricite de
France. We are grateful to D Rouillard (Institut Curie,
Paris) for ¯ow cytometry analysis, M Prosperi (Institut
Curie, Paris) for c-myc expression analysis and to C
Levalois for helpful technical assistance. We thank Drs J
Coppey (Institut Curie, Paris) and A Sarrasin (IFC1,
Villejuif) for providing us with the ®broblasts strains and
their corresponding SV40 transformed lines and to D Ron
(NYU) for the TLS cDNA and the 4H11 monoclonal antiTLS antibody. Thanks are due to S Ganglo€, P Radicella
and J Smith for helpful discussions and critical reading of
the manuscript.
References
Aboussekhra A, Chanet R, Adjiri A and Fabre F. (1992).
Mol. Cell Biol., 12, 3224 ± 3234.
Akhmedov AT, Bertrand P, Corteggiani E and Lopez BS.
(1995). Proc. Natl. Acad. Sci. USA, 92, 1729 ± 1733.
Albala JS, Thelen MP, Prange C, Fan W, Christensen M,
Thompson LH and Lennon GG. (1997). Genomics, 46,
476 ± 479.
Basile G, Aker M and Mortimer RK. (1992). Mol. Cell Biol.,
12, 3235 ± 3246.
Bertolotti A, Lutz Y, Heard DJ, Chambon P and Tora L.
(1996). EMBO J., 15, 5022 ± 5031.
Bertrand P, Akhmedov AT and Lopez BS. (1995). Biochimie,
77, 840 ± 847.
Bertrand P, Corgeggiani E, Dutreix M, Coppey J and Lopez
BS. (1993). Nucleic Acids Res., 21, 3653 ± 3657.
Bishop DK, Park D, Xu L and Kleckner N. (1992). Cell, 69,
439 ± 456.
Bortner C, Hernandez TR, Lehman IR and Grith J. (1993).
J. Mol. Biol., 231, 241 ± 250.
Buchhop S, Gibson MK, Wang XW, Wagner P, Sturzbecher
HW and Harris CC. (1997). Nucleic Acids Res., 25, 3868 ±
3874.
Cartwright R, Tambini CE, Simpson PJ and Thacker J.
(1998). Nucleic Acids Res., 26, 3084 ± 3089.
Crozat A, Aman P, Mandahl N and Ron D. (1993). Nature,
363, 640 ± 644.
Delattre O, Zucman J, Plougastel B, Desmaze C, Melot T,
Peter M, Kovar H, Joubert I, de Jong P, Rouleau G,
Aurias A and Thomas G. (1992). Nature, 359, 162 ± 165.
Dignam JD, Lebovitz RM and Roeder RG. (1983). Nucleic
Acids Res., 11, 1475 ± 1489.
Dosanjh MK, Collins DW, Fan W, Lennon GG, Albala JS,
Shen Z and Schild D. (1998). Nucleic Acids Res., 26,
1179 ± 1184.
Edelmann W and Kucherlapati R. (1996). Proc. Natl. Acad.
Sci. USA, 93, 6225 ± 6227.
Formosa T and Alberts BM. (1986). Cell, 47, 793 ± 806.
Friedberg EC, Walker GC and Siede W. (1995). DNA repair
and mutagenesis. ASM Press: Washington, D.C.
Golub EI, Ward DC and Radding CM. (1992). Nucleic Acids
Res., 20, 3121 ± 3125.
Hong X, Cadwell GW and Kogoma T. (1996). Mol.
Microbiol., 21, 953 ± 961.
Ichikawa H, Shimizu K, Hayashi Y and Ohki M. (1994).
Cancer Res., 54, 2865 ± 2868.
Kans JA and Mortimer RK. (1991). Gene, 105, 139 ± 140.
Kaslan E and Heyer WD. (1994). J. Biol. Chem., 269,
14103 ± 14110.
Kharbanda S, Pandey P, Morris PL, Whang Y, Xu Y,
Sawant S, Zhu LJ, Kumar N, Yuan ZM, Weichselbaum R,
Sawyers CL, Pandita TK and Kufe D. (1998). Oncogene,
16, 1773 ± 1777.
TLS/POMp75 DNA pairing activity in cell proliferation
P Bertrand et al
Kharbanda S, Ren R, Pandey P, Shafman TD, Feller SM,
Weichselbaum RR and Kufe DW. (1995). Nature, 376,
785 ± 788.
Kleckner N. (1996). Proc. Natl. Acad. Sci. USA, 93, 8167 ±
8174.
Kowalczykowski SC and Eggleston AK. (1994). Annu. Rev.
Biochem., 63, 991 ± 1043.
Li Z, Golub EI, Gupta R and Radding CM. (1997). Proc.
Natl. Acad. Sci. USA, 94, 11221 ± 11226.
Luisi-DeLuca C. (1995). J. Bacteriol., 177, 566 ± 572.
Lopez B and Coppey J. (1987). Nucleic Acids Res., 15, 6813 ±
6826.
Lovett ST. (1994). Gene, 142, 103 ± 106.
