Principles of Molecular Biology
1
Principles of Molecular Biology
Training course on the
Principles of Molecular
Biology
Course Coordinator
Prof.Dr. Mohamed M.H. El-Defrawy
Assiut University, Faculty of Agriculture
Genetics Department, Biotechnology Lab., Assiut 71516, Egypt.
Office: +2088-2412743 Fax: +2088-2412743
Cellular phone (mobile): +20164016202
email: [email protected], [email protected]
[email protected]
This wiki-booklet is available for anyone who needs such
information. Anyone can contribute to it by sending an
email to the course coordinator including the proposed
modification that he/she sees that they are adding valuable
information or update(s)
2010
2
Principles of Molecular Biology
Gontributors
-Prof. Dr. Fathy M. Saleh
-Prof. Dr.
⊗
, Professor of Microbial Genetics
Mohamed M.H. El-Defrawy⊗ , Professor of
Population and Quantitative Genetics
⊗
Assiut University, Faculty of Agriculture, Department of
Genetics, Assiut, Egypt.
-Dr. Péter Poczai♣∇ (who revised the manuscript also)
∇Present address:
CIMO Research Fellow
Plant Biology (Biocenter 3), PO Box 65, FIN00014 UNIV. HELSINKI, FINLAND
Phone: +358-(0)-9-19167790
Facsimle +358-(0)-9-19157788
♣Former address:
Doctor of Plant Health
Dept. of Plant Science and
Biotechnology, University of Pannonia, H-8360,
Festetics 7, Keszthely, Hungary
-Mr. Mohamed A. Khirshy Yousef
♥
⊗♥
Present address;
Ph.D Student (CICY)
Centro de investigacion cientifica de Yucatan
www.cicy.mx
Mexico - Yucatan - Merida
mobile:+5219992630144
3
Principles of Molecular Biology
Table of contents
DNA structure and replication
4
Genome fine structure
12
Polymerase Chain Reaction (PCR)
21
Types of PCRs
36
Quantitation of DNA and RNA with Absorption and Fluorescence
spectroscopy
60
Monitoring and interpreting separations of DNA through agarose gels
76
Genotyping
81
DNA Isolation protocoles
89
Gel reading and troubleshooting
99
Statistical analysis
107
4
Principles of Molecular Biology
DNA structure
Introduction
The complete set of instructions for making an organism is called its genome.
It contains the master blueprint for all cellular structures and activities for the lifetime
of the cell or organism. Found in every nucleus of a person's many trillions of cells.
The human genome consists of tightly coiled threads of deoxyribonucleic acid
(DNA) and associated protein molecules, organized into structures called
chromosomes.
If unwound and tied together, the strands of DNA would stretch more than 5
feet but would be only 50 trillionths of an inch wide. For each organism, the
components of these slender threads encode all the information necessary for
building and maintaining life, from simple bacteria to remarkably complex human
beings. Understanding how DNA performs this function requires some knowledge of
its structure and organization.
DNA:
It's what makes you unique. It's the stuff that tells each and every one of your
body's 10 trillion cells what it's supposed to be and what it's supposed to do and
5
Principles of Molecular Biology
where. And although your DNA is different from that of every other person in the
world -unless you have an identical twin- it's the same in every cell that makes up
your body.
That DNA is unique from person to person but the same from cell to cell in one
person can be a handy thing, especially when it comes to DNA fingerprinting. DNA
fingerprints can be used for anything from determining a biological mother or father
to identifying the suspect of a crime. And, as may someday prove to be the case with
Sam Sheppard, it can be used to clear someone's name.
But what exactly is a DNA fingerprint? Well, it certainly isn't an inky impression of a
DNA strand. Compared to unimaginably small DNA, a fingerprint is HUGE. So what
is it that we're looking at, and how is one of these fingerprints made? Here's your
chance to find out. You'll find out by solving a mystery a crime of sorts. Solving the
mystery involves creating a DNA fingerprint (we'll supply the lab and all necessary
materials) and comparing this fingerprint to those of the suspects.
In humans, as in other higher organisms, a DNA molecule consists of two strands that
wrap around each other to resemble a twisted ladder whose sides, made of sugar and
phosphate molecules are connected by rungs of nitrogen-containing chemicals called
bases. Each strand is a linear arrangement of repeating similar units called
nucleotides, which are each composed of one sugar, one phosphate, and a nitrogenous
base. Four different bases are present in DNA: adenine (A), thymine (T), cytosine (C),
and guanine (G). The particular order of the bases arranged along the sugarphosphate backbone is called the DNA sequence; the sequence specifies the
6
Principles of Molecular Biology
exact genetic instructions required to create a particular organism with its own unique
traits.
DNA Structure.
The four nitrogenous bases of DNA are arranged
along the sugar-phosphate backbone in a particular order (the
DNA sequence), encoding all genetic instructions for an
organism. Adenine (A) pairs with thymine (T), while
cytosine (C) pairs with guanine (G). The two DNA strands
are held together by weak hydrogen bonds between the bases.
A gene is a segment of a DNA molecule (ranging from fewer
than 1 thousand bases to several million), located in a
particular position on a specific chromosome, whose base
sequence contains the information necessary for protein
synthesis.
The two DNA strands are held together by weak hydrogen bonds between the bases on
each strand, forming base pairs (bp). Genome size is usually stated as the total number
of base pairs; the human genome contains roughly 3 billion bp.
7
Principles of Molecular Biology
Comparative Sequence Sizes
(Bases)
(yeast chromosome 3)
350 Thousand
Escherichia coli (bacterium) genome
4.6 Million
Largest yeast chromosome now mapped
5.8 Million
Entire yeast genome
15 Million
Smallest human chromosome (Y)
50 Million
Largest human chromosome (1)
250 Million
Entire human genome
3 Billion
Comparison of Largest Known DNA Sequence with Approximate
Chromosome and Genome Sizes of Model Organisms and Humans.
Each time a cell divides into two daughter cells, its full genome is duplicated; for
humans and other complex organisms, this duplication occurs in the nucleus. During
cell division the DNA molecule unwinds and the weak bonds between the base pairs
break, allowing the strands to separate. Each strand directs the synthesis of a
complementary new strand, with free nucleotides matching up with their
complementary bases on each of the separated strands. Strict base-pairing rules are
adhered to adenine will pair only with thymine (an A-T pair, with 2 hydrogen bonds)
and cytosine with guanine (a C- G pair, with 3 hydrogen bonds). Each daughter cell
receives one old and one new DNA strand. The cells adherence to these base-pairing
rules ensures that the new strand is an exact copy of the old one.
8
Principles of Molecular Biology
DNA Replication
During replication the DNA molecule unwinds,
with each single strand becoming a template for
synthesis of a new, complementary strand. Each
daughter molecule, consisting of one old and
one new DNA strand, is an exact copy of the
parent molecule.
This minimizes the incidence of errors (mutations) that may greatly affect the
resulting organism or its offspring.
Genes:
Each DNA molecule contains many genes the basic physical and functional units of
heredity. A gene is a specific sequence of nucleotide bases, whose sequences carry the
information required for constructing proteins, which provide the structural
components of cells and tissues as well as enzymes for essential biochemical
reactions.
Human genes vary widely in length, often extending over thousands of bases, but only
about 10% of the genome is known to include the protein-coding sequences (exons)
of genes. Interspersed within many genes are intron sequences, which have no known
coding function. The balance of the genome is thought to consist of other noncoding
regions (such as control sequences and intergenic regions), whose functions are
obscure. All living organisms are composed largely of proteins; humans can
synthesize at least 100,000 different kinds. Proteins are large, complex molecules
made up of long chains of subunits called amino acids. Twenty different kinds of
amino acids are usually found in proteins. Within the gene, each specific sequence of
three DNA bases (codons) directs the cells protein-synthesizing machinery to add
specific amino acids. For example, the base sequence ATG codes for the amino acid
methionine. Since 3 bases code for 1 amino acid, the protein coded by an average-
9
Principles of Molecular Biology
sized gene (3000 bp) will contain 1000 amino acids. The genetic code is thus a series
of codons that specify which amino acids are required to make up specific proteins.
The protein-coding instructions from the genes are transmitted indirectly through
messenger ribonucleic acid (mRNA), a transient intermediary molecule similar to a
single strand of DNA. For the information within a gene to be expressed, a
complementary RNA strand is produced (a process called transcription) from the
DNA template in the nucleus. This mRNA is moved from the nucleus to the cellular
cytoplasm, where it serves as the template for protein synthesis. The cells proteinsynthesizing machinery then translates the codons into a string of amino acids that
will constitute the protein molecule for which it codes. In the laboratory, the mRNA
molecule can be isolated and used as a template to synthesize a complementary DNA
(cDNA) strand, which can then be used to locate the corresponding genes on a
chromosome map. The utility of this strategy is described in the section on physical
mapping.
10
Principles of Molecular Biology
Gene Expression. When genes are expressed, the genetic information (base sequence) on
DNA is first transcribed (copied) to a molecule of messenger RNA (mRNA) in a process
similar to DNA replication. The mRNA molecules then leave the cell nucleus and enter the
cytoplasm, where triplets of bases (codons) forming the genetic code specify the particular
amino acids that make up an individual protein. This process, called translation, is
accomplished by ribosomes (cellular components composed of proteins and another class of
ribosomal RNA, rRNA) that read the genetic code from the mRNA, and the transfer RNAs
(tRNAs) transports amino acids to the ribosome(s) for attachment to the growing protein.
11
Principles of Molecular Biology
Chromosomes
The 3 billion bp in the human genome are organized into 23 distinct,
physically separate microscopic units called chromosomes. All genes are arranged
linearly along the chromosomes. The nucleus of most human cells contains 2 sets of
chromosomes, 1 set given by each parent. Each set has 23 single chromosomes 22
autosomes and an X or Y sex chromosome. (A normal female will have a pair of X
chromosomes; a male will have an X and Y pair.) Chromosomes contain roughly
equal parts of protein and DNA; chromosomal DNA contains an average of 150
million bases. DNA molecules are among the largest molecules now known.
Chromosomes can be seen under a light microscope and, when stained with certain
dyes, reveal a pattern of light and dark bands. Differences in size and banding pattern
allow the 23 chromosomes to be distinguished from each other, an analysis called a
karyotype. A few types of major chromosomal abnormalities, including missing or
extra copies of a chromosome or gross breaks and re-joinings (translocations), can be
detected by microscopic examination; Downs syndrome, in which an individual's cells
contain a third copy of chromosome 21, is diagnosed by karyotype analysis. Most
changes in DNA, however, are too subtle to be detected by this technique and require
molecular analysis. These subtle DNA abnormalities (mutations) are responsible for
many inherited diseases such as cystic fibrosis and sickle cell anemia or may
predispose an individual to cancer, major psychiatric illnesses, and other complex
diseases.
12
Principles of Molecular Biology
Human Karyoptype
Genome fine structure
Repeat sequence length: Varies from 1 nucleotide to whole gene
Repeated sequences are of two basic types: unique sequences that are repeated in one
area; and repeated sequences that are interspersed throughout the genomes. Satellites
are unique sequences that are repeated in tandem in one area. Depending on the length
of the repeat, they are classified as either:
Minisatellite:
Short repeats of nucleotides.
Simple sequence repeats (SSRs, or microsatellites) are a class of DNA sequences
consisting of simple motifs or monomers of 1–6 nucleotides that are exact in identity,
repetition and are tandemly repeated from two or three up to a few dozen times at a
locus. SSRs have long been known to be distributed throughout the genomes of
eukaryotes and to be highly polymorphic. There is accumulating evidence that SSRs
serve a functional role, affecting gene expression, and that polymorphism of SSR tracts
may be important in the evolution of gene regulation.
Microsatellite:
Very short repeats of nucleotides. Some trinucleotide repeats are
found in coding regions (see, Trinucleotide repeat disorder). Most are found in
noncoding regions. Their function is unknown, if they have any specific function. They
are used as molecular markers which might be used in Maker Assisted Selection MAS
and in DNA fingerprinting.
13
Principles of Molecular Biology
Interspersed sequences are tandem repeats interspersed across the genome. They can
be classified based on their length as:
Short interspersed sequences (SINE):
The repeats are normally a few hundred base pairs in length. These sequences
constitute about 13% of the human genome with the specific Alu sequence accounting
for 5%. The Alu family is a family of repetitive elements in the Human genome. Alu
sequences are about 300 base pairs long. There are over one million Alu sequences
interspersed throughout the human genome however less than 0.5% is polymorphic.
Alu:
GC rich
Length: ~ 280 base pairs
Location: Untranslated intronic regions
Species: Primate-specific
Methylation: Maternal
Function: mostly unknown. Do not encode






protein; LINE dependent replication; associated with some diseases (e.g. breast
cancer, hemophilia, diabetes mellitus type II).
Polymorphism in: Myotonic

dystrophy CTG repeats
Mutations involving Alu elements:

Occasional patient
CCFDN: Only mutation identified
o
LGMD 2A
o
Mental retardation with epilepsy,
rostral ventricular enlargement
o
ACE polymorphism
o
Dystrophin-related cardiomyopathy
o Mariner (Mariner-like) elements
Flanked sides by TA dinucleotide
Length: ~80 bp
Sequence structure
o
2 perfect inverted repeat sequences
of 37 base pairs
o
Separated by six unique base pairs
(GAAAGT)
related to production of mutations in CMT
o




1A
Long interspersed sequences (LINE): The repeats are normally several thousand
base pairs in length. These sequences constitute about 21% of the human genome.
14
Principles of Molecular Biology
Both of these types are classified as retrotransposons. LINEs and SINEs are examples
where the sequences are repeats, but there are non-repeated sequences that can also be
retrotransposons.
Retrotransposons are sequences in the DNA that are the result of retrotransposition of
RNA. They are also called transposons via RNA intermediates. They
are genetic elements that can amplify themselves in a genome and are ubiquitous
components of the DNA of many eukaryotic organisms. They are a subclass
of transposons. They are particularly abundant in plants, where they are often a
principal component of nuclear DNA. In maize, 49-78% of the genome is made up of
retrotransposons. In wheat, about 90% of the genome consists of repeated sequences
and 68% of transposable elements. In mammals, almost half the genome (45% to 48%)
comprises transposons or remnants of transposons. Around 42% of the human genome
is made up of retrotransposons while DNA transposons account for about 2-3%.
Typical eukaryotic chromosomes contain much more DNA than is classified in the
categories above. The DNA may be used as spacing, or have other as-yet-unknown
function. Or, they may simply be random sequences of no consequence.
Highly repetitive DNA is found in some untranslated regions
6 to 10 base pair sequences may be repeated 100,000 to
1,000,000 times
o
Whole genes may exist as tandem clusters of multiple copies (50 to
10,000)
o
Multiple copy genes include histones, ribosomal RNA, tRNA,
SMN
o
Allow more gene product to accumulate per unit time
o
Meet high biosynthetic requirements during early development
o
Repeat induced gene silencing: Via methylation and chromatin
compaction

1 gene copy at locus expressed more effectively than
multiple copies in arrays

More repression when multiple copies of gene on 1
chromosome than with dispersion over several chromosomes
• Some DNA repeats present in numerous places and genes in genome
• Some DNA repeats are mutation "hot spots"
o
Cause mismatching during DNA replication, e.g. Alu
o
Form fragile chromosomal break points, e.g. CCG repeats
o
Number of repeats may be unstable during DNA replication,
e.g. CAG repeats
o
o
o
Repeat induced gene silencing: Via methylation and chromatin compaction

1 gene copy at locus expressed more effectively
than multiple copies in arrays
15
Principles of Molecular Biology
More repression when multiple copies of gene
on 1 chromosome than
with dispersion over several chromosomes
o
Some DNA repeats present in numerous places & genes in
genome
o
Some DNA repeats are mutation "hot spots"

Cause mismatching during DNA replication, e.g. Alu

Form fragile chromosomal break points, e.g. CCG
repeats

Number of repeats may be unstable during DNA
replication, e.g. CAG repeats
•
DNA Repeat types: Tandemly repeated DNA and Interspersed
repetitive DNA
o
Tandemly repeated DNA

Repeats often associated with disease syndromes

Telomeres
o Contain long arrays of TTAGGG repeats
o Repeats form nucleoprotein complex: Associate with TERF proteins.
o Repeat function

Protection of chromosome ends

Replication of chromosome ends

Control of telomere length
o
Interspersed repetitive DNA

Long Interspersed Nuclear Elements (LINEs)
o L1 element (Kpn repeat)
o AT rich regions
o Length: 6-8 kb
o LINEs contain internal promotors for RNA polymerase III
o Methylation: Paternal
o Species: Mammals

Transposable elements with Long Terminal Repeats
o Length: 1.5 - 10 kbp
o Encode reverse transcriptase
o Flanked by 300 - 1000 bps terminal repeats
o Regulation

Methylation: Paternal

Repressive chromatin structures
o Include non-functional human endogenous retroviruses (hERV)

DNA Transposons
o Single intron-less open reading frame
o Encode transposase
o Two short inverted repeat sequences flanking the reading frame
o
Transposable repeat elements: Possible adverse effects

Direct insertional mutagenesis
o ~1 in 500 new germ line mutations 2" transposable elements

Recombination between non-allelic repeats
o Can cause translocations and other re-arrangements
o See CMT 1A

Presence of strong promotor regions

16
Principles of Molecular Biology
Can cause inappropriate protein production

Anti-sense production

Demethylation in tumors
o Dysfunctional transposon activity
o Inappropriate gene expression
o Increased Oncogene function

Inserted within genes
o Effect: Reduced function
o See Fukuyama congenital muscular dystrophy
•
Trinucleotide repeats
o
10 possible sequence motifs
o
Further functional variation depending on reading frame
o
Nomenclature:

Same nucleotide repeats can be written in different
ways
o CCG, CGG, GCC are identical
o AGC, CAG are identical

AGC repeat in exon reading frame: Translated from
CAG to polyglutamine
o
Repeat sequences are sometimes disease associated.
•
•
p(CCG)n repeats
o
Frequency: Not uncommon in human genome
o
Location: Usually in 5' untranslated regions of genes
o
Repeat sizes

Normal: Polymorphic range (25 to 55)

Large: Full mutation (> ~230)
o
Large mutation: Mechanisms of disease

Chromosome susceptible to breakage near site

May inactivate gene: Inhibits transcription of gene
o
Expanded repeat
o
Cytosine methylation of mutation & adjacent
CpG residues
o
Interaction of CGG binding protein with
expanded repeat sequence
p(CAG)n repeats
o
Location

In exons of genes throughout genome

Exception for SCA12
o
Amino acid coding: Glutamine
o
Repeat sizes

Normal: Upper limit 32 to 40

Large: Lower limit 32 to 62

Exception is SCA6: Normal 4 to 18; Large 21 to 30

Reduced disease penetrance: HD 36 to 41 repeats;
SCA2 32 to 34 repeats

Intermediate alleles: CAG size
o
From which new mutations arise
17
Principles of Molecular Biology
> than usual in general population, < than in
patients with disease
o
Found clinically in some normal persons
o
Huntington's: 29 to 35 repeats

Size range: Normal vs. disease
o
Mutually exclusive disease & normal range:
SBMA; SCA 3, 6 & 7; DRPLA
o
No gap between normal & disease ranges:
Huntington's; SCA1 & 2
o
CAG repeat related diseases and Interruptions in CAG
sequences
p(CTG)n repeats
o
Location: 3' untranslated region
o
Repeat sizes

Normal: 5 to 35 copies

Intermediate range: 35 to 50

Mildly affected: 50 to 80

Severely affected: Up to 4,000 copies
o
Diseases: Myotonic Dystrophy; SCA8
o
Inheritance: Dominant
o
Postulated disease mechanisms

Effect on RNA stability or processing

Protein binding to large trinucleotide repeats

Altered expression of flanking DNA into protein
(DMAHP)
p(GCG)n repeats
o
Nucleotide composition of repeats

Imperfect

GCN triplets: Over-representation by GCG triplet
o
Location: Exon
o
Amino acid coding: Alanine
o
Stable during meiosis and mitosis
o
Normal proteins: Poly-Alanine repeats

Frequent in eucaryotic cells: Especially common in
transcription factors

Poorly conserved in vertebrates

Commonly located
o
Outside of other functional domains
o
N-terminal end of proteins
o
Diseases: Poly-alanine repeat disorders

General
o
Disease types: Congenital malformations

Especially skeletal & nervous system
disorders
o
Protein

Functions: All transcription factor genes,
except OPMD

Mutant: Present; Stable
o
Onset age: Young, except OPMD
o
•
•
18
Principles of Molecular Biology
o
Comparison with other mutation types in same
gene
Tend to produce milder disorders
May not produce same disease
manifestations
Longer repeat sequences: Some disorders more


o
severe
Inheritance

Dominant: Usual

Recessive: Infantile spasm syndrome

Dosage effect: Homozygous more severe
than heterozygous
o
Mutation mechanism: Unequal allelic
homologous recombination
o
Disease mechanism

Toxic gain of function

Protein aggregation: Cytosol or Nucleus
Oculopharyngeal Muscular Dystrophy (OPMD)
o
Repeat sizes (OPMD)

Normal: 6 repeats

Recessive OPMD: Homozygous 7
repeats

Dominant OPMD: 8 to 13 repeats
Neural disorders
o
Congenital hypoventilation syndrome (CCHS):
Paired mesoderm homeo box 2B (PHOX2B)

Normal 20 repeats; Disease 25 to 29
repeats
o
Congenital hypoventilation syndrome: Hash-1

Normal 13 repeats; Disease 5 to 8
repeats
o
Holoprosencephaly: ZIC2
o
Infantile spasm syndrome: Aristaless-related
homeobox, X-linked (ARX)

Normal 10 to 12 repeats; Disease 17 to
20 repeats

Other features: Mental retardation;
Lissencephaly; Abnormal genitalia
o
Mental retardation, X-linked, with isolated
Growth hormone deficiency: SOX3

Normal 9 repeats; Disease 20 to 31
repeats
Skeletal disorders
o
Cleidocranial dysplasia (CCD)(Dominant): α1
core-binding factor (RUNX2)

Normal 11 to 17 repeats; Disease 27
repeats
o
Synpolydactyly: HOXD13
o
Hand-Foot-Genital syndrome HOXA13

Normal 18 repeats; Disease 26 repeats
o



19
Principles of Molecular Biology
Blepharophimosis/Ptosis/Epicanthus inversus
syndrome (BPEIS): FOXL2
p(AAG)n repeats
o
Location: Intron
o
Repeat sizes

Normal: Polymorphic range (7 to 22)

