Local Retention Versus Systemic Release of Soluble VEGF
Receptor-1 Are Mediated by Heparin-Binding and
Regulated by Heparanase
Shay Sela, Shira Natanson-Yaron, Eyal Zcharia, Israel Vlodavsky, Simcha Yagel, Eli Keshet
Rationale: The vascular endothelial growth factor (VEGF) decoy receptor soluble VEGF-R1 (sVEGF-R1) is
Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017
thought to protect the cells that produce it from adverse VEGF signaling. To accomplish this role, a mechanism
for pericellular retention of sVEGF-R1 is required. Local retention may also prevent the accumulation of high
circulating levels of sVEGF-R1 and resulting interference with homeostatic VEGF functions in remote organs.
Objective: To reveal natural storage depots of sVEGF-R1 and determine mechanisms underlying its pericellular
retention. To uncover natural mechanisms regulating its systemic release.
Methods and Results: We show that both the canonical and human-specific isoforms of sVEGF-R1 are strongly
bound to heparin. sVEGF-R1 produced by vascular smooth muscle cells is stored in the vessel wall and can be
displaced from isolated mouse aorta by heparin. Another major reservoir of sVEGF-R1 is the placenta. Heparin
increases the level of sVEGF-R1 released by cultured human placental villi, and pregnant women treated with
low molecular weight heparin showed markedly elevated levels of sVEGF-R1 in the circulation. Heparanase is
expressed in human placenta at the same locales as sVEGF-R1, and its transgenic overexpression in mice resulted
in a marked increase in the levels of circulating sVEGF-R1. Conversely, heparanase inhibition, by either a
neutralizing antibody or by inhibition of its maturation, reduced the amounts of sVEGF-R1 released from human
placental villi, indicating a natural role of heparanase in sVEGF-R1 release.
Conclusions: Together, the findings uncover a new level of regulation governing sVEGF-R1 retention versus
release and suggest that manipulations of the heparin/heparanase system could be harnessed for reducing
unwarranted release of sVEGF-R1 in pathologies such as preeclampsia. (Circ Res. 2011;108:1063-1070.)
Key Words: soluble VEGF-R1 䡲 heparan sulfate 䡲 vascular smooth muscle cell 䡲 heparanase 䡲 preeclampsia
S
oluble VEGF receptor 1 (sVEGF-R1) is a naturallyproduced decoy receptor capable of binding and sequestering VEGF-A, VEGF-B and Placental Growth Factor.1 The
primary mRNA is transcribed from a single VEGF-R1 locus
and is alternatively spliced to generate either the membranespanning receptor or sVEGF-R1 in a mutually exclusive
manner.2 The fact that sVEGF-R1 is a secreted protein
qualifies it as a “trap” capable of titrating extracellular VEGF.
Indeed, sVEGF-R1 has been extensively used experimentally
for VEGF inhibition. Yet, little is known regarding its natural
roles. A notable example of the physiological role of
sVEGF-R1 is in the cornea where it is indispensable for
maintaining corneal avascularity by virtue of neutralizing
VEGF-A.3 A notable pathophysiological role of sVEGF-R1 is
in preeclampsia (PE), the most common and dangerous
complication of pregnancy, where excessive levels of
sVEGF-R1 secreted by the diseased placenta to the maternal
circulation may reach remote organs, primarily the kidney,
neutralize podocyte-derived VEGF and cause endotheliosis,
hypertension and proteinuria.4,5 Although the latter case
clearly shows that sVEGF-R1 can access the systemic circulation, the former necessitates its retention within the tissue.
Moreover, if sVEGF-R1 is intended to play a protective role
against surplus VEGF via its local titration, a mechanism
must exist for its pericellular retention in the vicinity of the
cells that produce it.
Ig-like domain 4 of VEGF-R1 was previously shown to
bind heparin6 and the fact that this heparin-binding domain is
shared with sVEGF-R1 prompted Rajakumar et al to demonstrate that sVEGF-R1 also binds heparin, which can in fact be
enriched through binding to a heparin column.7 Because the
human-specific isoform of sVEGF-R1 shares the same
heparin-binding domain, we reasoned that it might mediate
pericellular retention of both soluble isoforms through bind-
Original received December 21, 2010; revision received March 8, 2011; accepted March 10, 2011. In February 2011, the average time from submission
to first decision for all original research papers submitted to Circulation Research was 13.7 days.
From the Department of Developmental Biology and Cancer Research (S.S., E.K.), Hebrew University-Hadassah Medical School, Jerusalem;
Department of Obstetrics and Gynecology (S.N.-Y., S.Y.), Hadassah University Hospital-Mount Scopus, Jerusalem; and Cancer and Vascular Biology
Research Center (E.Z., I.V.), Rappaport Faculty of Medicine, Technion, Haifa, Israel.
Correspondence to Dr Eli Keshet, Department of Developmental Biology and Cancer Research, The Hebrew University-Hadassah Medical School,
Jerusalem 91120, Israel. E-mail [email protected]
© 2011 American Heart Association, Inc.
Circulation Research is available at http://circres.ahajournals.org
DOI: 10.1161/CIRCRESAHA.110.239665
1063
1064
Circulation Research
April 29, 2011
Non-standard Abbreviations and Acronyms
E
GBM
HS
HSPG
LMWH
PE
sFlt1
sFlt1-14
sVEGF-R1
VEGF
VEGFR
VSMC
embryonic day
glomerular basement membrane
heparan Sulfate
heparan sulfate proteoglycan
low-molecular-weight heparin
preeclampsia
generic soluble VEGF receptor 1 isoform
human-specific soluble VEGF receptor 1 isoform
soluble VEGF receptor 1
vascular endothelial growth factor
vascular endothelial growth factor receptor
vascular smooth muscle cell
Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017
ing to cell surface heparan sulfate (HS). HS proteoglycans
(HSPGs) are either anchored to the cell surface or present in
the ECM and control many biological processes by virtue of
binding a host of growth factors, including VEGF.8 Here, we
show that both full-length isoforms of sVEGF-R1 are not
only capable of binding to heparin but are also bound to HS
in vivo.
