PAPER
www.rsc.org/analyst | Analyst
Sol–gel derived nano-structured zinc oxide film for sexually transmitted
disease sensor
Anees A. Ansari,* Renu Singh, G. Sumana and B. D. Malhotra*
Received 6th October 2008, Accepted 19th February 2009
First published as an Advance Article on the web 6th March 2009
DOI: 10.1039/b817562d
A 20-mer thiolated oligonucleotide probe (th-ssDNA) specific to Neisseria gonorrhoeae immobilized
onto a sol–gel derived nano-structured zinc oxide (ZnO) film dip-coated onto an indium-tin-oxide
(ITO) glass substrate has been used for the fabrication of a DNA biosensor for sexually transmitted
disease (gonorrhoea) detection using hybridization technique. The results of characterization studies
carried out on this th-ssDNA–ZnO/ITO bioelectrode using X-ray diffraction, UV-Visible, Fouriertransform infrared, scanning electron microscopy and electrochemical techniques reveal the linearity as
0.000524 fmol–0.524 nmol, with a detection limit of 0.000704 fmol within 60 s.
Introduction
Gonorrhoea is currently the second most common bacterial
sexually transmitted disease (STD). It is estimated that there are
about 25 million cases of gonorrhoea worldwide.1 To prevent
spread of this disease, increased attention is being focused on the
early diagnosis and treatment of symptomatic or asymptomatic
infected individuals. Traditional laboratory diagnosis of this
infection is carried out by culture, microscopy and PCR techniques. However, these diagnostic methods are expensive, timeconsuming (14–72 h) and are not reliable.2,3 Therefore, efforts are
being made towards the development of a rapid, sensitive and
specific STD-sensing device.
Electrochemical DNA biosensors based on nucleic acid
hybridization have received considerable attention due to their
potential application for the diagnosis of various diseases.4–12
Many approaches have been followed for the fabrication of
electrochemical nucleic acid biosensors. The nano-structured
metal oxides offer unique opportunities for electrochemical
transduction of DNA-sensing events.9,12,13 Feng et al. have
fabricated nano-porous cerium oxide (CeO2)/chitosan composite
film for detection of cancerous DNA sequence by an electrochemical method.13 In another approach, a nucleic acid sensor
has been fabricated using a single-stranded DNA-immobilized
MWCNT–nano ZrO2–chitosan-modified glassy carbon electrode.12,13 Liu et al. have recently reported application of a nanostructured ZnO/chitosan composite film-modified electrode for
detection of DNA hybridization.14
Many methods such as adsorption, covalent coupling and
electrochemical entrapment have been reported for the immobilization of DNA onto given solid substrates under desired
conditions. The sol–gel method is considered particularly
attractive for the development of a desired biosensor. This is
because sol–gel materials can be prepared under ambient conditions and exhibit tunable porosity, high surface area,
Department of Science & Technology Centre on Biomolecular Electronics,
National Physical Laboratory, Dr. K S Krishnan Marg, New Delhi 110012,
India. E-mail: [email protected]; [email protected];
Fax: +91-11-45609310; Tel: +91-11-4560915
This journal is ª The Royal Society of Chemistry 2009
biocompatibility, excellent thermal stability, chemical inertness and
negligible swelling in aqueous and non-aqueous solutions.15–17
Besides this, a sol–gel derived nano-porous film can retain its
bioactivity in a given micro-environment and can be used for
direct electron transfer between DNA active sites and the electrode. Many sol–gel metal oxides such as CeO2,16,17 tin oxide
(SnO2),18 titanium oxide (TiO2),15 zirconium oxide (ZrO2)12 and
zinc oxide (ZnO)19,20 have been utilized for the construction of
DNA and enzyme-based biosensors.
We report results of studies on the application of a sol–gel
derived nano-structured ZnO film deposited onto indium-tinoxide (ITO) glass for the fabrication of a DNA biosensor for
detection of Neisseria gonorrhoeae.