Large: Full mutation (200 to 900)
o
Disease: Friedreich Ataxia
o
Inheritance: Recessive
o
Disease mechanism: Reduced protein production
o
•
Nuclear Ribosomal Spacer regions:
Pe´ter Poczai (2009) Department of Plant Sciences and Biotechnology, Georgikon
Faculty, University of Pannonia, Festetics 7, 8360 Keszthely, Hungary
The ribosomal RNA (rRNA) genes and their spacer regions have become widely used
as a source of phylogenetic information across the entire breadth of life. The popularity
of the rDNA locus for phylogenetics might be attributed to the phenomena that they
serve the same function in all free-living organisms. They have the same or almost the
same structure within a wide range of taxa. The coding regions, like the small- and
large subunit gene, represent some of the most conservative sequences in eukaryotes
which is a result of a strong selection against any loss-of-function mutation in
components of the ribosome subunits. The most conservative part appears to be the 30
end of the 26S rDNA representing the a-sarcin/ricin (S/R) loop. The information
provided by the rDNA locus in phylogenetic research is significant, and it can be used
at different taxonomic levels, since the specific regions of the rDNA loci are conserved
differentially. The spacer regions of the rDNA locus possess information useful for
plant systematics from species to generic level. They have also been used on studies of
speciation and biogeography, due to the high sequence variability and divergence.
There are three notable spacer regions: the external- and internal transcribed spacers
(ETS, ITS) and the intergenic spacer (IGS).
The internal transcribed spacer ITS as a phylogenetic marker:
The internal transcribed spacer (ITS) is intercalated in the 16S-5.8S-26S region
separating the elements of the rDNA locus (Fig. 1). The ITS region consists of three
parts: the ITS1 and ITS2 and the highly conserved 5.8S rDNA exon located in
between. The total length of this region varies between 500 and 750 bp in angiosperms
while in other seed plants it can be much longer, up to 1,500–3,500 bp. Both spacers
are incorporated into the mature ribosome, but undergo a specific cleavage during the
maturation of the ribosomal RNAs. It is now certain that ITS2 is sufficient for the
20
Principles of Molecular Biology
formation of the large subunit (LSU) rRNA during the ribosome biogenesis. The
correct higher order structure of both spacers is important to direct endonucleolytic
enzymes to proper cut sites. Although, the sequence length of the ITS2 is highly
variable between different organisms, Hadjiolova et al. (1994) identified structurally
homologous domains within mammals and Saccharomyces cerevisiae. In contrast to
the coding regions, spacers evolve more quickly, like the internal transcribed spacer
(ITS) region, which is extensively used as a marker for phylogenetic reconstruction at
different levels.
Fig. 1 Schematic presentation of the universal structure of the rDNA region in plants. (a) The
chromosomal location of the rDNA regions. (b) Tandem arrays of the consecutive gene blocks (18S5.8S-26S). In the tandem arrays each gene block is separated by an intergenic spacer (IGS) consisting of
a 50 end and 30end external transcribed spacer (ETS). The two ETS regions are separated by a
nontranscribed region (NTS). The transcription start site (TIS) labels the start position of the 50ETS.
The small subunit (18S) and large subunit genes (5.8S and 26S) are separated by the internal transcribed
spacer 1 (ITS1) and internal transcribed spacer 2 (ITS2).
Since its first application by Porter and Collins (1991) it has become widely used for
phylogeny reconstruction. As a part of the transcriptional unit of rDNA, the ITS is
present in virtually all organisms. The advantages of this region are: (1) biparental
inheritance, in comparison to the maternally inherited chloroplast and mitochondrial
markers; (2) easy PCR amplification, with several universal primers available for a
various kind of organisms; (3) multicopy structure; (4) moderate size allowing easy
21
Principles of Molecular Biology
sequencing; and (5) based on published studies it shows variation at the level that
makes it suitable for evolutionary studies at the species or generic level. this variability
is due to frequently occurring nucleotide polymorphisms or to common
insertions/deletions in the sequence. This high rate of divergence is also an important
source to study population differentiation or phylogeography. It has been widely
utilized across the whole tree of life, including fungi, animals, different groups of
‘algae’ lichens, and bryophytes. In addition it is often used in the other two major
domains of the tree of life Archaea and Bacteria, where RISSC, a novel database for
ribosomal 16S–23S RNA genes and spacer regions is developed to provide easy access
to information. The high copy numbers allow for highly reproducible amplification and
sequencing results. The number of studies utilizing ITS in phylogenetic studies is
increasing, publicly available ITS sequences has tripled since 2003.The plant families
most intensively studied are Asteraceae, Fabaceae, Orchideaceae, Poaceae,
Brassicaceae, and Apiaceae. At the genus level there are for example more than 1,000
sequences available for different species of Carex (NCBI GenBank, nucleotide search
preformed in 15.02.2009). Besides several advantages there are many drawbacks for
use of rDNA ITS data in evolutionary studies. There are hundreds or thousands of ITS
copies in a typical plant genome. Inferring phylogeny from multigene families like ITS
can lead to erroneous results, because there is variation among the different repeats
present in a single eukaryote genome. Evidence now suggests that this variation among
ITS sequences of an organism is found only within organisms that are hybrids or
polyploids.
Poczai, P. and, J. Hyvönen (2009). Nuclear ribosomal spacer regions in plant
phylogenetics: problems and prospects. Mol Biol Rep DOI 10.1007/s11033-0099630-3.
Hadjiolova KV, Normann A, Cavaille´ J, Soupe´ne E, Mazan S, Hadjiolov AA,
Bachellerie JP (1994). Processing of truncated mouse or human rRNA transcribed
from ribosomal minigenes transfected into mouse cells. Mol Cell Biol 14:4044–4056.
Porter CH, Collins FH (1991). Species-diagnostic differences in the ribosomal DNA
internal transcribed spacer from the sibling species Anopheles freeborni and
Anopheles hermsi (Diptera: Culicidae). Am J Trop Med Hyg 45:271–279.
22
Principles of Molecular Biology
Polymerase Chain Reaction (PCR)
INTRODUCTION
In molecular biology, the polymerase chain reaction (PCR) is a technique to amplify a
single or few copies of a piece of DNA across several orders of magnitude, generating
thousands to billions of copies (amplicons) of a particular DNA sequence. The
technique was invented by Dr. Kary Mullins, 1983, for which he received the Nobel
Prize in Chemistry in 1993. The method relies on thermal cycling, consisting of
cycles of repeated heating and cooling of the reaction for DNA
melting and enzymatic replication of the DNA. Primers (short DNA fragments)
containing sequences complementary to the target region along with a DNA
polymerase (after which the method is named) are key components to enable selective
and repeated amplification. As PCR progresses, the DNA generated is itself used as a
template for replication, setting in motion a chain reaction in which the DNA template
is exponentially amplified. PCR can be extensively modified to perform a wide array
of genetic manipulations.
23
Principles of Molecular Biology
What do we need for PCR?
• DNA template that contains the DNA region (target) to be amplified.
• Two forward and reverse primers, which determine the beginning and end of the
region to be amplified. But sometimes one may use just one primer that plays
the role of forward and reverse primers.
• Nucleotides: the four dNTPs (Adenine, Thymine, Cytosine, Guanine) the building
blocks from which the DNA polymerases synthesizes a new DNA strand.
• Heat-stable DNA polymerase (like Taq Polymerase)
• Reaction Buffer providing a suitable chemical environment for optimum activity
and stability of the DNA polymerase.
• Divalent cations, magnesium or manganese ions; generally Mg2+ as a cofactor
(MgCl2) is used, but Mn2+ can be utilized for PCR-mediated DNA mutagenesis,
as higher Mn2+ concentration increases the error rate during DNA synthesis.
• Monovalent cation potassium ions.
Thermal cycler:
A thermal cycler (a machine that automatically changes the temperature at the correct
time for each of the stages and can be programmed to carry out a set number of
cycles) is used for a PCR reaction.
All components are placed in a thin-walled Eppendorf tube (0.2-0.5 ml) then these tubes
are placed in the PCR thermal cycler.
2.5µl
2.5µl
1.25µl
1µl
4µl
1µl
DNA stock (25ng/µl)
1X Taq polymerase buffer
2.5mM MgCl2 (2.5mM)
primer stock (25pmol)
dNTP's (400µM)
Taq polymerase (0.5-1U)
Sterile water to make 25 µl
Steps of PCR reactions:
24
Principles of Molecular Biology
The PCR reaction usually consists of a series of 30-40 cycles repeated temperature
changes called cycles; each cycle typically consists of 2-3 discrete temperature steps.
Most commonly PCR is carried out with cycles that have three temperature steps (see
figure below). The cycling is often preceded by a single temperature step
(called hold) at a high temperature (90-95°C), and followed by one hold at the end for
final product extension or brief storage. The temperatures used and the length of time
they are applied in each cycle depend on a variety of parameters. These include the
enzyme used for DNA synthesis, the concentration of divalent ions and dNTPs in the
.reaction, and the melting temperature (Tm) of the primers
Initialization step: This step consists of heating the reaction to a temperature of 8695°C (or 98°C if extremely thermostable polymerases are used), which is held for 1-9
minutes. It is only required for DNA polymerases that require heat activation by hot.start PCR
Denaturation step: This step is the first regular cycling event and consists of heating
the reaction to 86-95°C for 20-60 seconds. It causes melting of DNA template and
primers by disrupting the hydrogen bonds between complementary bases of the DNA
.strands, yielding single strands of DNA
Annealing step: The reaction temperature is lowered to 33-65°C for 20-60 seconds
allowing annealing of the primers to the single-stranded DNA template. Typically the
annealing temperature is about 3-5 degrees Celsius below the Tm of the primers used.
(depending upon the primers' melting temperature Tm used, its length and its GC
content). Stable DNA-DNA hydrogen bonds are only formed when the primer
sequence very closely matches the template sequence. The polymerase binds to the
primer-template hybrid and begins DNA synthesis.
Extension/elongation step: The temperature at this step depends on the DNA
polymerase used; Taq polymerase has its optimum activity temperature at 7580°C, and commonly a temperature of 72°C is used with this enzyme. At this step the
DNA polymerase synthesizes a new DNA strand complementary to the DNA
template strand by adding dNTPs that are complementary to the template in 5' to 3'
direction, condensing the 5'-phosphate group of the dNTPs with the 3'-hydroxyl
group at the end of the nascent (extending) DNA strand. The extension time depends
both on the DNA polymerase used and on the length of the DNA fragment to be
amplified. As a rule-of-thumb, at its optimum temperature, the DNA polymerase will
25
Principles of Molecular Biology
polymerize a thousand bases per minute. Under optimum conditions, i.e., if there are
no limitations due to limiting substrates or reagents, at each extension step, the
Schematic drawing of the PCR cycle. (1) Denaturing at 94-96°C. (2)
Annealing at ~65°C (3) Elongation at 72°C. Four cycles are shown here.
The blue lines represent the DNA template to which primers (red arrows)
anneal that are extended by the DNA polymerase (light green circles), to
give shorter DNA products (green lines), which themselves are used as
templates as PCR progresses.
amount of DNA target is doubled, leading to exponential (geometric) amplification
of the specific DNA fragment. The DNA of interest is amplified by a power of 2 for
26
Principles of Molecular Biology
each PCR cycle: For example, if one subjects the DNA of interest to 5 cycles of PCR,
he will end up with 32 copies of DNA. Similarly, if one subjects the DNA of interest
to 35 cycles of PCR, he will end up with 1073741824 copies of DNA. Amplification
(replication) proceeds at an exponential (logarithmic) rate (amount of DNA produced
doubles at each cycle).
Final elongation: This single step is occasionally performed at a temperature of 7074°C , and commonly a temperature of 72°C is used for 5-15 minutes after the last
.PCR cycle to ensure that any remaining single-stranded DNA is fully extended
Final hold: This step at 4-15°C for an indefinite time may be employed for short.term storage of the reaction
Primer features:
• PCR primers are short (10-40 bp), single stranded DNA molecules.
• DNA amplification in PCR required on two primer(s) (forward and reverse
primers),which determine the beginning and end of the region to be amplified.
• The Forward and Reverse primers should have similar Tm (melting temperature).
• Sometimes primers are sequence specific, they will bind to a particular sequence in a
genome.
• Primers anneal to the flanking regions by complementary-base pairing (G=C and
A=T) using hydrogen bonding.
• The G+C content of the primers should be ~ 50%, and having G or C at 3’ end.
• Avoid sequences leading to hairpin formation.
• Avoid complementarities between oligo-primers (primer dimmer).
• They are manufactured commercially and can be ordered to match any DNA
sequence.
• As the size of the primer is increased, the likelihood of, for example, a primer
sequence of 35 bases repeatedly encountering a perfect complementary section on
the target DNA become remote
So it become increasing unlikely that one will get 16 bases in this particular sequence
(1 chance in 4.3 billion). In this same way, one can see that as the primer increases in
size, the chances of a match other than the one intended for is highly unlikely.
1) Conventional PCR DNA Polymerase features:
27
Principles of Molecular Biology
• Given that PCR involves very high temperatures, it is imperative that a heatstable DNA polymerase be used in the reaction.
• Most DNA polymerases would denature, and thus not function properly at the high
temperatures of PCR.
• Heat stable Taq DNA polymerase was purified from the hot springs bacterium
Thermus aquaticus in 1976
• Taq has maximal enzymatic activity at 72 °C to 80 °C, and substantially reduced
activities at lower temperatures.
• The DNA polymerase recognizes the primer and makes a complementary copy of
the template which is now single stranded.
• Taq DNA Polymerase extends the DNA chain by adding approx. 150 nucleotides
per second to the 3’ ends of the primers.
• All thermophilic DNA polymerases used in PCR show a small but measurable
activity at room temperature where researchers assemble the reaction components.
The enzymes' DNA polymerase activity will catalyze the extension of any annealed
3' end. Upon amplification, the resulting product contains a mixture of specific and
non-specific bands. Furthermore, the 5'-3' exonuclease activity of these enzymes
will degrade any free 5' end of partially annealed nucleic acid destroying the primer
and template substrates of the polymerase reaction. Less substrate means an
inhibited reaction and a lower yield of desired product. A number of non-specific
priming events occur under the low stringency conditions of ambient temperature.
Template hybridizes to itself, primer dimers form, and individual primers form
hairpin structures or partially anneal to non-specific sites on the template.
Therefore, preparing PCR at room temperature can generate secondary products in
the first PCR cycle that are amplified in subsequent cycles. Even when assembled
on ice, the reactions briefly pass through low stringency temperatures on the way to
the first melting step. The amplification of secondary products and the non-specific
exonuclease activity also unnecessarily consumes PCR reagents inhibiting the
amplification of the specific desired product. Normally, using template amounts in
excess of 100 to 500 copies avoids some of these difficulties. However, with lower
amounts of PCR target (especially in the presence of excess non-specific and
complex genomic DNA), these low rates of room temperature extension and
28
Principles of Molecular Biology
nuclease activities affect the specificity and efficiency of the polymerase chain
reaction. Skewed threshold cycle values and false amplicon melting temperatures in
real-time PCR as well as false end points in conventional PCR can all occur as a
result.
2) Hot-start technology overcomes the previous phenomena to generate cleaner
PCR products. The methodology prevents non-specific extension or degradation of
nucleic acid substrates at ambient temperatures by either excluding or reversibly
inhibiting the polymerase enzyme. Upon assembly, pre-heating the other reaction
components melts all priming events, both specific and non-specific. Addition of
the polymerase, if missing, then initiates PCR. Alternatively, the heat also reverses
the inhibition of the enzyme thus activating it. The first annealing step, due to its
properly defined temperature, allows specific annealing reactions to occur and
prevents non-specific annealing events. With a lack of non-specific hybridization
of primers to template or to one another, the resulting amplified DNA bands are
cleaner.
I.
Manual Techniques:
Manual hot-start, the simplest hot-start method, requires the researcher to
withhold a critical component, usually the polymerase, until the reaction has been
heated briefly at the melting temperature. Addition of the enzyme then initiates
the reaction. This method proves difficult and inconvenient to perform, especially
when processing many reactions at the same time, because the tubes must be kept
at 100 °C in the PCR hot block, which serves as the working surface. This method
also increases the risk of inadvertently contaminating the reactions.
II. Use of Physical Barriers:
This relatively simple hot-start method separates the critical polymerase
component from the template, primers, and other reaction components with a
physical barrier that the high melting temperature removes. The most commonly
and easily used barrier is wax and requires the following steps. A PCR tube
containing most of the reaction components receives a molten bead of wax. Upon
cooling, the wax forms a solid barrier over the aqueous phase and a receptacle for
the addition of an aliquot of the polymerase. Upon reheating during the thermal
cycles, the wax barrier melts, allowing the polymerase to mix with the other
components in the aqueous phase.
29
Principles of Molecular Biology
III.Reversible Polymerase Inactivation and Specially Formulated Hot-Start
Polymerases:
a.
Non-Covalently Bound Inhibitor:
A polypeptide, antibody, or oligonucleotide aptamer mixed with the
polymerase binds to the active or nucleotide-binding site of the
polymerase, rendering the enzyme inactive. Upon heating, the compound
denatures and dissociates from the polymerase, restoring enzyme activity.
The non-covalent protein-protein or oligonucleotide-protein interactions
between the inhibitor and the enzyme require only relatively low activation
energy, normally one to five minutes at 95 °C, to remove the inhibitor
from the active site. However, the ability of the inhibitors to re-associate
with the enzyme active site during thermal cycles may still disrupt or slow
the reaction affecting the yield of product.
b.
Chemical Modification:
Covalent modifications of amino acid residues in the polymerase,
particularly those in the active site, also inhibit the enzyme's activities.
Typical protein modification reagents each react with a specific type of
amino acid. For some of these reagents, a combination of heat, water and a
change in pH hydrolyzes their covalent modifications to regenerate the
active amino acid, release a more inert compound, and restore enzyme
activity. Unlike the dissociation of inhibitors from the enzyme, this
chemical reactivation of the polymerase is irreversible because the
activation process breaks molecular bonds. This process requires higher
activation energy, ten to even fifteen minutes at 95 °C, than the
dissociation of inhibitors further insuring the complete melting of nonspecific annealing events.
3. Examples of HotStart enzymes:
The reversible inactivation of the polymerase, whether by use of an inhibitor or
chemical modification, remains the most effective hot-start method. However,
individual researchers lack the time or expertise to generate such enzymes routinely
30
Principles of Molecular Biology
and consistently. Fortunately, several manufacturers offer at very reasonable prices
specially formulated polymerase enzymes carefully prepared with lot-to-lot
consistency. A few examples are listed below:
Antibody:
Polypeptide:
Chemical Modification:
Invitrogen™ Platinum™ Taq
Eppendorf HotMaster™ Taq
Roche FastStart Taq
ABgene THERMO-START®
DNA Polymerase
Stratagene SureStart™ Taq
SABiosciences
ReactionReady™ HotStart
"Sweet" PCR master mix
4. Performance of Specially Formulated Hot-Start Polymerases:
Effective hot-start polymerases should have minimal to no polymerase activity at
ambient temperature and should only yield product when properly activated. Figure 1
compares a hot-start enzyme with a conventional one. Indeed, the hot-start enzyme
only generates product when activated, while the conventional enzyme generates
product whether pre-incubated at high temperature or not. Furthermore, the activated
hot-start enzyme amplifies DNA equally as well as the treated or untreated
conventional enzyme indicating that the pre-modification of the enzyme and its
reversal do not affect the enzyme's proficiency. The small amount of product
observed from the inactivated hot-start enzyme results from partial activation by the
brief melting step in each cycle of the PCR program.
Figure 1: Activation of ReactionReady™ HotStart "Sweet" PCR master mix. The
"Sweet" and HotStart "Sweet" master mixes were used to amplify a gene-specific
fragment in replicate reactions that were either not activated or activated at 95 °C for
15 min. The master mixes only differ in their source of polymerase: The "Sweet"
contains a standard enzyme, while the HotStart "Sweet" contains a specially
formulated hot-start enzyme. Products were characterized by agarose gel
electrophoresis.
31
Principles of Molecular Biology
Before the polymerase amplifies or degrades any nucleic acid substrate, the same heat
activation process must also successfully melt the non-specific annealing and priming
events. For example, primer dimers, one of the most commonly observed non-specific
PCR products, occur when primer pairs complementary at their 3'-ends anneal to each
other allowing primer extension from the 3'-ends to generate a small double-stranded
product. The amplification of primer dimers unnecessarily consumes primers and
nucleotides, frequently reducing the yield of the desired amplification product. Primer
dimer formation during PCR could occur due to poor primer design or failure to use
or activate a hot start enzyme. As shown in Figure 2, a conventional enzyme primarily
amplifies a primer dimer at the expense of the actual gene-specific fragment. In
contrast, the hot-start enzyme produces only the expected fragment of the correct size,
without any primer dimer, and generates a greater amount of the product.
Figure 2: The ReactionReady™ HotStart "Sweet" PCR master mix eliminates
problematic primer dimers. XpressRef™ Human Universal Reference Total RNA
(GA-004, 3 µg) was converted to PCR template using the ReactionReady™ First
Strand cDNA Synthesis Kit. Equal amounts of template were added to separate
reactions to amplify a gene-specific fragment of human BCL10 using either
SABiosciences' HotStart "Sweet" master mix or a standard non-hot start PCR enzyme.
Products were characterized by agarose gel electrophoresis.
Interestingly, the length of time required for activation significantly contributes to the
effectiveness of the hot-start enzyme, and the activation time of each commercially
available enzyme varies. The longer the incubation time, the more likely non-specific
annealing events melt and the more likely cleaner and specific products result. Figure
3 compares the ability of three different hot-start enzymes to amplify three different
human genes. One enzyme relies on an antibody inhibitor and a short activation time.
The other two both use chemical modification with one needing a longer activation
time than the other. The results demonstrate that the hot-start enzymes with short
activation times generate a population of products of various sizes for all three genes,
most likely resulting from non-specific annealing of the primers to the template.
However, the enzyme with the longer activation time yields predominately one band
of the predicted size for the BAX and ITGA5 genes and correctly fails to yield a band
in the case of the poorly expressed IL11 gene. Therefore, longer activation times
32
Principles of Molecular Biology
allow more than enough time for non-specific annealing events to dissociate
preventing the formation of secondary products.
Figure 3: The ReactionReady™ HotStart "Sweet" PCR master mix outperforms other
competing hot start enzymes. XpressRef™ Human Universal Reference Total RNA
(GA-004, 3 µg) was converted to PCR template using the ReactionReady™ First
Strand cDNA Synthesis Kit. Gene-specific fragments of three different human genes
(BAX, ITGA5, IL11) were amplified by PCR from equal amounts of template using
the same primers and using either SABiosciences' HotStart "Sweet" master mix or one
of two hot start enzymes from other manufacturers, according to their respective
specifications. The enzyme in the HotStart "Sweet" master mix requires a longer
activation time than the other two enzymes. The products were characterized by
agarose gel electrophoresis.
0
1
capillary_electrophoresis
33
Principles of Molecular Biology
The PCR products are exposed to electrophoresis to distinguish the different
.amplicons using gel electrophoresis then analyzed using gel documentation system
gel_documentation_system
Analysis of primer sequences
When designing primers for PCR, sequencing or mutagenesis it is often necessary to
make predictions about these primers, for example melting temperature (Tm) and
propensity to form dimers with itself or other primers in the reaction. The following
program will perform these calculations on any primer sequence or pair.
IDT DNA (Select Oligo Analyzer)
http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
34
Principles of Molecular Biology
The programs will calculate both the Tm of the primers, as well as any undesireable
pairings of primers. When primers form hairpin loops or dimers less primer is
available for the desired reaction. For example...
Some thoughts on designing primers.
1. primers should be 17-28 bases in length
2. base composition should be 50-60% (G+C)
3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of
ends and increases efficiency of priming
4. Tms between 55-80oC are preferred
35
Principles of Molecular Biology
5. 3'-ends of primers should not be complementary (ie. base pair), as otherwise
primer dimers will be synthesised preferentially to any other product
6. primer self-complementarity (ability to form 2o structures such as hairpins) should
be avoided
7. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming
at G or C-rich sequences (because of stability of annealing), and should be avoided.
Also keep in mind that most oligonucleotide synthesis reactions are only 98%
efficient. This means that each time a base is added, only 98% of the oligos will
receive the base. This is not often critical with shorter oligos, but as length increases,
so does the probability that a primer will be missing a base. This is very important in
mutagenesis or cloning reactions. Purification by HPLC or PAGE is recommended
in some cases.
Oligonucleotide length
10 bases
20 bases
30 bases
40 bases
Percent with correct sequence
(0.98)10 = 81.7%
(0.98)20 = 66.7%
(0.98)30 = 54.6%
(0.98)40 = 44.6%
Designing Degenerate Oligonucleotides.
A group of degenerate oligonucleotides contain related sequences with differences at
specific locations. These are used simultaneously in the hope that one of the
sequences of the oligonucleotides will be perfectly complementary to a target DNA
sequence.
One common use of degenerate oligonucleotides is when the amino acid sequence of
a protein is known. One can reverse translate this sequence to determine all of the
possible nucleotide sequences that could encode that amino acid sequence. A set of
degenerate oligonucleotides would then be produced matching those DNA
sequences. The following link will take you to a program that will perform a reverse
translation. http://arbl.cvmbs.colostate.edu/molkit/rtranslate/
36
Principles of Molecular Biology
For example, the amino acid sequence shown in purple below could be encoded by
the following codons.
AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln
GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA
C
G
C
CT CAGC
A
A
G
G
C
C
T C
C
A
A
A
G
G
G
C
G
One could then select the 14 base sequence (in blue) to generate a smaller set of
degenerate oligonucleotides. Each oligonucleotide in the set would have one base
changed at a time (shown in purple below). A total of 32 unique oligonucleotides
would be generated.
TATTGTTGGCTTCC
TACTGTTGGCTTCC
TATTGCTGGCTTCC
TACTGCTGGCTTCC
etc.
When ordering degenerate oligonucleotides, you just let the company know that you
want a mixture of nucleotides added at a specific position using the code below. By
adding the mixture, oligos will incorporate one of the bases, leading to a mixture of
oligonucleotides.
Standard MixBase Definitions
A, G
C, T
A, C
G, T
C, G
A, T
A, C, T
C, G, T
A, C, G
37
Principles of Molecular Biology
A, G, T
A, C, G, T
Types of PCR:
1) Touchdown polymerase chain reaction
Touchdown polymerase chain reaction or touchdown style polymerase chain
reaction is a method of polymerase chain reaction by which primers will avoid
amplifying nonspecific sequence. The temperature at which primers anneal during a
cycle of polymerase chain reaction determines the specificity of annealing.
The melting point of the primer sets the upper limit on annealing temperature. At
temperatures just below this point, only very specific base pairing between the primer
and the template will occur. At lower temperatures, the primers bind less specifically.
Nonspecific primer binding obscures polymerase chain reaction results, as the
nonspecific sequences to which primers anneal in early steps of amplification will
"swamp out" any specific sequences because of the exponential nature of polymerase
amplification.
The earliest steps of a touchdown polymerase chain reaction cycle have high
annealing temperatures. The annealing temperature is decreased in increments for
every subsequent set of cycles (the number of individual cycles and increments of
temperature decrease is chosen by the experimenter). The primer will anneal at the
highest temperature which is least-permissive of nonspecific binding that it is able to
tolerate. Thus, the first sequence amplified is the one between the regions of greatest
primer specificity; it is most likely that this is the sequence of interest. These
fragments will be further amplified during subsequent rounds at lower temperatures,
and will out compete the nonspecific sequences to which the primers may bind at
those lower temperatures. If the primer initially (during the higher-temperature
phases) binds to the sequence of interest, subsequent rounds of polymerase chain
reaction can be performed upon the product to further amplify those fragments.
2) Quantitative PCR (Q-PCR or qPCR)
Q-PCR is a PCR technique used to quantify starting amounts of DNA template.
Amounts can be measured either at the end of the PCR (end-point assay) or during the
PCR steps (real-time PCR). Today real-time PCR is more commonly used because it
can be more precise. Cells in all organisms regulate gene expression and turnover of
gene transcripts (messenger RNA, abbreviated to mRNA), and the number of copies
of an mRNA transcript of a gene in a cell or tissue is determined by the rates of its
expression and degradation.
38
Principles of Molecular Biology
Northern blotting is often used to estimate the expression level of a gene by
visualizing the abundance of its mRNA transcript in a sample. In this method, purified
RNA is separated by agarose gel electrophoresis, transferred to a solid matrix (such as