We further reasoned that to exert dynamic regulation,
binding of sVEGF-R1 to HS is not rigid but rather flexible
and actively subjected to regulation. An attractive candidate
for such regulation is heparanase, an endo-␤-D-glucuronidase
known to be implicated in diverse processes such as angiogenesis, metastasis and inflammation. It has been shown that
heparanase-mediated release of HS-bound growth factors
plays a major role in the above processes.9 Here, we extended
this biological principle to the HS-bound decoy receptor
sVEGF-R1 by showing that heparanase indeed plays a natural
role in liberating sVEGF-R1 from its placental reservoir.
Methods
Recombinant Expression of sVEGF-R1 Isoforms
cDNAs encompassing the entire coding region of both soluble
receptor isoforms (GenBank sequences EU368830.1 and U01134.1)
were subcloned into Bluescript expression vectors and transfected
onto T7 polymerase-expressing Hela cells. Twenty-four hours later,
media containing the secreted proteins were collected. Protein
concentration was determined with sVEGF-R1 ELISA.
Displacement From Heparin Sepharose Columns
Heparin sepharose (GE Healthcare, CL-6B) was packed on chromatography columns according to manufacturer instructions. A 1-␮g
sample of each sVEGF-R1 isoform was loaded and bound to the
columns. Proteins were displaced from the columns using increasing
NaCl concentrations. Fractions were collected and evaluated for
sVEGF-R1 amount by Western blotting as described below.
sVEGF-R1, Heparanase, and Cathepsin L
Western Blotting
Human recombinant proteins that were displaced from heparin
sepharose columns were run on a separating gel and blotted with the
ab9540 antibody (Abcam). Mouse endogenous sVEGF-R1 was
immuno-precipitated using the V4262 antibody (Sigma), and im-
muno blotted using the sc-9029 antibody (Santa-Cruz biotechnology). C2970 antibody (Sigma) was used for human cathepsin L
blotting. Human heparanase was detected using the monoclonal
antibody 01385-126 (kindly provided by ImClone Systems Inc.,
New York, NY), recognizing both the 50-kDa subunit and the
65-kDa proheparanase.10
sVEGF-R1 In Situ Hybridization
For in situ detection of mouse sVEGF-R1 RNA, paraffin-embedded
sections of mouse heart were hybridized with 35S-labeled riboprobe
complementing the first 600 nucleotides of intron 13 of VEGF-R1,
as previously described.11
sVEGF-R1 and Active
Heparanase Immunohistochemistry
Paraffin-embedded sections of mouse heart, or human term placenta
were used. Antigen retrieval was performed by microwave heating in
pH 6 citrate buffer. The 36-1100 antibody (Zymed) was used at a
1:100 dilution to detect sFlt1. The 733 antibody was used at a 1:100
dilution to detect the active form of heparanase.12
Heparin Displacement of sVEGF-R1 From
Aortic Arches
Mouse aortic arches were isolated, cleaned from adventitia, cut into
cylinder segments, and incubated for 24 hours with or without 10
U/mL heparin (Sigma, H0777). Medium was collected and evaluated
for sVEGF-R1 levels with sVEGF-R1 ELISA.
Term Human Placental Explants Culture
Term human placentas were excised to small sections, and incubated
according to guidelines detailed elsewhere.13 In short, 75 mg of
placental villi were placed in each well, and incubated in DMEM/
F12 medium supplemented with 10% FCS, in 8% oxygen. Incubation time varied according to the different protocols used in each
experimental setting.
Heparin Displacement of sVEGF-R1 From Human
Placental Villi Explants
Human term placental villi were explanted for 24 hours with
different heparin concentrations. sVEGF-R1 levels were determined
in media and explanted placental villi using ELISA. Protein concentration of each villi sample was determined using the Bradford assay.
Similar protein amount of each villi sample was used to determine
sVEGF-R1 concentration.
Heparanase-Overexpressing Transgenic Mice
The generation and characterization of these mice are described
elsewhere.14
Real-Time PCR
RNA and cDNA were generated from embryonic day (E)16.5
placentas of Wt and heparanase Tg mice. sVEGF-R1 levels were
evaluated using SYBR green real time PCR, and normalized according to ␤-actin levels.
The primers used were as follows: sVEGF-R1 forward primer:
GGCCCAGAGGAAACGCTCCTC; sVEGF-R1 reverse primer:
AATCCAAACACACACCGGGCG; ␤-actin forward primer: ACCCGCGAGCACAGCTTCTT; ␤ -actin reverse primer:
GAACTGGTGGCGGGTGTGGA.
Heparanase Inhibition in Human Placental
Villi Explants
Heparanase processing and thereby enzymatic activity was indirectly
inhibited via a 72- hour incubation with 8 ␮mol/L of the specific
Sela et al
Local Retention Versus Systemic Release of sVEGF-R1
1065
cathepsin L inhibitor (Calbiochem, catalog no. 219427).10 Heparanase was directly inhibited via a 48-hour incubation with the
neutralizing antibody 733 added to the medium at concentration of
10 ␮g/mL.12 Heparanse inhibition required a longer incubation time
than the 24 hours used for the heparin displacement experiment to
elicit an inhibition effect: Heparanase neutralization was evaluated
after 48 hours, whereas cathepsin L inhibitor required 72 hours of
incubation, as active heparanase can be found in the villi, and longer
incubation time allows diminishing its effect.
Enzyme-Linked Immunosorbent Assay
Human sVEGF-R1 levels were determined using the DVR100b
sVEGF-R1 ELISA kit (R&D Systems). Mouse sVEGF-R1 levels
were determined using the MVR100 sVEGF-R1 ELISA kit (R&D
Systems).
Serum and Placentas From Pregnant Women
Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017
Serum samples and term placentas were taken with Institutional
Review Board approval with the informed consent of pregnant
women.
Statistics
Data were analyzed by 2-sample t test. Standard error of the mean
(SEM) was calculated as sample standard deviation divided by the
square root of the sample size.
Results
sVEGF-R1 Is a Heparin-Binding Protein
To examine the proposition that sVEGF-R1 might be retained
in the vicinity of the producing cell through binding to HS,
we first examined its ability to bind heparin. Because 2
distinct splice variants of sVEGF-R1 are known to exist,
namely the “generic” soluble receptor (sFlt1) and the recently
identified human-specific variant (sFlt1-14),15 we wished to
determine whether the previously reported heparin-binding
capability of the generic isoform also applies to sFlt1-14. To
this end, the respective recombinant proteins were produced
in a cell culture, loaded on heparin sepharose columns and
subsequently displaced by increasing concentration of NaCl.
