BR A IN RE S E A RCH 1 2 03 ( 20 0 8 ) 8 9 –9 6
a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m
w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s
Research Report
Daily oscillation of gene expression in the retina is
phase-advanced with respect to the pineal gland
Lin Bai b , Sybille Zimmer a , Oliver Rickes a , Nils Rohleder a , Heike Holthues a , Lydia Engel a ,
Rudolf Leube b , Rainer Spessert a,⁎
a
Department of Anatomy and Cell Biology, Johannes Gutenberg University, Saarstraβe 19-21, 55099 Mainz, Germany
Department of Molecular and Cellular Anatomy, RWTH Aachen, Wendlingweg 2, 52074 Aachen, Germany
b
A R T I C LE I N FO
AB S T R A C T
Article history:
The photoreceptive retina and the non-photoreceptive pineal gland are components of the
Accepted 27 January 2008
circadian and the melatonin forming system in mammals. To contribute to our
Available online 9 February 2008
understanding of the functional integrity of the circadian system and the melatonin
forming system we have compared the daily oscillation of the two tissues under various
Keywords:
seasonal lighting conditions. For this purpose, the 24-h profiles of the expression of the genes
Retina
coding for arylalkylamine N-acetyltransferase (AA-NAT), nerve growth factor inducible gene-A
Pineal gland
(NGFI-A), nerve growth factor inducible gene-B (NGFI-B), retinoic acid related orphan receptor β (RORβ),
Circadian system
dopamine D4 receptor, and period2 (Per2) have been simultaneously recorded in the retina and
Gene expression
the pineal gland of rats under short day (light/dark 8:16) and long day (light/dark 16:8)
Photoperiod
conditions. We have found that the cyclical patterns of all genes are phase-advanced in the
Arylalkylamine N-acetyltransferase
retina, often with a lengthened temporal interval under short day conditions. In both tissues,
(AA-NAT)
the AA-NAT gene expression represents an indication of the output of the relevant
pacemakers. The temporal phasing in the AA-NAT transcript amount between the retina
and the pineal gland is retained under constant darkness suggesting that the intrinsic selfcycling clock of the retina oscillates in a phase-advanced manner with respect to the selfcycling clock in the suprachiasmatic nucleus, which controls the pineal gland. We therefore
conclude that daily rhythms in gene expression in the retina are phase-advanced with
respect to the pineal gland, and that the same temporal relationship appears to be valid for
the self-cycling clocks influencing the tissues.
© 2008 Elsevier B.V. All rights reserved.
1.
Introduction
The retina and the pineal gland of mammals are components
of the circadian system and display daily oscillations of bio-
chemical, physiological, and morphological parameters.
These changes are a consequence of oscillating gene expression in both tissues. Therefore, a subset of genes is under daily
regulation in the retina (for review, see Iuvone et al., 2005) and
⁎ Corresponding author. Fax: +49 6131 3925401.
E-mail address: [email protected] (R. Spessert).
Abbreviations: AA-NAT, arylalkylamine N-acetyltransferase; Ct, threshold cycles; DD, constant darkness; GAPDH, glyceraldehyde-3phosphate dehydrogenase; LD, light/dark; NA, noradrenalin; NGFI-A, nerve growth factor inducible gene-A; NGFI-B, nerve growth factor
inducible gene-B; PCR, polymerase chain reaction; Per2, period2; RORβ, retinoic acid related orphan receptor β; RT, reverse transcription;
SCN, suprachiasmatic nucleus; ZT, Zeitgeber time
0006-8993/$ – see front matter © 2008 Elsevier B.V. All rights reserved.
doi:10.1016/j.brainres.2008.01.073
90
BR A IN RE S EA RCH 1 2 03 ( 20 0 8 ) 8 9 –96
the pineal gland (for review, see Karolczak et al., 2005). Among
the daily regulated genes, the gene arylalkylamine N-acetyltransferase (AA-NAT; EC 2.3.1.87) has been investigated most
intensively because of its importance for the formation of the
hormone melatonin (for review, see Klein, 2007). In the retina,
the daily AA-NAT rhythm not only occurs in vivo but is
maintained in cultured retinas, persisting for at least 3 days in
constant darkness (DD) indicating that AA-NAT rhythm
generation is accomplished by an intrinsic self-cycling molecular oscillator (Tosini and Menaker, 1996, 1998; Sakamoto et
al., 2000, 2004). The retinal pacemaker (for review, see Ruan et
al., 2006; Tosini and Fukuhara, 2002, 2003) appears to be
located in photoreceptor cells (Tosini et al., 2007) and to target
AA-NAT by the binding of clock gene products to an E-box in
the AA-NAT promoter (for review, see Iuvone et al., 2005). In
addition, AA-NAT gene transcription can be activated by the
BMAL1/CLOCK heterodimer in cultured rat photoreceptors
(Chen and Baler, 2000) suggesting that induction occurs
primarily in photoreceptor cells. In the pineal gland, AA-NAT
expression is driven by a circadian oscillator located in the
suprachiasmatic nucleus (SCN), which in turn is entrained by
the light/dark (L/D) cycle through neural inputs from the
retina (for review, see Morin and Allen, 2006). The SCN sends
signals to the pineal gland via the neurotransmitter noradrenalin, which, in the rat as in other rodents, induces
nocturnal transcription of the aa-nat gene via β1- and α1adrenoceptor stimulation and subsequent cAMP formation
(for review, see Gupta et al., 2005; Simonneaux and Ribelayga,
2003). The functional integrity of the circadian system relies
on the proper temporal phasing of its components (for
review, see Morin and Allen, 2006), and thus, the temporal
relationship between the retina and the pineal gland is of
functional significance. Although the oscillations of each
tissue have been investigated extensively (for review, see
Iuvone et al., 2005; Karolczak et al., 2005), none of the studies
has examined the temporal relationship between both
systematically. Only two reports compare the oscillation of
AA-NAT gene expression in the retina and the pineal gland.