a nylon membrane), and probed with a specific DNA or RNA probe that
iscomplementary to the gene of interest. Although this technique is still used to assess
gene expression, it requires relatively large amounts of RNA and provides only
qualitative or semiquantitative information of mRNA levels.
In order to robustly detect and quantify gene expression from small amounts of RNA,
amplification of the gene transcript is necessary. The polymerase chain reaction is a
common method for amplifying DNA; for mRNA-based PCR the RNA sample is first
reverse transcribed to cDNA with reverse transcriptase.
Development of PCR technologies based on reverse transcription
and fluorophores permits measurement of DNA amplification during PCR in real
time, i.e., the amplified product is measured at each PCR cycle. The data thus
generated can be analysed by computer software to calculate relative gene
expression in several samples, or mRNA copy number. Real-time PCR can also be
applied to the detection and quantification of DNA in samples to determine the
presence and abundance of a particular DNA sequence in these samples.
A DNA-binding dye binds to all double-stranded (ds)DNA in PCR, causing
fluorescence of the dye. An increase in DNA product during PCR therefore leads to
an increase in fluorescence intensity and is measured at each cycle, thus allowing
DNA concentrations to be quantified. However, dsDNA dyes such as SYBR
Green will bind to all dsDNA PCR products, including nonspecific PCR products
(such as "primerdimers"). This can potentially interfere with or prevent accurate
quantification of the intended target sequence.
1.
The reaction is prepared as usual, with the addition of fluorescent
dsDNA dye.
2.
The reaction is run in a thermocycler, and after each cycle, the levels
of fluorescence are measured with a detector; the dye only fluoresces when
bound to the dsDNA (i.e., the PCR product). With reference to a standard
dilution, the dsDNA concentration in the PCR can be determined.
Like other real-time PCR methods, the values obtained do not have absolute units
associated with it (i.e. mRNA copies/cell). As described above, a comparison of a
measured DNA/RNA sample to a standard dilution will only give a fraction or ratio of
the sample relative to the standard, allowing only relative comparisons between
different tissues or experimental conditions. To ensure accuracy in the quantification,
39
Principles of Molecular Biology
it is usually necessary to normalize expression of a target gene to a stably expressed
gene (see below). This can correct possible differences in RNA quantity or quality
across experimental samples.
Fluorescent reporter probes detect only the DNA containing the probe sequence;
therefore, use of the reporter probe significantly increases specificity, and enables
quantification even in the presence of non-specific DNA amplification. Fluorescent
probes can be used in multiplex assays—for detection of several genes in the same
reaction—based on specific probes with different-coloured labels, provided that all
targeted genes are amplified with similar efficiency. The specificity of fluorescent
reporter probes also prevents interference of measurements caused byprimer dimers,
which are undesirable potential by-products in PCR. However, fluorescent reporter
probes do not prevent the inhibitory effect of the primer dimers, which may depress
accumulation of the desired products in the reaction.
The method relies on a DNA-based probe with a fluorescent reporter at one end and
a quencher of fluorescence at the opposite end of the probe. The close proximity of
the reporter to the quencher prevents detection of its fluorescence; breakdown of the
probe by the 5' to 3'exonuclease activity of the Taq polymerase breaks the reporterquencher proximity and thus allows unquenched emission of fluorescence, which can
be detected after excitation with a laser. An increase in the product targeted by the
reporter probe at each PCR cycle therefore causes a proportional increase in
fluorescence due to the breakdown of the probe and release of the reporter.
1.
The PCR is prepared as usual (see PCR), and the reporter probe is
added.
2.
As the reaction commences, during the annealing stage of the PCR
both probe and primers anneal to the DNA target.
3.
Polymerisation of a new DNA strand is initiated from the primers, and
once the polymerase reaches the probe, its 5'-3-exonuclease degrades the
probe, physically separating the fluorescent reporter from the quencher,
resulting in an increase in fluorescence.
4.
Fluorescence is detected and measured in the real-time PCR
thermocycler, and its geometric increase corresponding to exponential
increase of the product is used to determine the threshold cycle (CT) in each
reaction.
40
Principles of Molecular Biology
(1) In intact probes, reporter fluorescence is quenched. (2) Probes and the
complementary DNA strand are hybridized and reporter fluorescence is still
quenched. (3) During PCR, the probe is degraded by the Taq polymerase and the
fluorescent reporter released.
Quantifying gene expression by traditional methods presents several problems.
Firstly, detection of mRNA on a Northern blot or PCR products on a gel or Southern
blot is time-consuming and does not allow precise quantification. Also, over the 20-40
cycles of a typical PCR, the amount of product reaches a plateau determined more by
the amount of primers in the reaction mix than by the input template/sample.
Relative concentrations of DNA present during the exponential phase of the reaction
are determined by plotting fluorescence against cycle number on a logarithmic
scale (so an exponentially increasing quantity will give a straight line). A threshold
for detection of fluorescence above background is determined. The cycle at which the
fluorescence from a sample crosses the threshold is called the cycle threshold, Ct. The
quantity of DNA theoretically doubles every cycle during the exponential phase and
relative amounts of DNA can be calculated, e.g. a sample whose Ct is 3 cycles earlier
than another's has 23 = 8 times more template. Since all sets of primers don't work
equally well, one has to calculate the reaction efficiency first. Thus, by using this as
the base and the cycle difference C(t) as the exponent, the precise difference in
starting template can be calculated (in previous example, if efficiency was 1.96, then
the sample would have 7.53 times more template).
Amounts of RNA or DNA are then determined by comparing the results to a standard
curve produced by real-time PCR of serial dilutions (e.g. undiluted, 1:4, 1:16, 1:64) of
a known amount of RNA or DNA. As mentioned above, to accurately quantify gene
expression, the measured amount of RNA from the gene of interest is divided by the
amount of RNA from a housekeeping gene measured in the same sample to normalize
for possible variation in the amount and quality of RNA between different samples.
This normalization permits accurate comparison of expression of the gene of interest
between different samples, provided that the expression of the reference
(housekeeping) gene used in the normalization is very similar across all the samples.
Choosing a reference gene fulfilling this criterion is therefore of high importance, and
41
Principles of Molecular Biology
often challenging, because only very few genes show equal levels of expression
across a range of different conditions or tissues. There are numerous applications for
real-time polymerase chain reaction in the laboratory. It is commonly used for both
diagnostic and basic research.
Diagnostic real-time PCR is applied to rapidly detect nucleic acids that are diagnostic
of, for example, infectious diseases, cancer and genetic abnormalities. The
introduction of real-time PCR assays to the clinical microbiology laboratory has
significantly improved the diagnosis of infectious diseases, and is deployed as a tool
to detect newly emerging diseases, such as flu, in diagnostic tests. In research settings,
real-time PCR is mainly used to provide quantitative measurements of gene
transcription. The technology may be used in determining how the genetic expression
of a particular gene changes over time, such as in the response of tissue and cell
cultures to an administration of a pharmacological agent, progression of cell
differentiation, or in response to changes in environmental conditions.
In a real time PCR protocol, a fluorescent reporter molecule is used to monitor the
PCR as it progresses. The fluorescence emitted by the reporter molecule manifolds as
the PCR product accumulates with each cycle of amplification. Based on the molecule
used for the detection, the real time PCR techniques can be categorically placed under
two heads:
1. Non-specific detection using DNA binding dyes
In real time PCR, DNA binding dyes are used as fluorescent reporters to monitor the
real time PCR reaction. The fluorescence of the reporter dye increases as the product
accumulates with each successive cycle of amplification. By recording the amount of
fluorescence emission at each cycle, it is possible to monitor the PCR reaction during
exponential phase. If a graph is drawn between the log of the starting amount of
template and the corresponding increase the fluorescence of the reporter dye
fluorescence during real time PCR, a linear relationship is observed.
SYBR® Green is the most widely used double-strand DNA-specific dye reported
for real time PCR. SYBR® Green binds to the minor groove of the DNA double helix.
In the solution, the unbound dye exhibits very little fluorescence. This fluorescence is
substantially enhanced when the dye is bound to double stranded DNA. SYBR®
Green remains stable under PCR conditions and the optical filter of the thermocycler
can be affixed to harmonize the excitation and emission wavelengths. Ethidium
42
Principles of Molecular Biology
bromide can also be used for detection but its carcinogenic nature renders its use
restrictive.
Principles of RQ-PCR techniques. (a) SYBR Green I technique. SYBR Green I
fluorescence is enormously increased upon binding to double-stranded DNA. During
the extension phase, more and more SYBR Green I will bind to the PCR product,
resulting in an increased fluorescence. Consequently, during each subsequent PCR
cycle more fluorescence signal will be detected. (b) Hydrolysis probe technique. The
hydrolysis probe is conjugated with a quencher fluorochrome, which absorbs the
43
Principles of Molecular Biology
fluorescence of the reporter fluorochrome as long as the probe is intact. However,
upon amplification of the target sequence, the hydrolysis probe is displaced and
subsequently hydrolyzed by the Taqpolymerase. This results in the separation of the
reporter and quencher fluorochrome and consequently the fluorescence of the reporter
fluorochrome becomes detectable. During each consecutive PCR cycle this
fluorescence will further increase because of the progressive and exponential
accumulation of free reporter fluorochromes. (c) Hybridization probes technique. In
this technique one probe is labeled with a donor fluorochrome at the 3' end and a
second probe is labeled with an acceptor fluorochrome. When the two fluorochromes
are in close vicinity (ie within 1–5 nucleotides), the emitted light of the donor
fluorochrome will excite the acceptor fluorochrome. This results in the emission of
fluorescence, which subsequently can be detected during the annealing phase and first
part of the extension phase of the PCR reaction. After each subsequent PCR cycle
more hybridization probes can anneal, resulting in higher fluorescence signals.
Although these double-stranded DNA-binding dyes provide the simplest and cheapest
option for real time PCR, the principal drawback to intercalation based detection of
PCR product accumulation is that both specific and nonspecific products generate
signal.
2. Specific detection target specific probes
Specific detection of real time
PCR is done with some
oligonucleotide probes labeled
with both a reporter fluorescent
dye and a quencher dye. Probes
based on different chemistries are
available for real time detection,
these include: Molecular Beacons
(Molecular beacons are short segments of ssDNA)
a.This beacon is 33 nucleotides long with a reporter dye attached to the 5' end and a
quencher attached to the 3' end. The nine 5' bases are able to form base pairs with the
44
Principles of Molecular Biology
nine 3' bases which brings the reporter and quencher in very close proximity.
Therefore, when the reporter is excited by the appropriate light, its emission is
absorbed by the quencher and no fluorescence is detected. The pink lines represent
nucleotides that can form base pairs with the PCR product under investigation.
The PCR portion of real-time PCR is standard. Two PCR primers are used to amplify
a segment of DNA .
PCR product of interest. The two primers are show as purple arrows and the base
pairing between the two strands are shown in pink.
As the PCR continues, the newly synthesized PCR products are denatured by high
temperatures. As each strand of the product are separated, the molecular beacon also
is denatured so the hairpin structure is disrupted. As the temperatures cool for the next
round of primer annealing, the molecular beacon is capable of forming base pairs with
the appropriate strand of the PCR product (Figure 3). Any molecular beacons that do
not bind to PCR product reform the hairpin structures and thus are unable to fluoresce.
However, molecular beacons that bind to PCR product remove the ability for the
quencher to block fluorescence from the reporter dye. Therefore, as PCR product
accumulates, there is a linear increase in fluorescence.
Detection of PCR product by molecular beacon. When the beacon binds to the PCR
product, it is able to fluoresce when excited by the appropriate wavelength of light.
45
Principles of Molecular Biology
The amount of fluorescence is directly proportional to the amount of PCR product
amplified.
Real-time PCR can be performed in a "multiplex" format which means that more than
one PCR product can be detected in a single reaction tube. For each sequence, there is
a unique color of fluorescent dye and therefore, each PCR product is associated with
its own color which is detected by the real-time PCR machine.
b. TaqMan® Probes
TaqMan probes (also known as Fluorogenic 5’ nuclease assay) contain two dyes, a
reporter dye (e.g. 6-FAM) at the 5’ end and a 3’ acceptor dye, usually TAMRA.
Recent designs substitute the 3’ TAMRA fluorescent acceptor quencher dye with nonfluorescent quencher, e.g. Black Hole Quencher. The proximity of the quencher to the
reporter in an intact Taqman probe allows the quencher to suppress, or “quench” the
fluorescence signal of the reporter dye through FRET. If the target of interest is
present, these Taqman probes specifically anneal between the forward and reverse
primer sites. During the reaction, the 5’ to 3’ nucleolytic activity of Taq polymerase
cleaves the probe between the reporter and the quencher only if the probe hybridizes
to the target. The probe fragments are displaced from the target, separating the
reporter dye from the quencher dye and thus resulting in increased fluorescence of the
reporter. Accumulation of PCR products is detected directly by monitoring the
increase in fluorescence of the reporter dye. Because increase in fluorescence signal is
detected only if the target sequence is complementary to the probe, nonspecific
amplification is not detected.
46
Principles of Molecular Biology
c. FRET HybridizationProbes
Förster resonance energy transfer (FRET), wherein an excited dye molecule transfers
it’s energy to a different, lower energy dye. This results in quenching of the
fluorescence from the first (donor) dye and stimulation of fluorescence from the
second (acceptor) dye, observed at longer wavelength. FRET is typically observed if
the donor and acceptor are separated by less than 10 nm and thus, it can be used to
monitor processes that result in changes in the donor-acceptor separation distance.
An interesting application of FRET is to monitor the process of RNA splicing, which
occurs in the nucleus of the cell. In humans (and many other organisms), the sequence
of a gene usually codes for a protein that would be much longer than what is actually
found when the protein is sequenced. The loss of information between DNA and
protein occurs at the RNA level by a process known as splicing. During this process,
RNA introns are
excised
out
of
the
initially
transcribed
RNA
and
the
remainingexons are stitched together to form the mature mRNA, which is
subsequently translated into protein by the ribosome (Figure 1). Splicing is catalyzed
by a large RNA-protein complex known as the spliceosome and, while much is known
about the composition of the spliceosome, far less is known about the individual steps
that occur during splicing. These steps include binding, conformational changes,
dissociation and chemical reactions. We can begin to understand the overall
mechanism of splicing by mapping out the structural changes that take place during
47
Principles of Molecular Biology
the splicing process.
In principle, FRET can be used to follow structural changes since the distance
between appropriately placed donor and acceptor dyes should change in response to a
conformational or chemical reaction step. However, RNA is not inherently
fluorescent, so donor and acceptor dyes need to be introduced into the RNA structure.
We use PNA to accomplish this by designing the PNA to be complementary to a
specific site in the RNA. In addition, we synthesize the PNA bearing a fluorescent
donor or acceptor dye. Mixing the PNA with the RNA allows the PNA to bind to its
target site in the RNA, delivering the fluorescent dye to that specific location. Figure 1
illustrates how this strategy is used to follow splicing. Before splicing occurs, the
donor and acceptor fluorophores are far apart due to the presence of the intron.
However, after splicing, the donor-acceptor distance is much smaller and FRET can
occur. We detect this as a decrease in donor fluorescence and an increase in acceptor
fluorescence.
Schematic of RNA splicing reaction as followed by fluorescent PNA hybridization probes.
48
Principles of Molecular Biology
d. Scorpion Primers
Allele-specific mutation detection by Scorpion Amplified Refractory Mutation
System. Allele-specific Scorpion primers are composed of a specific
fluorophore (green circleor red circle), a stem (purple), a gene-specific probe
region (orange), a quencher (gray circle), a blocker molecule (gray square),
and a primer (black) with a 3′-terminal nucleotide complementary to either the
wild-type or the mutant base in the DNA template (green line or red line).
Genomic DNA extracted from plasma is amplified by PCR in a reaction
containing Scorpion primers specific for wild-type or mutant alleles. Primers
anneal to template DNA, and the fluorophore remains quenched. Extension
occurs in an allele-specific manner. On denaturation, the probe mediates selfassociation of the Scorpion primer and, consequently, dissociation of the
fluorophore/quencher to generate allele-specific fluorescence. Fluorescence is
detected and quantitated by real-time PCR permitting a determination of the
genotype of input plasma DNA.
Real time PCR applications include
1 . Quantitative mRNA expression studies.
2 . DNA copy number measurements in genomic or viral DNAs.
3 . Allelic discrimination assays or SNP genotyping.
49
Principles of Molecular Biology
4 . Verification of microarray results.
5 . Drug therapy efficacy.
6 . DNA damage measurement.
Real Time PCR VS Traditional PCR
Real time PCR allows for the detection of PCR product during the early phases of the
reaction. This ability of measuring the reaction kinetics in the early phases of PCR
provide a distinct advantage over traditional PCR detection. Traditional methods use
gel electrophoresis for the detection of PCR amplification in the final phase or at endpoint of the PCR reaction.
3) Reverse transcription polymerase chain reaction (RT-PCR)
RT-PCR is a variant of polymerase chain reaction (PCR), a laboratory technique
commonly used in molecular biology to generate many copies of a DNA sequence, a
process termed "amplification". In RT-PCR, however, RNA strand is first reverse
transcribed into its DNA complement (complementary DNA, or cDNA) using the
enzyme reverse transcriptase, and the resulting cDNA is amplified using traditional
or real-time PCR. Reverse transcription PCR is not to be confused with real-time
polymerase chain reaction (Q-PCR/qRT-PCR), which is also sometimes (incorrectly)
abbreviated as RT-PCR.
RT-PCR utilizes a pair of primers, which are complementary to a defined sequence on
each of the two strands of the cDNA. These primers are then extended by a DNA
polymerase and a copy of the strand is made after each cycle, leading to logarithmic
amplification.
RT-PCR includes three major steps. The first step is the reverse transcription (RT)
where RNA is reverse transcribed to cDNA using a reverse transcriptase and primers.
This step is very important in order to allow the performance of PCR since DNA
polymerase can act only on DNAtemplates. The RT step can be performed either in
the same tube with PCR (one-step PCR) or in a separate one (two-step PCR) using a
temperature between 40°C and 50°C, depending on the properties of the reverse
transcriptase used.
The next step involves the denaturation of the dsDNA at 95°C, so that the two strands
separate and the primers can bind again at lower temperatures and begin a new chain
reaction. Then, the temperature is decreased until it reaches the annealing temperature
which can vary depending on the set of primers used, their concentration,
50
Principles of Molecular Biology
the probe and its concentration (if used), and the cations concentration. The main
consideration, of course, when choosing the optimal annealing temperature is the
melting temperature (Tm) of the primers and probes (if used). The annealing
temperature chosen for a PCR depends directly on length and composition of the
primers. This is the result of the difference ofhydrogen bonds between A-T (2 bonds)
and G-C (3 bonds). An annealing temperature about 5 degrees below the lowest Tm
of the pair of primers is usually used.
The final step of PCR amplification is the DNA extension from the primers which is
done by the thermostable Taq DNA polymerase usually at 72°C, which is the optimal
temperature for the polymerase to work. The length of the incubation at each
temperature, the temperature alterations and the number of cycles are controlled by a
programmable thermal cycler. The analysis of the PCR products depends on the type
of PCR applied. If a conventional PCR is used, the PCR product is detected
using agarose gel electrophoresis and ethidium bromide (or other nucleic acid
staining).
Conventional RT-PCR is a time-consuming technique with important limitations
when compared to real time PCR techniques. This, combined with the fact
that ethidium bromide has low sensitivity, yields results that are not always reliable.
Moreover, there is an increased cross-contamination risk of the samples since
detection of the PCR product requires the post-amplification processing of the
samples. Furthermore, the specificity of the assay is mainly determined by the
primers, which can give false-positive results. However, the most important issue
concerning conventional RT-PCR is the fact that it is a semi or even a low
quantitative technique, where the amplicon can be visualised only after the
amplification ends.
Real time RT-PCR provides a method where the amplicons can be visualised as the
amplification progresses using a fluorescent reporter molecule. There are three major
kinds of fluorescent reporters used in real time RT-PCR, general non specific DNA
Binding Dyes such as SYBR Green I, TaqMan Probes and Molecular
Beacons (including Scorpions).
The real time PCR thermal cycler has a fluorescence detection threshold, below which
it cannot discriminate the difference between amplification generated signal and
background noise. On the other hand, the fluorescence increases as the amplification
progresses and the instrument performs data acquisition during the annealing step of
each cycle. The number of amplicons will reach the detection baseline after a specific
cycle, which depends on the initial concentration of the target DNA sequence. The
cycle at which the instrument can discriminate the amplification
51
Principles of Molecular Biology
generated fluorescence from the background noise is called the threshold cycle (Ct).
The higher the initial DNA concentration, the lower its Ct will be.
Uses of reverse transcription polymerase chain reaction
The exponential amplification via reverse transcription polymerase chain reaction
provides for a highly sensitive technique, where a very low copy number of RNA
molecules can be detected. Reverse transcription polymerase chain reaction is widely
used in the diagnosis of genetic diseases and, semiquantitatively, in the determination
of the abundance of specific different RNA molecules within a cell or tissue as a
measure of gene expression. Northern blot is used to study the RNA's gene expression
further. RT-PCR can also be very useful in the cloning of eukaryotic genes in
prokaryotes. Due to the fact that most eukaryotic genes contain introns which are
present in the genome but not in the mature mRNA, the cDNA generated from a RTPCR reaction is the exact (without regard to the error prone nature of reverse
transcriptases) DNA sequence which would be directly translated into protein after
transcription. When these genes are expressed in prokaryotic cells for the sake of
protein production/purification, the RNA produced directly from transcription need
not undergo splicing as the transcript contains only exons (prokaryotes, such as E.coli,
lack the mRNA splicing mechanism of eukaryotes).
RT-PCR is commonly used in studying the genomes of viruses whose genomes are
composed of RNA, such as Influenzavirus A andretroviruses like HIV.
The Quantitative PCR Primer Database (QPPD) provides information about primers
and probes that can be used to quantitate human and mouse mRNA by reverse
transcription polymerase chain reaction (RT–PCR) assays. All data has been gathered
from published articles, cited in PubMed.
4) Multiplex PCR
Multiplex PCR is a variant of PCR which enabling simultaneous amplification of
many targets of interest in one reaction by using more than one pair of primers. Since
its first description in 1988 by Chamberlain et al, this method has been applied in
many areas of DNA testing, including analyses of deletions, mutations, and
polymorphisms, or quantitative assays and reverse transcription PCR. Typically, it is
used for genotyping applications where simultaneous analysis of multiple markers is
required, detection of pathogens or genetically modified organisms (GMOs), or for
microsatellite analyses. Multiplex assays can be tedious and time-consuming to
establish, requiring lengthy optimization procedures. Since the turn of the century
seven new respiratory viruses have infected man and two of these have resulted in
52
Principles of Molecular Biology
worldwide epidemics. Both SARS Coronavirus which quickly spread to 29 countries
in February 2003 and H1N1 swine influenza that recently spread from Mexico to 30
countries in three weeks represent major pandemic threats for mankind. Diagnostic
assays are required to detect novel influenza strains with pandemic potential.
Multiplex PCR have the ability to detect new, "non-seasonal" influenza viruses
including the H1N1 swine influenza.
5) Nested PCR
Nested polymerase chain reaction is a modification of polymerase chain
reaction intended to reduce the contamination in products due to the amplification of
unexpected primer binding sites. One of the methods currently employed to increase
sensitivity and specificity is the nested PCR (nPCR). Nested Primers for PCR is a
powerful method to amplify specific sequences of DNA from a large complex mixture
of DNA. For example, you can design PCR primers to amplify a single locus from an
entire genome. From a single template molecule, you can produce over 1 billion
copies of the PCR product very quickly. However, the capacity to amplify over one
billion fold also increases the possibility of amplifying the wrong DNA sequence over
one billion times. The specificity of PCR is determined by the specificity of the PCR
primers. For example, if your primers bind to more than one locus (e.g. paralog or
common domain), then more than one segment of DNA will be amplified. To control
for these possibilities, investigators often employ nested primers to ensure specificity.
Nested PCR means that two pairs of PCR primers were used for a single locus (figure
1). The first pair amplified the locus as seen in any PCR experiment. The second pair
of primers (nested primers) bind within the first PCR product (figure 4) and produce a
second PCR product that will be shorter than the first one (figure 5). The logic behind
this strategy is that if the wrong locus were amplified by mistake, the probability is
very low that it would also be amplified a second time by a second pair of primers.
Figure 1. Nested PCR strategy. Segment of DNA with dots representing nondiscript
DNA sequence of unspecified length. The double lines represent a large distance
between the portion of DNA illustrated in this figure. The portions of DNA shown
53
Principles of Molecular Biology
with four bases in a row represent PCR primer binding sites, though real primers
would be longer.
Figure 2. The first pair of PCR primers (blue with arrows) bind to the outer pair of
primer binding sites and amplify all the DNA in between these two sites.
Figure 3. PCR product after the first round of amiplificaiton. Notice that the bases
outside the PCR primer pair are not present in the product.
Figure 4. Second pair of nested primers (red with arrows) bind to the first PCR
product. The binding sites for the second pair of primers are a few bases "internal" to
the first primer binding sites.
Figure 5. Final PCR product after second round of PCR. The length of the product is
defined by the location of the internal primer binding sites.
When a complete genome sequence is known, it is easier to be sure you will not
amplify the wrong locus but since very few of the world's genomes have been
sequenced completely, nested primers will continue to be an important control for
many experiments.
54
Principles of Molecular Biology
6) Random Amplification of Polymorphic DNA (RAPD-PCR)
In 1990, two teams simultaneously reported the development of PCR-based,
novel, genetic screening techniques random amplified polymorphic DNA (RAPD)
and arbitrarily-primed PCR (AP-PCR) (Williams et al., 1990 and Welsh and
McClelland, 1990). The use of the polymerase chain reaction (PCR) in generating
random amplified polymorphic DNA (RAPD) has already proven valuable in
genetic analyses. Generation of molecular markers by RAPD PCR have provided
an efficient means to screen large populations in comparison with probe
construction and restriction fragment-length polymorphism (RFLP) linkage
analysis. RAPD markers have been used for generating genetic linkage maps
(Martin et al., 1991; Williams et al., 1990), genotype fingerprinting (Welsh and
McClelland, 1990), analyzing populations and pedigree (Dweikat et al., 1993),
predicting phylogenies (Halward et al., 1992), studying population dynamics
(Fritsch and Rieseberg, 1992), and identifying clones (Smith et al., 1992).
RAPD markers are decamer (10 nucleotide length) DNA fragments from PCR
amplification of random segments of genomic DNA with single or double
primer(s) of arbitrary nucleotide sequence and which are able to differentiate
between genetically distinct individuals, although not necessarily in a reproducible
way. The resulting amplified DNA markers are random polymorphic segments
with band sizes from 100 to 3000 bp depending upon the genomic DNA and the
primer. No fragment is produced if primers annealed too far apart or 3' ends of
the primers are not facing each other. Polymorphism of amplified fragments are
caused by: (1) base substitutions or deletions in the priming sites, (2) Insertions
that render priming sites too distant to support amplification, or (3) insertions or
deletions that change the size of the amplified fragment. If a mutation has
occurred in the template DNA at the site that was previously complementary to
the primer, a PCR product will not be produced, resulting in a different pattern of
amplified DNA segments on the gel. Selecting the right sequence for the primer is
very important because different sequences will produce different band patterns
and possibly allow for a more specific recognition of individual strains.
55
Principles of Molecular Biology
Limitations of RAPD

