volume 10 Number 21982 N u c l e i c A c i d s Research CoDection of published SS and 5.8S RNA sequences and their precursors Volker A.Erdmann Institut fur Biochemie, Fachbereich Chemie, Freie Universitat Berlin, Thielallee 69-73, 1000 Berlin 33 (Dahlem), GFR The 1980 collection (1) of mature 5S and 5.8S RNA sequences as well as those of their precursors are updated. This summary does not include those earlier publications in which the oligonucleotide composition, but not the sequences of 5S RNAs. has been reported. For this information the reader is referred to reference 2. The possible structures and functions of prokaryotic 5S and 5.8S RNAs are discussed in two other reviews (3,4). I would also like to thank those colleagues who have sent me their pre- or reprints on small ribosomal RNA sequences in 1981. © IRL Press Limited. 1 Falconberg Court, London W1V 6FG, U.K. 0306-1046/82/1002-T093 82.00/0 r93 30 40 SO 60 70 80 90 100 110 120 The tingle underlined sequence! *re tentative. The double underlined nucleotides occur in l e d th«n one mole per nole 5S RNA. Nucleotide written directly under another nucleotide in the sequence indicate! that it may also be found in this position. For abbreviation of organitma and literature referencea tee opposite page. pUCgCUCGCGGCCgUACCCCGCUGCUaXACCUCACCCCAUCCCGAACUWGMcilCykMCCCCGUACCGCCGAUGGUAGWlHXMCUCUCCC^ pUCCCuttXCCCJGUAGCCCCCUCCUCCCACCUCACCCCAuraCGAACUCACMGUCAA E.C.(a) pUjjUGCUGjjgGAUgGCGAACAGCZCACACCCCWCCCAlACCCMUCCCAACinjAACCuCmiCACCCCCGAUCGUAGUCC^^ B.Q. E.C. (b) pCCUACUCCW;AUACXGGACCG(^M«CCa;UUCCCAlK:CCCAACACCCMGinjAAKgCUCCAGCGCCGAUCCUACTOCGG(XCAGCMCCCUGCAAGACU puyUCGlK^CAUAKGAACACCu(JuUCCCCUaJCCCAUgCCGAACACGC^ B. S. (b) B. S u . OH C pUGCUU(£CGACWUAGCGAuuuGGACCCACCUwi|CUlJCCAuUCCGMCUCAGAAGu!y^ pUpCCUCJgCAUgCCGAACAGCUCACACCCCUUCCCAUCCCGAACACCCAACUUAACCUCuTJCAGCCCCGAW;CUACuT«KXXCCUUCCCCCUGjJGACAGUACGACJgCCCCA^C<^H 20 B.H B.L. 10 pUCCUGCUGUCUAUCGCGCUAUCGAACCAOTCU^CCCCAUCCCGAACUCAGuTJGUCAAAWUACCUCCWXAACCAUACCUCCCGCGuACCCGCUCCCUAAAAUACCUC GACCCCAGCUC^ A. N. 1 EUBACTERIAL 5S RNA SEQUENCES U) 3J <B oi o' c 13 - 17 133 1 - 1 16 6 Bacillus llchenlformis S 244 Bacillus megaterlum KM Bacillus stearothermophilus 1439 FV Bacillus stearothermophllua (strain not given) Bacillus stearothenpophllus 799 Bacillus subtillB 168 Bacillus £ Closteridium pasteurianum ATCC 6013 Escherichia c o l i MRE 600 Escherichia c o l i CA265 B.L. B.M. B.S. (a) B.S. (b) B.S. (b) B.Su. B.Q. C.P. E.C. (a) E.C. (b) 12 7 7, 9 11 10 9 8 6, 7, 9 72 Beneckea harveyi 392 B.B. 5 Reference Number Anacystis Nidulans 1405/1 Katz/Allen (Blue-green Alga) RNA Sourse A.N. Abbreviation Eubacterial 5S RNA Sequences cS CD 30 O. Q. 3> 20 20 30 30 40 40 JO JO 90 100 110 120 ( B 1 ) pUCAGAGAACACCL'CUCAAUCG p.B.Q. i i t * i » i i » m a t u r e 5 S RNA Mature 5S RNA m a t u r e 5S RNA i I |UH O H i I i t I t i I i t I i t I |UH i i | OH t The Blngl^ underlined «cqucnces are tentative. The double underlined nucleotidei occur in leoa than one mole per molo 5S RNA. Nuclcotideu written directly under another nucleotide in the sequence indicate* that it nay also be found in this position. X indicates nucleotide unknown. For abbreviation of organisms and literature reference see opposite page