The findings described therein, however, do not provide a
clear idea of the temporal relationship between AA-NAT
transcription in both tissues, since the cyclical pattern in AANAT gene expression has been found to be phase-advanced
in the retina under lighting conditions of LD 12:12 (Sakamoto
and Ishida, 1998) but is synchronous in the retina and the
pineal gland under extreme lighting regimes (LD 20:4 and LD
4:20) (Engel et al., 2004).
The aim of the present study has been to compare the
oscillations of gene transcription in the retina and the pineal
gland directly in order to contribute to our understanding of
the relationship of these two compounds of the circadian and
the melatonin forming system. For this purpose, we have first
identified the genes under daily regulation in both the tissues
and subsequently compared their oscillating patterns
between the retina and the pineal gland of the same animals.
Since the daily profiles of various genes in the retina and
the pineal gland depend upon seasonal lighting conditions
(Engel et al., 2004; Rohleder et al., 2006; Ribelayga et al., 1999;
Spessert et al., 2006), the comparison between both tissues has
been conducted under long days (LD 16:8) and short days (LD
8:16).
2.
Results
2.1.
Identification of genes oscillating in the retina and the
pineal gland
To compare oscillations of the retina and the pineal gland,
we sought genes under daily regulation in both tissues. For
this purpose, we compared the transcriptome of the retina
and the pineal gland between ZT 18 and ZT 12, and between ZT 18 and ZT 6, under LD 12:12. To identify the genes
in question, we first performed high density microarray analyses and subsequent real-time PCR of the retinal transcriptomes. Genes showing a more than two-fold change in
transcript amount either between ZT 18 and ZT 12 or between
ZT 18 and ZT 6 were subjected to further testing in the pineal
gland by real-time PCR (Table 1). Of these, the genes coding
for AA-NAT (AA-NAT), nerve growth factor inducible gene-A
(NGFI-A), nerve growth factor inducible gene-B (NGFI-B), retinoic
acid related orphan receptor (ROR), dopamine D4 receptor
(dopamine D4 receptor), and period2 (Per2) also showed a more
than two-fold change in transcript amount in the pineal gland
and were therefore used for the comparison in oscillation (see
below). For the genes oscillating in both tissues, the cyclical
changes were noted, with higher ratios being observed in the
pineal gland than in the retina (Table 1). The only exception was
NGFI-A, which showed higher day/night ratios in the retina.
Cyclical changes were observed with the highest ratios for NGFIA in the retina and for aa-nat in the pineal gland.
2.2.
Daily profiles of gene expression under various LD
conditions
Gene transcription aa-nat, ngfi-a, ngfi-b, RORβ, dopamine D4
receptor, and Per2 was recorded in the retina and the pineal
gland under LD 16:8 and LD 8:16 by real-time PCR analysis
Table 1 – Genes identified as being under daily regulation
under light/dark (LD) 12:12 in both the retina and the
pineal gland of rats
Gene
Ratio ZT 18/ZT 12
Retina
AA-NAT
NGFI-A
NGFI-B
RORβ
Dopamine
D4 receptor
Per2
Pineal
gland
Ratio ZT 18/ZT 6
Retina
Pineal
gland
Microarray
PCR
PCR
Microarray
PCR
PCR
4.59
4.92
2.30
2.46
2.14
6.54
8.19
3.48
2.39
2.02
82.3
4.66
13.1
3.76
23.3
3.48
4.07
2.00
3.73
2.83
4.18
6.44
1.79
2.15
2.35
90.0
3.76
20.5
4.63
9.10
1.41
0.93
2.69
2.64
1.58
6.13
First, genes in question were identified by comparing the transcriptome of the retina between Zeitgeber times (ZT) 18 and ZT 12,
and between ZT 18 and ZT 6, by microarray analysis and real-time
PCR. Then, genes showing daily changes in the retina were tested
for also being under daily regulation in the pineal gland by realtime PCR.
BR A IN RE S E A RCH 1 2 03 ( 20 0 8 ) 8 9 –9 6
(Fig. 1; statistical analysis: Table 2). All genes underwent
significant daily changes irrespective of the tissue and the
lighting regime, with peak expression during the dark phase.
The only exception was Per2 whose corresponding mRNA levels
failed to oscillate under LD 8:16 in the retina. All genes
responded uniformly to the lighting regime. In general, the
nocturnal rise and the nocturnal peak occurred at an earlier ZT
under short days, and the duration of elevated expression was
also lengthened under short days in comparison with long days.