Nearly all RAPD markers are dominant, i.e. it is not possible to distinguish
whether a DNA segment is amplified from a locus that is heterozygous (1
copy) or homozygous (2 copies). Co-dominant RAPD markers, observed as
different-sized DNA segments amplified from the same locus, are detected
only rarely.

PCR is an enzymatic reaction, therefore the quality and concentration of
template DNA, concentrations of PCR components, and the PCR cycling
conditions may greatly influence the outcome. Thus, the RAPD technique is
notoriously laboratory dependent and needs carefully developed laboratory
protocols to be reproducible.

Mismatches between the primer and the template may result in the total
absence of PCR product as well as in a merely decreased amount of the
product. Thus, the RAPD results can be difficult to interpret.
Developing Locus-specific, Co-Dominant Markers from RAPDs

The polymorphic RAPD marker band is isolated from the gel.

It is amplified in the PCR reaction.

The PCR product is cloned and sequenced.

New longer and specific primers are designed for the DNA sequence, which is
called the Sequenced Characterized Amplified Region Marker (SCAR).
RAPD Protocol
•
Deoxynucleoside triphosphates (dNTP'S): 2.5 mM each of
dCTP,dATP,dTTP,dGTP. Store at –20 ºC
•
Magnesium chloride: 25mM stock and store at –20 º C
56
Principles of Molecular Biology
•
Genomic DNA 5-25 ng/ml stocks.
1. Assemble RAPD reactions as follows for each sample:
2.5µl
2.5µl
1.25µl
1µl
4µl
1µl
DNA stock (25ng/µl)
1X Taq polymerase buffer
2.5mM MgCl2 (2.5mM)
primer stock (25pmol)
dNTP's (400µM)
Taq polymerase (0.5-1U)
Sterile water to make 25 µl
Mix by inversion and spin for 2 seconds to collect solution. You may make a
mixture for the total number of samples +1 (as a spare) before adding the Taq
polymerase.
•
Wear gloves throughout RAPD reaction preparation procedure. Assay
buffer, dNTPs, MgCl2 and primer solution are thawed from frozen
stock. Keep the assembled reaction in themocycler for amplification.
Stock and final concentrations per 25 µl of reaction mixture:
Components
Stock Concentration
Final Concentration
Vol/Rxn
dNTPs
100 mM
0.8 mM
0.2 µl
1X Taq polym. buffer
10x
1x
2.5 µl
MgCl2
Taq
50 mM
2.5 mM
1.25 µl
5 u/µl
1 u/rxn
0.2 µl
Primer
10 µM
0.4 µM
1.0 µl
dH2O
-
-
17.35 µl
DNA
2 ng/µl
5 ng/µl
25 µl
Agarose gel electrophoresis
•
Reagents for agarose gel electrophoresis
•
Agarose, TBE (or TAE) buffer, Ethidium Bromide, gel loading dye,
•
To prepare 100ml of a 0.7-2% agarose solution, measure 0.7-2g agarose
into a glass beaker or flask and add 100ml 0.5X TBE buffer (or TAE).
•
Microwave (or stir on a hot plate) until agarose is dissolved and solution is
clear.
57
Principles of Molecular Biology
•
Allow solution to cool to about 55º C before pouring. ( ethidium bromide
can be added at this point to concentration of 0.5µg/ml).
•
Place the comb in the gel tray onto a leveled platform.
•
Pour 50º C gel solution into tray to a depth of about 5mm. Allow the gel to
solidify for about 20 min at room temperature.
•
To run, gently remove the comb, place the tray in electrophoresis
chamber, and cover (just until wells are submerged) with electrophoresis buffer
(the same buffer used to prepare the agarose: TBE (or TAE) buffer). Fill the
electrode tank also with 0.5X TBE buffer.
•
To the RAPD sample from refrigerator, add 1µl of 6% gel loading dye for
every 5 µl of DNA solution. Mix well. Load 15-20µl of DNA per well. Load also
the DNA size standards 10 µl of 1 Kb DNA Ladder (marker) alongside RAPD
reactions.
•
Connect the electrodes to the power supply and electrophorese at 50-
150Volts (depending on the distance between electrodes: 5volts/1cm) until the
bromophenol blue dye reaches 1cm of the gel edge.
Stain the gel with ethidium bromide (0.5-1 µl of the stack solution: 10 mg/ml, if not
already included in the gel). Note: Ethidium bromide is a mutagen and a probable
carcinogen. Wear gloves when working with ethidium bromide solutions. Also use care
not to contaminate the work area with the solution. UV light is damaging and must be
used with caution. UV light causes burns and can damage the eyes.
•
Examine the gel under UV light (transilluminator).
Depending on the objective of the experiment make a note of polymorphism, segregating
bands, and appearance of overall pattern within fingerprint. Bands may be sized by
comparison to molecular weight standards. The standards should be used to generate a
standard curve for interpolation.
After you have run the gel, obtain a photograph, and label and measure the migration of
the DNA bands. Make a standard curve plot of the known size markers, and determine
the size of the marker bands. Analyze the data using computer software NTSYS /
RAPDistance. Such steps are automated using a Gel documentation system.
58
Principles of Molecular Biology
DNA amplification
Place PCR tubes in a thermal cycler. Amplify using the following temperature profile:
Temperature (°C)
94
94
33-37
72
72
4
Time
Steps
2-5 min
60-30sec
20-30 min
0.5-2 min
5 min
∞
1
59
2 for 41 cycles
Final Extension
Final hold
Principles of Molecular Biology
Capillary electrophoresis
PCR conditions must be optimized and this is normally achieved by titrating the
magnesium-, template-, primer-, dNTP- and Taq polymerase concentration, “Hot Start
PCR”, “Touch-down PCR”, adding detergents, reducing the PCR cycles or by
gradually increasing the annealing temperature. The selection of the annealing
temperature is possibly the most critical component for optimizing the specificity of a
PCR reaction. In most cases, this temperature must be empirically tested. The PCR is
normally started at 5°C below the calculated temperature of the primer melting point
(Tm). However, the possible formation of unspecific secondary bands shows that the
optimum temperature is often much higher than the calculated temperature (>12°C).
Further PCR reactions with gradually increasing temperatures are required until the
most stringent conditions have been found. When a standard PCR cycler is used, this
method is the most time-intensive optimization strategy. The gradient PCR now
enables rapid testing of the optimum temperature conditions on one block and in one
experiment. During the PCR, a temperature gradient, which can be programmed
between 1°C and 20°C, is built up across the thermoblock. This allows the most
stringent parameters for every primer set to be calculated with the aid of only one
single PCR reaction.
60
Principles of Molecular Biology
gel documentation_system
61
Principles of Molecular Biology
Specifications: Multiplexing of up to 5 fluorophores in each reaction vessel.
Reliable thermal cycling performance and real-time PCR thermal gradient for
rapid assay development Embedded tool for end-point fluorescence analysis
that simplifies qualitative assessment of sample abundance in single or
multicolor assays.
62
Principles of Molecular Biology
 Dweikat, I., S. Mackenzie, M. Levy, and O. Herbert. 1993. Pedigree
assessment using RAPD-DGGE in cereal crop species. Theor. Appl. Genet.
85:497-505.
 Fritsch, P., and L. H. Rieseberg. 1992. Outcrossing rates are high in
androdioecious populations of the flowering plant Datisca glomerata. Nature
359-633-636.
 Halward, T. T. Stalker, E. LaRue, and G. Kochert. 1992. Use of singleprimer DNA amplification in genetic studies of peanut (Arachis hypogaea
L). Plant Mol. Biol. 18:315-325.
 Martin, G. B., J. G. K. Williams, and S. D. Tanksley. 1991. Rapid
identification of markers linked to a Pseudomonas resistance gene in tomato
by using random primers and near-isogenic lines. Proc. Natl. Acad. Sci.
USA. 88:2336-2340.
 Smith, M. L., J. N. Bruhn, and J. B. Anderson. 1992. The fungus
Armillaria bulbosa is among the largest and oldest living organisms. Nature
356:428-431.
 Welsh, J., and M. McClelland. 1990. Fingerprinting genomes using PCR
with arbitrary primers. Nucleic Acids Res. 189:7213-7218.
 Williams, J. G. K., Kubelik, A. R., Livak, K. J., Rafalski, J. A., and
Tingey, S. V. 1990. DNA polymorphisms amplified by arbitrary primers are
useful as genetic markers. Nucl. Acids Res. 18:6531-6535.
Quantitation of DNA and RNA with Absorption and Fluorescence
spectroscopy
Reliable quantitation of nanogram and microgram amounts of DNA and RNA in
solution is essential to researchers in molecular biology. In addition to the traditional
absorbance measurements at 260 nm three more sensitive fluorescence techniques are
presented below. These four procedures cover a range from 5 to 10 ng/ml DNA to 25
pg/ml DNA. Absorbance measurements are straightforward as long as any
contribution from contaminants and the buffer components are taken into account.
Fluorescence assays are less prone to interference than A260 measurements and are
also simple to perform. As with absorbance measurement, a reading from the reagent
blank is taken prior to adding the DNA. In instruments where the readout can be set to
indicate concentration, a known concentration is used for calibration and subsequent
readings are taken in µg/ml, ng/ml, or pg/ml DNA.
63
Principles of Molecular Biology
BASIC PROTOCOL DETECTION OF NUCLEIC ACIDS
USING ABSORPTION SPECTROSCOPY:
Absorption of the sample is measured at several different wavelengths to
assess purity and concentration of nucleic acids. A260 measurements are quantitative
for relatively pure nucleic acid preparations in microgram quantities. Absorbance
readings cannot discriminate between DNA and RNA; however, the ratio of A at 260
and 280 nm can be used as an indicator of nucleic acid purity. Proteins, for example,
have a peak absorption at 280 nm that will reduce the A260/A280 ratio. Absorbance
at 325 nm indicates particulates in the solution or dirty cuvettes; contaminants
containing peptide bonds or aromatic moieties such as protein and phenol absorb at
230 nm. This protocol is designed for a single-beam ultraviolet to visible range (UVVIS) spectrophotometer. If available, a double-beam spectrophotometer will simplify
the measurements, as it will automatically compare the cuvette holding the sample
solution to a reference cuvette that contains the blank. In addition, more sophisticated
double-beam instruments will scan various wavelengths and report the results
automatically.
Materials
1X TNE buffer (see recipe), DNA sample to be quantitated, Calf thymus DNA standard
solutions (see recipe). Matched quartz semi-micro spectrophotometer cuvettes (1-cm
pathlength). Single- or dual-beam spectrophotometer (ultraviolet to visible)
1. Pipet 1.0 ml of 1X TNE buffer into a quartz cuvette. Place the cuvette in a single- or
dual-beam spectrophotometer, read at 325 nm (note contribution of the blank relative to
distilled water if necessary), and zero the instrument. Use this blank solution as the
reference in double-beam instruments. For single-beam spectrophotometers, remove
blank cuvette and insert cuvette containing DNA sample or standard suspended in the
same solution as the blank. Take reading. Repeat this process at 280, 260, and 230 nm. It
is important that the DNA be suspended in the same solution as the blank.
2. To determine the concentration (C) of DNA present, use the A260 reading in
conjunction with one of the following equations:
Single-stranded DNA: C (pmol /μl) = A260/10*S,
Double-stranded DNA: C (pmol/μl) = A260/13.2*S,
C (μg/ml)= A260/0.027
C (μg/ml)= A260/0.020
Single-stranded RNA: C (μg/ml)= A260/0.025
Oligonucleotide: C (pmol/μl) = (A260) * [(100)/(1.5 NA + 0.71 NC + 1.20 NG + 0.84 NT)]
64
Principles of Molecular Biology
where S represents the size of the DNA in kilobases and N is the number or residues of
base A, G, C, or T.
For double-or single-stranded DNA and single-stranded RNA: These equations assume a
1cm-pathlength spectrophotometer cuvette and neutral pH. The calculations are based on
the Lambert-Beer law, A = ECl, where A is the absorbance at a particular wavelength, C
is the concentration of DNA, l is the pathlength of the spectrophotometer cuvette
(typically 1 cm), and E is the extinction coefficient. For solution concentrations given in
mol/liter and a cuvette of 1-cm pathlength, E is the molar extinction coefficient and has
units of M−1cm−1. If concentration units of μg/ml are used, then E is the specific
absorption coefficient and has units of (μg/ml)−1cm−1. The values of E used here are as
follows: ssDNA, 0.027 (μg/ml)−1cm−1; dsDNA, 0.020 (μg/ml)−1cm−1; ssRNA, 0.025
(μg/ml)
−1
cm−1. Using these calculations, an A260 of 1.0 indicates 50 μg/ml double-
stranded DNA, ~37 μg/ml single-stranded DNA, or ~40 μg/ml single-stranded RNA
(adapted from Applied Biosystems, 1987).
For oligonucleotides: Concentrations are calculated in the more convenient units of
pmol/μl. The base composition of the oligonucleotide has significant effects on
absorbance,
because the total absorbance is the sum of the individual contributions of each base
(Table A.3D.1).
3. Use the A260/A280 ratio and readings at A230 and A325 to estimate the purity of the
nucleic acid sample.
Table A.3D.1 Molar Extinction Coefficients of DNA Basesa
ε 1M260 nm
Base
Adenine
Cytosine
Guanosine
Thymine
15,200
7,050
12,010
8,400
a
Measured at 260 nm; see Wallace and Miyada, 1987
Ratios of 1.8 to 1.9 and 1.9 to 2.0 indicate highly purified preparations of DNA
and RNA, respectively. Contaminants that absorb at 280 nm (e.g., protein) will lower this
ratio.
Absorbance at 230 nm reflects contamination of the sample by phenol or urea, whereas
absorbance at 325 nm suggests contamination by particulates and dirty cuvettes. Light
65
Principles of Molecular Biology
scatter at 325 nm can be magnified 5-fold at 260 nm. Typical values at the four
wavelengths for a highly purified preparation are shown in Table A.3D.2.
Table A.3D.2 Spectrophotometric Measurements of Purified DNAa
Wavelength (nm)
Absorbance
A260/A280
Conc. (μg/ml)
325
280
260
230
0.01
0.28
0.56
0.30
—
—
2.0
—
—
—
28
—
aTypical absorbancy readings of highly purified calf thymus DNA suspended in 1X TNE buffer. The concentration of DNA was
nominally 25 μg/ml.
DNA DETECTION USING THE DNA-BINDING FLUOROCHROME
HOECHST 33258
Use of fluorometry to measure DNA concentration has gained popularity because it is
simple and much more sensitive than spectrophotometric measurements. Specific for
nanogram amounts of DNA, the Hoechst 33258 fluorochrome has little affinity for RNA
and works equally well with either whole-cell homogenates or purified preparations of
DNA. The fluorochrome is, however, sensitive to changes in DNA composition, with
preferential binding to AT-rich regions. A fluorometer capable of an excitation
wavelength of 365 nm and an emission wavelength of 460 nm is required for this assay.
Additional Materials (also see Basic Protocol). Hoechst 33258 assay solution (working
solution; see recipe). Dedicated filter fluorometer (Hoefer TKO100) or scanning
fluorescence spectrophotometer (Shimadzu model RF-5000 or Perkin-Elmer model LS5B or LS-3B). Fluorometric square glass cuvettes or disposable acrylic cuvettes
(Sarstedt) Teflon stir rod:
1. Prepare the scanning fluorescence spectrophotometer by setting the excitation
wavelength to 365 nm and the emission wavelength to 460 nm. The dedicated filter
fluorometer has fixed wavelengths at 365 and 460 nm and does not need adjustment.
2. Pipet 2.0 ml Hoechst 33258 assay solution into cuvette and place in sample chamber.
Take a reading without DNA and use as background. If the fluorometer has a
concentration readout mode or is capable of creating a standard curve, set instrument to
read 0 with the blank solution. Otherwise note the readings in relative fluorescence units.
Be sure to take a blank reading for each cuvette used, as slight variations can cause
changes in the background reading.
66
Principles of Molecular Biology
3. With the cuvette still in the sample chamber, add 2 μl DNA standard to the blank
Hoechst 33258 assay solution. Mix in the cuvette with a Teflon stir rod or by capping and
inverting the cuvette. Read emission in relative fluorescence units or set the concentration
readout equal to the final DNA concentration. Repeat measurements with remaining
DNA standards using fresh assay solution (take background zero reading and zero
instrument if needed). If necessary, the DNA standards should be quantitated by A260
measurement (Basic Protocol) before being used here. Small-bore tips designed for
loading sequencing gels minimize errors of pipetting small volumes. Prerinse tips with
sample and make sure no liquid remains outside the tip after drawing up the sample. Read
samples in duplicate or triplicate, with a blank reading taken each time. Unusual or
unstable blank readings indicate a dirty cuvette or particulate material in the solution,
respectively.
4. Repeat step 3 with unknown samples.
A dye concentration of 0.1 μg/ml is adequate for final DNA concentrations up to ~500
ng/ml. Increasing the working dye concentration to 1 μg/ml Hoechst 33258 will extend
the assay’s range to 15 μg/ml DNA, but will limit sensitivity at low concentrations (5 to
10 ng/ml). Sample volumes of ≤10 μl can be added to the 2.0-ml aliquot of Hoechst
33258 assay solution.
In contrast to the fluorochrome Hoechst 33258, ethidium bromide is relatively
unaffected by differences in the base composition of DNA. Ethidium bromide is not as
sensitive as Hoechst 33258 and, although capable of detecting nanogram levels of DNA,
will also bind to RNA. In preparations of DNA with minimal RNA contamination or with
DNA samples having an unusually high guanine and cytosine (GC) content where the
Hoechst 33258 signal can be quite low, ethidium bromide offers a relatively sensitive
alternative to the more popular Hoechst 33258 DNA assay. A fluorometer capable of an
excitation wavelength of 302 or 546 nm and an emission wavelength of 590 nm is
required for this assay.
Additional Materials (also see Basic Protocol)
Ethidium bromide assay solution (see recipe)
1. Pipet 2.0 ml ethidium bromide assay solution into cuvette and place in sample