AAGCUUAAACCCAGCUCAAUGAGCUGGGUUUUUUGUuTJUUUC t CUUUUU i UUUWJn,, t pAUU, pUU and pU h a v e b e e n found a t t h e 5 ' e n d o f E . c o l i 5S RNA i i GAUACUUCACCCAGUUCAUCxxxxxjaraXMiotM,.,, I AAUCAUACGUCAAAGACAGAUGCUGAGCUUUUmJCnu p.E.C. i m a t u r e 5S RNA AAUCAUACGGUCCCAUGCGAUGCUAAAGGCUUinJXQj^ pUGAGAGAACACUCUCAAUUUC t ( B 2 ) pUGAGACAACACCUCUCAAUGC it i m a t u r e 5S RNA m a t u r e 5S RNA p.B.Su. p.B.Q. ( A 3 ) pUGAJACAACACCUCUCAAUCG p.B.Q. pUCAGAGAACACCUCUCAAUGC (A2) p.B.Q. EUBACTERIAL 5S RNA PRECURSORS M. C . pUGAGACAACACCUCUCAAUGG pUUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAU WCGeUGAAGAUAUUACUGAUGUGAGAAAAUAGCAAGCUGCCAGUUnu OH I . A. T. T. (A1) pAAUCCCCCKCCuTJAGCCGCCUGCMMCCCGOTCCCAuTrcCCMCACCC^GUGAMCCaK^ PWyCCCCCGUGCtCAUAGCGGCGU^CWrcCGlTOCCCT^ P. F. p.B.q. pUCCuTCMGACMUAMCUUAUGCACCCACCuX^UeXCUUGCCGAAaJCACUACUCAAACCUAAUAGCGCCGAUGGTJAGUGUGGGOTCUCCCCAWnJW pUCWJCUgUCACG ACUAGUG^CAUUGCAACACajGAireCCAUCCCGAACUCACAGGU^AAACCAUGC^UCGCCGAUCCUAGUCUKMOTn)^ P. pUClttUGCCGGCCAUACCGCAGUGGUCCCACCUCAUCCC^UGCCGAACUCAGAACUGAAACGUUGUACCGCCGAUGAUGGUGUG^ 80 P . V. 70 I . , . , • I I ' , I I I 0H, pCUUCACAUCCGCCAGCACCCCKCCAUUACACCCCCUAUCCAGCCCCAACCCGCAAGCCAAAGCCCCGAACCCCXCCAUCCUAGCUCGGGU AUCCCCCGGCAACACUUACGCAUCUCAACA P 60 M.S. L . V . (m) pUGUUGUMUGAUGGCAUTJMGGCCACACCUiaUCCCAUACCGMUU^ 10 10 EUBACTERIAL 5S RNA SEQUENCES ^ 3J O. CD o_ Lactobacillus virldescens ATCC 12 706 Mycobacterium smegmatis SN2 Proteus vulgaris (strain not given) Photobacter 8265 Pseudomonas fluorescens ATCC 13430 Thermua aquaticus ATCC 25104 Thermus thermophilus HB8 Mycoplasma caprlcolum ATCC 27 343 L.V. M.S. P.V. P P.F. T.A. T.T. M.C. 25, 26 27 Bacillus subtilis 168 Escherichia coli 217 p .B .Su p .E •C. 24 Bacillus 2 75 74 23 22 21 17 20 19 73 Reference Number p .B • Q.(Ar B 2 ) Prokaryotic 5S RNA Precursors Lactobacillus virideacens ATCC 12 706 (minor) RNA Sources L.V.(m) Abbreviation Eubacterial 5S RNA Sequences o_ n 3} 9 > o <•>' 2 H. T. 40 50 60 70 80 90 100 110 120 10 20 . 30 40 SO 70 80 90 100 Th« doubl* undarlln*d nuclootides occur in l e s s than one mol« per mole 5S RNA. For abbreviation of organisnfl and litarature refaranca see opposite page. 60 5 S RNA SEQUENCBS p^cCGGGCACUACGGlKaaCGlKAMACACCCGAUCC^UC^CCU^ 1 MITOCHONDRIA 110 120 PVAUUCUGGUGUCCUAGGCGUAGAGGMCCACACCMUCCAUCCCGMCUIWGUGGUUAMCUCUACUGCGOreACSAUACUGUAGGGSAGGUCCUGCG<WAAAAUAGCUCGACGCCAGGAy0H pUAUUCUGGUGUCCUAGGCGUAWGGMCCACACCAAUCCAUCCOWCUUGGUGGUU^ JO CHLOROPLAST 5 S RNA SEQUENCBS 3" n CD CD CD VI o' o a. B.B. Duckweed (Lemna minor) Broad bean (Vicia faba) 28 28 28 Chloroplast 5S RNA Sequences D. Dwarf bean (Phaseolua vulgari3) 76 Reference Number D.B. Spinach (Spinacia oleracia) 28, 77 Abbreviation S. Tobacco (Nicotiana tabacum var. Bright Yellow 4) Mitochondria 5S RNA Sequences Wheat embryo (Triticum vulgare Vill., Triticum aestivum L. var. Thatcher) 29 T. W. o > o a. 3J CD CD 0) 81 T.A. H. C. H.H. t i i i i • i i i i i i i i i I i i i i i i 100 ^ > 110 The doubls underlined nucleotldes occur in less than one mole per mole 5S RNA. For abbreviation of oryanlama and literature reference see opposte page. GCCUCGCMGAGGGGCCAAGUGUGAGCC(^G(aGCGCMUCGGUAGWCACGCGWGUCCGUCCCGa]GGMCCCGAGACCGCUCCGUUACMCGGCUC^MCUAGU B.M. 5S RNA lequence has the following 108 nucleotide Insertion