Experimental
Zinc acetate dihydrate, Triton X-100, Tris buffer, ethylenediaminetetraacetic acid (EDTA), potassium monohydrogen
phosphate, potassium dihydrogen phosphate, methylene blue,
and N. gonorrhoeae oligonucleotide probes were procured from
Sigma-Aldrich (USA). NH4OH, HNO3, solvents and reagents
were purchased from Merck India Ltd, Mumbai, India. All the
solutions and glass wares were autoclaved prior to being used
and desired reagents (molecular biology grade) were prepared in
de-ionized water (Milli Q 10 TS). ITO-coated glass substrates
were obtained from Balzers, UK. Probes used for the studies
include: 50 -thiol end-labeled probe (20-mer) specifically targeting the Opa gene (a multi copy gene) of N. gonorrhoeae,
a complementary target sequence. The sequences of DNA
probes used for electrochemical DNA hybridization detection
are as follows:
Probe: thiol-50 -CCGGTGCTTCATCACCTTAG-30 ;
Complementary target: 50 - CTAAGGTGATGAAGCACCGG -3’;
Non-complementary
target:
50 GTATGGTGATCAAGCTCCCG -30 .
Firstly, 1 g of zinc acetate dihydrate [Zn(CH3COO)2$2H2O] is
dissolved in 10 ml distilled de-ionized water. Then 1 ml (1 M) of
ammonium hydroxide solution (NH4OH) is added drop wise to
this solution with constant stirring for 4 h at 25 C to maintain pH
Analyst, 2009, 134, 997–1002 | 997
8–9. A white milky precipitate of Zn(OH)2 thus obtained is
washed with de-ionized water until neutral pH is achieved.17
Subsequently, dilute HNO3 (1 M) is added to the precipitate at 25
C to obtain a solution of pH 1. A transparent sol thus obtained is
used to fabricate the thin film on an ITO glass plate via dip coating.
To achieve a uniform coating on the ITO electrode, 2 wt% Triton
X-100 surfactant is added to the resulting solution. These films are
then allowed to dry at 400 C for about 20 minutes.
The ZnO/ITO surface is washed and subject to 5 minutes
incubation for physisorption of the 20-mer thiolated oligonucleotide probe (th-ssDNA, 1 ng/ml) specific to N. gonorrhoeae in
a humid chamber at 25 C. This ZnO/ITO film is subsequently
washed with buffer and dried in a nitrogen environment. The
prepared th-ssDNA–ZnO/ITO film bioelectrode is stored at 4 C
when not in use. The sol–gel derived nano-structured ZnO/ITO
and th-ssDNA–ZnO/ITO electrodes have been characterized by
UV-Visible (Phoenix), SEM (SEM, LEO 440) and Fouriertransform infrared (FTIR) spectrophotometer (Perkin-Elmer,
Model 2000) in the wavelength range 400–4000 cm1. Electrochemical data have been obtained using an Autolab Potentiostat/
Galvanostat (Eco Chemie, Netherlands) using a three-electrode
system with ITO as the working electrode, platinum wire as the
auxiliary electrode, and Ag/AgCl electrode as the reference
electrode in phosphate buffer saline (PBS) solution containing 5
mM [Fe(CN)6]3/4. The th-ssDNA–ZnO/ITO electrode has been
optimized for hybridization time and is subject to incubation in 5
ml of DNA solution in the concentration range (0.000524 fmol–
0.524 nmol) of complementary target solution for 60 s at 25 C.
The proposed mechanism of the probe DNA immobilization
onto ZnO/ITO and hybridization with target DNA for the
detection of N. gonorrhoeae is shown in Scheme 1. It has been
found that one-minute incubation in target sample solution is
sufficient for the hybridization process (data not shown). CV and
DPV measurements of the th-ssDNA–ZnO/ITO electrode have
been carried out using 20 mM methylene blue (MB), in 0.05 M
PBS, pH 7.0, containing 0.9% NaCl.