chamber. Set excitation wavelength to 302 nm or 546 nm and emission wavelength to
590 nm. Take an emission reading without DNA and use as background. If the instrument
has a concentration readout mode or is capable of creating a standard curve, set
instrument to read 0 with the blank solution. Otherwise note the readings in relative
67
Principles of Molecular Biology
fluorescence units. The excitation wavelength of this assay can be either in the UV range
(~302 nm) using a quartz cuvette or in the visible range (546 nm) using a glass cuvette. In
both cases the emission wavelength is 590 nm.
2. Read and calibrate these samples as described in step 3 of the Hoechst 33258 assay.
3. Read emissions of the unknown samples as in step 4 of the Hoechst 33258 assay. A
dye concentration of 5 µg/ml in the ethidium bromide assay solution is appropriate for
final DNA concentrations up to 1000 ng/ml. 10 μg/ml ethidium bromide in the ethidium
bromide assay solution will extend the assay’s range to 10 μg/ml DNA, but is only used
for DNA concentrations >1 μg/ml. Sample volumes of up to 10 μl can be added to the
2.0-ml aliquot of ethidium bromide assay solution.
DNA DETECTION USING PICOGREEN dsDNA QUANTITATION REAGENT
PicoGreen dsDNA quantitation reagent enables researchers to quantitate as little
as 25 pg/ml of dsDNA (50 pg dsDNA in a 2-ml assay volume) with a standard
spectrofluorometer and fluorescein excitation and emission wavelengths. This sensitivity
exceeds that achieved with the Hoechst 33258–based assay (Alternate Protocol 1) by
400-fold. Using a fluorescence microplate reader, it is possible to detect as little as 250
pg/ml dsDNA (50 pg in a 200-μl assay volume). The standard PicoGreen assay protocol
is also simpler than that for Hoechst 33258 because a single concentration of the
PicoGreen reagent allows detection over the full dynamic range of the assay. In order to
achieve more than two orders of magnitude in dynamic range with Hoechst-based assays,
two different dye concentrations are recommended. In contrast, the linear detection range
of the PicoGreen assay in a standard fluorometer extends over more than four orders of
magnitude in DNA concentration—from 25 pg/ml to 1000 ng/ml—with a single dye
concentration (Fig.A.3D.1).
68
Principles of Molecular Biology
Linearity is maintained in the presence of several compounds that commonly contaminate
nucleic acid preparations, including salts, urea, ethanol, chloroform, detergents, proteins,
and agarose.
CAUTION: No data are available addressing the mutagenicity or toxicity of PicoGreen
dsDNA quantitation reagent. Because this reagent binds to nucleic acids, it should be
treated as a potential mutagen and handled with appropriate care. The DMSO stock
solution should be handled with particular caution, as DMSO is known to facilitate the
entry of organic molecules into tissues. It is strongly recommended that double gloves be
used when handling the DMSO stock solution. As with all nucleic acid reagents,
solutions of PicoGreen reagent should be poured through activated charcoal before
disposal. The charcoal must then be incinerated to destroy the dye.
Additional Materials (also see Basic Protocol)
PicoGreen dsDNA quantitation kit containing: PicoGreen dsDNA quantitation reagent
(Component A), 1 ml solution in DMSO (store frozen up to 6 months at −20°C, protected
from light) 20X TE (Component B), 25 ml of 200 mM Tris.Cl/20 mM EDTA, pH 7.5
(store up to 6 months at 4°C; may be frozen for long-term storage) Lambda DNA
standard (Component C), 1 ml of 100 μg/ml in TE (store up to 6 months at 4°C; may be
frozen for long-term storage) Spectrofluorometer or fluorescence microplate reader.
NOTE: For either the kits or the stand-alone reagent, sufficient reagent is supplied for
200 assays using an assay volume of 2 ml according to the protocol below. Note that the
assay volume is dependent on the instrument used to measure fluorescence; with a
microplate reader and a 96-well microplate, the assay volume is reduced to 200 μl and
2000 assays are possible. The PicoGreen reagent supplied in the kits is exactly the same
as the reagent sold separately. The DMSO stock solution should be stored frozen at
−20°C and protected from light. The 20X assay buffer and lambda DNA standard in the
kits are best stored at 4°C; however, either may be frozen for long-term storage. When
properly stored, components should be stable for at least 6 months.
Prepare the reagent
1. On day of experiment, prepare an aqueous working solution of the PicoGreen reagent
by making a 200-fold dilution of the concentrated DMSO solution in 1X TE. Allow the
PicoGreen reagent to warm to room temperature before opening the vial. Because the
PicoGreen dye is an extremely sensitive detection reagent for dsDNA, it is imperative
that the TE solution be free of contaminating nucleic acids. The 20X TE buffer included
in the PicoGreen dsDNA Quantitation Kits is certified to be nucleic acid–free and
69
Principles of Molecular Biology
DNase-free. Prepare a 1X TE working solution by diluting the concentrated buffer 20fold with sterile, distilled, DNase-free water. To prepare enough working solution to
assay 20 samples in a 2-ml final volume, add 100µl PicoGreen dsDNA quantitation
reagent to 19.9 ml TE. The author recommends preparing this solution in a plastic
container rather than glass, as the reagent may adsorb to glass surfaces. Protect the
working solution from light by covering it with foil or placing it in the dark, as the
PicoGreen reagent is susceptible to photodegradation. For best results, this solution
should be used within a few hours of its preparation. Establish the DNA standard curve
2. Prepare a 2 μg/ml stock solution of dsDNA in 1X TE. Determine the DNA
concentration on the basis of absorbance at 260 nm (A260) in a cuvette with a 1-cm
pathlength (see Basic Protocol); an A260 of 0.04 corresponds to 2 μg/ml dsDNA
solution.
For a standard curve, the author commonly uses bacteriophage lambda DNA (provided
with kit) or calf thymus DNA, although any purified dsDNA preparation may be used.
The lambda DNA standard, provided at 100 _g/ml in the PicoGreen Kits, can simply be
diluted 50-fold in 1X TE to make the 2 μg/ml working solution. For example, 30 μl of the
DNA standard mixed with 1.47 ml of TE will be sufficient for the standard curve
described below. It is sometimes preferable to prepare the standard curve with DNA
similar to the type being assayed; e.g., long or short linear DNA fragments when
quantitating similar-sized restriction fragments or plasmid when quantitating plasmid
DNA. However, most linear dsDNA molecules yield approximately equivalent signals,
regardless of fragment length. Results have shown that the PicoGreen assay remains
linear in the presence of several compounds that commonly contaminate nucleic acid
preparations, although the signal intensity may be affected (Table A.3D.3). Thus, to serve
as an effective control, the dsDNA solution used to prepare the standard curve should be
treated the same way as the experimental samples and should contain similar levels of
such compounds.
3a. For high-range standard curve: Create a five-point standard curve from 1 ng/ml to 1
μg/ml by combining the 2 μg/ml stock prepared in step 2 with 1X TE, in disposable
cuvettes (or plastic test tubes for transfer to quartz cuvettes), according to Table A.3D.4.
3b. For low-range standard curve: Prepare a 40-fold dilution of the 2 μg/ml DNA solution
to yield a 50 ng/ml DNA stock solution. Create a five-point standard curve from 25
pg/ml to 25 ng/ml by combining this 50 ng/ml stock with 1X TE in disposable cuvettes
(or plastic test tubes for transfer to quartz cuvettes), according to Table A.3D.4.
70
Principles of Molecular Biology
To create the low-range standard curve, adjust the fluorometer gain to accommodate the
lower fluorescence signals.
4. Add 1.0 ml of the aqueous working solution of PicoGreen reagent (prepared in step1)
to each cuvette. Mix well and incubate for 2 to 5 min at room temperature, protected from
light.
5. After incubation, measure sample fluorescence using a spectrofluorometer or
fluorescence microplate reader and standard fluorescein wavelengths (excitation ~480
nm, emission ~520 nm). To ensure that the sample readings remain in the detection
range of the fluorometer, set the instrument’s gain so that the sample containing the
highest DNA concentration yields a fluorescence intensity near the fluorometer’s
maximum. To minimize photobleaching effects, keep the time for fluorescence
measurement constant for all samples.
6. Subtract the fluorescence value of the reagent blank from that of each of the samples.
Use corrected data to generate a standard curve of fluorescence versus DNA
concentration (see Fig. A.3D.1). Analyze samples
71
Principles of Molecular Biology
7. Add 1.0 ml of the aqueous working solution of the PicoGreen reagent (prepared in step
1) to each sample. Incubate 2 to 5 min at room temperature, protected from light.
72
Principles of Molecular Biology
8. Measure fluorescence of sample using instrument parameters that correspond to those
used when generating standard curve (see steps 2 to 6). To minimize photobleaching
effects, keep time for fluorescence measurement constant for all samples.
9. Subtract fluorescence value of reagent blank from that of each sample. Determine
DNA concentration of the sample from standard curve.
10. If desired, repeat assay using a different dilution of the sample to confirm results.
REAGENTS AND SOLUTIONS
Use deionized, distilled water in all recipes and protocol steps.
Calf thymus DNA standard solutions Kits containing calf thymus DNA standard for
fluorometry are available (Fluorometry Reference Standard Kits, Hoefer). Premeasured,
CsCl-gradient-purified DNA of defined GC content, for use in absorption and
fluorometric spectroscopy, is available from Sigma (e.g., calf thymus DNA, 42% GC;
Clostridium perfringen DNA, 26.5% GC).
Ethidium bromide assay solution
Add 10 ml of 10X TNE buffer (see recipe) to 89.5 ml H2O. Filter through a 0.45-μm
filter, then add 0.5 ml of 1 mg/ml ethidium bromide. Add the dye after filtering, as
ethidium bromide will bind to most filtration membranes.
CAUTION: Ethidium bromide is hazardous; wear gloves and use appropriate care in
handling, storage, and disposal.
Hoechst 33258 assay solutions
Stock solution: Dissolve in H2O at 1 mg/ml. Stable for ~ 6 months at 4°C.
Working solution: Add 10 ml of 10X TNE buffer (see recipe) to 90 ml H2O. Filter
through a 0.45-μm filter, then add 10 μl of 1 mg/ml Hoechst 33258.
Hoechst 33258 is a fluorochrome dye with a molecular weight of 624 and a molar
extinction coefficient of 4.2*104 M−1cm−1 at 338 nm. The dye is added after filtering
because it will bind to most filtration membranes. Hoechst 33258 is hazardous; use
appropriate care in handling, storage, and disposal.
TNE buffer, 10SX, 100 mM Tris base, 10 mM EDTA, 2.0 M NaCl, Adjust pH to 7.4
with concentrated HCl. As needed, dilute with H2O to desired concentration.
COMMENTARY
Background Information
In deciding what method of nucleic acid measurement is appropriate, three issues are
critical: specificity, sensitivity, and interfering substances. Properties of the four assays
described in this section are listed in Table A.3D.5.
73
Principles of Molecular Biology
The traditional method for determining the amount of DNA in solution is by measuring
absorbance at 260 nm. Because many potential contaminants of DNA and RNA
preparations also absorb in the UV range, absorption spectroscopy is a reliable method to
assess both the purity of a preparation and the quantity of DNA or RNA present.
Absorption spectroscopy does have serious limitations. Relatively large amounts of DNA
are required to get accurate readings—for example, 500 ng/ml DNA is equivalent to only
0.01 A260 units. Furthermore, the method cannot discriminate between RNA and DNA,
and UV-absorbing contaminants such as protein will cause discrepancies. The assay
using Hoechst 33258 dye (Alternate Protocol 1) is the only procedure in common use that
is specific for DNA (i.e., it does not measure RNA). This assay is the method of choice
for rapid measurement of low quantities of DNA, with a detection limit of ~1 ng DNA.
Concentrations of DNA in both crude cell lysates and purified preparations can be
quantified (Labarca and Paigen, 1980). Because the assay quantifies a broad range of
DNA concentrations— from 10 ng/ml to 15 μg/ml—it is useful for the measurement of
both small and large amounts of DNA (e.g., in verifying DNA concentrations prior to
performing electrophoretic separations and Southern blots). The Hoechst 33258 assay is
also useful for measuring products of the polymerase chain reaction (PCR) synthesis.
Upon binding to DNA, the fluorescence characteristics of Hoechst 33258 change
dramatically, showing a large increase in emission at ~458 nm. Hoechst 33258 is
nonintercalating and apparently binds to the minor groove of the DNA, with a marked
preference for AT sequences (Portugal and Waring, 1988). The fluorochrome 4′,6diamidino-2-phenylindole (DAPI; Daxhelet et al., 1989) is also appropriate for DNA
74
Principles of Molecular Biology
quantitation, although it is not as commonly used as Hoechst 33258. DAPI is excited with
a peak at 344 nm. Emission is detected at ~ 466 nm, similar to Hoechst 33258.
Ethidium bromide is best known for routine staining of electrophoretically separated
DNA and RNA, but it can also be used to quantify both DNA and RNA in solution (Le
Pecq, 1971). Unlike Hoechst 33258, ethidium bromide fluorescence is not significantly
impaired by high GC content. The ethidium bromide assay (with excitation at 546 nm) is
~20-fold less sensitive than the Hoechst 33258 assay. In addition to the advantages
mentioned in the protocol itself (see Alternate Protocol 3), the PicoGreen assay protocol
also minimizes the fluorescence contribution of RNA and single-stranded DNA (ssDNA).
Although the Hoechst 33258–based method is not significantly affected by the presence
of RNA when the assay is carried out in the recommended high-salt buffer, Hoechst
33258 does exhibit a large fluorescence enhancement with ssDNA under these
conditions. Furthermore, when the Hoechst 33258–based assay is carried out in TE alone
(10 mM Tris.Cl/1 mM EDTA, pH 7.5, with no NaCl added), RNA contributes a
significant fluorescence signal. Using the PicoGreen dsDNA quantitation reagent as
described in Alternate Protocol 3, researchers can quantitate dsDNA in the presence of
equimolar concentrations of ssDNA and RNA with minimal effect on the quantitation
results.
Critical Parameters
Care should be taken when handling sample cuvettes in all spectrophotometric
procedures. Fluorometers use cuvettes with four optically clear faces, because excitation
and emitting light enter and leave the cuvette through directly adjacent sides. Thus,
fluorometric cuvettes should be held by the upper edges only. In contrast, transmission
spectrophotometers use cuvettes with two opposite optical windows, with the sides
frosted for easy handling. It is important to check that the optical faces of cuvettes are
free of fingerprints and scratches. In addition, for accurate absorbance readings,
spectrophotometer cuvettes must be perfectly matched. Proteins in general have A280
readings considerably lower than nucleic acids on an equivalent weight basis. Thus, even
a small increase in the A280 relative to A260 (i.e., a lowering of the A260/A280 ratio)
can indicate severe protein contamination. Other commonly used buffer components
absorb strongly at 260 nm and can cause interference if present in high enough
concentrations. EDTA, for example, should not be present at ≥10 mM. Sensitivity of the
Hoechst 33258 fluorescence assay decreases with nuclease degradation, increasing GC
content, or denaturation of DNA (Labarca and Paigen, 1980; Stout and Becker, 1982).
75
Principles of Molecular Biology
Increased temperature of the assay solution and ethidium bromide contamination also
decrease the Hoechst 33258 signal. Sodium dodecyl sulfate (>0.01% final concentration)
also interferes with accurate readings (Cesarone et al., 1979). The pH of the assay
solution is critical to sensitivity and should be pH ~7.4 (Labarca and Paigen, 1980; Stout
and Becker, 1982). At a pH <6.0 or >8.0 the background becomes much higher and there
is a concomitant loss of fluorescence enhancement. High-quality double-stranded DNA is
recommended, although single-stranded genomic DNA also works well with this assay.
However, with very small fragments of DNA, the Hoechst 33258 dye binds to doublestranded DNA only. Thus, the assay will not work with single-stranded oligomers. Linear
and circular DNA give approximately the same levels of fluorescence (Daxhelet et al.,
1989). When preparing DNA standards, an attempt should be made to equalize the GC
content of the standard DNA and that of the sample DNA. In most situations, salmon
sperm or calf thymus DNA is suitable. An extensive list of estimated GC content for
various organisms is available (Marmur and Doty, 1962). Eukaryotic cells vary
somewhat in GC content but are generally in the range of 39% to 46%. Within this range,
the fluorescence per microgram of DNA does not vary substantially. In contrast, the GC
content of prokaryotes can vary from 26% to 77%, causing considerable variation in the
fluorescence signal. In these situations, the sample DNA should be first quantitated via
transmission spectroscopy and compared to a readily available standard (e.g., calf thymus
DNA). Future measurements would then use calf thymus as a standard, but with a
correction factor for difference in fluorescence yield between the two DNA types. For
further troubleshooting information, see Van Lancker and Gheyssens (1986), in which
the effects of interfering substances on the Hoechst 33258 assay (and several other
assays) are compared.