between positions 108 and 109 : pGGCAACGGUCAUAG^AGGGAAACACCAGAUCCCAUUCCGMbcGACGGUUAAGCCUGCUGCGUAUUGCGUU^UACUGU^ • 1 10 20 30 40 50 60 70 80 90 pUUAAGGCGGCCAUAKGGUGGGGUUACUCCCGUACCCAUCCCGAACACGGMGAUAAGCCCGCCIJGCGUUCCGGUCAGUACUGGMUGC^ tpUUAAGGCGGCCACAGCGGCG^CGACUCC'C(UMCCCAUCCCGAAMC^ ARCHAEBACTERIAL 5S RNA SEQUENCES i i 120 , ^ r .8 o' > o a. </> 30 w |S Reference Number 18 78 79 80 Halobacterium cutirubrum N.R.C. 34001 Halococcus morrhuae ATCC 17082 Sulfolobua acidocaldarlus Thermoplasma acldophilum (122-1B2 or 122-1B3) H.. C . U. M. S. .A. T,• A. Abbreviation RNA Source ArchaabacteriaL 5S RNA Sequences u> JO a srd. o c o • t JO 30 t 40 t 50 _ • • i • i i i i i i t i i ° 7 , . i •» , , i '° . i i !°° . i , !'° . , Un ' ,1M i i i • i t I • i I . M i i • i • i p«;U<XCAUACCAU(>GCACUAAlK^C(»GAtKXAUCAGAACUCC<XACUlJMCCCUCCUUCC^ t i i i i i i i t i i t i i Ry- pACAUACGACCAUACCCACUGGAAAACUC&JGAUCCCGUCCGCUCUCCCAUAGAUAAGCCAGUGAGGGCCA^CU PGCCUACCCCCAUAC<>CCCUGAA<>CMCC<^UCUCClK^MUClK-CAArcUAA(X-iGGGUC^ Re. M.F.S.p(kuU/i£GGC^ACWCCCI^aCGCCC<_A^^ N. C. • i • • • t • i • > i i i i i i t f*f* i Single underlined sequences are tentative. Double underlined nucleotidts or 5 1 phosphate* occur in less than one n o W per mole 5S RHA. ? underneath the 3' terminal U of the D.B. sequence indicates that it has not clearly been Identified as uridine. For abbroviations of organisas and literature references see opposite page. R.T. i p^a)AC(:ACMUACWUCCU(ilAUAUACC«UUCUCCUC<!x^UCACCaAACUCAACCAGCAUACGCCUCCGU-AC^ "pGUCU ACGAC W U A C WCGUUGAAAKACCOHnJCUCWCCGAUC A C C G A A G U U A A G C M C G U G G G C C J ^ i M.F.O.pGCUUACGGCCACACCMCCUGAG(_MGCCCGAUCUCGUCUGAUCUCGGMGC(^GCAGGGUUGGGCCUGG^ v L. A . i H. L . pppCTCUACCOX^UACCACanKlkACGCreCCCAUCl)COTC.GAlX:iXXGMGCUAAGCAGGCUCG-<XCUCCUUACU L • i _. . . __.___. . _ _ _ _ . _ _ _ _ _ _ _ . . . _ _ _ . _ _ _ _ _ _ _ _ _ & _ _ _ _ . ,____r« * « _ _ & _ « _ ^«_p« • • • * • _ A # * « • # « _ * * t 1 _ « ^ 4 ^ 4 _ _ **r*fh ll|ipi\uw<un\^UW^UnV^bWHillJUUIUWUiV(VWlK'liWIUVnUI-^UliWjJ1AWUUi-IA1AUUWUtnFUU>fU\i\mu . pppCCCAACCACWUACCACCCUCAAUACAUC^ljmXW_^W^CCG^ P . D. B. D D. t. . pAUGGAUlHSCUlJAUACClAJUAlKiAAMCUCCCCAUCCCAU-AGCACUG i C . R . I I • pAUGWUCGUUCAAACCUUCAAKCCCCUCCCCAUCCCAUC^ACUGGGAAGAUAAGCCU i i i i i i i • • , • i i • ' i i ' OH • H U n CU-U- U yo^ CC I OH _ « 4 _ % * t _ «%_ • — ** W /MI i • PCAGUACCA(XAUACUUGACUCAAAACACCAUAUCCCCUCCGAUUIK;UCAACUUAACCACCCACACCCUUACUUACUACUGACCUCACUCAUCACUCCGGAACCCUCA(:U<;CCCUACUCM^ pGCUGACGGCCAUACCGUGUCWAUGCACCI^UCUCUUCUGA^ C.R.I C. F. C. C. cuuij , CUUU , to pGCC AACGUCCAUACCAUGUUGAAUACACCGCWCUCGUCCGAUCACCGAAGUCAAG^ i pGCAUACGACCAUAGGGUGUGGAAAACA&_GCUUCCCGUCCGCUCAGCCGUACAU^ pGGAUACGGCWUACUGCGCAGAAAGCACCKUUCCCAUCCGMCAGCGA^ 10 C ( b ) EEPCCCUACrec^^CCACCCUC_UAACCCCCWlKHJCGlJCU«UciKX;GAACCUAACCAC^UCGGGCCUGGUUAGUACUUCM •M • N , c (a) EEPf^^cc^^iK^ccccucuAAcax^uciKrcrucuciMrarcc^ B • A. C. A 1 EUKARYOTIC 5S RNA SEQUENCES Chicken, embryo fibroplast culture C Duckweed Drosophlla melanogaster F6 of KC Dwarf bean (Phaseolus vulgaris) C.P. D. D.M. D.B. Rye (Secale cereale c.v. Lovaszpatonai) Rainbow trout (Salmo gairdneri, RTG-2) Neurospora crassa R.T. Misgurnus fossilis (Somatic) M.F.S. Ry. Misgurnus fossllls (Oocyte) M.F.O. Reptile (Iguana iguana) 82 