91
Remarkably, the cyclical patterns were different between
the retina and the pineal gland for all genes under investigation (Fig. 1; statistical analysis: Table 2). The nocturnal peak
occurred at an earlier ZT in the retina than in the pineal gland
for aa-nat, ngfi-a, ngfi-b, and Per2 under both lighting regimes
and for RORβ and dopamine D4 receptor under LD 8:16. The
temporal interval in the cyclical patterns between the retina
and the pineal gland depended upon the lighting regime.
Thus, the temporal interval was no longer evident for RORβ
Fig. 1 (part 1) – Cyclical patterns of gene transcription in the retina (white circles/solid line) and the pineal gland
(black boxes/dashed lines) of the same rats. For each gene (arylalkylamine N-acetyltransferase (AA-NAT), nerve growth factor
inducible gene-A (NGFI-A), nerve growth factor inducible gene-B (NGFI-B), retinoic acid related orphan receptor β(RORβ), dopamine D4
receptor and period2 (Per2)), the daily profile was recorded under light/dark (LD) 8:16 (left column) and under LD 16:8
(right column). All genes under consideration underwent significant 24-h oscillations under both lighting regimes in each
tissue with the exception of Per2, which failed to show a significant daily change only under LD 8:16 in the retina (analyzed by
one-way ANOVA; see Table 2). Note that the cyclical pattern is phase-advanced in the retina for aa-nat, ngfi-a, ngfi-b, and Per2
under both lighting regimes and for RORβ and dopamine D4 receptor under only LD 8:16 (analyzed by multivariable linear
regression models; see Table 2). Solid bars indicate dark periods under LD 8:16 and LD 16:8 lighting regimes. Data represent the
percentage of the maximal value. Each value represents the mean ± SEM (n = 3; each derived from three pooled organs).
92
BR A IN RE S EA RCH 1 2 03 ( 20 0 8 ) 8 9 –96
Fig. 1 (continued ).
and dopamine D4 receptor (see above) and shortened for aa-nat
and ngfi-a under long days.
entrained photoperiod and was similar under LD 16:8 and LD
8:16.
2.3.
Daily profiles of gene expression under constant
darkness
3.
To compare the pacemakers relevant for the retina and the
pineal gland, animals adapted to either of the lighting
regimes were kept for two cycles under DD, and gene
expression was recorded during the third cycle in both
tissues. After exposure to DD, relevant oscillations persisted
only for the AA-NAT gene in both tissues (Fig. 2; statistical
analysis: Table 2) and, for all other genes, only in the pineal
gland (not shown). As a consequence, the comparison of the
pacemakers was conducted in terms of only the AA-NAT
gene. We observed that the temporal phasing in the cyclical
pattern of AA-NAT gene expression between the retina and
the pineal gland persisted under DD. In contrast to LD
conditions, the temporal interval did not depend on the
In the present study, we have confirmed the daily oscillations of
mRNA levels of the genes coding for aa-nat (Sakamoto and
Ishida, 1998; Rohleder et al., 2006; Spessert et al., 2006; Borjigin et
al., 1995; Sakamoto et al., 2002; Engel et al., 2005; Roseboom et al.,
1996; Simonneaux et al., 2004), ngfi-a (Spessert et al., 2006; Carter,
1996; Gudehithlu et al., 1993), RORβ (Andre et al., 1998; Kamphuis
et al., 2005; Baler et al., 1996), and Per2 (Rohleder et al., 2006; Engel
et al., 2005; Kamphuis et al., 2005; Namihira et al., 2001; Fukuhara
et al., 2000; Karolczak et al., 2004) in the retina and the pineal
gland. We have also extended previous observations by showing
that ngfi-B undergoes daily changes not only in the pineal gland
(Humphries et al., 2004) but also in the retina, and by
demonstrating that the transcription of the dopamine D4 receptor
Discussion
BR A IN RE S E A RCH 1 2 03 ( 20 0 8 ) 8 9 –9 6
Table 2 – Statistical analysis
Gene
Lighting
regime/tissue
AA-NAT
LD 8:16
LD 16:8
DD 8:16
DD 16:8
NGFI-A
LD 8:16
LD 16:8
NGFI-B
LD 8:16
LD 16:8
RORβ
LD 8:16
LD 16:8
DopamineD4
receptor
LD 8:16
LD 16:8
Per2
LD 8:16
LD 16:8
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Retina
Pineal
Difference in
Daily
oscillation of 24-h transcript
level profiles b
transcript
level a
p b 0.001
p = 0.004
p = 0.001
p = 0.017
p b 0.001
p b 0.001
p = 0.035
p b 0.001
p = 0.001
p b 0.001
p = 0.006
p b 0.001
p = 0.002
p b 0.001
p = 0.013
p = 0.025
p = 0.013
p b 0.001
p = 0.026
p b 0.001
p = 0.004
p = 0.003
p = 0.011
p = 0.011
p = 0.443
p b 0.001
p = 0.002
p b 0.001
p b 0.001
p b 0.001
p b 0.001
p b 0.001
p b 0.001
p b 0.001
p b 0.001
p = 0.004
p = 0.04
p = 0.047
p b 0.001
p b 0.001
p = 0.004
p = 0.011
Inclusion criterion: p ≤ 0.05.