Results and discussion
standard (JCPDS #751526) data.19,21 The ZnO film coated onto
the glass substrate shows three strong diffraction peaks at (100),
(002) and (101), indicating distribution of ZnO grains in the film
along different directions. This may be attributed to optimized
deposition and annealing of the ZnO film. The diffraction peaks
of ZnO are broad suggesting a smaller crystalline size of ZnO.
The thickness of the ZnO film is 325 nm. The average crystallite
size of the ZnO film calculated by Scherrer’s equation is 3.2–5 nm
(Fig. 1A). The values of the lattice constants of the ZnO film
calculated from the peak position are found to be a ¼ 3.495 Å
and c ¼ 5.25 Å, which are slightly higher than those of the bulk
ZnO (a ¼ 3.249 Å and c ¼ 5.202 Å). The higher value of the
lattice constant may be attributed to the fact that the unit cell is
slightly elongated along the growth direction. In addition,
increase in the lattice constant reveals a lattice expansion effect
resulting from increased oxygen vacancies and Zn2+ ions with
decreased particle size.
Fig. 1B shows UV-Visible spectra obtained for the sol–gel
derived nano-structured ZnO and th-ssDNA–ZnO film. It can be
seen that the observed absorption maximum (371 nm) of the
nano-structured ZnO film (curve a) is blue shifted to 345 nm with
increased intensity after DNA immobilization, indicating
immobilization via electrostatic interactions between negatively
charged th-ssDNA and positively charged ZnO (curve b).22
The SEM image (Fig. 1C) of ZnO/ITO shows a uniformly
distributed porous three-dimensional structure that is conducive
for the immobilization of oligonucleotides [Fig. 1C(i)]. Upon
immobilization of DNA, the porous structure of the ZnO/ITO
film becomes globular containing light/bright streaks. The
globular morphology is attributed to the immobilization of DNA
biomolecules onto the free volume of ZnO/ITO whereas bright/
light streaks are assigned to the charged DNA molecules
[Fig. 1C(ii)]. The immobilization of DNA onto ZnO/ITO occurs
due to high isoelectric point (IEP) of ZnO (9.5) that is suitable for
adsorption of low IEP DNA (IEP 4.2). At the physiological pH
7.5, the positively charged ZnO matrix not only provides
a biocompatible environment for immobilizing negatively
charged DNA molecules, but also promotes electron transfer
between DNA and the electrode19
Characterization of the sol–gel derived nano-structured ZnO film
The XRD diffraction pattern (Fig. 1A) shows a crystallographic
phase present in the sol–gel derived ZnO film deposited on the
glass substrate. A high degree of preferential orientation is
evident, giving rise to spectra resembling a single crystal
diffraction pattern. The prepared film shows (100), (002), (101),
(102), (110), (103) and (112) diffraction planes corresponding to
the hexagonal wurtzite ZnO structure and well-matched with the
Electrochemical studies of the ZnO/ITO electrode, th-ssDNA–
ZnO/ITO bioelectrode and th-dsDNA-ZnO/ITO bioelectrode
Fig. 2A shows results of cyclic voltammetry (CV) measurements
carried out on the bare ITO electrode, ZnO/ITO electrode, thssDNA–ZnO/ITO bioelectrode and th-dsDNA-ZnO/ITO bioelectrode in PBS (50 mM, pH 7.0, 0.9% NaCl) containing 5 mM
Scheme 1 Sol–gel derived ZnO-based STD sensor for the detection of N. gonorrhoeae.
998 | Analyst, 2009, 134, 997–1002
This journal is ª The Royal Society of Chemistry 2009
Fig. 1 (A) X-Ray diffraction pattern of sol–gel derived nano-structured ZnO film. (B) UV-Vis spectra of (a) sol–gel derived nano-structured ZnO/ITO
electrode and (b) th-ssDNA–ZnO/ITO bioelectrode. (C) SEM micrograph of (i) sol–gel derived nano-structured ZnO/ITO electrode and (ii) th-ssDNA/
ZnO/ITO bioelectrode.