In the ethidium bromide assay, single-stranded DNA gives approximately half the
signal as double-stranded calf thymus DNA. Ribosomal RNA also gives about half the
fluorescent signal as double-stranded DNA, and RNase and DNase both severely
decrease the signal. Closed circular DNA also binds less ethidium bromide than nicked or
linear DNA. Further critical parameters of the ethidium bromide assay are described by
Le Pecq (1971).
With PicoGreen, dsDNA can be quantitated in the presence of equimolar
concentrations of single-stranded nucleic acids with minimal interference. Table A.3D.6
shows the concentrations of RNA or ssDNA that, for a given dsDNA concentration,
result in less than a 10% change in the signal intensity using the PicoGreen assay
76
Principles of Molecular Biology
protocol. Fluorescence due to PicoGreen reagent binding to RNA at high
concentrations can be eliminated by treating the sample with DNase-free RNase. The
use of RNase A/RNase T1 with S1 nuclease will eliminate all single-stranded nucleic
acids and ensure that the entire sample fluorescence is due to dsDNA.
Anticipated Results
The detection limit of absorption spectroscopy will depend on the sensitivity of
the spectrophotometer and any UV-absorbing contaminants that might be present. The
77
Principles of Molecular Biology
lower limit is generally ~ 0.5 to 1 μg nucleic acid. Typical values for a highly purified
sample of DNA are shown in Table A.3D.2. For the Hoechst 33258, ethidium bromide,
and PicoGreen assays, a plot of relative fluorescence units or estimated concentration (y
axis) versus actual concentration (x axis) typically produces a linear regression with a
correlation coefficient (r2) of 0.98 to 0.99 (Fig. A.3D.2). Table A.3D.3 provides a
comparison of the sensitivities and specificities of the three assays.
Time Considerations
The three assays described can be performed in a short period of time. In a wellplanned series of assays, 50 samples can be prepared and read comfortably in 1 hr.
Although some error might be introduced, DNA samples can be sequentially added to the
same cuvette containing working dye solution. The increase in fluorescence with each
sample is noted and subtracted from the previous reading to give relative fluorescence or
concentration of the new sample, eliminating the need to change solutions for each
sample. Be certain that the final amount of DNA does not exceed the linear portion of the
assay.
Literature Cited
Applied Biosystems. 1987. User Bulletin Issue 11, Model No. 370. Applied Biosystems,
Foster City, Calif. Cesarone, C.F., Bolognesi, C., and Santi L. 1979.
Improved microfluorometric DNA determination in biological material using 33258
Hoechst. Anal. Biochem. 100:188-197.
Daxhelet, G.A., Coene, M.M., Hoet, P.P., and Cocito, C.G. 1989. Spectrofluorometry of
dyes with DNAs of different base composition and conformation. Anal. Biochem.
179:401-403.
Labarca, C. and Paigen, K. 1980. A simple, rapid, and sensitive DNA assay procedure.
Anal. Biochem.102:344-352.
Le Pecq, J.-B. 1971. Use of ethidium bromide for separation and determination of nucleic
acids of various conformational forms and measurement of their associated enzymes. In
Methods of Biochemical Analysis, Vol. 20 (D. Glick, ed.) pp. 41-86. John Wiley & Sons,
New York.
Marmur, J. and Doty, P. 1962. Determination of the base composition of
deoxyribonucleic acid from its thermal denaturation temperature. J. Molec. Biol. 5:109118.
78
Principles of Molecular Biology
Portugal, J. and Waring, M.J. 1988. Assignment of DNA binding sites for 4′,6-diamidine2- phenylindole and bisbenzimide (Hoechst 33258): A comparative footprinting study.
Biochem. Biophys. Acta 949:158-168.
Stout, D.L. and Becker, F.F. 1982. Fluorometric quantitation of single-stranded DNA: A
method applicable to the technique of alkaline elution. Anal. Biochem. 127:302-307.
Van Lancker, M. and Gheyssens, L.C. 1986. A comparison of four frequently used assays
for quantitative determination of DNA. Anal. Lett. 19:615-623.
Wallace, R.B. and Miyada, C.G. 1987. Oligonucleotide probes for the screening of
recombinant DNA libraries. In Methods of Enzymology, Vol. 152: Guide to Molecular
Cloning Techniques (S.L. Berger and A.R. Kimmel, eds.) pp. 432-442. Academic Press,
San Diego.
Key References
Labarca and Paigen, 1980. See above. Contains a detailed description of the Hoechst
33258 fluorometric DNA assay. Contributed by Sean R. Gallagher UVP, Inc.
Upland, California
Supplement 66 Current Protocols in Molecular Biology A.3D.12
Quantitation of DNA and RNA with Absorption and Fluorescence Spectroscopy.
Monitoring and interpreting separations of
DNA through agarose gels
When choosing the amount of DNA to be loaded, the width of the well plus the depth
of the gel and the number and size of DNA fragments should be considered. Between
5 and 200 ng of a single DNA fragment can be loaded into a 0.5-cm-wide ~ 0.2-cm
deep sample well; 5 ng approaches the minimal amount of an individual DNA
fragment that can be detected by ethidium bromide staining, and 200 ng approximates
the most that can be resolved before overloading occurs (the trailing and smearing
characteristic of overloading become more pronounced with DNA fragments above
10 kb). For samples of DNA containing several fragments, between 0.1 and 0.5 µg of
DNA is typically loaded per 0.5 cm sample well. Up to 10 µg of DNA can be
adequately resolved for samples containing numerous fragments of different sizes
(e.g., restriction digests of genomic DNA).
The most common means of monitoring the progress of an electrophoretic
separation is by following the migration of tracking dyes that are incorporated into the
79
Principles of Molecular Biology
loading buffer. Two widely used dyes displaying different electrophoretic mobilities
are bromphenol blue and xylene cyanol. Xylene cyanol typically migrates with DNA
fragments around 5 kb and bromphenol blue usually comigrates with DNA molecules
around 0.5 kb. Bromphenol Blue therefore provides an index of the mobility of the
fastest fragments and is particularly valuable in determining the length of the gel over
which the separation of DNA has occurred.
Xylene cyanol is useful for monitoring the progress of longer runs. Both dyes can
interfere with the visualization of the fragments that comigrate with them.
Ethidium bromide is commonly used for direct visualization of DNA in gels.
The dye intercalates between the stacked bases of nucleic acids and fluoresces redorange (560 nm) when illuminated with UV light (260 to 360 nm). This allows very
small quantities of DNA to be detected (~5 ng) (Sharp et al., 1973). Ethidium bromide
is frequently added to the gel and running buffer prior to electrophoresis. While this
has a slight effect on the mobility of the DNA, it eliminates the need to stain the gel
upon completion of the separation. An added advantage to running gels with ethidium
bromide is that the mobility of the DNA can be monitored throughout the run until the
desired separation is achieved.
Among the samples loaded onto the gel, at least one lane should contain a
series of DNA fragments of known sizes so that a standard curve can be constructed
to allow the calculation of the sizes of unknown DNA fragments. The most commonly
used molecular weight markers are restriction digests of phage λDNA or, for
smaller fragments, the plasmid pBR322. Figure 2.5A.3 shows the migration pattern
and fragment sizes for restriction digests of λ DNA and pBR322 that are frequently
used as molecular weight markers. Aside from restriction fragments, many
commercial preparations of molecular weight markers are also available. These
products usually cover a wide range of DNA sizes, and some manufacturers also offer
supercoiled (form I) markers for calculating plasmid sizes.
Troubleshooting
Common problems encountered in agarose gel electrophoresis are described
below, along with several possible causes.
Poor resolution of DNA fragments. The most frequent cause of poor DNA
resolution is improper choice of agarose concentration. Low percentage agarose gels
should be used to resolve high-molecular-weight DNA fragments and high percentage
80
Principles of Molecular Biology
gels for low-molecular weight DNAs. Fuzzy bands, encountered particularly with
small DNA fragments, result from diffusion of the DNA through.
Band smearing: Trailing and smearing of DNA bands is most frequently observed
with high-molecular-weight DNA fragments. This is often caused by overloading the
DNA sample or running gels at high voltages. DNA samples loaded into torn sample
wells will also cause extensive smearing, as the DNA will tend to run in the interface
between the agarose and the gel support.
Melting of an agarose gel during an electrophoretic separation is a sign that
either the electrophoresis buffer has been omitted in the preparation of the gel or has
become exhausted during the course of the run.
For high-voltage electrophoresis over long time periods, TBE should be used instead
of TAE as it has a greater buffering capacity. Also, minigel and midigel boxes, which
typically have small buffer reservoirs, tend to exhaust buffers more readily than larger
gel boxes.
Among the parameters that influence the length of time required to complete
an electrophoretic separation, the one that has the greatest effect is the applied
voltage. Most large agarose gels are run overnight (~16 hr) at voltages between 1 and
1.5 V/cm. While gels can be run much faster, particularly if the gel apparatus is
cooled, resolution of larger DNA fragments is lost when higher voltages are used.
Because the resolution required depends on the relative molecular weights of the
fragments of interest, the time required for adequate separation is best determined
empirically. As described above, this is most easily done by including ethidium
bromide in the gel and then monitoring the progress of the run directly by
visualization with UV light. Two consequences of high-voltage runs should be kept in
mind: First, as mentioned above, buffers become quickly exhausted and therefore
TBE should be used, or gel tanks with large buffer capacities. Second, high voltages
provide poor resolution of high-molecular-weight DNA fragments (see previous
discussion). If large DNA fragments are to be separated, it may be advisable to use
larger gels and/or lower applied voltages.
Gels and Electric Circuits
Gel electrophoresis units are almost always simple electric circuits and can be
understood using two simple equations. Ohm’s law, V = IR, states that the electric
field, V (measured in volts), is proportional to current, I (measured in milliamps),
81
Principles of Molecular Biology
times resistance, R (measured in ohms). When a given amount of voltage is applied to
a simple circuit, a constant amount of current flows through all the elements and the
decrease in the total applied voltage that occurs across any element is a direct
consequence of its resistance. For a segment of a gel apparatus, resistance is inversely
proportional to both the cross-sectional area and the ionic strength of the buffer.
Usually the gel itself provides nearly all of the resistance in the circuit, and the
voltage applied to the gel will be essentially the same as the total voltage applied to
the circuit. For a given current, decreasing either the thickness of the gel (and any
overlying buffer) or the ionic strength of the buffer will increase resistance and,
consequently, increase the voltage gradient across the gel and the electrophoretic
mobility of the sample. A practical upper limit to the voltage is usually set by the
ability of the gel apparatus to dissipate heat.
A second useful equation, P = I2R, states that the power produced by the
system, P (measured in watts), is proportional to the resistance times the square of the
current. The power produced is manifested as heat, and any gel apparatus can
dissipate only a particular amount of power without increasing the temperature of the
gel. Above this point small increases in voltage can cause significant and potentially
disastrous increases in temperature of the gel. It is very important to know how much
power a particular gel apparatus can easily dissipate and to carefully monitor the
temperature of gels run above that level.
Two practical examples illustrate applications of the two equations. The first
involves the fact that the resistance of acrylamide gels increases somewhat during a
run as ions related to polymerization are electrophoresed out of the gel. If such a gel is
run at constant current, the voltage will increase with time and significant increases in
power can occur. If an acrylamide gel is being run at high voltage, the power supply
should be set to deliver constant power. The second situation is the case where there is
a limitation in number of power supplies, but not gel apparati.
A direct application of the first equation shows that the fraction of total
voltage applied to each of two gels hooked up in series (one after another) will be
proportional to the fraction of total resistance the gel contributes to the circuit. Two
identical gels will each get 50% of the total voltage and power indicated on the power
supply.
Finally, it should be noted that some electrophoretic systems employ lethally
high voltages, and almost all are potentially hazardous. It is very important to use an
82
Principles of Molecular Biology
adequately shielded apparatus, an appropriately grounded and regulated power
supply, and most importantly, common sense when carrying out electrophoresis
Restriction Fragment Length Polymorphism (RFLP)
Introduction
Restriction Fragment Length Polymorphism (RFLP) is a difference in homologous
DNA sequences that can be detected by the presence of fragments of different lengths
after digestion of the DNA samples in question with specific restriction
endonucleases. RFLP, as a molecular marker, is specific to a single clone/restriction
enzyme combination. Most RFLP markers are co-dominant (both alleles in
heterozygous sample will be detected) and highly locus-specific.
An RFLP probe is a labeled DNA sequence that hybridizes with one or more
fragments of the digested DNA sample after they were separated by gel
electrophoresis, thus revealing a unique blotting pattern characteristic to a specific
genotype at a specific locus. Short, single- or low-copy genomic DNA or cDNA
clones are typically used as RFLP probes. The RFLP probes are frequently used
in genome mapping and in variation analysis (genotyping, forensics, paternity tests,
hereditary disease diagnostics, etc.).
How It Works:
SNPs or IN
DE
Ls can
create
or
abolish
restriction
endonuclease (RE) recognition sites, thus affecting quantities and length of DNA
fragments resulting from RE digestion.
Genotyping
Developing RFLP probes
83
Principles of Molecular Biology
Total DNA is digested with a methylation-sensitive enzyme (for example, PstI),
thereby enriching the library for single- or low-copy expressed sequences (PstI clones
are based on the suggestion that expressed genes are not methylated).
The digested DNA is size-fractionated on a preparative agarose gel, and fragments
ranging from 500 to 2000 bp are excised, eluted and cloned into a plasmid vector (for
example, pUC18).
Digests of the plasmids are screened to check for inserts.
Southern blots of the inserts can be probed with total sheared DNA to select clones
that hybridize to single- and low-copy sequences.
The probes are screened for RFLPs using genomic DNA of different genotypes
digested with restriction endonucleases. Typically, in species with moderate to high
polymorphism rates, two to four restriction endonucleases are used such
as EcoRI, EcoRV, and HindIII. In species with low polymorphism rates, additional
restriction endonucleases can be tested to increase the chance of finding
polymorphism.
PCR-RFLP
Isolation of sufficient DNA for RFLP analysis is time consuming and labor intensive.
However, PCR can be used to amplify very small amounts of DNA, usually in 2-3
hours, to the levels required for RFLP analysis. Therefore, more samples can be
analyzed in a shorter time. An alternative name for the technique is Cleaved
Amplified Polymorphic Sequence (CAPS) assay.
84
Principles of Molecular Biology
Amplified fragment length polymorphism (AFLP)
Amplified fragment length polymorphism (AFLP) DNA fingerprinting is a firmly
established molecular marker technique for evolutionary, genetic, and ecological
studies of plants, animals, and microorganisms. The AFLP technique (Vos et al.,
1995) was developed by KeyGene (Netherlands), a private biotechnology company
that has filed property rights on the technology. For more information, see KeyGene’s
home page: http://www.keygene.com. AFLP has a number of broad applications,
ranging from linkage mapping to analyses using population-based and phylogenetic
methods. Genomic DNA is first digested using two restriction endonucleases,
typically one with a 6-bp recognition sequence (usually EcoRI) and one with a 4-bp
recognition sequence (usually Msel). Adapters of known sequence are then ligated to
each end of the fragments and two successive rounds of selective PCR amplification
are performed. The first round of PCR (preselective or -f-1 amplification) uses
primers that match the adapters on the EcoRI end and Msel end of the fragments plus
one extra nucleotide. The second round (selective or +3 amplification) has an
additional two nucleotides added to the +1 primers sequences. These rounds of
selective amplification reduce the resulting pool of DNA fragments to a size more
manageable for analysis. Although the DNA fragments are anonymous, the method is
remarkably reliable and consistent (Vos et al., 1995). This technique is readily
adapted to new taxa because no taxon-specific information is needed and AFLPs are
suitable for use in both prokaryotic and eukaryotic organisms. Moreover, the
technique surveys the entire genome, is relatively inexpensive, and generates many