a
Daily oscillation in the amount of transcript was analyzed by
one-way ANOVA.
b
Differences between the tissues in the 24-h cyclical pattern of a
given gene were analyzed by multivariable linear regression models.
gene (for review, see Wong and Van Tol, 2003) is under daily
regulation. Since the dopamine D4 receptor (Patel et al., 2003)
plays a major role in diminishing the strength of rod signals in
daylight illumination (Nir et al., 2002), the newly identified daily
93
regulation of the dopamine D4 receptor gene in the retina is likely
to be of functional significance for visual signal processing and
light adaptation. The observations that, in both tissues, the
duration of elevated nocturnal expression is lengthened, and
that peak expression occurs at an earlier ZT under short days for
AA-NAT (retina: Rohleder et al., 2006; pineal gland: Ribelayga et
al., 1999; Spessert et al., 2006; Engel et al., 2005), NGFI-A (retina:
this study; pineal gland: Spessert et al., 2006), ngfi-B (retina: this
study; pineal gland: Spessert et al., 2006), RORβ (retina and pineal
gland: this study), and dopamine D4 receptor (retina and pineal
gland: this study) suggest that this type of coordinated daily
regulation and response to seasonal lighting is a general
phenomenon. The daily rhythm of AA-NAT in the retina and
the pineal gland reflects the activity of the circadian oscillators in
the SCN and the retina, respectively. Therefore, the uniform
response of the AA-NAT gene to photoperiodic treatment in the
retina and the pineal gland (Ribelayga et al., 1999; Rohleder et al.,
2006; Spessert et al., 2006) suggests that the message regarding
the ‘time of year’ is encoded in two basically independent
circadian oscillators in a similar manner.
We have found that the cyclical pattern for all genes under
investigation exhibits an earlier nocturnal rise and an earlier
nocturnal peak in the retina than in the pineal gland. We
therefore conclude that the retina oscillates in a phase-advanced
manner to the pineal gland. Under LD 16:8, the temporal interval
between the retina and the pineal gland is shortened for aa-nat
and ngfi-a and was even absent for RORβ and dopamine D4
receptor. Thus, the temporal interval in oscillation tends to be
shortened in long days. A negative correlation between the
length of temporal interval and the length of the photoperiod
may also explain the synchrony in the daily profiles under
extreme long days (LD 20:4) for the AA-NAT gene in the retina
and the pineal gland (Engel et al., 2004). On the other hand, the
synchronous expression of the AA-NAT gene occurs also under
LD 4:20 (Engel et al., 2004). Therefore, another possibility is that
extreme lighting conditions in general compress the oscillation
of the retina and the pineal gland to a congruent pattern.
AA-NAT gene expression is probably restricted to photoreceptor cells in the retina (Cahill and Besharse, 1992; Sakamoto et al., 2004) and to pinealocytes in the pineal gland (for
Fig. 2 – Cyclical patterns of the arylalkylamine N-acetyltransferase (AA-NAT) gene in the retina (white circles/solid line) and the
pineal gland (black boxes/dashed lines) of the same rats. The rats were housed first under light/dark (LD) LD 8:16 (left column) or
LD 16:8 (right column) and then kept for two cycles under constant darkness (DD). Note that the temporal interval between the
retina and the pineal gland is retained under DD (analyzed by multivariable linear regression models; see Table 2). Solid bars
indicate subjective dark periods. Data represent the percentage of the maximal value. Each value represents mean ± SEM (n = 3;
each derived from three pooled organs).
94
BR A IN RE S EA RCH 1 2 03 ( 20 0 8 ) 8 9 –96
review, see Karolczak et al., 2005). The finding that AA-NAT
oscillation is phase-advanced in the retina (Sakamoto and
Ishida, 1998; this study) therefore indicates that oscillation of
photoreceptors is phase-advanced to that of pinealocytes.
Furthermore, the longer temporal interval in AA-NAT expression under short days recorded in the present study suggests
that the temporal phasing between photoreceptors and pinealocytes depends on the seasonal lighting conditions and is
more prominent under short days.
In accordance with previous reports oscillation of the AA-NAT
gene persists under DD in the retina (for review, see Tosini and
Fukuhara, 2003) and the pineal gland (for review, see Gupta et al.,
2005). This is in agreement with the idea that the oscillation of
the AA-NAT gene is an indicator of the output of the pacemakers
in the retina and the SCN, respectively. Our present findings
indicate that the temporal phasing in AA-NAT gene expression
between the retina and the pineal gland is retained under DD.
Provided that, for both the pacemakers, the induction of the AANAT gene involves a similar time-span, this observation suggests
that the retinal pacemaker oscillates in a phase-advanced manner with respect to that in the SCN. In rats and other mammals,
daily oscillation of clock genes is delayed by about 4 h in various
tissues when compared with that in the SCN (for review, see
Balsalobre, 2002). Therefore, the retinal pacemaker appears to be
phase-advanced not only in comparison with that of the SCN but
also in comparison with the molecular oscillators of other
tissues. This, in turn, suggests that the retina occupies a special
position among the body's tissues with respect to the daily
timing of the pacemaker and the subsequent circadian rhythms.