High concentrations (⬎1.1 mol/L) were required to displace
the bulk of either protein, demonstrating a capacity to bind
heparin at a high affinity (Figure 1). For comparison, 0.8
mol/L NaCl is sufficient to displace VEGF, which is considered a classical heparin-binding growth factor.16 This experiment also showed that the human-specific soluble receptor,
the predominant isoform in the human placenta, binds heparin
as efficiently as the canonical isoform. In experiments described herein, the term sVEGF-R1 was interchangeably used
for both isoforms on the premise that they have comparable
heparin-binding capabilities.
Natural Stores of sVEGF-R1 in the Vessel Wall
Are Displaceable by Heparin
To determine whether natural tissue stores of sVEGF-R1
exist, we first searched for sVEGF-R1 reservoir in the vessel
wall. Previously, we showed that cultured VSMCs obtained
from resected human vessels indeed secrete sVEGF-R1.15
Here, we examined sections of different mouse organs for
sVEGF-R1 production using in situ hybridization with a
sVEGF-R1–specific riboprobe. sVEGF-R1 was abundantly
Figure 1. sVEGF-R1 binding to heparin. Recombinant sFlt1-14
or sFlt1 were loaded on heparin-sepharose column and subsequently displaced by increasing NaCl concentrations. Relative
amounts of displaced sFlt1-14 and sFlt1 were determined by
Western blotting using an antibody (ab9540) recognizing a
shared epitope.
expressed in ␣SMA-positive VSMCs of various organs, as
can be seen for VSMCs belonging to the outflow tract of the
heart (Figure 2A, left). Immuno-staining specific for
sVEGF-R1 validated its expression at the protein level in
VSMCs of different vessels (Figure 2A, right). Western blot
analysis further showed that high levels of sVEGF-R1 protein
are indeed present in the aortic segment examined. Remarkably, the protein detected in the vessel wall was predominantly the decoy soluble receptor and not the membranespanning signaling receptor (Figure 2B).
To determine whether this sVEGF-R1 store is displaceable
by heparin, the aortic segment was excised and incubated ex
vivo for 24 hours in the presence or absence of heparin.
sVEGF-R1 ELISA was used to determine the amount of
sVEGF-R1 released to the conditioned medium. As shown in
Figure 2C, heparin treatment resulted in a 6-fold increase in
the amount of sVEGF-R1 secreted to the culture medium.
Natural Stores of sVEGF-R1 in the Human
Placenta Are Displaceable by Heparin
Reasoning that there are additional physiological arenas
where sVEGF-R1 is retained in the tissue, we turned to the
human placenta. It is known that the human placenta is a rich
source of sVEGF-R1 secreted to the circulation during
normal pregnancy, which is even greatly increased in PE.4,5
Yet, the notion that the placenta is also a HS-bound depot of
sVEGF-R1 has not been considered.
To test this, human placental villi explants were incubated
for 24 hours with increasing concentrations of heparin and the
amounts of sVEGF-R1 released to the medium (Figure 3A) or
remaining in the tissue (Figure 3B) were determined. As
shown, heparin treatment led to release of sVEGF-R1 to the
medium in a dose-dependent manner and was mirror-imaged
by a parallel decrease in the protein remaining in the villi. The
apparent increase in the amount of sVEGF-R1 released to the
medium was not merely a reflection of increased sVEGF-R1
production, as the total amount of sVEGF-R1 was not
increased in heparin-treated explants and the only difference
was in its relative distribution between the tissue and medium
1066
Circulation Research
April 29, 2011
Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017
Figure 2. sVEGF-R1 stored in the vessel wall and its displacement by heparin. A, Left, In situ mRNA hybridization of an aortic section (outflow tract region) with a sVEGF-R1–specific riboprobe (see Methods). Upper and lower images, Dark field and bright field
images, respectively, of serial sections. The section shown in the lower image was immunostained with ␣SMA to highlight VSMCs, the
apparent source of sVEGF-R1 in the vessel wall. Right, Visualizing sVEGF-R1 in coronary vessels by immunostaining with an antibody
directed against the 31 unique carboxy-terminal 31 aa of sFlt1. Note (in the inset), a positive signal in VSMCs and a negative signal in
endothelial cells. B, A Western blot of aortic arch-extracted proteins with an antibody detecting both VEGF-R1 and sVEGF-R1. Note
exclusive expression of sVEGF-R1 but not of the signaling transmembrane receptor. Both VEGF-R1 and sVEGF-R1 are detected in kidney tissue, applied as control. C, Mouse aortic arches were isolated and incubated for 24 hours with or without 10 U/mL of heparin.
Data are presented as means⫾SEM n⫽3 for each group; *P⬍0.05.
(Online Figure I, available in the Online Data Supplement at
http://circres.ahajournals.org).
To extend this finding to an in vivo setting, we resorted to
analysis of serum samples obtained from pregnant women
treated with the low molecular weight heparin (LMWH)
clexane, which is routinely used for prophylaxis of coagulation abnormalities during pregnancy. As shown in Figure 3C,
clexane increased the level of sVEGF-R1 released to the
circulation by 4-fold. Together, these results established that
the level of sVEGF-R1 detectable in the circulation represent
only a small fraction of the total amount of bodily sVEGFR1, the majority of which is stored in tissue reservoirs.
Heparanase Is a Potential Regulator of
sVEGF-R1 Release
The presence of sVEGF-R1 tissue stores, on one hand, and
its presence in the circulation, on the other hand, argues for
an active mechanism governing the retention versus release of this natural VEGF inhibitor. Reasoning that
heparanase might play such a regulatory role by virtue of
releasing HS-bound sVEGF-R1, we first determined whether heparanase is indeed produced in the relevant tissue environment. To this
end, we analyzed term human placentas for heparanase production,
as the placenta is known to be the major source of circulating
sVEGF-R1 in pregnancy.