potential marker candidates. Many other enzyme combinations are possible, but for
convenience this discussion will focus on the EcoR I—Mse I system. Usually in
excess of 50 products, with a size range of 50–500 bp (including the non-genomic
adapter sequences), are reported for this enzyme combination per +3/+3 primer pair,
and there is a distinct skewing towards the lower end of this size range. The subset of
fragments are analysed by denaturing polyacrylamide gel electrophoresis to generate a
fingerprint and DNA bands may be detected, using different methods. In addition to
the advantage of not requiring radioisotopes, fluorescent primers can be loaded as sets
of three, each labelled with a different coloured dye, into the same gel lane, thus
maximising the number of data points gathered per gel.
85
Principles of Molecular Biology
.Fig.1. Schematic representation of AFLP workflow
The molecular basis of AFLP polymorphisms will usually be caused at the nucleotide
level. Single nucleotide changes will be detected when (1) the actual restriction sites
are affected; and (2) nucleotides adjacent to the restriction sites are affected, which
cause the primers to mispair at the 3' end and prevent amplification. Most AFLP
markers will be mono-allelic, meaning that only one allele can be scored and the
corresponding allele is not detected. At a low frequency, bi-allelic markers will be
identified, as a result of small insertions or deletions in the restriction fragments. The
AFLP technology can be applied to any DNA sample, including human, animal, plant
and microbial DNA, giving it the potential to become a universal DNA fingerprinting
system. Because of the nature of AFLP primers, the markers obtained are highly
reliable and robust, unaffected by small variations in the amplification process. A
typical AFLP fingerprint contains between 50 and 100 amplified fragments, many of
which, or even most, may serve as genetic markers. The generation of transcript
profiles using AFLPs with cDNAs is an efficient tool for identifying differentially
expressed mRNAs. This tool has several advantages that can be useful for discovering
genes in germplasm. A further drawback of AFLP technology is perhaps the lack of
guarantee of homology between bands of similar molecular weight (MW), thus
creating difficulties for some types of studies such as phylogenetic analyses.
However, while non-homologous bands with similar weight are also found with other
86
Principles of Molecular Biology
markers such as RAPDs, they may, in fact, be less common with AFLP technology
because gel resolution is very high and, consequently, the likelihood of nonhomologous bands being coincidentally of the same molecular weight is low.
.Fig.2. Adapter ligation and fluorescent labeling
Technical details: Setting up an AFLP study
Commercial AFLP kits or DIY?
Commercial AFLP kits (usually from Applied Biosystems or Invitrogen) offer the
advantages of convenience and some level of technical support. However, assembling
your own set of reagents can reduce the consumables cost by 50%, and is suitable for
larger projects and more experienced users. Protocols are readily available on the
Web and in the literature see: http://awcmee.massey.ac.nz/aflp/AFLP_Protocol.pdf).
87
Principles of Molecular Biology
DNA
Successful AFLP digests require _100–1000 ng high molecular weight DNA (i.e. not
obviously degraded) that is free of contaminants (e.g. inhibitory compounds and nontarget DNA) that could otherwise interfere with the digestion, ligation and
amplification steps. Commercial DNA extraction kits (e.g. Qiagen DNeasy) can give
better quality DNA than some other methods. Researchers should not use DNA
samples obtained from different extraction methods because the method can affect the
resulting AFLP profile. Use of degraded and/or smaller quantities of DNA (such as
that often obtained from herbarium material) can result in poor quality profiles with
low reproducibility. Whole genome amplification (WGA) techniques have the
potential to enable AFLP fingerprinting in situations where previously insufficient
quantities of tissue were available (e.g. herbarium material or small individuals).
Choice of restriction enzymes
The restriction enzymes EcoR I (a six base cutter) and Mse I (a four base cutter) are
used in most AFLP studies, yielding fragments in an appropriate size range for
amplification and electrophoresis. Alternatives to Mse I include Taq I (which can
produce better quality results) and Tru I (a cheaper isoschizomer of Mse I). Pst I, the
most common alternative to EcoR I, is
methylation-sensitive, and although it might be appropriate for differential gene
expression and some mapping applications, it can have undesirable effects for most
other applications of the technique (i.e. when differences in gene expression between
samples could affect the AFLP profiles).
Choice of selective primers – length, composition and screening
The number of selective nucleotides on the selective primers should be increased with
increasing genome size so that the number of fragments is high enough to maximize
resolution but low enough to minimize homoplasy. This ranges from Eco+2–Mse+3
primers for small genomes to Eco+4–Mse+4 for larger genomes. Previous AFLP
studies on related taxa or those with similar genome sizes provide the best guide for
appropriate length selective primers http://www.rbgkew.org.uk/cval/homepage.html).
The ‘quality’ of AFLP profiles varies widely between selective primer combinations
partly because of the base composition of the selective primers. Therefore it is
necessary to screen potential combinations on a small number of samples before
embarking on the full project. High-quality profiles have well-separated peaks, a high
signal-to-noise ratio, a lack of shoulder or stutter peaks, fragments distributed
88
Principles of Molecular Biology
throughout the available size range, and clear polymorphisms. In a screen of 32
primer combinations assessed (subjectively) using these criteria, we found 20% of
primer combinations produced profiles suitable for high-throughput genotyping. If a
fluorescent system is used, it will normally only be economical to screen different
unlabelled primers (e.g. Mse+3) and, therefore, the selective bases of the fluorescent
primers (e.g. Eco+3) will need to be decided a priori (usually based on a literature
survey of successful fluorescent primers). The number of primer combinations
required depends on the application and biological question. It should be determined
by measuring the proportional increase in resolving power and decrease in error with
the accumulation of data from each additional primer combination.
Fluorophores
Fluorescent labelling has dramatically increased the output of AFLP fingerprinting
by enabling poolplexing of differently labelled products (up to four, plus a size
standard for Applied Biosystems’ Genetic Analysers). Choice of fluorophores is
largely determined by the available electrophoresis system (gel or capillary) and
software because potentially significant problems can occur with nonrecommended
dyes, including weak fluorescence and interference between emission spectra
(spectral ‘bleed-through’) and absorption spectra of poolplexed fluorophores. Even
with recommended set-ups there will be differential amplitude of emission between
fluorophores, which can be compensated for by empirically determining the optimum
pooling ratio.
Duplication, randomization and reproducibility
Although AFLPs are highly reproducible, replicate or duplicate AFLP profiles –
preferably from separate DNA extractions of a single individual – should be generated
for at least 5–10% of all samples. These should represent all treatments (e.g. DNA
extraction method, position on plate or gel and time stored in refrigerator). This is
crucially important for AFLP because replicates are the only objective measure of
quality (unlike DNA sequencing, where correct nucleotides can be determined with a
high degree of confidence). The same subset of samples should be included as
positive controls in every electrophoresis ‘run’ to ensure between-run reproducibility,
and to act as anchor points to detect errors in sample order (e.g. mistakes in plate
orientation). To enable any positional biases to be identified, sample order should be
randomized (e.g. order should not reflect evolutionary relationships or DNA
extraction method). Samples should be anonymously labelled to prevent any
89
Principles of Molecular Biology
investigator-associated scoring biases. To ensure reproducibility, it is essential to
standardize the method and maintain consistency for the duration of the study. In
addition to the factors already mentioned, factors such as fluorescent dyes, size
standard, laboratory equipment and capillary instrument can affect reproducibility and
comparability of AFLP profiles. For example, it is advisable not to change
fluorophores mid-project, because different fluorophores have different emission
properties, which might make the resulting data incomparable.
Error rates in AFLP data
Quantifying genotyping error rates is an essential component of an AFLP study.
Because it is usually not possible to know the ‘true’ genotype of an individual, error
rates cannot be assessed directly but instead must be estimated using replicates. Using
replicates, the error rate per locus has been estimated at between 2–5% for AFLP, but
unfortunately this is not explicitly calculated in most empirical studies. There are
multiple causes of genotyping errors in AFLPs, including the technical aspects of
generating the profiles (e.g. PCR stutter, non-specific amplification), subjectivity or
human error in (mis)reading the profiles, and differences in peak mobility and
intensity in the fingerprint profiles. Although these errors might not bias the results of
the analysis, they cause a reduction in the signal-to-noise ratio and hence a loss of
resolving power. Several strategies have been proposed to reduce errors in AFLPs,
and some software has been developed for finding and removing errors from AFLP
data.
Recommended Literature
Vos P, Hogers R, Bleeker m, Reijans M, van de Lee T, Hornes M, Frijters A, Pot j,
Peleman J, Kuiper M (1995) AFLP: new technique for DNA fingerprinting. Nucleic
Acids Res 23(21):4407-4414.
Meudt HM, Clarke AC (2007) Almost forgotten or latest practice? AFLP
applications, analyses and advances. Trend Plant Sci 12(3):106-117.
90
Principles of Molecular Biology
DNA Extraction from Plant tissues
1- CTAB DNA Extraction Protocol
•
Required reagents:
1- Extraction Buffer (pH 8) 100ml:
1- Tris- Base (100 mM= 1.576gm).
2- Nacl (1.4 M= 8.18gm).
3- EDTA (20 mM= 0.744gm).
4- 2% CTAB (2 gm/100 ml).
2- 1X TE Buffer (pH=8.0):
•
Tris- Base (0.01 M, pH=8.0).
•
EDTA (0.001 M, pH=8.0).
3- TBE Buffer 5X (pH 8) 500 mL:
•
27 g of Tris base
•
13.7.5 g of boric acid
•
10 ml of 0.5 M EDTA (1.861gm, pH 8.0) and pH should be
adjusted in this solution separately.
TBE can be diluted to 0.5X prior to use in electrophoresis, 1x is acceptable as well.
1- RNAase (10 mg/ ml).
2- Proteinase-K (1mg/ ml).
3- Sodium acetate (3 M, 20.412 gm of Sodium Acetate in 50ml dH2O).
4- Ethidium Bromide (10 mg/ml dH2O, stored in a dark bottle).
5- Chlorophorm : isoamyle alcohol (24:1).
6- Loading Dye (stored at 4o C):
•
3ml glycerol (30%)
•
25mg bromophenol blue (0.25%)
•
dH2O 10mL
Species-specific primers and RAPD-PCR analysis for Saccharomyces cerevecia
1.DNA extraction
Total genomic DNA was isolated using CTAB protocol for plants (Murray and
Thompson, 1980; Saghai-Maroof, et. al., 1984; and Kumar, et. al., 2003) with some
modifications.
91
Principles of Molecular Biology
1)
Freshly prepared cultures were grown onto solidified yeast-peptone-
dextrose medium. Collected yeast cells were ruptured by using smashed slide
covers in the presence of liquid nitrogen while using a mortar and a pestle.
2)
Ground powder was transferred to 2 ml Eppendorf tube. Then, 1 ml of
60ºC extraction buffer (100mM Tris-HCl, 1.4M NaCl, 20 mM EDTA, 2%
hexadecyl trimethyl ammonium bromide (CTAB), adjusted to pH 8.0 with 50
µl β-mercaptoethanol were added to the samples, mixed by gentle inversion
and incubated in 60ºC water-bath (with occasional gentle mixing) for 30
minutes.
3)
Samples were then removed from the water-bath and cooled to room
temperature for 4-6 minutes. An equal volume of chloroform: isoamylalcohol
(24:1) (v/v) was added to the cooled mixture then samples were mixed by
gentle inversion to form an emulsion.
4)
Samples were centrifuged at 5000 rpm for 20 minutes at 10ºC. The
supernatant was transferred to a new 1.5 ml Eppendorf tube. An equal
volume of cold (-20ºC) isopropanol was added to supernatant.
5)
Samples were then placed in a freezer (-20ºC) for 1hour or left
overnight at 4ºC to accentuate precipitation. Then, samples were centrifuged
at 10000 rpm for 5 minutes at 4ºC.
6)
Supernatant was poured and pellets were washed with cold 70%
ethanol (v/v) and centrifuged at 10000 rpm for 2 minutes at 4ºC. The latter
step was repeated twice, and then pellets were dried (under vacuum) at 37ºC
incubator (under vacuum) or left overnight at room temperature.
7)
Pellets were dissolved in 300-500µl TE buffer (250mM Tris-HCl,
0.5mM EDTA, (pH 8.4)). Dissolved pellets were then treated with 3µl RNase
A (10 mg/ml) and incubated at 37ºC for 30 minutes (with occasional gentle
mixing).
8)
Samples were then treated with 3µl proteinase-K (1mg/ml) and
incubated at 37ºC for 30 minutes (with occasional gentle mixing).
92
Principles of Molecular Biology
9)
An amount of 300 µl chlorophorm: isoamyl alcohol 24:1 (v/v) was
added to a 1.5 ml Eppendorf tube, mixed gently then centrifuged at 1000 rpm
for 5minutes at 20ºC.
10)
Then the supernatant was transferred to a new Eppendorf tube where
two volumes of cold ethanol were added to it and 1/10 volume of sodium
acetate (3M) was added to the previous mixture, mixed and left for one hour
in a freezer (-20ºC).
11)
Samples were then centrifuged at 10,000 rpm for 10 minutes at 4ºC,
drained and washed with 70% ethanol (v/v) as previously mentioned.
12)
Ethanol was then removed and pellets were left to dry (under vacuum)
or overnight then dissolved in 50-µl TE buffer. DNA dilutions were made to
detect the optimum concentration for RAPD-PCR analysis.
2. PCR assays
2.1. Species - specific primers used in PCR assay
The 5' specific primer (SC1) was designed from the ITS-1 region (between
positions 161 and 181 from the 3'-SSU end, forward).
Its sequence was: 5'-AACGGTGAGAGATTTCTGTGC-3'. The 3' specific
primer (SC2) was located in the LSU gene (between positions 562 and 582 from the 5'
end of this gene, backward) and its sequence was: 5'AGCTGGCAGTATTCCCACAG-3' (Josepa, et al., 2000).
2.2. RAPD analysis
RAPD assays were based on the polymerase chain reaction (PCR) amplification
of random sites spread allover the genomic DNA. DNA amplification protocol was
performed as described by (Williams, et al., 1990) with some modifications.
2.3. Preparation of PCR reactions
To perform several parallel reactions, a master mix containing water, buffer,
dNTPs, primers, and Taq DNA Polymerase was prepared in a single tube. MgCl2 and
93
Principles of Molecular Biology
template DNA solutions were then added. The master mix was prepared in a 1.5 ml
Eppendorf tube, according to the number of PCR reactions to be performed, with an
extra reaction included for compensating the loss of solution due to frequent pipetting.
An aliquot of 24 µl master mix solution was dispensed in each PCR tube (0.5 ml),
containing 1-2µl of the appropriate template DNA dilution, so that each reaction
contained:
Components of PCR reactions
Component
dH2O
10X reaction buffer
dNTP's mix
Primer
Taq polymerase
MgCl2
Template DNA
Total volume
Amount of one PCR reaction
11.0 µl
3.0 µl
3.0 µl
2.0 µl
1.0 µl
4.0 µl
1.0 µl
25.0 µl
2.4. PCR program and temperature profile
For DNA amplification, a TECHNE thermocycler (Model FTGEN5D,
TECHNE, Cambridge Ltd, Oxford, and Cambridge, U.K.) was used. The
thermocycler program for specific primers was characterized by:
1) Initial denaturation for 5 minutes at 94ºC (1st step),
2) 10 cycles of 94ºC for 1 minute 20 seconds, 55ºC for 40 seconds, and 72ºC for 1
minute 10 seconds (2nd step);
3) 30 cycles of 1 minute 20 seconds at 94ºC, 40 seconds at 50ºC and 1 minute 10
seconds at 72ºC (3rd step),
4) 10 minutes at 72ºC (4th step), then followed by a final hold at 4ºC.
And a different program was adopted for RAPD PCR and was characterized by:
1.
initial denaturation for 3 minutes at 90ºC (1rst step),
94
Principles of Molecular Biology
2.
40 cycles of 1 minute at 90ºC, 2 minutes at 33ºC and 2 minutes at 72ºC
(2nd step),
3.
10 minutes at 72ºC (3rd step), then followed by a final hold at 4ºC.
Extraction of DNA from whole blood
Nucleated cells are separated from whole blood by lysing the red cells,
followed by centrifugation to pellet the nuclei. Following white cell lysis
contaminating proteins are removed by precipitation with a high concentration of
ammonium acetate. DNA is then precipitated with isopropanol followed by washing
the DNA with ethanol. The DNA is then dissolved in TE buffer and used for analysis.
Solutions and Chemicals
Red Blood cell Lysis Solution
155 mM Ammonium Chloride
10 mMpotassium bicarbonate
1 mM EDTA
8.3 g per liter
1 g per liter
0.4 g liter or 2 mls 0.5 M EDTA
White cell lysis Solution
25 mM EDTA
2 % SDS
9.3 g per liter or 50 mls 0.5 M EDTA
20 g per liter or 200 mls 10 % SDS
Protein precipitation solution
10 mM Ammonium Acetate
385.4 g per 500 ml
Procedures:
1.
Transfer 300 µl of the whole blood into a clean 1.5 ml tube.
2.
Add 900 µl of RBCs lysis solution.
3.
Incubate at room temperature for 10 minutes with occasional inversion.
4.
Centrifuge at 12000 rpm for 30-60 seconds to collect the WBCs.
5.
Pour off the supernatant but leave behind about 20 µl residual liquid.
6.