Lytechinus variegatus L.V. Re. 87 Lingula anatina L.A. 3 7 , 38 43 30, 31 42 87 41 86 39, 40 HeLa Cells KB cells H.L. 30, 31 36 28 35 85 34 84 33 32 83 30, 31 82 81 Reference Number K.B. (sea urchin) Chlorella pyrenoldosa 211/8b C.R.I, and II. (Lemna minor) Crlthldla fasclculata Chlamydomonas relnhardli (CW 15) C.F. Crypthecodinlum cohnii C.C. (b) Chicken (Gallus gallus), embryo fibroplast culture roorl C (a) (Vicia faba) Broad bean Bombyx B'.Mi Aspergillus nidulans (strain paba A l , bi Al) B.B. Acantharooeba castellanl A.N. Source A.C. Abbreviation Eukaryotic 5S RNA Sequences ^ 8> jo 2. O • . JO i • *0 . • 50 • . 60 > • 70 • • 80 • • 90 • • 100 ' ' 110 ' |>CCUCCGAUACCAUCAGCACUAAUCiACCC(^UCCAUCAC/LACUt;CCCAGUUAACXGUGCUUCCCCCACACUACUACUAKAUCCCUCACCCCCUGCCyUkCUCCUCCUCWCCACCU pGGGUqCGAUCAUAC(^MCUMimCCGumCCAUCAGMCUCCGCAGUUMGCGUGCW . )2o I 1 I t 1 1 1 I t I ' YTU I 1 I I 1 I 135 I I I Single underlined aequeacea are tentative. Double underlined nucleotidea or 5' phoaphatea occur in leaa than one • o l e per Dole 5S RNA. X in U.K. ia not certain; could be occupied by one or »ore unknown nucleotidea. For abbreviation of organiama and literature referencea see oppoaite page. at Che 3" end with CUU^ ( 6 0 1 ) , CUUUQH (201) and CUUUU^ (20X). 3S RNA ayntheaited by i a o l a t e d HeLa c e l l nuclei in v i t r o waa found to terminate 130 I p.H.L. l i t I Droaophlla pelanoRaater 5S RNA aequence plua at 3 ' end . . . CCUCCACAACUUUUUUnH I p.D.M. EUKARYOTIC 5S RNA PRECURSORS £p<OTUCCCCCCAUAW:UACCACAAAaaCCCTnJClKCCUCCCAUCMCUGW 125 jgpCCCUACCCCCACACCACCCUCAAACUCCCCCAUCUCCUCUGAUCUCCCAACCC^CCACCCUCGCCCClKXnmGM^ YSchPPpCUCUACGGCCAUACCUAGGCGAAAACACCAG'JUCCCGUCCGAUW^ XLS 1 • 1 ggpCUCUACGCCCAUACCACCCUCAACACCCCCCAUCUCCUCUGAW;UCCCAACCUMCCACGCUCCCCCCUWUUACUACUUCMUGCCAGACCUCCUCCCAAUACUCCCUGCUGUACCCUUy0H T.t. pCJjU^l'll.C^CCCAUACUAACCUGAAAACACCCCAUCCCAUUCCAACu^a^ACUUAACCCCCUUAACCCUCCCUUACUACUAACGUCGGCCACCCCUWKCAACU W F ' ' S. Sp. 20 • • tO EUKARYOTIC 5S RNA SEQUENCES 9J 3- 9 o* JjJ" Yeast (KluyveromyceB lactla) Yeast (Plchla membranaefaclens) Yeast (Schizosaccharomyces pombe, IFO No, 0345) Yeast (Torulopsls utllla) Y.K.L. Y.P.M. Y.Sch. Y.T.U. Drosophila melanogaster KcO HeLa cells p.D.H. p.H.L. Eukaryotic 5S RNA Precursors Yeast (SaccharomyceB carlsbergenals) Yeast (Saccharomyces carlsbergenBis) Y.S.Ca. (a) Yeast (Saccharomyces cerevlslae) Xenopus mullerl (oocytes) X.M.O. Y.S.Ce. Xenopus mullerl (somatic) X.M.S. Y.S.Ca. (b) Xenopua Laevis (somatic from kidney) Xenopus Laevis (oocytes) Wheat embryo W.E. X.L.O. Tetrahyemena thermophila T.t. X.L.S. Turtle (Terrapene Carolina, TH-I line of hear cells) Tu. 58 57 56 89 54 54 54, 55 54 53 52 52 42-44, 49-51 42-44, 49-51 46 45 44 30, 31 30, 31 Sunflower (Helianthua anuus) Tomato (Lycoperslcum esculentum) S. 88 Reference Number Spinach (Spinacla oleracea L. var. 424) Source To. Sp. Abbreviation Eukaryotic 5S RNA Sequences SJ 3D en C 10 • » » • * • 20 t i 30 i • 40 » i SO i • 60 i • 70 • * 80 i i 90 t 100 * i i , . , I t I I I t I I I I » T UUCCAACGCACUUUCCCCCCCCAGCCCUUCCUCCUGCCCCUACCCCUCUCUCACUCUCCCUUou UUCCAACCCACUUCCCCCCCCGCCUIICCUCCCCCCCCUACCCCUCUCUCACCCUCCCUU^ t OH Th. double underlinod nucleotide. occur in ltl> th.n on. aole per »ole 5.8S RNA. Nucl.otlde written directly