Figure 3. sVEGF-R1 stored in the placenta and its displacement by heparin. A and B, Human term placental villi were explanted
and grown in culture for 24 hours in the absence or presence of different concentrations of heparin. Levels of sVEGF-R1 released to
the medium (A) and remaining in the tissue (B) were determined by ELISA. Data are presented as means⫾SEM (n⫽3 for each group);
*P⬍0.01, **P⬍0.05. C, Serums levels of sVEGF-R1 from untreated and clexane-treated pregnant women were determined as above.
Serum samples were obtained at a mean gestational age of 35.8 weeks for the clexane-treated group and 37.9 weeks for the normal
pregnancy group. Data are presented as means⫾SEM n⫽5 for each group; *P⬍0.004.
Sela et al
Local Retention Versus Systemic Release of sVEGF-R1
1067
Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017
Figure 4. Heparanase expression and localization in human
placenta. A, Western blot analysis of 2 representative normal
term placentas with anti-heparanase antibody (01385 to 126
mAb) detecting both the latent (65 kDa) and mature active protein (50 kDa). Note that cathepsin L, the protease mediating
heparanase activation, is also expressed in the placenta. B, In
situ immunohistochemistry of human term placenta section with
an antibody detecting primarily the active form of heparanase
(ab733). Note extensive staining in syncytiotrophoblasts, as well
as in syncytial knots, the degenerative structures previously
shown to be the major source of placental sFlt1-14 production.
Western blot analysis revealed that both the precursor
inactive protein, as well as the proteolytically processed
active enzyme, are readily detected in the placenta (Figure
4A). Correspondingly, cathepsin L, the protease responsible
for processing of the 65 kDa precursor protein,10 was also
detectable in the placenta (Figure 4A).
To determine localization of active heparanase within the
placenta, in situ immuno-histochemical analysis with an
antibody that recognizes primarily active heparanase was
performed. As shown in Figure 4B, heparanase was predominantly detected in syncytiotrophoblasts and in placental
syncytial knots. Remarkably, these locales completely coincide with the sites of sVEGF-R1 production,15 consistent with
the proposition that heparanase may function in sVEGF-R1
release.
Transgenic Heparanase Overexpression Increases
the Level of Circulating sVEGF-R1
To examine whether heparanase is capable of releasing
sVEGF-R1 into the systemic circulation, transgenic mice in
which heparanase expression is controlled by a ubiquitous
promoter driving its overexpression in all tissues14 was used.
Higher levels of sVEGF-R1 were detected in the serum of
heparanase-overexpressing mice in comparison to littermate
controls (230 pg/mL and 140 pg/mL, respectively) (Figure
5A). This significant 65% increase likely reflects sVEGF-R1
release from different tissue depots.
A similar analysis was also performed in pregnant mice
where circulating sVEGF-R1 can reach levels ⬎180-fold
higher than in nonpregnant mice. Control mice showed a
gestational stage-dependent increase in circulating
sVEGF-R1 reaching 25 ng/mL on average at E16.5. Remark-
Figure 5. Increased circulating levels of sVEGF-R1 in
heparanase-overexpressing mice. A, Circulating levels of
sVEGF-R1 were determined by ELISA in female transgenic mice
overexpressing heparanase (Tg) and in wild-type controls (Wt).
Transgenic: n⫽4; wild type: n⫽3; *P⬍0.02. B, A similar analysis
was performed during pregnancy. Blood was withdrawn and
serum was analyzed at 3 time points (E11.5, E13.5, and E16.5).
Each black line represents sVEGF-R1 levels of a wild-type
pregnant mouse, and each red line represents sVEGF-R1 levels
of a heparanase transgenic mouse (n⫽6 for each group). An
increase in sVEGF-R1 levels can be seen in normal wild-type
pregnancies as pregnancy develops. At all time points examined, sVEGF-R1 levels of the heparanase-overexpressing mice
exceeded the respective normal levels by a factor of 3 to 4.
ably, heparanase overexpression resulted in a significant
increase in the levels of circulating sVEGF-R1 at all stages
and was 3.5-fold higher by E16.5 (Figure 5B). This result
could not be explained by a difference in embryo number,
which was comparable to controls (data not shown). Noteworthy, at this time point, the level of placental sVEGF-R1
expression was indistinguishable between control and
heparanase-overexpressing transgenic mice, indicating that
heparanase indeed act to release sVEGF-R1 from its placental
stores (Online Figure II).
These results corroborate the notion that only a minor
fraction of placentally produced sVEGF-R1 is reaching the
circulation and further suggest that heparanase might play a
role in sVEGF-R1 release.
Heparanase Inhibition Decreases sVEGF-R1
Release From the Placenta
To determine whether heparanase plays a natural role in
regulated release of placental sVEGF-R1, we used 2 independent approaches for inhibiting endogenous heparanase: pre-
1068
Circulation Research
April 29, 2011
Figure 6. Heparanase loss-of-function reduces sVEGF-R1 release in human placental villi explants. Villi from human term placenta were cultured as described in Methods. A, Specific cathepsin L inhibitor (concentration, 8 ␮mol/L) (Calbiochem, catalog no.
219427) was added to the culture medium and sVEGF-R1 was determined 3 days later. *P⬍0.03; n⫽4. B, Heparanse neutralizing antibody (ab733) was added to the culture medium and sVEGF-R1 was determined 2 days later. *P⬍0.02; n⫽6.
Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017
venting processing and activation of the proenzyme via
cathepsin L inhibition and direct inhibition of heparanase
through the use of a neutralizing antibody. Inhibition of
cathepsin L activity in human placental villi explants resulted
in a 35% reduction in sVEGF-R1 secreted to the medium
(Figure 6A). Likewise, heparanase neutralizing antibody
reduced the level of sVEGF-R1 secreted to the culture
medium by 32% (Figure 6B). This was associated with a
parallel similar increase in sVEGF-R1 retained in the villi
(data not shown). These results indicate that heparanase is a
natural regulator of sVEGF-R1 release from the placenta.
Discussion
Here, we showed that the majority of sVEGF-R1 is retained
in the vicinity of the producing cell in spite of it being a
secreted protein. Further, we showed that pericellular retention of this natural VEGF decoy receptor is mediated through
its high affinity binding to HS and that its release is controlled
at least in part by heparanase.