The retinal circadian rhythms allow the organism to adapt to and
to anticipate the more than million-fold change in light intensity
during a 24-h period, thereby optimizing visual function for each
photic situation (for review, see Iuvone et al., 2005). Therefore, the
special daily timing of the retinal pacemaker may be necessary
to fully synchronize oscillation of processes relevant to light
adaptation with the daily change in light intensity.
In contrast to AA-NAT gene, the other genes under investigation fail to oscillate under DD. This suggests that daily regulation of these genes depends primarily on the lighting
conditions. Therefore, phase-advanced gene expression in the
retina is valid for genes depending on the intrinsic retinal pacemaker and for those depending primarily on external light dark
cues. The finding that the clock gene Per2 fails to oscillate under
DD (Rohleder et al., 2006; this study) is of particular interest because it suggests that either overall Per2 expression in preparations of the whole retina represents only in a minor portion of the
circadian pacemaker or that Per2 is even absent from the retinal
pacemaker. The recent observation that photoreceptor cells
contain a self-cycling oscillator but do not express Per2 (Tosini
et al., 2007) clearly favors the latter possibility.
What is the functional implication of the temporal interval
between retinal and pineal oscillation? Since AA-NAT is the
rate-limiting enzyme in melatonin formation (for review, see
Klein, 2007), a differential timing of oscillation may result in a
different timing of melatonin formation in the retina and the
pineal gland. Melatonin is of local significance in the retina and
influences multiple physiological parameters, such as outer
segment turnover (White and Fischer, 1989). On the other hand,
its synthesis in the pineal gland has more systemic effects by
contributing significantly to overall circulating levels (for
review, see Gupta et al., 2005; Simonneaux and Ribelayga,
2003). Therefore, the staggered oscillations of AA-NAT in the
retina and the pineal gland may reflect the different physiological functions of melatonin at different time points of the daily
cycle. Another possibility is that the delay in oscillation of the
pineal gland is required to lengthen the melatonin supply of the
retina. According to this concept, the retina is provided with
melatonin first from local sources and later from circulating
levels produced in the pineal gland. Furthermore, RORβ
probably acts as a nuclear melatonin receptor (for review, see
Smirnov, 2001), and the dopamine D4 receptor may play a
regulatory role in melatonin formation (Nguyen-Legros et al.,
1996; Santanavanich et al., 2003, 2005). Therefore, the temporal
interval between the cyclical expression patterns of both genes
may ensure that nuclear melatonin receptors and regulatory
receptors are available in each tissue when melatonin is formed.
Because the components of the circadian system influence
each other (for review, see Pevet et al., 2006) and, in particular
the retina appears to influence the SCN (for review, see Green
and Besharse, 2004), the phase relationship among the components is relevant to the functional integrity of the circadian
system. For this reason, and because each of the components is
relevant to the timing of particular biological events, an understanding of the way in which appropriate phasing between the
components of the circadian system is established and of the
possible variations in this temporal relationship under different
environmental conditions will be of interest.
4.
Experimental procedures
4.1.
Animals
.
Animal experimentation was carried out in accordance with
the European Communities Council Directive (86/609/EEC).
Adult male and female Sprague–Dawley rats (body weight: 150
to 180 g) were kept under standard laboratory conditions (illumination with fluorescent strip lights, 200 lux at cage level
during the day and dim red light during the night; 20 ± 1 °C;
water and food ad libitum) under various LD cycles (LD 12:12, LD
8:16, LD 16:8) for 3 weeks. When indicated, the rats were then
kept for two cycles under dim red light and killed during the
next cycle. Animals were killed at the indicated time points by
decapitation after open ether anesthesia. The retinas and the
pineal glands were quickly removed, immediately frozen in
liquid N2, and kept at −70 °C until RNA extraction. During the
dark phase, dissections were carried out under dim red light.
4.2.