under th indic £°T,l r f r i N.c. ! l nitquence ° " " "h«i ' " " b«en " " t h fron " " rDNA. » » « 1 « b e f o u n d 1" ' h i ' PO»ition. m indicate, th.t the nucleotid. U aethylated. derived R. T . T. UUCCAACCCACUUCCCCCCCCCCCUUCCUCCCCCGGCUACCCCUCUCUCACCCUCCCUQ i N. H. . IJGAACGUAUACUGCGCCCGAGGCCCCGGUAGAGCAUGUCUGCCUUAGUGCUGGGyU0l( injCCAACCCACUUCCCCCCCCCCr.uUCCUCCCCCCCCUACCCCUCUCUGAGCCUCCCUU.,. UUCAACCCACAUUCCGCUCCCCACUAUUCUCUCGAGCAUCCCUCUUCGACCCUUUUQH -R- N. C. c UGAAUGCAUACUGCUCCAGCUGACUUGUCAGUUGGAUAAUCUCCCUCAGGGACUA^ ISO C. C . UO UUCGAACCCACUUCCCGCCCCCGGUUCCUCCCCGCCCUACGCCUGCCUCAGCCUCCCUU^. " 130 UGAACGCAAGUUGCGCUCUCQJGGUUUAACCCCCCGGGAGCACGIJUCGCUUGAGIJGCCGCU U Q,. 120 A.C. 110 C. 101 p£AACUCmjAACCCyCCAUCAClK:CGCUCGUCCCUCCAUCAAC^kCCCACC(XUAGCUGCGAGAAUUMUGyCAAUUCCAGCACACAUUCAUCAUCCACAC pr^cuCUjjACCMj^WUCACUCCCCUCGUGCGUCGAUCAACMCCCAGCCCUACCVCCCACAACUAAUC^CAAUUgCACCACACAUUCAUCAUUCACAC R •T . - pCGACuXUlMGCGCyGGAUCACu^CGCUCCUCCCUCCAUr^UVGAACCCACCCCUACCUCCCACAAUUAAUCyCAAUtJC^MACACAUUCAUCAUCCACAC N. H. T pCCACUCuTJAGCCGJpjAUCACUCCCCUCGUCCCUCCAU^GAACCCACCCCUACCVCCCACMUUAAUCVCAAUUJCACCACACAUUCAlJCAUCCACAC pAAACUUuX^CAACCCAUCWUlMXUUCu^CCAUCCAUCAAGAACCCACCCAAAUCCOAUACflUAAUCUrAAUUCCACAAUUCACUCAAUCAllCCAAUr.ll H.L."V_ pAACUCUCAACAACGMUAUc'uUGGCUCUCG'GAUC^UGAAGGACGCAGC^UGCGAUACGUAG'uGUGMCUGfAGAAAUACGyGMCyAUCGAAUCCC U.C. •R- pACAACUUUCAGCAGUUGAUUCCUUGGUUCAGACCUCGAUGAAGGGCACUGCGAAAGUGAAUGGCAUGUGMUGCAGGCAUCCGGGAAUUGAGAGCUUCU c C C. PAACtCCUAACAACgGAVAUCUUGGUUCUCGCGAGGAUGAAGA^CGCAGCGAAAUGCGAUACGUAGUGUGAAUCGCAGGGAUCAGUGAAjJCATCGAAUCUT pCAACUCUUACCWyGCAUCACUCCCCUCCUCCCUCCAUCAAGAACCCACCCCUAGCVGCCACAAinjAAUGliCAAUUgCACCACACAUUCAUCAUCCACAC •c • 5•8S RNA SEQUENCES • C 11 EUKARVOTIC §• * <J> O QL o 62 63 64 Crypthecodlnium cohnli Chlamydomonas reinhardil HeLa cells Mouse (MPC-11 cells) Neurospora crassa Novikoff hepatoma ascites cells Rainbow trout (Salmo gairdneri, RTG-2) Turtle (heart cells CCL 50) c.c. C.R., H.L. M. N.C. N.H. R.T. T. 61 60 59, 60 85 84 59 Chicken (embryonic cells) C. 81 Reference Number Acanthamoeba castellanl RNA Source A.C. Abbreviation Eukaryotic 5.8S RNA Sequences Z 3 a CD 33 (A d. o' CD o_ SO 60 70 80 90 100 i 130 t > i U0 i 130 , i •L • X UUCGAACCCACCUUCCCCCCCCCCCUUCCUCCCCCGCCUACGCCUCUCUCACCCUCCCUJoH i i i i i i t i t i * ^ y i i * t AACCCAUAUCCCACUCCAUCCUCuunuguacuuuasuunauuuunungugcUCCUUCCACUACAUAUCCUUCACCOJUCUA^ i UUCAACCCACAUUCCCCCCCUUGGUAUUCCACCCGCCAUCCCUCUUUCACCCUCAUUDn,. UUCCAACCCACCUUGCGGCCCCGCCUUCCUCCCCCCCCCACCCCUC UCUGAGCCUCCCUC J ^ The double underlined nucleotides occur in l e s s than one mole per Hole S.8S RNA. Nucleotide written d i r e c t l y under another n u c l e o t i d e in the sequence indicates that i t may a l s o be found in this p o s i t i o n , m i n d i c a t e s that the nuclaotide i s methylated. N.C. sequence has been derived from rDNA.