Add 300 µl white blood cells lysis solution to resuspend pellet-pipette
up/down to lyse cells.
7.
Invert several times, then add 100 µl of protein precipitation solution.
8.
Whirly mix for 20 seconds.
9.
Centrifuge at 6000 rpm for 3 minutes.
10.
Pour supernatant into a clean tube, and then add equal volume of
isopropanol to precipitate the DNA.
11.
Collect the DNA by centrifugation at 6000 rpm for 5 minutes.
12.
Gently pour off the supernatant, blot onto a paper towel.
13.
Wash once with 70 % ethanol.
14.
Decant the ethanol and leave the pellet to dry at room temperature for
10minutes.
15.
Resuspend the DNA pellet in 100 µl of TE buffer.
95
‫‪Principles of Molecular Biology‬‬
‫‪Analyze the DNA by running a small aliquots onto 1 % Agarose gel.‬‬
‫‪16.‬‬
‫‪Conversions‬‬
‫‪Micrograms (µg) = 10−6 grams‬‬
‫‪Micro liters (µl) = 10−6 liters‬‬
‫)‪Milligrams (mg) = 10−3 grams (g‬‬
‫)‪Milligrams per liter (mg/liter) = 1 part per million (ppm‬‬
‫‪Milliliters (ml) = 10−3 liters‬‬
‫‪Nanogram (ng) = 10-9 grams‬‬
‫‪Picomole (pM) = 10-12 Mole‬‬
‫‪Picogram = 10-12 gram‬‬
‫‪DNA Isolation protocols‬‬
‫طرق عزل الـ ‪DNA‬‬
‫تختلف صور وأماكن تواجد الـ ‪ DNA‬في الكائنات وذلك حسب نوع الكائن كما يلي‪:‬‬
‫أو ً‬
‫ل‪ :‬الكائنات غير مميزة النواة ‪:Prokaryotes‬‬
‫يوجد الـ ‪ DNA‬في الكائنات غير مميزة النواة )مثل البكتريا( عادة في سيتوبلزم الخلية في صورة‬
‫‪ DNA‬حلقي ‪ Circular DNA‬الشكل حيث تتميز تلك الكائنات بعدم وجود غشاء نووي يحيط بالنواة ويحددها‬
‫ويسمي جزئ الـ ‪ DNA‬الخاص بالبكتريا بالكروموسوم البكتيري أو الـ ‪ DNA‬البكتيري ‪Bacterial‬‬
‫‪.DNA‬‬
‫)ومن المعروف أن الكائنات غير مميزة النواة مثل البكتريا تتميز بوجود جزيئات ‪ DNA‬صغيرة حلقية مستقلة‬
‫عن الـ ‪ DNA‬البكتيري تسمى بالبلزميدات ‪.(Plasmids‬‬
‫ثانيًا‪ :‬الكائنات مميزة النواة ‪:Eukaryotes‬‬
‫تمتاز الكائنات مميزة النواة بوجود الـ ‪ DNA‬في عضيات خاصة أهمها‪:‬‬
‫‪ -1‬النواة ‪:Nucleus‬‬
‫وهي تحتوي على معظم الـ ‪ DNA‬الخلوي الذي يعتبر المادة الوراثية الرئيسية في الخلية ويسمى بالـ‬
‫‪ .(Genomic DNA or Nuclear DNA (nDNA‬وهو يوجد مغلف بأغلفة بروتينية في صورة‬
‫كروموسومات ‪ Chromosomes‬يختلف عددها على حسب النوع‪ ،‬وينتقل هذا الـ ‪ DNA‬عن طريق الب‬
‫والم معًا‪.‬‬
‫‪ -2‬الميتوكوندريا ‪:Mitochondoria‬‬
‫وهي تحتوي على كمية صغيرة من الـ ‪ DNA‬وعادة ما يحتوي على جينات خاصة بأنزيمات الطاقة‪.‬‬
‫ويسمى بالـ ‪ (Mitochondorial DNA (mtDNA‬وهو يتوارث عن طريق الم فقط‪.‬‬
‫‪ -3‬البلستيدات ‪:Plastids‬‬
‫‪96‬‬
‫‪Principles of Molecular Biology‬‬
‫وتحتوي على كمية صغيرة من الـ ‪ DNA‬عادة ما يحتوي على الجينات الخاصة بأنزيمات البناء‬
‫الضوئي ويسمى بالـ ‪ (Chloroplast DNA (cpDNA‬ويتوارث عن طريق الم فقط‪.‬‬
‫أهمية إستخلص المادة الوراثية )‪:(DNA‬‬
‫الحصول على الـ ‪ DNA‬في صورة نقية لستخدامه في التطبيقات المختلفة مثل‪:‬‬
‫• الــ ‪PCR‬‬
‫• ‪DNA sequencing‬‬
‫• ‪Fingerprinting‬‬
‫• ‪Genomic map‬‬
‫• ‪Transformation‬‬
‫كما تختلف طرق عزل الـ ‪ DNA‬عل حسب نوع الكائن وكذلك حسب موقع الـ ‪ DAN‬في الخلية‪.‬‬
‫الخطوات العامة لعزل الـ ‪ DNA‬تتضمن عدة خطوات هي‪:‬‬
‫‪ -1‬الحصول على مكونات الخلية‪:‬‬
‫حيث يتم تكسير جميع الغشية الخلوية والحصول علي جميع مكونات الخلية مختلطةمعًا‪ ،‬وتتم تلك‬
‫العملية إما بالطحن أو باستخدام المعاملة النزيمية‪ .‬وتتم عملية الطحن وتكسير الخليا في محلول منظم لبد أن‬
‫يحتوي على مثبطات لنزيم الـ ‪) DNAase‬الذي يقوم بتكسير خيوط الـ ‪ (DNA‬مثال الـ ‪ EDTA‬أو مادة الـ‬
‫‪ SDS‬والتي تثبط نشاط إنزيم الـ ‪.DNAase‬‬
‫‪ -2‬فصل الـ ‪ DNA‬والتخلص من البروتين‪:‬‬
‫يتم في هذه العملية استبعاد المواد المرتبطة بالـ ‪ DNA‬مثل البروتينات والـ ‪.RNA‬‬
‫‪ -3‬ترسيب الـ ‪:((DNA DNA precipitation‬‬
‫في هذه العملية يتم الحصول على خيوط الـ ‪ DNA‬من المحول المائي الذي توجد به‪.‬‬
‫‪ -4‬إذابة الـ ‪:DNA‬‬
‫بعد ترسيب الـ ‪ DNA‬يتم إذابته لعمل محلول منه ليستخدم في الغراض المختلفة بعد ذلك‪.‬‬
‫‪ -5‬الكشف عن وجود الـ ‪ DNA‬بعد العزل‪.‬‬
‫‪ -6‬قياس تركيز الـ ‪ DNA‬المعزل‪.‬‬
‫***‬
‫‪:‬خطوات العمل‬
‫خطوات عزل الــ ‪ DNA‬من أنسجة نباتية و إنسانية‪:‬‬
‫‪ُ -1‬يوضع النسيج في نيتروجين سائل بكمية تمل هون كبير الحجم ثم تتبخر ثم تضاف كمية أخرى بنفس‬
‫الحجم ويستمر الطحن لتلك النسجة بإستمرار حتى تصير تراب ‪.powder‬‬
‫‪ُ -2‬يوضع من هذا التراب الــ ‪ powder‬قدر ملئ نصف أنبوبة إبندورف سعة واحد ونصف ملليليتر‪.‬‬
‫‪97‬‬
‫‪Principles of Molecular Biology‬‬
‫‪-3‬‬
‫ُتوضع في أنبوبة البندورف ‪ 1000‬ميكروليتر من منظم الستخلص الـ ‪ Extraction Buffer‬ويضاف‬
‫إلى منظم الستخلص من خمسين إلى مائة ميكروليتر من ‪ β-Mercaptoethanol‬الذي يعمل على فك‬
‫الروابط ثنائية السلفايد ‪ disulfide bonds‬مما يتيح الفرصة لفرد البروتينات وأحيانا فك مجموعة من‬
‫عديدات البيبتيد المترابطة بواسطة الروابط ثنائية السلفايد‪ .‬ويفضل بالضافة إلى ذلك إضافة خمسين‬
‫ميكروليتر من الـ ‪) dithiothreitol DTT‬إن توفر فهخو يؤدي غرض الــ ‪ β-Mercaptoethanol‬أيضا(‬
‫ثم توضع أنبوبة البندورف في حمام مائي على ‪ oC 90-85‬لمدة ‪ 1‬إلى ‪ 2/1‬ساعة‪ .‬ويراعى تقليب النابيب‬
‫مرارا طوال فترة الحمام المائي‪.‬‬
‫‪-4‬‬
‫بعد استخراج النابيب تترك لبضع دقائق حتى تصل لدرجة حرارة الغرفة‪.‬‬
‫‪-5‬وُيضاف إلي أنبوبة إبندورف جديدة ذات سعة إثنين ملليليتر‪ 1000 ،‬ميكروليتر من الـ )‬
‫‪) Chlorophorm:Isoamyle (24:1‬حجم إلى حجم( ثم وُتكمل حتى آخرها بما كان في النبوبة ذات‬
‫السعة واحد ونصف ملليليتر ثم ترج جيدا بخفة ولطف وهذا يعمل على ترسيب الجزاء الخلوية وفصلها عن‬
‫الـ ‪.DNA‬‬
‫‪ُ-6‬يعمل طرد مركزي ‪) rpm 5,000‬خمسة ألف لفة في الدقيقة( لمدة ‪ 20‬دقيقة ويضبط الجهاز على عشر‬
‫درجات مئوية فتظهر بعد إنتهاء الطرد المركزي ثلث طبقات‪ :‬طبقة سفلى وأخرى وسطى )وهي البقايا‬
‫الخلوية غير المرغوب فيها ‪ ( cellular debris‬والخيرة عليا رائقة‪.‬‬
‫‪ُ-7‬يؤخذ من الطبقة العليا ‪ supernatent‬خمسمائة أو سبعمائة وخمسين ميكروليتر من الرائق بحذر شديد‬
‫وُيوضع محلول الطبقة العليا في أنبوبة ايبندورف جديدة ‪ .ml 1.5‬ويمكن بعد هذه الخطوة في بعض الحالت‬
‫القفز إلى الخطوة الثامنة عشر‪.‬‬
‫‪ُ-8‬يضاف الى أنبوبة البندورف السالفة نفس حجم الطبقة العليا )خمسمائة أو سبعمائة وخمسين ميكروليتر(‬
‫من الـ ‪) Cold Isopropanol‬لترسيب الـ ‪ (DNA‬ثم ترج النابيب بهدوء وتوضع النابيب في الفريزر‬
‫)‪ (20oC-‬لمدة ساعة أو على درجة حرارة ‪ 4oC‬أي في الثلجة طوال الليل‪.‬‬
‫‪ُ-9‬يعمل طرد مركزي ‪ rpm 10,000‬لمدة ‪ 5‬دقائق على ‪.4oC‬‬
‫‪ُ -10‬يزال الرائق )أي ما يَْعلَُو الراسب ‪ (pellet‬وُيترك الراسب ‪ Pellet‬في قاع النبوبة ثم يتم غسل الراسب‬
‫بكحول إيثيلي ‪ (Ethanol 70% (1ml‬لكل أنبوبة والرج بهدوء حتى يتحرر الراسب من قاع النبوبة ثم‬
‫ُيعمل طرد مركزي ‪ rpm 10,000‬لمدة دقيقتين‪.‬‬
‫‪ -11‬يزال الرائق وُيترك الـراسب في قاع النبوبة لتجف على )أو ُتوضع تحت تفريغ‬
‫‪Vaccum‬لتجف(‪.‬‬
‫‪ -12‬يتم إذابة الـراسب ‪ Pellet‬في ‪ (TE Buffer (500 µl‬وتترك لمدة ‪ 1/2‬ساعة على ‪.37oC‬‬
‫‪ُ -13‬يضاف ‪ µl 4‬من إنزيم الـ ‪ RNAase‬وتترك على لمدة ‪1/4‬ساعة على درجة ‪) 37oC‬يراعي التقليب‬
‫برفق بين الحين والخر(‪.‬‬
‫‪ -14‬ثم ُيضاف ‪ µl 4‬من الـ ‪ Proteinase-K‬لهضم إنزيم الـ ‪ RNAase‬وتترك لمدة ‪1/4‬ساعة على‬
‫درجة ‪) 37oC‬يراعي التقليب برفق بين الحين والخر(‪.‬‬
‫‪ -15‬يضاف ‪ µl 500‬من الـ ‪ (Chlorophorm:Isoamyl (24:1‬ثم يتم الرج برفق‪.‬‬
‫‪98‬‬
‫‪Principles of Molecular Biology‬‬
‫‪ُ -16‬يعمل طرد مركزي ‪) rpm 1,000‬ألف لفة في الدقيقة( لمدة ‪ 5‬دقائق على حرارة ‪) oC 20‬للتخلص من‬
‫الـ ‪ Proteinase-K‬والـ ‪ RNAase‬وباقي البروتينات( فتتكون ثلث طبقات‪.‬‬
‫‪ -17‬يؤخذ الرائق )الطبقة العليا( بحذر شديد ويراعى عدم سحب الهالة الوسطية )بقايا الخليا ويراعي التأكد‬
‫من ذلك جيدًا(‪.‬‬
‫‪ُ -18‬يضاف إلى الرائق ضعف حجمه )أي حجم الرائق( كحول إيثيلى مطلق بارد )موضوع في الفريزر( ثم‬
‫ُيضاف ‪ 10/1‬حجم الرائق خلت الصوديم ‪) (Sodium acetate (3M‬أي في مثالنا هذا يؤخذ خمسين‬
‫ميكروليتر من خلت الصوديوم( وتوضع في الفريزر )‪ (oC 20-‬لمدة ‪ 45‬دقيقة إلى ساعة فيظهر الــ ‪DNA‬‬
‫في صورة هالة قطنية وقد ل يظهر الـ ‪ DNA‬لقلة كميتة وفي هذه الحالة إن كانت العينة ل تعوض يمكن‬
‫الستمرار للخر ثم تقدر كميتة إما وصفيا بالتفريد الكهربي ‪ gel electrophoresis‬لخمسة ميكروليتر مع‬
‫منظم التحميل ‪ loading buffer‬أو بإستخدام جهاز ‪. UV Spectrophotometer‬‬
‫‪ُ -19‬يعمل طرد مركزي ‪) rpm 10,000‬عشرة آلف لفة( لمدة ‪ 10‬دقائق على درجة حرارة ‪ 4oC‬فيظهر‬
‫الــ ‪ DNA‬في صورة راسب ‪. pellet‬‬
‫‪ -20‬يزال الرائق وُيترك الـراسب ‪ Pellet‬في القاع لتغسل بـإيثانول ‪ (500µl-1000) %70‬مع مراعاة أن‬
‫يزحزح الراسب من مكانة ثم ُيعمل طرد مركزي ‪) rpm 10,000‬عشرة ألف لفة( لمدة دقيقتين ومن‬
‫الفضل تكرار خطوة الغسيل هذه مرتين‪.‬‬
‫‪ -21‬بعد استبعاد الكحول تجفف الـ ‪ Pellet‬جيداً )ُيراعى التأكد من تمام التجفيف(‪.‬‬
‫‪ُ -22‬يضاف إلى الراسب من ‪ 20µl‬إلى ‪ µl 50‬من الـ ‪ TE Buffer‬حسب حجم الـراسب ‪ pellet‬مع‬
‫التحضين على ‪ 37oC‬لضمان تمام ذوبان الـراسب ‪.Pellet‬‬
‫‪ -23‬ثم ُيحفظ هذا الـ ‪ DNA‬المذاب في الـ ‪ TE Buffer‬في فريزر الثلجة لحين الستخدام‪.‬‬
‫***‬
‫الكشف عن وجود الـ ‪ DNA‬بعد العزل‪:‬‬
‫يتم الكشف عن تواجد الـ ‪ DNA‬في العينات المعزلة باستخدام طريقة التفريد الكهربي على الجيل ‪Gel‬‬
‫‪ .electrophoresis‬نظراً لن الـ ‪ DNA‬شحنته سالبه فإنه عند وضع الـ ‪ DNA‬عند القطب السالب فإنه يحدث‬
‫له هجرة ناحية القطب الموجب مبتعداً عن القطب السالب‪ ،‬من خلل ذلك يمكن عن طريق تفريد الـ ‪ DNA‬على‬
‫طبقة من الجيل بعمل حفر ‪ well‬عند القطب السالب ووضع عينات الـ ‪ DNA‬فيها ثم السماح للتيار الكهربي‬
‫بالمرور من القطب السالب إلى القطب الموجب يحدث هجرة له مبتعداً عن القطب السالب من خلل مروره خلل‬
‫الثقوب الموجودة في الجيل‪ ،‬ويمكن رؤية الـ ‪ DNA‬بعد عملية التفريد من خلل إضافة الـ ‪Ethidium‬‬
‫‪ bromide‬للجيل قبل تصلبه وهي مادة تتداخل بين خيوط الـ ‪ DNA‬حيث تظهر حزم الـ ‪ DNA‬على أبعاد‬
‫مختلفة على حسب الوزن الجزيئي على لوح الجيل بلون برتقالي وذلك عند تعريض الجيل للشعة الفوق بنفسجية‬
‫‪.((.U.V‬‬
‫‪99‬‬
‫‪Principles of Molecular Biology‬‬
‫يحضر الجيل بتركيز )‪ (%2-0.7‬بإضافة ‪ 0.7 -2‬جرام أجاروز لكل ‪ ml 100‬من الـ ‪(TBE buffer (0.5 X‬‬
‫ثم إذابة الجاروز في مايكروويف ‪ microwave‬أو على ‪ hot plate‬ثم يضاف ‪ µl 0.5‬مـن الــ ‪Ethidium‬‬
‫‪ Bromide‬عند وصول درجة حرارته ‪.oC 50‬‬
‫وتسمى عملية وضع الـ ‪ DNA‬في البار ‪ well loading‬وتتم من خلل صبغ وجذب الـ ‪ DNA‬لسفل البئر‬
‫بإستخدام صبغة التحميل ‪) Loading Dye‬التي تعمل على جعل الـ ‪ DNA‬يرسب في قاع البئر كما إن هذه‬
‫الصبغة تهاجر مع الـ ‪ DNA‬ولكن بسرعة أكبر من أصغر شظية من الـ ‪ DNA‬فتبين نهاية عملية التفريد‬
‫الكهربي (‪.‬‬
‫‪100‬‬
‫‪Principles of Molecular Biology‬‬
‫‪Gel reading and troubleshooting‬‬
‫قراءة وتحليل الجل‬
‫مقدمة‪:‬‬
‫تعتبر طرق التفرقة بين تراكيب وراثية مختلفة على اساس جزيئي من أهم الطرق المستخدمة حاليًا‪.‬‬
‫حيث انها توفر وسيلة سهلة وسريعة للتنبؤ بوجود اختلفات بين هذه التراكيب فى وقت قصير وفى أي مرحلة‬
‫عمرية‪ .‬ومن ضمن هذه الطرق المستخدمة‪:‬‬
‫‪-1‬‬
‫طرق تحليل البروتين‪ :‬وهى تشمل التحليل الكلى للمحتوى البروتينى ‪Total Protein‬‬
‫‪ analysis‬و تحليل مشابهات النزيمات ‪.Isozymes analysis‬‬
‫‪-2‬‬
‫طرق تحليل الحمض النووى‪ :‬وهى تشمل تحليل الـ ‪ RAPD‬و الـ ‪ RFLP‬و الـ ‪SSR‬‬
‫وغيرها من التحليلت‪.‬‬
‫ونتائج جميع هذه الطرق تنتهى بالحصول على جل أو صورة لهذا الجل سواء كان بولى أكريلميد‬
‫‪ Ployachrylamid gel‬أو أجاروز ‪ Agarose Gel‬محتويا ً على نمط حزمى ‪ Band pattern‬معين خاص‬
‫بكل عينة مدروسة‪ .‬والشكل التالى يوضح ذلك‪.‬‬
‫‪101‬‬
‫‪Principles of Molecular Biology‬‬
‫‪RAPD Gel‬‬
‫والن‪ ،‬كيف يمكننا قراءة هذا الجل وكيفية تحليل الحزم الموجودة به؟‬
‫‪Protein Gel‬‬
‫قراءة الجل ‪Gel Reading‬‬
‫‪-‬‬
‫فى البداية يجب أن نحصل على صورة لهذا الجل على جهاز الكمبيوتر‪ ،‬سواء بالتصوير اللكترونى‬
‫‪ Digital‬أو تسجيل الصورة بالماسح اللكترونى ‪.Scanner‬‬
‫‪-‬‬
‫تحويل إمتداد إالصورة الى ‪ .TIFF‬وهذه النوعية تعمل عليها معظم برامج التحليل‪.‬‬
‫‪-‬‬
‫استخدام أحد برامج التحليل‪.‬‬
‫هناك العديد من برامج الكمبيوتر التى تقوم بتحليل صور الجل وعمل تعيين لمناطق الحزم ‪Band detection‬‬
‫وكذلك عمل مطابقة لمواضع الحزم ‪ Band Matching‬فى العينات المختلفة‪ .‬وتعتمد هذه البرامج على درجة‬
‫وضوح وإضاءة الحزمة الموجودة بالصورة وجودة الصورة‪ ،‬ولكن غاليا ً ما تفشل هذه البرامج فى التحديد الكلى‬
‫والفعلى للحزم الموجودة على الصورة و يتوقف ذلك على جودة الصورة والحزم التى بها وأيضا ً نوع البرنامج‬
‫المستخدم‪ ،‬مما يتطلب تدخل المستخدم فى إعادة تعين وتحديد للحزم على الصورة بشكل يدوي‪ .‬فكيف يمكنا ذلك؟‬
‫يمكن ذلك بعد الخذ فى العتبار هذه النقاط‪:‬‬
‫‪-‬‬
‫يجب تجاهل الحزم الى تقع خارج المجال وتكون باهتة ويقصد بخارج المجال هنا الحزم التى‬
‫توجد فى أعلى أو أسفل الصورة فى واحدة أو أكثر من العينات ويفصلها مسافة كبيرة بين مجال الحزم‬
‫الساسية الكثيرة‪ ،‬وغالبا ً ما تكون هذه الحزم قليلة العدد وباهتة ول يقابلها حزم كثيرة فى باقى العينات‪.‬‬
‫‪-‬‬
‫يجب أن نقوم بتحديد الحزم الباهتة التى لم يحددها البرانامج والموجودة داخل المجال ويقابلها‬
‫حزم من باقى العينات‪.‬‬
‫‪-‬‬
‫يجب تحديد الحزم ذات الشكل المبتسم ‪ Smiley shape‬من بداية نقطتى الحزمة من أعلى‪.‬‬
‫‪-‬‬
‫يجب أن تحدد الحزمة فى منتصفها‪.‬‬
‫‪-‬‬
‫يجب محاكاة الميول الموجود فى بعض حارات الجل إن وجد‪.‬‬
‫شرح مبسط لستخدام برنامج ‪ Gene profiler‬فى قراءة الجل‬
‫يعتبر هذا البرنامج من البرامج السهلة فى التعامل لتحليل الجل‪ .‬والن سنأخذ مثال على تحليل صورة‬
‫لجل خاص بتحليل ‪ RAPD‬على نسخة تجريبية من البرنامج يمكنك الحصول عليها من الموقع اللكترونى‪:‬‬
‫‪.www.scanalytics.com‬‬
‫‪102‬‬
‫‪Principles of Molecular Biology‬‬
‫الخطوات‪:‬‬
‫‪-1‬‬
‫نقوم بفتح البرنامج بعد تثبيته على الجهاز‪.‬‬
‫‪-2‬‬
‫ستظهر لنا النافذة التالية‪ ،‬ونقوم بالضغط على ‪ Enter‬ثم ‪ OK‬مع العلم بأن البرنامج يعمل‬
‫لمدة ‪ 45‬دقيقة فقط حيث أنه نسخة غير كاملة‪.‬‬
‫‪-3‬‬
‫سيطلب منك فتح الصورة بإمتداد ‪ tif‬كما سبق أن وضحنا‪.‬‬
‫‪-4‬‬
‫بعد إختيار الصورة سيطلب منك حفظ المشروع )يمكنك تجاهله(‪.‬‬
‫‪-5‬‬
‫نبدأ أول خطوة فى التعامل مع الصورة وهى من قائمة ‪ Analyze‬نختار المر ‪Mark‬‬
‫‪ lanes location‬وهو يمكننا من تحديد أماكن الحارات الى تمثل كلً منها عينة‪ .‬بعد إختيار هذا المر‬
‫نقوم بالضغط على الصورة باستخدام الماوس فى قمة أول حارة وغالبا ً ما يوجد بها الـ ‪ Ladder‬مع‬
‫الستمرار فى الضغط حتى نصل لنهاية الحارة‪ ،‬ونكرر ذلك مع آخر حارة‪ .‬كما فى الشكل التالى‪.‬‬
‫‪103‬‬
‫‪Principles of Molecular Biology‬‬
‫‪-6‬‬
‫بعد النتهاء من تحديد الحارات نختار من قائمة ‪ Analyze‬المر ‪ Define lanes‬لتظهر لنا‬
‫نافذة نقوم بكتابة عدد الحارات الموجودة بالصورة بما فيها حارة الـ ‪ Ladder‬كما فى الشكل التالى‪.‬‬
‫‪-7‬‬
‫ستظهر نافذة أخرى نقوم بكتابة اسماء العينات فى كل حارة خاصة بها مع تحديد حارة الـ‬
‫‪ Ladder‬كـ ‪ Standard‬كما فى الشكل التالى‪.‬‬
‫‪104‬‬
‫‪Principles of Molecular Biology‬‬
‫‪-8‬‬
‫ستظهر لك الن صورة الجل وعليها تحديدات الحزم التى قام البرنامج بعملها تلقائيًا‪ .‬وفى‬
‫الغالب يكون بها أخطاء‪ .‬كما نرى فى الشكل التالى‪.‬‬
‫‪-9‬‬
‫ولعلج هذه الخطاء نقوم بالضغط بالزر اليمن للماوس على الصورة ونختار ‪Edit‬‬
‫‪ detected bands‬ثم نضغط مرة أخرى ونختار ‪ delete band‬لزالة الحزم أو ‪ Add band‬لضافة‬
‫حزمة أو ‪ Move band‬لتحريك حزمة معينة الى مكانها الصحيح‪ .‬كما هو واضح من الشكل التالى‪.‬‬
‫‪105‬‬
‫‪Principles of Molecular Biology‬‬
‫‪-10‬‬
‫ويراعى وضع العلمة فى منتصف الحزمة‪ .‬وبعد النتهاء من التحرير نضغط على ‪Done‬‬
‫‪.editing bands‬‬
‫‪-11‬‬
‫من قائمة ‪ Analyze‬نختار ‪ Calibrate MW/PI‬ستظهر لنا نافذة يمكن من خللها إضافة‬
‫الوزان الجزيئية الخاصة بالـ ‪ Ladder‬المستخدم بالضغط على ‪ ..Add Stds‬كما فى هذا الشكل‪.‬‬
‫‪-12‬‬
‫وبعد إضافة الـ ‪ MW‬نضغط على ‪ .Apply Stds‬ثم ‪.Calibrate‬‬
‫‪-13‬‬
‫من قائمة ‪ Analyze‬نختار ‪ Match Bands‬لجعل البرنامج يقوم بمطابقة الحزم المشتركة‪.‬‬
‫والبرنامج يضع قيمة للـ ‪ Match tolerance‬والتي تحدد مقدار دقة تطابق الحزم عن بعضها وكلما‬
‫زادت القمية كلما ُأخذ عدد كبير من المستويات كمستوى واحد من الحزم ويفضل استخدام القيمة التى‬
‫يحددها البرنامج أو أقل منها على حسب التطابق‪ ،‬وبعده سيتم وضع دائرة صغيرة على الحزم التى‬
‫يعتبرها البرنامج متطابقة أى فى نفس الموضع ويمكن التنقل بين مستويات الحزم المتطابقة باستخدام‬
‫أسهم لوحة المفاتيح‪ .‬كما فى الشكل التالى‪.‬‬
‫‪106‬‬
‫‪Principles of Molecular Biology‬‬
‫‪-14‬‬
‫من قائمة ‪ Analyze‬نختار ‪ Match Statistics‬لمعرفة الوزان الجزيئية للحزم المتطابقة‪.‬‬
‫ويوضح البرنامج أماكن وجود الحزم مع إعطاء مدى للوزن الجزيئى للحزم التى ليست على نفس‬
‫المحازاة‪ ،‬مع إعطاء متوسط لقيمة الوزن الجزيئى لهذه الحزم وهى القيمة التى يجب استخدامها فى‬
‫التحليلت التالية‪ .‬كما فى الشكل التالى‪.‬‬
‫‪-15‬‬
‫ولن هذه نسخة تجريبية من البرنامج‪ ،‬ل يمكن لنا أن نقوم بحفظ هذه القيم‪ ،‬لذا يجب علينا‬
‫كتابتها فى جدول يبين رقم الحزمة والوزن الجزيئي الخاص بها وأماكن تواجدها فى الحارات بإضافة‬
‫‪ 1‬للتواجد و صفر لعدم التواجد‪ .‬كما يمكننا أن نظهر تقرير مفصل عن صورة الجل وذلك من قائمة‬
‫‪ File‬فنختار ‪ Reports‬ومنها نحدد الختيارات المطلوبة لعرضها كما فى هذا الشكل‪.‬‬
‫‪107‬‬
‫‪Principles of Molecular Biology‬‬
‫‪-16‬‬
‫ويمكننا إظهار منحنى الحزم الخاص بكل حارة بالضغط المزدوج على الحارة ليظهر الشكل‬
‫التالى‪.‬‬
‫ولكن ل يمكن حفظ هذه الصور لنها نسخة تجريبية‪.‬‬
‫وبهذا نكون أنهينا العمل على هذا البرنامج وحصلنا على جدول يحتوى على توقيع الحزم الخاصة‬
‫بالجل‪.‬‬
‫‪108‬‬
‫‪Principles of Molecular Biology‬‬
‫التحليل الحصائى والتحليل العنقودى ‪Cluster analysis‬‬
‫أصبح الن معنا جدول توقيع الحزم لصورة الجل السابق‪ ،‬حيث أن الواحد يدل على وجود الحزمة والصفر يدل‬
‫على غياب الحزمة‪ .‬والجدول التالى يوضح ذلك‪.‬‬
‫‪Guava-5‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪Guava-4‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪0‬‬
‫‪1‬‬
‫‪Guava-2‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪0‬‬
‫‪1‬‬
‫‪Guava-3‬‬
‫‪1‬‬
‫‪0‬‬
‫‪0‬‬
‫‪1‬‬
‫‪1‬‬
‫‪0‬‬
‫‪1‬‬
‫‪Guava-1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪1‬‬
‫‪Band No.‬‬
‫‪1‬‬
‫‪2‬‬
‫‪3‬‬
‫‪4‬‬
‫‪5‬‬
‫‪6‬‬
‫‪7‬‬
‫يتم بعد ذلك استعمال هذه البيانات فى عمل التحليل العنقودى ‪ Cluster Analysis‬وحساب درجة التشابه‬
‫‪ Similarity Index‬بين العينات وذلك عن طريق استخدام أحد البرامج المتخصصة فى عمل الـ‬
‫‪ Dendrogram‬أو التحليل العنقودى ومن هذه البرامج برنامج الـ ‪Multi Variants Statistical Package‬‬
‫‪ ((MVSP‬ويمكنك الحصول على نسخة تجريبية من البرنامج على الموقع‪:‬‬
‫‪http://www.kovcomp.co.uk/mvsp‬‬
‫خطوات التحليل‪:‬‬
‫‪-1‬‬
‫بعد تثبيت البرنامج على جهاز الكمبيوتر وفتحه‪ .‬سيظهر لك الشكل التالى‪.‬‬
‫‪-2‬‬
‫من قائمة ‪ File‬نختار ‪ New‬ستظهر لك نافذة يتم تحديد عدد الصفوف ‪ Cases‬والعمدة‬
‫‪ Variables‬كما فى الشكل التالى‪.‬‬
‫‪109‬‬
‫‪Principles of Molecular Biology‬‬
‫‪-3‬‬
‫من قائمة ‪ Data‬نختار ‪ Edit data‬سيظهر لنا جدول البيانات الذى سنقوم بتغذيته بالبيانات‬
‫الموجودة فى جدول توقيع الحزم مع كتابة أسماء العينات‪.‬‬
‫‪-4‬‬
‫من قائمة ‪ Analyses‬نختار ‪ Cluster Analysis‬ستظهر لنا نافذة الختيارت‪ ،‬ومنها يتم‬
‫تحديد طريقة التحليل وكذلك معامل التشابه ‪ Similarity coefficient‬ومنها نختار طريقة التحليل‬
‫‪ UPGMA‬والمعامل طبقا ً لـ ‪ .Nei & li's Coefficient‬وبإختيار ‪ Advanced‬يمكننا أن نحدد نتائج‬
‫التحليل المراد إظهارها ويجب إختيار ‪ Similarity Matrix‬وذلك يتضح من الشكل التالى‪.‬‬
‫‪-5‬‬
‫بالضغط على ‪ Ok‬سيظهر لنا التحليل ممثل فى الشكل العنقودى ‪ Dendrogram‬كما هو‬
‫موضح بالشكل التالى‪.‬‬
‫‪110‬‬
‫‪Principles of Molecular Biology‬‬
‫وكذلك نتيجة درجة التشابه ‪ Similarity Index‬فى جدول كالتالى‪.‬‬
‫وبذلك نكون قد انتهينا من قراءة وتحليل الجل‪.‬‬
‫‪111‬‬
Principles of Molecular Biology
112