Micro-array hybridization
Retinas were obtained from rats during the various L/D cycles,
and total RNA was immediately purified from two retinas by
using 1 ml Trizol reagent (Invitrogen, San Diego, CA, USA) and
the RNeasy kit (Qiagen, Hilden, Germany) following the hybrid
protocol provided by Affymetrix (www.affymetrix.com). RNA
concentration and quality was determined with the aid of an
Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA,
USA). Total RNA (15 μg) was used to prepare labeled probes for
microarray hybridization according to protocols recommended
by Affymetrix. Briefly, reverse transcription was performed with
BR A IN RE S E A RCH 1 2 03 ( 20 0 8 ) 8 9 –9 6
Table 3 – Primer sequences
Gene
GAPDH
Accession
number
Primer sequence 5′ to 3′
NM_017008 Forward
Reverse
AA-NAT U40803
Forward
Reverse
NGFI-A
NM_012551 Forward
Reverse
NGFI-B
RNU17254 Forward
Reverse
RORβ
XM_219749 Forward
Reverse
Dopamine NM_012944 Forward
D4
Reverse
receptor
Per2
NM_031678 Forward
Reverse
ATGACTCTACCCACGGCAAG
CTGGAAGATGGTGATGGGTT
GAAGGGAGACAGCAGTTC
GTCCTGGTCTTGCCTTTG
CACGTCTTGGTGCCTTTG
CTCAGCCCTCTTCCTCATC
TATCCCTCCCAGCTCAGAC
CCACCCTTCCTCTCAAACC
GCCTGGCTGTTAGAACCAAG
GTTGCAGACTGCCGTGATAG
GTTGGACGCCTTTCTTCG
GGGCACTGTTGACATAGC
the Poly-A-Control kit by using an oligo(dT)24-T7 primer
(Invitrogen), and double-stranded cDNA was synthesized with
the Superscript II double-stranded cDNA synthesis kit (Invitrogen). The double-stranded cDNA was then purified by using the
GeneChip Sample Cleanup Module (Affymetrix, High Wycombe,
UK) and served as a template in the subsequent in vitro
transcription reaction (IVT Labeling Kit, Affymetrix) with T7
RNA-polymerase and biotinylated nucleotides (Invitrogen). The
labeled and fragmented cDNAs (15 μg) were then hybridized for
16 h at 45 °C with Rat Genome 430 2.0 GeneChip arrays
(Affymetrix) containing over 31,000 probe sets that represented
more than 28,700 well-characterized rat genes. After hybridization and staining and washing steps with R-phycoerythrin–
streptavidin (Merck, Darmstadt, Germany), quantification of
signals was performed according to the protocols provided by
Affymetrix. The arrays were scanned with an Affymetrix GCS
3000 scanner, and images were analyzed by using Microarray
Suite 5.0 (Affymetrix). The resulting data were normalized
globally. All parameters of GeneChip quality control were within
accepted ranges as described by the manufacturer. The signal
log ratios of the expression levels in experimental and control
samples were calculated by using the GeneChip robust multiarray analysis method with the help of the Array Assist Software
3.0 (Strategene, La Jolla, CA, USA).
4.3.
carried out in a total volume of 25 μl containing 12.5 μl
ABsolute™ QPCR SYBR® Green Fluorescein Mix (Abgene,
Hamburg, Germany), 0.75 μl primer (10 mM), 6 μl RNase-free
water, and 5 μl sample. Primer sequences are listed in Table 3.
PCR amplification and quantification were performed in an iCycler (BioRad, Munich, Germany) as follows: denaturation for
3 min at 95 °C, followed by 40 cycles of 30 s at 95 °C, 20 s at 60 °C,
and 20 s at 72 °C. All amplifications were carried out in duplicate.
The amount of RNA was calculated from the measured threshold cycles (Ct) by a standard curve. The data were normalized to
the amount of glyceraldehyde-3-phosphate dehydrogenase
(GAPDH). GAPDH transcript amount did not display a significant
circadian variation under any of the entrained lighting regimes.
4.4.
AGCAGTCCCCTACAGCTTAACCT
CCGAGATGCGCCAGATGT
Real-time polymerase chain reaction
RNA of three retinas or pineal glands per sample was isolated by
using the RNeasy Mini Kit (Qiagen) following the instructions of
the manufacturer. The amount of extracted RNA was determined by measuring the optical density at 260 and 280 nm.
Extracted RNA (1 μg) was reverse-transcribed by using 4 U
Ominiscript reverse transcriptase (Qiagen, Hilden, Germany) in
a total volume of 20 μl, containing 2.0 μl 10× buffer (supplied with
the transcriptase), 0.5 mM deoxynucleotide triphosphate, 10 U
ribonuclease inhibitor, and 1 μM oligo d(T) primer. A sample
without the addition of RNA was routinely included as a control.
The reverse transcription mixture was incubated at 37 °C for
60 min to promote cDNA synthesis. The reaction was terminated by heating the samples at 95 °C for 5 min. The cDNA was
then diluted 1:10 in RNase-free water, and aliquots of 5 μl were
used for the polymerase chain reaction (PCR). Real-time PCR was
95
Statistical analysis
All PCR data are given as the mean ± SEM of three independent
experiments. PCR data of each experiment refer to two (constant darkness) or three (various L/D conditions) pooled pineals.
The oscillation of each transcript expression was analyzed by
using a one-way analysis of variance. The influences of the
Zeitgeber time (ZT) (as a categorized and continuous variable,
as a second and third order polynomial), the photoperiod, and
the interaction between ZT and photoperiod on each transcript
expression were analyzed by multivariable linear regression
models, using the software SPSS (SPSS version 11, SPSS Inc.
Chicago, Illinois). General linear models with explanatory influential variables were built by using stepwise variable
selection (inclusion criterion: p ≤ 0.05) for each of the dependent
variables. For the final models, p-values of the t-statistic are
given. All analyses are regarded as explorative, and p-values
are given descriptively. Therefore, no significance level is fixed.
Acknowledgments
We thank Ms. U. Frederiksen and U. Göringer-Struwe for their
excellent technical assistance. We also thank Ms. R. Dechau
for secretarial help. The data contained in this study are included in theses presented by Sybille Zimmer, Oliver Rickes,
and Nils Rohleder toward partial fulfillment of their degrees of
medical doctor at the Johannes Gutenberg University, Mainz.
REFERENCES
Andre, E., Conquet, F., Steinmayr, M., Stratton, S.C., Porciatt, V.,
Becker-Andre, M., 1998. Disruption of retinoid-related orphan
receptor beta changes circadian behaviour causes retinal
degeneration and leads to vacillans phenotype in mice. EMBO J.