Fig. 2 (A) Cyclic voltammograms of (a) bare ITO electrode, (b) sol–gel derived nano-structured ZnO/ITO electrode, (c) th-ssDNA–ZnO/ITO bioelectrode, and (d) th-dsDNA-ZnO/ITO bioelectrode in PBS (50 mM, pH 7.0, 0.9% NaCl) containing 5 mM [Fe(CN)6]3/4 at a scan rate of 50 mV/s. (B)
Electrochemical impedance of (a) bare ITO electrode, (b) sol–gel derived nano-structured ZnO/ITO electrode, (c) th-ssDNA–ZnO/ITO bioelectrode,
and (d) th-dsDNA-ZnO/ITO bioelectrode in PBS (50 mM, pH 7.0, 0.9% NaCl) containing 5 mM [Fe(CN)6]3/4 at a scan rate of 50 mV/s.
This journal is ª The Royal Society of Chemistry 2009
Analyst, 2009, 134, 997–1002 | 999
[Fe(CN)6]3/4 at a scan rate of 50 mV/s, respectively. The CV of
the bare ITO electrode (curve a) shows a well-defined cathodic
peak at 0.0544 V and an anodic peak at 0.356 V in the potential
range of 0.6 to –0.50 V. However, significant enhancement (curve
b) in the peak potential [cathodic peak potential (Epc) to 0.064
V and anodic peak potential (Epa) to 0.353 V] is observed after
the sol–gel ZnO film is deposited. The considerable enhancement
in peak current may be attributed to increased electrical
conductivity due to ZnO nanoparticles. However, after immobilization of th-ssDNA onto the ZnO electrode, the peak current
decreases. The cathodic and anodic peak potentials are observed
at 0.0135 and 0.0257 V, respectively, implying the immobilization of th-ssDNA onto the ZnO electrode. This result can be
attributed to electrostatic interactions between polyanionic
DNA immobilized onto the sol–gel derived nano-structured
ZnO/ITO and the anionic redox couple ions.12,28 It appears that
insulating ssDNA layer self-assembled on the modified electrode
surface blocks conducting sites of the ZnO/ITO electrode. After
hybridization of the bioelectrode with target DNA, a decrease in
the peak current is observed.
Fig. 2B shows results of electrochemical impedance spectroscopy (EIS) measurements carried out as a function of frequency
on bare ITO, ZnO/ITO electrode, th-ssDNA–ZnO/ITO and thdsDNA-ZnO/ITO bioelectrode in the presence of PBS (50 mM,
pH 7.0, 0.9% NaCl) containing 5 mM [Fe(CN)6]3/4. The charge
transfer resistance (RCT)6–9 of the ZnO/ITO electrode is found to
decrease to 2.21 kU as compared to that of the bare ITO electrode (RCT 4.28 kU) and lower value of RCT of the ZnO/ITO
electrode reveals that ZnO nanoparticles provide an increased
electroactive surface for ZnO nanoparticles and enhanced electron transfer. However, when th-ssDNA is immobilized onto
ZnO/ITO electrode, RCT of the ZnO/ITO electrode increases to
4.99 kU due to presence of electro-negative phosphate skeletons
that perhaps prevent [Fe(CN)6]3/4 ions from reaching the
electrode surface for electron transfer during redox reaction. This
reveals that th-ssDNA has been immobilized on the sol–gel
derived nano-structured ZnO/ITO electrode. Further increase in
RCT of the th-dsDNA-ZnO/ITO bioelectrode may be due to the
negatively charged surface of the th-dsDNA-ZnO/ITO bioelectrode that prevents [Fe(CN)6]3/4 in solution from clustering
on the electrode surface for electron exchange.