Existence of tissue depots of sVEGF-R1 provide a basis for
the notion that the primary physiological role of sVEGF-R1 is
to sequester VEGF locally thereby granting the producing
cell protection against unwarranted VEGF signaling. Thus, it
can be argued that the abundant presence of sVEGF-R1 in the
vessel wall shown here has a functional role in protecting
VSMCs from adverse VEGF signaling. Consistent with this
proposition is our previous observation that the mRNA
transcribed from the VEGF-R1 locus in VSMCs is spliced in
a mode yielding exclusively sVEGF-R115 (but not the signaling transmembrane receptor) and results shown here that only
sVEGF-R1 protein is produced and deposited in the VSMC
layer (Figure 2). Because VEGF is known to cause vasodilatation,17,18 it could be speculated that its local titration keeps
VEGF-induced vasodilatation in check.
Local retention of sVEGF-R1, thereby preventing its systemic release, might also be required to avoid indiscriminate
neutralization of VEGF in remote organs. This may include
interference with homeostatic function of VEGF in the
kidney and in additional organs where constitutive VEGF
signaling is needed to maintain endothelial fenestrations.
Indeed, it was shown that excessive systemic release of
placentally-produced sVEGF-R1 may cause PE through interfering with normal VEGF kidney function.4,5 It may be
generalized that high levels of circulating sVEGF-R1 detectable in pathological settings likely reflect a failure to retain it
locally (see below). It is important to keep in mind that in the
human, 2 isoforms of the decoy receptor coexist, namely the
generic sFlt1 and the human-specific sFlt1-14, with the latter
predominating in normal and PE pregnancies.15
Local retention of sVEGF-R1 is mediated by cell-bound or
ECM deposited HS. This was shown in 2 independent ways:
First, by showing sVEGF-R1 displacement and release by
heparin and LMWH and second, by demonstrating increased
levels of sVEGF-R1 in the circulation of transgenic mice
overexpressing heparanase. These experiments allow for the
evaluation of the relative amounts of retained versus released
sVEGF-R1 in respective tissues. For example, the finding
that the amount of sVEGF-R1 displaceable from the vessel
wall of the aortic arch by heparin largely exceeds the
normally secreted amount by 6-fold (Figure 2C) indicates that
the majority of the decoy receptor is stored rather than
released. Interestingly, levels of sVEGF-R1 detectable in the
vessel wall were found to vary depending on the anatomic
location of the respective arterial segment (data not shown).
Likewise, the finding that heparanase overexpression in
pregnant mice results in 3 to 4-fold increase of circulating
sVEGF-R1 indicates that only a minor fraction of sVEGF-R1
produced by the placenta, apparently the richest storage depot
of sVEGF-R1, finds its way to the circulation. Because
circulating sVEGF-R1 has been causally implicated in the
development of PE,5 existence of a large placental reservoir
of this potentially harmful agent may greatly impact the
pathogenic process. In this regard, mechanisms accounting
for balancing retained versus secreted sVEGF-R1 are of great
importance.
It is likely that increased levels of circulating sVEGF-R1 in
PE reflects a limited retention capacity by placental HS which
is overwhelmed by excessive production of sVEGF-R1.
Several parameters may determine the retention capacity of
secreted sVEGF-R1. First is the repertoire of placental
HSPGs and their levels, which may vary. For example,
placental expression of the key HSPG syndecan 1 was shown
Sela et al
Local Retention Versus Systemic Release of sVEGF-R1
Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017
to diminish in preeclampsia19 and thereby possibly reduce
overall retention capacity. Second, heparanase activity responsible for release of HSPG-bound proteins in general,
might also participate in sVEFGF-R1 release. Indeed, heparanase is expressed in the same locales shown previously to
produce sVEGF-R1, and has a natural role in regulating
sVEGF-R1 release, as demonstrated in loss-of-function experiments described above (Figure 6). The observed 32% to
35% decrease in sVEGF-R1 secretion is likely an underestimation considering that the 2 reagents used, ie, heparanase
neutralizing antibody and a cathepsin-L inhibitor, do not fully
block heparanase activity (not shown). The fraction of
sVEGF-R1 released by heparanase in the normal and PE
placenta is yet to be determined. Heparanse is constitutively
expressed in the placenta in small fetal vessels and in a
variety of trophoblast subpopulations with different potentials
for invasion. Interestingly, heparanase expression was shown
to be progressively up regulated during pregnancy,20 which
grossly correlates with the progressive accumulation of
sVEGF-R1 in the circulation.4 Yet, a comparison of heparanase levels between normal and PE placenta did not reveal
additional increase in PE (data not shown). Regardless of the
mechanisms accounting for sVEGF-R1 retention, the fact that
only circulating sVEGF-R1 is pathogenic, suggests that
inhibition of its systemic release (eg, via inhibition of
heparanase activity) could be harnessed therapeutically.
Neutralization of VEGF function in the kidney glomerular
basement membrane (GBM) is known to be the primary
cause of PE-associated renal damage.5,21 Specifically, it has
been shown that podocyte-derived VEGF acts on VEGF
receptors displayed on nearby endothelial cells.21 Thus,
sVEGF-R1 entrapped in the HS-rich GBM is bound to
interfere with this homeostatic VEGF function. Accordingly,
inhibition of sVEGF-R1 binding to HS (eg, with LMWH) in
the target organ may also be beneficial. Consistent with this
proposition, is a recent report showing that the low molecular
weight heparin dalteparin is effective in decreasing the
recurrence of placental-mediated complications in women
without thrombophilia.22 Noteworthy, HSPG-bound proteins
released by heparanase are still bound to a sugar moiety of an
average size of 10 to 20 sugar units, which may alter its
biological activity.9 Thus, sVEGF-R1 released by heparanase
may also have different affinity for GBM binding than
sVEGF-R1 released by another mode.
In conclusion, this study uncovered a previously unrecognized level of VEGF regulation, namely, bioavailability of its
decoy receptor determined by its local storage versus its
systemic release. The first situation, we argue, is intended for
keeping in check local VEGF action, whereas the second
situation is largely associated with pathological VEGF neutralization. Further mechanistic insights on factors governing
retention versus release of sVEGF-R1 might be harnessed for
ameliorating the pathological consequences of excessive
circulating sVEGF-R1 acting on remote organs.