17, 3867–3877.
Balsalobre, A., 2002. Clock genes in mammalian peripheral tissues.
Cell Tissue Res. 309, 193–199.
Baler, R., Coon, S., Klein, D.C., 1996. Orphan nuclear receptor
RZRbeta: cyclic AMP regulates expression in the pineal gland.
Biochem. Biophys. Res. Commun. 220, 975–978.
Borjigin, J., Wang, M.M., Snyder, S.H., 1995. Diurnal variation in
mRNA encoding serotonin N-acetyltransferase in pineal gland.
Nature 378, 783–785.
Cahill, G.M., Besharse, J.C., 1992. Light-sensitive melatonin
synthesis by Xenopus photoreceptors after destruction of the
inner retina. Vis. Neurosci. 8, 487–490.
96
BR A IN RE S EA RCH 1 2 03 ( 20 0 8 ) 8 9 –96
Carter, D.A., 1996. Trans-synaptic control of NGFI-A and jun-B
expression: contrasting transcriptional and
posttranscriptional mechanisms directed by common
receptors. Neurosci. Lett. 206, 41–44.
Chen, W., Baler, R., 2000. The rat arylalkylamine
N-acetyltransferase E-box: differential use in a master vs a
slave oscillator. Brain Res. Mol. Brain Res. 81, 43–50.
Engel, L., Vollrath, L., Spessert, R., 2004. Arylalkylamine
N-acetyltransferase gene expression in retina and pineal gland
of rats under various photoperiods. Biochem. Biophys. Res.
Commun. 318, 983–986.
Engel, L., Lorenzkowski, V., Langer, C., Rohleder, N., Spessert, R.,
2005. The photoperiod entrains the molecular clock of the rat
pineal. Eur. J. Neurosci. 21, 2297–2304.
Fukuhara, C., Dirden, J.C., Tosini, G., 2000. Circadian expression of
period 1, period 2, and arylalkylamine N-acetyltransferase
mRNA in the rat pineal gland under different light condition.
Neurosci. Lett. 286, 167–170.
Green, C.B., Besharse, J.C., 2004. Retinal circadian clocks and
control of retinal physiology. J. Biol. Rhythms 19, 91–102.
Gudehithlu, K.P., Neff, N.H., Hadjiconstantinou, M., 1993. c-fos and
NGFI-A mRNA of rat retina: evidence for light-induced
augmentation and a role for cholinergic and glutamate
receptors. Brain Res. 631, 77–82.
Gupta, B.B.P., Spessert, R., Vollrath, L., 2005. Molecular
components and mechanism of adrenergic signal transduction
in mammalian pineal gland: regulation of melatonin
synthesis. Indian J. Exp. Biol. 43, 115–149.
Humphries, A., Weller, J., Klein, D., Baler, R., Carter, D.A., 2004.
NGFI-B (Nurr77/Nr4a1) orphan nuclear receptor in rat
pinealocytes: circadian expression involves an
adrenergic-cyclic AMP mechanism. J. Neurochem. 91, 946–955.
Iuvone, P.M., Tosini, G., Pozdeyev, N., Haque, R., Klein, D.C.,
Chaurasia, S.S., 2005. Circadian clocks, clock networks,
arylalkylamine N-acetyltransferase, and melatonin in the
retina. Prog. Retin. Eye Res. 24, 433–456.
Kamphuis, W., Cailotto, C., Dijk, F., Bergen, A., Buijs, R.M., 2005.
Circadian expression of clock genes and clock-controlled genes
in the rat retina. Biochem. Biophys. Res. Commun. 330, 18–26.
Karolczak, M., Burbach, G.J., Sties, G., Korf, H.W., Stehle, J.H., 2004.
Clock gene mRNA and protein rhythms in the pineal gland of
mice. Eur. J. Neurosci. 19, 3382–3388.
Karolczak, M., Korf, H.W., Stehle, J.H., 2005. The rhythm and blues of
gene expression in the rodent pineal gland. Endocrine 27, 89–100.
Klein, D.C., 2007. Arylalkylamine N-acetyltransferase: “the
Timezyme”. J. Biol. Chem. 282, 4233–4237.
Morin, L.P., Allen, C.N., 2006. The circadian visual system, 2005.
Brain Res. Rev. 51, 1–60.
Namihira, M., Honma, S., Abe, H., Masubuchi, S., Ikeda, M.,
Honmaca, K., 2001. Circadian pattern, light responsiveness and
localization of rPer1 and rPer2 gene expression in the rat retina.
Neuroreport 12, 471–475.
Nguyen-Legros, J., Chanut, E., Versaux-Botteri, C., Simon, A.,
Trouvin, J.H., 1996. Dopamine inhibits melatonin synthesis in
photoreceptor cells through a D2-like receptor subtype in the rat
retina: biochemical and histochemical evidence.
J. Neurochem. 67, 2514–2520.
Nir, I., Harrison, J.M., Haque, R., Low, M.J., Grandy, D.K., Rubinstein,
M., Iuvone, P.M., 2002. Dysfunctional light-evoked regulation
of cAMP in photoreceptors and abnormal retinal adaptation
in mice lacking dopamine D4 receptors. J. Neurosci. 22,
2063–2073.