* Nucleotides 1-123 correspond to «5.8S and n u c l e o t i d e s 152-181 to 2S RNA; n u c l e o t i d e s 124-151 are part of the precursor and reaoved during processing. For abbreviations of organisa* and l i t e r a t u r e references see opposite paga. D. H. * Y.S.Ce. •B • X GUCUUUGAACGCAAGUUGCGCCCGAGCCACUCGCCGAGGGCACGCCUGCCUGGGCGUCACGCnu i 120 W. E . i CUCUUUCAACCCAAGUUCCCCCGAUCCCAUUACCUUCACCCCACCUCUCCCUGCCUCUCACAU^ 110 V. F. ' i i 101 pAACUCUAACCMlWCAUCAClK^CUCAUCCCUCCAUCAACAACCCACCAAACUCUCCGUCAUCCUClKIAACUCC^MACACAUCAACAUCCACAUUUUC p/UUlCUinjCAACAACCCAUCUCUUCCUUCUCCCAUCCAU(y^ Y. S . C e . •M • * X.L. D pCCACUCUUACCCCyCCAUCACUCCCCUCCUCCCUCGAUCAAGAACMACCCCUAGCyCCCACAAUUAGUC^CAAUUgCACCACACAUUCAUCAUCCACAC pCCACUCUUACCCCj|CCAUCACUCCCCUCCUCCCUCCAUGAACAACCCACCGCUAGCJGCWGAAUUACUCyGA>mjjCAGWCACAUUCAUCAUCCACAC X . B. pJACACGACUCUCGGCAACGGAf AUCUCGGWCUCdCAUCG^UGAAGAACGUAGCGAMUGCt^kcUGGUGUGAAUrgCAGAAUCCCGCGAACCAUCGA 40 w. E. 30 pACAAUCAClKIWXICCAACCCATAUCUACCCUCUUCCAUCCAlX^ACAACCUAGCCAAAUCCCAUACUUGGUCUCAAUTjJCACAAUCCCCUCAACCAUCCA 20 5 . 8 S RNA SEQUENCES V.P. 10 EUKARYOTIC Wheat ambryo Xenopus borealis (somatic) Xenopus leavis (somatic) Yeast (Saccharomyces cerevisiae A364A gal-1 ade-1 ade-2 ura-1 his-7 lys-2 try-1 (ATCC 22 244)) Drosophila melanogaater W.E. X.B. X.L. y.S'.Ce. D.M.* 68 67 59, 66 66 46 65 Reference Number Vlcla faba (broad bean) RNA Source V.F. Abbreviation Eukaryotic 5.8S RNA Sequences JO CD d. u> o_ a o' Three d i f f e r e n t p.X.L. 5 ' and 3 ' n u c l e o t i d e s e q u e n c e s i n p r e c u r s o r 5 . 8 s RNA were i i t i i i underlined Yeast Yeast p.Y.S.Ca. p.Y.S.Ce. Single Xenopus l e a v i s p.X.L. (somatic) RNA Source sequences are tentative. (Saccharomyces c e r e v i s i a e S-74) . 71 70 66,69 5 9 Reference Number S288 a mal g a l - 2 ) (Saccharomyces c a r l s b e r q e n s i s , HeLa c e l l s p.H.L. Abbreviation EUKARYOTIC 5 . 8 S RNA PRECURSORS p . Y . S . C c . 4>UAUUAA and pAUAUUAA have been found a t t h e 5 ' end o f t h i s y e a s t S.8S RNA. p . Y . S . C a . The f o l l o w i n g a d d i t i o n a l sequence h a s been found a t t h e 3 ' end: CCUUCyCAAACAUUCUGp 3'end:..CACCUCCAuCCCCCCCCCCCCCUCCCUCCCCCCoH i CCCCCCCCCCCACCCCUCACACCGCACCCCCCCUACCCCUGCCCACACCCAAAACCAAAACCCACCCACGCCUCCGCCACACCUCC . . . deduced a s f o l l o w s : From DNA s e q u e n c i n g data the a d d i t i o n a l 5'end: S.8S RNA. 5 ' n u c l e o c i d e s a r e r e p o r t e d : pUCG ( 4 0 2 ) , pCC (202) and pG (AOZ). pUCC i n s t e a d of pCC has a l s o been found a t Che 5 ' end of HeLa c e l l p.H.L. EUKARYOTIC 5 . 8 S RNA PRECURSORS Nucleic Acids Research REFERENCES 1. Erdmann, V.A.(1981) 2. Erdmann, V.A. (1978). Nucleic Acids Res. £, r1-r13. Nucleic Acids Res. £, r25-r42. 3. Monier, R. (1974) in Ribosomes, Nomura, M., Tissieres, A. and Lengyel, P., Eds., pp 141-168. Cold Spring Harbor Laboratory, New York. 4. Erdmann, V.A. (1976) in Progress in Nucleic Acid Research and Molecular Biology, Conn, W.E., Ed., Vol. 18, pp 45-90. Academic Press, New York. 5. Corry, M.J., Payne, P.I. and Dyer, T.A. (1974). FEBS Lett. £6, 63-66. 6. Raue, H.A., Stoof, T.J. ahd Planta, R.J. (1975). Eur. J. Biochem. 5£, 35-4 2. 7. Raufe, H.A., Rosner, A. and Planta, R.J. (1977). Molec. 8. Pribula, C D . , Fox, G.E. and Noese, C.R. (1974). FEBS 9. Marotta, C.A., Varricchio, F., Smith, I., Weissman, S.M., gen. Genet. _T££» 185-193. Lett. 4±, 322-323. Sogin, M.L. and Pace, N.R. (1976). J. Biol. Chem. 251, 3122-3127. 10. Stanley, J.R. and Penswick, J.R. (1975). 9th FEBS Meeting, Abstract 421. 11. Zimmermann, J. and Erdmann, V.A. (1978). Nucleic Acids Res. b, 2267-2288. 12. Pribula, C D . , Fox, G.E. andWoese, C.R. (1976). FEBS Lett. S±, 350-352. 