The impedance data have been fitted using commercially
available software Zview. A modified Randle’s equivalent circuit
has been used for measurement over the entire measurement
frequency range. The circuit, which is often used to model
interfacial phenomena, includes (i) ohmic resistance of the electrolyte solution, Rs; (ii) Warburg impedance, Zw, resulting from
the diffusion of ions from the bulk electrolyte to the electrode
interface; (iii) the interfacial double layer capacitance (Cdl)
between an electrode and solution, relating to the surface
condition of the electrode, since the surface of the three-dimensional nano-structured ZnO/ITO film is very rough, it has
a larger real surface area – we have, therefore, used a constant
phase element (CPE) instead of classical capacitance to fit the
impedance data, since the electrolyte side of the interface dominates impedance of the interface; and (iv) the electron transfer
resistance, RCT, which exists if a redox probe is present in the
electrolyte solution.6,7 The parallel elements (CPE and Zw + RCT)
of the equivalent circuit have been introduced since the total
1000 | Analyst, 2009, 134, 997–1002
Table 1 Electrochemical impedance characteristics of the modified
ZnO/ITO bioelectrode
S.N.
Electrode
Rs (U)
RCT (kU)
Cdl (mF)
Zw (mU)
1
2
3
4
Bare ITO
Sol–gel ZnO/ITO
th-ssDNA–ZnO/ITO
th-dsDNA-ZnO/ITO
1.32
6.92
7.16
2.26
4.28
2.21
4.99
1.00
4.62
5.90
4.60
5.46
8.56
8.09
14.83
10.22
current through the working interface is sum of the respective
contributions from the Faradaic process and the double layer
charging. Ideally, Zw and Rs represent bulk properties of the
electrolyte solution and diffusion of the redox probe in solution.23,24 A negligible change in Rs is observed during the modification process. As shown in Fig. 2B, it can be seen that ohmic
resistance of the solution is not affected by modification of the
electrode. Moreover, it can be seen (Fig. 2B) that observed
changes in RCT are much larger than those of other impedance
components (Table 1).
Amperometric response characteristics of th-ssDNA–ZnO/ITO
and th-dsDNA-ZnO/ITO bioelectrodes
Fig. 3A shows the results of differential pulse voltammetry
(DPV) measurements carried out on the ITO electrode, thssDNA–ZnO/ITO, th-dsDNA-ZnO/ITO and th-ssDNA–ZnO/
ITO treated with non-complementary DNA in PBS (50 mM, pH
7.0, 0.9% NaCl) in the presence of methylene blue (MB). MB as
an electroactive redox indicator is used for the electrochemical
sensing of DNA hybridization at the electrode surface4,5,12,13 and
is known to associate with unpaired nitrogenous bases of ssDNA
as compared to dsDNA. Curve a in Fig. 3A is the DPV curve of
bared ITO, that has a well-defined peak at around 0.25 V.
Curve b is the DPV of the th-ssDNA–ZnO/ITO electrode, indicating strong affinity of MB for free guanine bases and that no
duplex/hybrid is formed at the th-ssDNA–ZnO/ITO electrode.4,5,25 This may be attributed to the positively charged ZnO
molecules that may repel positively charged MB molecules
facilitating MB molecules to get associated with both partially or
unpaired nitrogenous bases of the DNA probe stationed at the
th-ssDNA–ZnO/ITO surface. The observed peak seen at 0.25 V
may be assigned to the reduction of unpaired nitrogenous bases
or to the ZnO matrix. A significant decrease in MB signal is
observed when hybridizing with the complementary target
sequence (curve c), since interaction of MB and guanine residues
of the probe is prevented by duplex formation on the electrode
surface.4,5,25 The observed insignificant change in MB signal on
its treatment with the non-complementary target sequence (curve
d) indicates non-hybridization.