Sources of Funding
This work was supported by grants from the Israel Science Foundation (grant 593/10) and the National Cancer Institute, NIH (grant
CA106456) to I.V.
1069
Disclosures
None.
References
1. Kendall RL, Thomas KA. Inhibition of vascular endothelial cell growth
factor activity by an endogenously encoded soluble receptor. Proc Natl
Acad Sci U S A. 1993;90:10705–10709.
2. Kondo K, Hiratsuka S, Subbalakshmi E, Matsushime H, Shibuya M.
Genomic organization of the flt-1 gene encoding for vascular endothelial
growth factor (VEGF) receptor-1 suggests an intimate evolutionary relationship between the 7-ig and the 5-ig tyrosine kinase receptors.
Gene. 1998;208:297–305.
3. Ambati BK, Nozaki M, Singh N, Takeda A, Jani PD, Suthar T, Albuquerque RJ, Richter E, Sakurai E, Newcomb MT, Kleinman ME,
Caldwell RB, Lin Q, Ogura Y, Orecchia A, Samuelson DA, Agnew DW,
St Leger J, Green WR, Mahasreshti PJ, Curiel DT, Kwan D, Marsh H,
Ikeda S, Leiper LJ, Collinson JM, Bogdanovich S, Khurana TS, Shibuya
M, Baldwin ME, Ferrara N, Gerber HP, De Falco S, Witta J, Baffi JZ,
Raisler BJ, Ambati J. Corneal avascularity is due to soluble VEGF
receptor-1. Nature. 2006;443:993–997.
4. Levine RJ, Maynard SE, Qian C, Lim KH, England LJ, Yu KF,
Schisterman EF, Thadhani R, Sachs BP, Epstein FH, Sibai BM, Sukhatme
VP, Karumanchi SA. Circulating angiogenic factors and the risk of
preeclampsia. N Engl J Med. 2004;350:672– 683.
5. Maynard SE, Min JY, Merchan J, Lim KH, Li J, Mondal S, Libermann
TA, Morgan JP, Sellke FW, Stillman IE, Epstein FH, Sukhatme VP,
Karumanchi SA. Excess placental soluble fms-like tyrosine kinase 1
(sflt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia. J Clin Invest. 2003;111:649 – 658.
6. Park M, Lee ST. The fourth immunoglobulin-like loop in the extracellular
domain of flt-1, a VEGF receptor, includes a major heparin-binding site.
Biochem Biophys Res Commun. 1999;264:730 –734.
7. Rajakumar A, Powers RW, Hubel CA, Shibata E, von Versen-Hoynck F,
Plymire D, Jeyabalan A. Novel soluble flt-1 isoforms in plasma and
cultured placental explants from normotensive pregnant and preeclamptic
women. Placenta. 2009;30:25–34.
8. Bishop JR, Schuksz M, Esko JD. Heparan sulphate proteoglycans
fine-tune mammalian physiology. Nature. 2007;446:1030 –1037.
9. Vlodavsky I, Goldshmidt O, Zcharia E, Atzmon R, Rangini-Guatta Z,
Elkin M, Peretz T, Friedmann Y. Mammalian heparanase: involvement in
cancer metastasis, angiogenesis and normal development. Semin Cancer
Biol. 2002;12:121–129.
10. Abboud-Jarrous G, Atzmon R, Peretz T, Palermo C, Gadea BB, Joyce JA,
Vlodavsky I. Cathepsin l is responsible for processing and activation of
proheparanase through multiple cleavages of a linker segment. J Biol
Chem. 2008;283:18167–18176.
11. Motro B, Itin A, Sachs L, Keshet E. Pattern of interleukin 6 gene
expression in vivo suggests a role for this cytokine in angiogenesis. Proc
Natl Acad Sci U S A. 1990;87:3092–3096.
12. Zetser A, Levy-Adam F, Kaplan V, Gingis-Velitski S, Bashenko Y, Schubert
S, Flugelman MY, Vlodavsky I, Ilan N. Processing and activation of latent
heparanase occurs in lysosomes. J Cell Sci. 2004;117:2249–2258.
13. Miller RK, Genbacev O, Turner MA, Aplin JD, Caniggia I, Huppertz B.
Human placental explants in culture: approaches and assessments.
Placenta. 2005;26:439 – 448.
14. Zcharia E, Metzger S, Chajek-Shaul T, Aingorn H, Elkin M, Friedmann
Y, Weinstein T, Li JP, Lindahl U, Vlodavsky I. Transgenic expression of
mammalian heparanase uncovers physiological functions of heparan
sulfate in tissue morphogenesis, vascularization, and feeding behavior.
FASEB J. 2004;18:252–263.
15. Sela S, Itin A, Natanson-Yaron S, Greenfield C, Goldman-Wohl D, Yagel S,
Keshet E. A novel human-specific soluble vascular endothelial growth factor
receptor 1: Cell-type-specific splicing and implications to vascular endothelial
growth factor homeostasis and preeclampsia. Circ Res. 2008;102:1566–1574.
16. Krilleke D, DeErkenez A, Schubert W, Giri I, Robinson GS, Ng YS, Shima
DT. Molecular mapping and functional characterization of the VEGF164
heparin-binding domain. J Biol Chem. 2007;282:28045–28056.
17. Hood JD, Meininger CJ, Ziche M, Granger HJ. VEGF upregulates ecnos
message, protein, and no production in human endothelial cells. Am J
Physiol. 1998;274:H1054 –H1058.
18. Horowitz JR, Rivard A, van der Zee R, Hariawala M, Sheriff DD, Esakof
DD, Chaudhry GM, Symes JF, Isner JM. Vascular endothelial growth
factor/vascular permeability factor produces nitric oxide-dependent hypo-
1070
Circulation Research
April 29, 2011
tension. Evidence for a maintenance role in quiescent adult endothelium.
Arterioscler Thromb Vasc Biol. 1997;17:2793–2800.
19. Jokimaa VI, Kujari HP, Ekholm EM, Inki PL, Anttila L. Placental
expression of syndecan 1 is diminished in preeclampsia. Am J Obstet
Gynecol. 2000;183:1495–1498.
20. Haimov-Kochman R, Friedmann Y, Prus D, Goldman-Wohl DS,
Greenfield C, Anteby EY, Aviv A, Vlodavsky I, Yagel S. Localization of
heparanase in normal and pathological human placenta. Mol Hum
Reprod. 2002;8:566 –573.