13. Brownlee, G.G., Sanger, F. and Barrell, B.G. (1967). Nature 215, 735-736. 14. Brownlee, G.G. and Sanger, F. (1967). J. Mol. Biol. 23, 337-353. 15. Brownlee, G.G., Sanger, F. and Barrell, B.G. (1968). J. Mol. Biol. 34, 379-412. 16. Brownlee, G.G. (1972) in "Laboratory Techniques in Biochemistry and Molecular Biology" (eds. Work, T.S. and Work, E.) North-Holland Publishing Company, Amsterdam, D. 102. Nucleic Acids Research 17. F i s c h e l , J . L . and Ebel, J . - P . (1975). Biochimie 57_, 899904. 18. Nazar, R.N. and Matheson, A.T. (1978). J . B i o l . Chem. 253, 5464-5469. 19. Alexander, L.J. and Stewart, T.S. (1980). Nucleic Acids Res. 6, 979-987. 20. Jagadeeswaran, P. and Cherayil, Y.D. (1978). Proc. Indian Acad. Sci. 82B, 213-224. 21. Hoese, C.R., Pribula, C D . , Fox, G.E. and Zablen, L.B. (1975). J. Mol. Evol. 5, 35-46. 22. DuBuy, B. and Weissman, S.M. (1971). J. Biol. Chem. 246, 747-761. 23. Nazar, R.N. and Matheson, A.T. (1977). J. Biol. Chem. 252, 4256-4261. 24. Stiekeraa, W.J., Raue, H.A. and Planta, R.J. (1980). Nucleic Acids Res. j$, 2193-2211. 25. Sogin, M.L. and Pace, N.R. (1974). Nature 2^, 598-600. 26. Sogin, M.L. and Pace, N.R. (1976). J. Biol. Chem. 251, 3480-3488. 27. Feunteun, J., Jordan, B.R. and Monier, R. (1972). J. Hoi. Biol. 70. 465-474. 28. Dyer, T.A. and Bowman, C M . (1979). Biochem. J. 183, 595-604. 29 # Spencer, D.F., Bonen, L. and Gray, M.W. (1981). Biochem. 2£, 4022-4029. 30. Payne, P.I., Corry, M.J. and Dyer, T.A. (1973). Biochem. J. JU5, 845-851. 31. Payne, P.I. and Dyer, T.A. (1976). Eur. J. Biochem. 71, 33-38. 32. Pace, N.R., Walker, T.A. and Pace, B. (1974). J. Mol. Evol. 3, 151-159. 33. Brownlee, G.G. and Cartwright, E.M. (1975). Nucleic Acids Res. 2, 2279-2288. 34. MacKay, R.M., Gray, M.W. Doolittle, W.P. (1980). Nucleic Acids Res. 8, 4911-4917. 35. Jordan, B.R., Galling, G. and Jourdan, R. (1974). J. Mol. Biol. 87, 205-225. 36. Benhamou, J. and Jordan, B.R. (1976). FEBS Lett. 63, 146-149. 3 7 . H a t l e n , L . E . , Araaldi, F . and A t t a r d i , Biochem. r112 8, 4989-5005. G. (1969). Nucleic Acids Research 38. Vigne, R. and Jordan, B.R. (1977). J. Mol. Evol. 10, 77-86. 39. Forget, B.C. and Weissman, S.M. (1967). Science 158, 1695-1699. 40. Forget, B.G. and Weissman, S.M. (1969). J. Hoi. Biol. 244, 3148-3165. 41. Lu, A.L., Steege, D.A. and Stafford, D.W. (1980). Nucleic Acids Res. 8_, 1839-1853. 42. Roy, K.L. and Enns, L. (1976). J. Biol. Chem. 251, 6352-6354. 43. Roy, K.L. (1978). Can. J. Biochem. 5j>, 60-65. 44. Roy, K.L. (1977). FEBS Lett. 80, 266-270. 45. Luehrsen, K.R., Fox, G.E. and Woese, C.R. (1980). Current Microbiology, £, 123-126. 46. Barber, C. and Nichols, J.L. (1978). Can. J. Biochem. £6, 357-364. 47. Soave, C , Nucca, R., Sala, E., Viotti, A. and Galante, 48. 49. 50. 51. E. (1973). Eur. J. Biochem. 22' 392-400. Mackay, B.M., Spencer, D.F., Doolittle, W.F. and Gray, M.W. (1981). Eur. J. Biochem. _H_2' 561-576. Brownlee, G.G., Cartwright, E., McShane, T. and Williamson, R. (1972). FEBS Lett. 2j>, 8-12. Denis, H. and Wegnez, M. (1977). Dev. Biol. 58, 212-217. Ford, P.J. and Southern, E.M. (1973). Nature New Biology 241, 7-12. 52. Ford, P.J. and Brown, R.D. (1976). Cell 8, 485-493. 