Fig. 3B describes the results of response studies of th-ssDNA–
ZnO/ITO bioelectrode after hybridization with different
concentrations of target DNA of N. gonorrhoeae ranging from
0.000524 fmol to 0.524 nmol. The absence of the MB peak after
hybridization with the complementary synthetic oligomer is
attributed to steric inhibition of MB packing between double
helix of the hybrid.4,5,25–27 The DPV peak current of th-ssDNA–
ZnO/ITO increases with the decrease in the concentration of
target DNA, indicating an enhanced number of double-stranded
This journal is ª The Royal Society of Chemistry 2009
Fig. 3 (A) Differential pulse voltammograms of (a) bare ITO electrode, (b) th-ssDNA–ZnO/ITO bioelectrode, (c) th-dsDNA-ZnO/ITO bioelectrode,
and (d) th-ssDNA–ZnO/ITO bioelectrode treated with non-complementary target DNA at a pulse height of 50 mV and pulse width of 70 ms, in 0.05 M
phosphate buffer of pH 7.0 containing 0.9% NaCl and methylene blue (MB, 20 mM). (B) Response of the th-ssDNA–ZnO/ITO bioelectrode after
hybridization with complementary target probe concentration 0.000524 fmol–0.524 nmol at a pulse height of 50 mV and pulse width of 70 ms, in 0.05 M
phosphate buffer of pH 7.0 containing 0.9% NaCl and methylene blue (MB, 20 mM). (C) The MB peak height as a function of target DNA concentration.
DNA molecules at the surface (Fig. 3B). The average current of
the DNA bioelectrode is linear with logarithmic value of the
complementary sequence concentration range of 0.000524 fmol–
0.524 nmol. The detection limit of the th-ssDNA–ZnO/ITO
bioelectrode is 0.000704 fmol with a hybridization time of 60 s.
The decrease in the MB peak with respect to concentration
(Fig. 3C) follows eqn (1) with a regression coefficient as 0.99611
and standard deviation of 0.06602, respectively.
th-dsDNA ¼ 0.14637[ln(1/th-dsDNA concentration)] +
3.22364
(1)
It may be noted that we have not observed any change in the
MB peak height after hybridization with the target DNA <
0.000704 fmol, hence the detection limit of the th-ssDNA–ZnO/
ITO electrode is 0.000704 fmol with the hybridization time of 60 s.
Conclusions
The sol–gel ZnO nano-porous film has been successfully deposited onto a glass substrate via dip-coating. The spectroscopic and
This journal is ª The Royal Society of Chemistry 2009
electrochemical measurements show that the sol–gel derived
nano-structured ZnO film is an excellent matrix for the immobilization of th-ssDNA onto the ZnO/ITO electrode surface for
DNA hybridization detection. The relatively high sensitivity of
the sol–gel derived ZnO matrix is due to the high surface area of
nano-porous ZnO nanoparticles. The sol–gel nano-structured thssDNA–ZnO/ITO bioelectrode exhibits linearity in the range of
0.000524 fmol–0.524 nmol, with a detection limit of 0.000704
fmol and a hybridization time of 60 s. Efforts should be made to
utilize this nucleic acid electrode for detection of gonorrhoea
(STD) using clinical samples. This nucleic acid sensor has
implications towards the clinical diagnosis of other sexually
transmitted diseases.
Acknowledgements
We thank Dr Vikram Kumar, Director, NPL, New Delhi, India
for facilities. Financial support received under the Department of
Science and Technology (DST) projects (DST/TSG/ME/2008/18
and GAP- 070932), in-house project (OLP-070632D) and the
DBT project (GAP-070832), are sincerely acknowledged. Thanks
Analyst, 2009, 134, 997–1002 | 1001
are due to Dr Seema Sood and Rachna Prasad (AIIMS, New
Delhi), and members of DSTCBE for interesting discussions.
References
1 A. Alam, M. Miah, M. Rahman, H. Sattar and A. Saleh, Indian
Journal of Medical Microbiol., 2002, 20, 37–39.
2 J. Wang, Nucleic Acid Research, 2000, 28, 3011–3016.
3 J. M. Nam, S. I. Stoeva and C. A. Mirkin, J. Am. Chem. Soc., 2004,
126, 5932–5933.
4 K. Arora, N. Prabhakar, S. Chand and B. D. Malhotra, Anal. Chem.,
2007, 79, 6152–6158.
5 K. Arora, N. Prabhakar, S. Chand and B. D. Malhotra, Biosens. &
Bioelectron., 2007, 23, 613–620.