Luo CM, Tang W, Mekeel KL, DeFrank JS, Anne PR and
Powell SN. (1996). J. Biol. Chem., 271, 4497 ± 4503.
Maldonado E, Shiekhattar R, Sheldon M, Cho H, Drapkin
R, Rickert P, Lees E, Anderson CW, Linn S and Reinberg
D. (1996). Nature, 381, 86 ± 89.
Malkova A, Ivanov EL and Haber JE. (1996). Proc. Natl.
Acad. Sci. USA, 93, 7131 ± 7136.
Marmorstein LY, Ouchi T and Aaronson SA. (1998). Proc.
Natl. Acad. Sci. USA, 95, 13869 ± 13874.
Meselson MS and Radding CM. (1975). Proc. Natl. Acad.
Sci. USA, 72, 358 ± 361.
Meyn MS. (1993). Science, 260, 1327 ± 1330.
Mizuta R, LaSalle JM, Cheng HL, Shinohara A, Ogawa H,
Copeland N, Jenkins NA, Lalande M and Alt FW. (1997).
Proc. Natl. Acad. Sci. USA, 94, 6927 ± 6932.
Noirot P and Kolodner RD. (1998). J. Biol. Chem., 273,
12274 ± 12280.
Perrotti D, Bonatti S, Trotta R, Martinez R, Skorski T,
Salomoni P, Grassilli E, Lozzo RV, Cooper DR and
Calabretta B. (1998). EMBO J., 17, 4442 ± 4455.
Pittmann DL, Weinberg LR and Schimenti JC. (1998).
Genomics, 49, 103 ± 111.
Rabbitts TH, Forster A, Larson R and Nathan P. (1993).
Nat. Genet., 4, 175 ± 180.
Radding CM. (1991). J. Biol. Chem., 266, 5355 ± 5358.
Rice MC, Smith ST, Bullrich F, Havre P and Kmiec EB.
(1997). Proc. Natl. Acad. Sci. USA, 94, 7417 ± 7422.
Roca AI and Cox MM. (1990). Crit. Rev. Biochem. Mol.
Biol., 25, 415 ± 456.
Roeder GS. (1990). Trends Genet., 6, 385 ± 389.
Ron D. (1997). Curr. Top. Microbiol. Immunol., 220, 131 ±
142.
Rossignol JL and Faugeron G. (1994). Experientia, 50, 307 ±
317.
Sambrook J, Fritsch EF and Maniatis T. (1989). Molecular
Cloning: A Laboratory Manual. 2nd edn. Cold Spring
Harbor Laboratory Press: Cold Spring Harbor, New
York.
Scully R, Chen J, Plug A, Xiao Y, Weaver D, Feunteun J,
Ashley T and Livingston DM. (1997). Cell, 88, 265 ± 275.
Shinohara A, Ogawa H, Matsuda Y, Ushio N, Ikeo K and
Ogawa T. (1993). Nat. Genet., 4, 239 ± 243.
Shinohara A, Ogawa H and Ogawa T. (1992). Cell, 69, 457 ±
470.
Sonoda E, Sasaki MS, Buerstedde JM, Bezzubova O,
Shinohara A, Ogawa H, Takata M, Yamaguchi-Iwai Y
and Takeda S. (1998). EMBO J., 17, 598 ± 608.
Strickland S, Smith KK and Marotti KR. (1980). Cell, 21,
347 ± 355.
Sturzbecher HW, Donzelmann B, Henning W, Knippschild
U and Buchhop S. (1996). EMBO J., 15, 1992 ± 2002.
Sung P. (1994). Science, 265, 1241 ± 1243.
Szostak JW, Orr-Weaver TL, Rothstein RJ and Stahl FW.
(1983). Cell, 33, 25 ± 35.
Thyagarajan B and Campbell C. (1997). J. Biol. Chem., 272,
23328 ± 23333.
Thyagarajan B, McCormick-Graham M, Romero DP and
Campbell C. (1996). Nucleic Acids Res., 24, 4084 ± 4091.
Tsuzuki T, Fujii Y, Sakumi K, Tominaga Y, Nakao K,
Sekiguchi M, Matsushiro A, Yoshimura Y and Morita T.
(1996). Proc. Natl. Acad. Sci. USA, 93, 6236 ± 6240.
West SC. (1992). Ann. Rev. Biochem., 61, 603 ± 640.
Yamamoto A, Taki T, Yagi H, Habu T, Yoshida K,
Yoshimura Y, Yamamoto K, Matsushiro A, Nishimune
Y and Morita T. (1996). Mol. Gen. Genet., 251, 1 ± 12.
Yoshimura Y, Morita T, Yamamoto A and Matsushiro A.
(1993). Nucleic Acids Res., 21, 1665.
Yuan ZM, Huang Y, Ishiko T, Nakada S, Utsugisawa T,
Kharbanda S, Wang R, Sung P, Shinohara A, Weichselbaum R and Kufe D. (1998). J. Biol. Chem., 273, 3799 ±
3802.
Zinszner H, Sok J, Immanuel D, Yin Y and Ron D. (1997). J.
Cell Sci., 110, 1741 ± 1750.
4521