21. Eremina V, Sood M, Haigh J, Nagy A, Lajoie G, Ferrara N, Gerber HP,
Kikkawa Y, Miner JH, Quaggin SE. Glomerular-specific alterations of
VEGF-A expression lead to distinct congenital and acquired renal
diseases. J Clin Invest. 2003;111:707–716.
22. Rey E, Garneau P, David M, Gauthier R, Leduc L, Michon N, Morin F,
Demers C, Kahn SR, Magee LA, Rodger M. Dalteparin for the prevention
of recurrence of placental-mediated complications of pregnancy in
women without thrombophilia: a pilot randomized controlled trial.
J Thromb Haemost. 2009;7:58 – 64.
Novelty and Significance
What Is Known?
●
Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017
●
The soluble vascular endothelial growth factor (VEGF) receptor 1
(sVEGF-R1) is a heparin-binding, naturally secreted decoy receptor
functioning as a VEGF trap.
sVEGF-R1 could accumulate in the circulation and interfere with
normal VEGF functioning in remote organs, notably with kidney
function in the context of preeclampsia (PE).
What New Information Does This Article Contribute?
●
●
There are large tissue stores of extracellular sVEGF-R1, primarily in
the vessel wall and in placenta that are displaceable by heparin
and heparin mimetics.
Heparanase, a heparan-sulfate endoglycosidase, plays a natural
regulatory role governing the retention vs. the systemic release of
sVEGF-R1.
The sVEGF-R1 is thought to play a protective role against
adverse VEGF signaling, which requires a mechanism for its
pericellular retention. Extending previous studies showing that
sVEGF-R1 binds heparin, we show that sVEGF-R1 is efficiently
retained in the vicinity of its producer cells in multiple tissues via
binding to heparan sulfates. sVEGF-R1 could, however, also
accumulate in the circulation under pathophysiological conditions like PE, raising the possibility of an active mechanism
regulating its systemic release. Here, we show that heparanase
releases sVEGF-R1 from its cellular stores. Using a combination
of transgenic heparanase manipulations with different modes of
heparanase inhibition, we show that heparanase is coexpressed
with sVEGF-R1 and that it plays a natural role in determining the
biodistribution of sVEGF-R1. These findings suggest that heparanase inhibitors might be therapeutically useful for reducing
pathogenic levels of circulating sVEGF-R1 and for normalizing
essential homeostatic VEGF functions in multiple organs.
Local Retention Versus Systemic Release of Soluble VEGF Receptor-1 Are Mediated by
Heparin-Binding and Regulated by Heparanase
Shay Sela, Shira Natanson-Yaron, Eyal Zcharia, Israel Vlodavsky, Simcha Yagel and Eli Keshet
Downloaded from http://circres.ahajournals.org/ by guest on June 14, 2017
Circ Res. 2011;108:1063-1070; originally published online March 17, 2011;
doi: 10.1161/CIRCRESAHA.110.239665
Circulation Research is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2011 American Heart Association, Inc. All rights reserved.
Print ISSN: 0009-7330. Online ISSN: 1524-4571
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://circres.ahajournals.org/content/108/9/1063
Data Supplement (unedited) at:
http://circres.ahajournals.org/content/suppl/2011/03/17/CIRCRESAHA.110.239665.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Circulation Research can be obtained via RightsLink, a service of the Copyright Clearance Center, not the
Editorial Office. Once the online version of the published article for which permission is being requested is
located, click Request Permissions in the middle column of the Web page under Services. Further information
about this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Circulation Research is online at:
http://circres.ahajournals.org//subscriptions/
Expanded Methods:
Recombinant expression of sVEGF-R1 isoforms - cDNAs encompassing the entire coding region of
both soluble receptor isoforms (Genbank sequences EU368830.1 and U01134.1) were sub-cloned into
Bluescript expression vectors and transfected onto T7 polymerase-expressing Hela cells. Twenty-four
hours later, media containing the secreted proteins was collected. Protein concentration was determined
with sVEGF-R1 ELISA.
Displacement from heparin sepharose columns – Heparin sepharose (GE Healthcare, CL-6B) was
packed on chromatography columns according to manufacturer instructions. A 1ug sample of each
sVEGF-R1 isoform was loaded and bound to the columns. Proteins were displaced from the columns
using increasing NaCl concentrations. Fractions were collected and evaluated for sVEGF-R1 amount by
western blotting as described below.
sVEGF-R1, Heparanase and Cathepsin L western blotting- Human recombinant proteins that were
displaced from heparin sepharose columns were run on a separating gel and blotted with the ab9540
antibody (Abcam). Mouse endogenous sVEGF-R1 was immuno-precipitated using the V4262 antibody
(Sigma), and immuno blotted using the sc-9029 antibody (Santa-Cruz biotechnology). C2970 antibody
(Sigma) was used for human cathepsin L blotting. Human heparanase was detected using the monoclonal
antibody 01385-126 (kindly provided by ImClone Systems Inc., New York, NY) , recognizing both the
50-kDa subunit and the 65-kDa proheparanase1.
sVEGF-R1 in situ hybridization- For in situ detection of mouse sVEGF-R1 RNA, paraffin-embedded
sections of mouse heart were hybridized with 35S-labeled riboprobe complementing the first 600
nucleotides of VEGF-R1's intron 13, as previously described2. In brief, 10-gm-thick frozen sections were
collected on poly(L-lysine)-coated glass slides, refixed in 4% paraformaldehyde, and dehydrated in
graded ethanol solutions. Before hybridization, sections were pretreated successively with 0.2 M HCl, 2x
SSC (lx SSC is 0.15 M NaCl/0.015 M sodium citrate), Pronase (0.125 mg/ml), 4% paraformaldehyde,
and acetic anhydride in triethanolamine buffer. Hybridization was carried out at 500C overnight in 50%
(vol/vol) formamide/0.3 M NaCl containing 10% (wt/vol) dextran sulfate, lx Denhardt's solution (0.02%
Ficoll/0.02% polyvinylpyrrolidone/0.02% bovine serum albumin), carrier tRNA (1 mg/ml), 10 mM
dithiothreitol, 5 mM EDTA, and 35S-labeled RNA probe (2 x 108 cpm/ml). Washing was performed
under stringent conditions that included an incubation at 50°C for >14 hr in 50% formamide/0.3 M NaCI
and a 30-min incubation at 37°C with RNase A (20 ug/ml).Autoradiography was performed using Kodak
NTB-2 nuclear track emulsion and autoradiographic exposure was for 4-5 days. Control hybridizations
with "sense" RNA probes were carried out in all experiments.
sVEGF-R1 and active heparanase immunohistochemistry - Paraffin-embedded sections of mouse
heart, or human term placenta were used. Antigen retrieval was performed by microwave heating in
citrate buffer (10mM Citric Acid, 0.05% Tween 20, pH 6.0). The 36-1100 antibody (Zymed) was used at
a 1:100 dilution to detect sFlt1. The 733 antibody was used at a 1:100 dilution to detect the active form of
heparanase3.