6 L. Shen, Z. Chen, Y. Li, S. He, S. Xie, X. Xu, Z. Liang, X. Meng,
Q. Li, Z. Zhu, M. Li, X. C. Le and Y. Shao, Anal. Chem., 2008, 80,
6323–6328.
7 J. Liu, S. Tian, P. E. Nielsen and W. Knoll, Chem Commun., 2005,
2969–2971.
8 K. J. Odenthal and J. J. Gooding, Analyst, 2007, 132, 603–610.
9 S. Shrestha, C. M. Y. Yeung, C. E. Mills, J. Lewington and
S. C. Tsang, Angew. Chem., Int. Ed., 2007, 119, 1–6.
10 J. Wang, D. Xu and R. Polsky, J. Am. Chem. Soc., 2002, 124, 4208–
4209.
11 G. Marrazza, I. Chianella and M. Mascini, Biosens. & Bioelectron.,
1999, 14, 43–51.
12 N. Zhu, A. Zhang, Q. Wang, P. He and Y. Fang, Anal. Chim Acta,
2004, 510, 163–168.
13 K. J. Feng, Y. H. Yang, Z. J. Wang, J. H. Jiang, G. L. Shen and
R. Q. Yu, Talanta, 2006, 70, 561–565.
1002 | Analyst, 2009, 134, 997–1002
14 Z. M. Liu, Y. L. Liu, G. L. Shen and R. Q. Yu, Anal. Lett., 2008, 41,
1083–1095.
15 X. Chen and S. Dong, Biosens. & Bioelectron., 2003, 18, 999–1004.
16 A. A. Ansari, A. Kaushik, P. R. Solanki and B. D. Malhotra,
Electrochem. Commun., 2008, 10, 1246–1249.
17 A. A. Ansari, P. R. Solanki and B. D. Malhotra, Appl. Phys. Lett.,
2008, 92, 263901–3.
18 E. Topoglidis, Y. Astuti, F. Duriaux, M. Gratzel and J. R. Durrant,
Langmuir, 2003, 19, 6894–6900.
19 A. Wei, X. W. Suna, J. X. Wang, Y. Lei, X. P. Cai, C. M. Li,
Z. L. Dong and W. Huang, Appl. Phys. Lett., 2006, 89, 123902–3.
20 R. Khan, A. Kaushik, P. R. Solanki, A. A. Ansari, M. K. Pandey and
B. D. Malhotra, Anal. Chim. Acta, 2008, 616, 207–213.
21 J. J. Schneider, R. C. Hoffmann, J. Engstler, O. Soffke,
W. Jaegermann, A. Issanin and A. Klyszcz, Adv. Mater., 2008, 20,
3383–3387.
22 L. Irimpan, V. P. N. Nampoori, P. Radhakrishnan, A. Deepthy and
B. Krishnan, J. Appl. Phys., 2007, 102, 063524–6.
23 X. Chen, Y. Wang, J. Zhou, W. Yan, X. Li and J.-J. Zhu, Anal.
Chem., 2008, 80, 2133–2140.
24 Q. Li, G. Luo, J. Feng, Q. Zhou, L. Zhang and Y. Zhu,
Electroanalysis, 2001, 13, 413–416.
25 J. C. Liao, M. Mastali, Y. Li, V. Gau, M. A. Suchard, J. Babbitt,
J. Gornbein, E. M. Landaw, E. R. B. McCabe, B. M. Churchill and
D. A. Haake, J. Molecular Diagnostics, 2007, 9, 158–168.
26 K. Kerman, D. Ozkan, P. Kara, B. Meric, J. J. Gooding and
M. Ozsoz, Anal. Chim. Acta, 2002, 462, 39–47.
27 A. Erdem, K. Kerman, B. Meric, U. S. Akarca and M. Ozsoz, Anal.
Chim. Acta, 2000, 422, 139–149.
28 Y. Liu, M. Zhong, G. Shan, Y. Li, B. Huang and G. Yang, J. Phys.
Chem. B, 2008, 112, 6484–6489.
This journal is ª The Royal Society of Chemistry 2009