53. Hindley, J. and Page, S.M. (1972). FEBS Lett. 2£» 1 5 7 ~ 160. 54. Miyazaki, M. (1977). Nucleic Acids Res. Special Supple55. 56. 57. 58. 59. ment No. 3, 153-156. Miyazaki, M. (1974). J. Biochem. J_5, 1407-1407. Nishikawa, K. and Takemura, S. (1974). J. Biochem. 76.' 935-947. Jacq, B., Jourdan, R. and Jordan, B.R. (1977). J. Mol. Biol. VT7, 785-795. Yamamoto, M. and Seifart, K.H. (1978). Biochemistry 17, 457-461. Khan, N . S . N . and Maden, B . E . H . ( 1 9 7 7 ) . N u c l e i c A c i d s R e s . 4, 2495-2505. r113 Nucleic Acids Research 60. Nazar, R.N., Sitz, T.O. and Busch, H. (1976). Biochem. J_5, 505-508. 61. Selker, E. and Yanofsky, C. (1979). Nucleic Acids Res. 6, 2561-2567. 62. Nazar, R.N., Sitz, T.O. and Busch, H. (1975). J. Biol. Chem. 2i£, 8591-8597. 63. Nazar, R.N. and Roy, K.L. (1978). J. Biol. Chera. 253, 395-399. 64. Nazar, R.N. and Roy, K.L. (1976). FEBS Lett. Jl> 116. 65. Tanaka, Y., Dyer, T.A. and Brownlee, G.G. 111 ~ (1980). Nucleic Acids Res. 8, 1259-1272. 66. Ford, P.Y. and Mathieson, T. (1978). Eur. J. Biochem. 67. 68. 69. 70. 71. 72. 82, 199-214. Rubin, G.M. (1973). J. Biol. Chem. 248, 3860-3875. Parlakis, G.N., Jordan, B.R., Wurst, R.M. and Vournakis, J.N. (1979). Nucleic Acids Res. 2 ' 2213-2238. Boseley, P.G., Tuyns, A. and Birnstiel, M.L. (1978). Nucleic Acids Res. 5, 1121-1137. DeJonge, D., Kastelein, R.A. and Planta, R.J. (1978). Eur. J. Biochem. £3, 537-546. Rubin, G.M. (1974). Eur. J. Biochem. 4_W 197-202. Luehrsen, K.R. and Fox, G.E. (1981). J. Mol. Evol» V7» 52-55. 73. Alexander, L.J. and Stewart, T.S. (1981). FEBS-Lett. 135, 151-154., 74. Kumagai, I., Digweed, M., Erdmann, V.A., Watanabe, K. and Oshima, T. (1981). Nucleic Acids Res. £, 5159-5162. 75_ Hori, H., Sawada, M., Osawa, S., Murao, K. and Ishikura, H. (1981). Nucleic Acids Res. 9_, 5407-5410. 76. Dellhas, N., Andersen, J., Sprouse, H.M. and Dudock, B. (1981). Nucleic Acids Res. ±, 2801-2805. 77. Takaiwa, F. and Sugiura, M. (1981). Mol. Gen. Genet. 182, 385-389. 78. Luehrsen, K.R., Nicholson, D.E., Eubanks, D U C. and Fox, G.E. (1981). Mature 29_3, 755-756. 79. Stahl, D.A., Luehrsen, K.R., Woese, C.R. and Pace, N.R. (1981). Nucleic Acids Res. 9, 6129-6137. r114 Nucleic Acids Research 80= Luehrsen, K.R., Fox, G.E., Kilpatrick, H.W., Walker, R.T., Domdey, H., Krupp, G. and Gross, H.J. (1981). Nucleic Acids Res. 2' 965-970. 81. Mackay, R.M. and Doolittle, W.F. (1981). Nucleic Acids Res. 2' 3321-3334. Piechulla, B., Hahn, U., McLaughlin, L.W. and KUntzel, H. (1981). Nucleic Acids Res. £, 1445-1450. 83. Komiya, H., Kawakarai, M. and Takemura, S. (1981). J. Biochem. £9, 717-722. 82. 84. Hinnebusch, A.G., Klotz, L.C., Blanken, R.I. and Loeblich, A.R. (1981). J. Mol. Evol. V7' 334-347. 85. Darlix, J.-L. and Rochaix, J.-D. (1981). Nucleic Acids Res. 2/ 1291-1299. 86. Koraiya, H., Shiraizu, N., Kawakarai, M. and Takemura, S. (1980). J. Biochem. 88, 1449-1456. 87. Mashkova, T.D., Serenkova, T.I., Mazo, A.M., Avdonina, T.A., Timofeyeva, M.Y. and Kisselev, L.L. (1981). Nucleic Acids Res. 9_, 2141-2151. 88. Delihas, N., Andersen, J., Sprouse, H.M., Kashdan, M. and Dudock, B. (1981). J. Biol. Chem. 2S$_, 7515-7517. 89. Komiya, H., Miyazaki, Mu and Takemura, S. (1981). J. Biochem. 89, 1663-1666. r116
© Copyright 2026 Paperzz