Heparin displacement of sVEGF-R1 from aortic arches – Mouse aortic arches were isolated, cleaned
from adventitia, cut into cylinder segments and incubated for 24 hours with or without 10 units/ml
heparin (Sigma, H0777). Medium was collected and evaluated for sVEGF-R1 levels with sVEGF-R1
ELISA.
Term human placental explants culture – Term human placentas were excised to small sections, and
incubated according to guidelines detailed elsewhere4. In short, 75 mg of placental villi were placed in
each well, and incubated in DMEM/F12 medium supplemented with 10% FCS, in 8% oxygen. Incubation
time varied according to the different protocols used in each experimental setting.
Heparin displacement of sVEGF-R1 from human placental villi explants – Human term placental
villi were explanted for 24 hours with different heparin concentrations. sVEGF-R1 levels were
determined in media and explanted placental villi using ELISA. Protein concentration of each villi sample
was determined using the Bradford assay. Similar protein amount of each villi sample was used to
determine sVEGF-R1 concentration.
Heparanase over-expressing transgenic mice – The generation and characterization of these mice are
described elsewhere5.
Real Time PCR - RNA and cDNA were generated from E16.5 placentas of Wt and heparanase Tg mice.
sVEGF-R1 levels were evaluated using SYBR green real time PCR, and normalized according to beta
actin levels.
sVEGF-R1 F primer:GGCCCAGAGGAAACGCTCCTC; sVEGF-R1 R primer:
AATCCAAACACACACCGGGCG. Beta actin F primer: ACCCGCGAGCACAGCTTCTT; Beta actin R
primer: GAACTGGTGGCGGGTGTGGA.
Heparanase inhibition in human placental villi explants - Heparanase processing and thereby
enzymatic activity was indirectly inhibited via a 72- hour incubation with 8 µmol/L of the specific
cathepsin L inhibitor (Calbiochem, cat. 219427)1. Heparanase was directly inhibited via a 48-hour
incubation with the neutralizing antibody 733 added to the medium at concentration of 10µg/ml3.
Heparanse inhibition required a longer incubation time than the 24 hours used for the heparin
displacement experiment in order to elicit an inhibition effect: Heparanase neutralization was evaluated
after 48 hours, whereas cathepsin L inhibitor required 72 hours of incubation, as active heparanase can be
found in the villi, and longer incubation time allows diminishing its effect.
ELISA- Human sVEGF-R1 levels were determined using the DVR100b sVEGF-R1 ELISA kit (R&D
systems). Mouse sVEGF-R1 levels were determined using the MVR100 sVEGF-R1 ELISA kit (R&D
systems).
Serum and placentas from pregnant women - Serum samples and term placentas were taken with
Institutional Review Board approval with the informed consent of pregnant women.
Statistics- Data was analyzed by two sample t-test. Standard error of the mean (SEM) was calculated as
sample standard deviation divided by the square root of the sample size.
References:
1. Abboud-Jarrous G, Atzmon R, Peretz T, Palermo C, Gadea BB, Joyce JA, Vlodavsky I.
Cathepsin l is responsible for processing and activation of proheparanase through multiple
cleavages of a linker segment. J Biol Chem. 2008;283:18167-18176
2. Motro B, Itin A, Sachs L, Keshet E. Pattern of interleukin 6 gene expression in vivo suggests a
role for this cytokine in angiogenesis. Proc Natl Acad Sci U S A. 1990;87:3092-3096
3. Zetser A, Levy-Adam F, Kaplan V, Gingis-Velitski S, Bashenko Y, Schubert S, Flugelman MY,
Vlodavsky I, Ilan N. Processing and activation of latent heparanase occurs in lysosomes. J Cell
Sci. 2004;117:2249-2258
4. Miller RK, Genbacev O, Turner MA, Aplin JD, Caniggia I, Huppertz B. Human placental
explants in culture: Approaches and assessments. Placenta. 2005;26:439-448
5. Zcharia E, Metzger S, Chajek-Shaul T, Aingorn H, Elkin M, Friedmann Y, Weinstein T, Li JP,
Lindahl U, Vlodavsky I. Transgenic expression of mammalian heparanase uncovers physiological
functions of heparan sulfate in tissue morphogenesis, vascularization, and feeding behavior.
Faseb J. 2004;18:252-263
Supplement Material
Online Figure I: Heparin changes the ratio of secreted vs. retained sVEGF-R1 in placental villi explants .
The total amounts of sVEGF-R1 detected in the medium (Secreted sVEGF-R1) and villi (Bound sVEGF-R1) in the heparin displacement
experiments (see Fig.3 for details) are shown. Note that a dose-dependent increase in released sVEGF-R1 is not accompanied by a statistically
significant
i ifi t increase
i
in
i overall
ll sVEGF-R1
VEGF R1 production.
d ti
D t are presented
Data
t d as mean±SEM.
±SEM n=3
3 ffor each
h group.
Online Figure II: sVEGF-R1 mRNA expression in placentas of wild type (Wt) and heparanase over-expressing transgenic mice.
(Tg). Real time PCR was used to evaluate the relative expression levels of sVEGF-R1 mRNA in E16.5 placentas of Wt and Tg mice
(normalized to β-actin levels). Note no significant difference in sVEGF-R1 levels. Data are presented as mean±SEM. n=5 and n=6 for
Wt and Tg group, respectively.