Patel, S., Chapman, K.L., Marston, D., Hutson, P.H., Ragan, C.I.,
2003. Pharmacological and functional characterisation of
dopamine D4 receptors in the rat retina. Neuropharmacology
44, 1038–1046.
Pevet, P., Agez, L., Bothorel, B., Saboureau, M., Gauer, F., Laurent,
V., Masson-Pevet, M., 2006. Melatonin in the multi-oscillatory
mammalian circadian world. Chronobiol. Int. 23, 39–51.
Ribelayga, C., Garidou, M.L., Malan, A., Gauer, F., Calgari, C., Pévet,
P., Simonneaux, V., 1999. Photoperiodic control of the rat pineal
arylalkylamine-N-acetyltransferase and
hydroxyindole-O-methyltransferase gene expression and its
effect on melatonin synthesis. J. Biol. Rhythms 14, 105–115.
Rohleder, N., Langer, C., Maus, C., Spiwoks-Becker, I., Emser, A.,
Engel, L., Spessert, R., 2006. Influence of photoperiodic history
on clock genes and the circadian pacemaker in the rat retina.
Eur. J. Neurosci. 23, 105–111.
Roseboom, P.H., Coon, S.L., Baler, R., McCune, S.K., Weller, J.L.,
Klein, D.C., 1996. Melatonin synthesis: analysis of the more
than 150-fold nocturnal increase in serotonin
N-acetyltransferase messenger ribonucleic acid in the rat
pineal gland. Endocrinology 137, 3033–3045.
Ruan, G.X., Zhang, D.Q., Zhou, T., Yamazaki, S., McMahon, D.G.,
2006. Circadian organization of the mammalian retina. Proc.
Natl. Acad. Sci. U. S. A. 103, 9703–9708.
Santanavanich, C., Chetsawang, B., Ebadi, M., Govitrapong, P., 2003.
Effects of D1- and D2-dopamine receptor activation on melatonin
synthesis in bovine pinealocytes. J. Pineal Res. 35, 169–176.
Santanavanich, C., Ebadi, M., Govitrapong, P., 2005. Dopamine receptor
activation in bovine pinealocyte via a cAMP-dependent
transcription pathway. J. Pineal Res 38, 170–175.
Sakamoto, K., Ishida, N., 1998. Circadian expression of serotonin
N-acetyltransferase mRNA in the rat retina. Neurosci. Lett. 245,
113–116.
Sakamoto, K., Oishi, K., Shiraishi, M., Hamano, S., Otsuka, H., Miyake,
Y., Ishida, N., 2000. Two circadian oscillatory mechanisms in the
mammalian retina. Neuroreport 11, 3995–3997.
Sakamoto, K., Oishi, K., Ishida, N., 2002. Ontogeny of circadian
expression of serotonin N-acetyltransferase mRNA in the rat
retina. Neurosci. Lett 317, 53–55.
Sakamoto, K., Liu, C., Tosini, G., 2004. Circadian rhythms in the
retina of rats with photoreceptor degeneration. J. Neurochem.
90, 1019–1024.
Simonneaux, V., Ribelayga, C., 2003. Generation of the melatonin
endocrine message in mammals: a review of the complex
regulation of melatonin synthesis by norepinephrine,
peptides, and other pineal transmitters. Pharmacol. Rev. 55,
325–395.
Simonneaux, V., Poirel, V.J., Garidou, M.L., Nguyen, D.,
Diaz-Rodriguez, E., Pevet, P., 2004. Daily rhythm and regulation
of clock gene expression in the rat pineal gland. Brain Res. Mol.
Brain Res 120, 164–172.
Smirnov, A.N., 2001. Nuclear melatonin receptors. Biochemistry
66, 19–26.
Spessert, R., Gupta, B.B.P., Rohleder, N., Gerhold, S., Engel, L., 2006.
Cyclic AMP-inducible genes respond uniformly to seasonal
lighting conditions in the rat pineal gland. Neuroscience 143,
607–613.
Tosini, G., Davidson, A.J., Fukuhara, C., Kasamatsu, M.,
Castanon-Cervantes, O., 2007. Localization of a circadian clock
in mammalian photoreceptors. FASEB J. Electronic publication
ahead of print (PMID: 17621597).
Tosini, G., Menaker, M., 1996. Circadian rhythms in cultured
mammalian retina. Science 272, 419–421.
Tosini, G., Menaker, M., 1998. The clock in the mouse retina:
melatonin synthesis and photoreceptor degeneration. Brain
Res. 789, 221–228.
Tosini, G., Fukuhara, C., 2002. The mammalian retina as a clock.
Cell Tissue Res. 309, 119–126.
Tosini, G., Fukuhara, C., 2003. Photic and circadian regulation of
retinal melatonin in mammals. J. Neuroendocrinol 15, 364–369.
White, M.P., Fischer, L.J., 1989. Effects of exogenous melatonin on
circadian disc shedding in the albino rat retina. Vis. Res. 29,
167–179.
Wong, A.H., Van Tol, H.H., 2003. The dopamine D4 receptors and
mechanisms of antipsychotic atypicality. Prog.
Neuropsychopharmacol. Biol. Psychiatry 27, 1091–1099.