Communication
Mol. Cells, Vol. 6, No.3, pp. 374-380
Development of a Reporter Gene: Expression of the Fused
lux Gene in Escherichia coli, Yeast and COS-7 Cells
Heon Man Lim
Department of Biology, College of Natural Sciences, Chungnam National University, Taejon
305-764, Korea
(Received on December 4, 1995)
To develop a useful reporter gene system that could be used to monitor promoter activity
not only in vitro but also in vivo, the fused structural genes of bacterial luciferase (luxA,
luxB) from a marine bacterium, Vibrio harveyi, was expressed in Eschericha coli, yeast,
and COS-7 cells. Furthermore, a 2.0 kb Hindill gene cassette of the lux was constructed
by introducing two HindIII sites flanking the open reading frame to facilitate future cloning of the lux gene. Escherichia coli cells harboring the lux gene cassette in a plasmid emitted light when the substrate decanal was supplied as vapor. The repression and induction
of the yeast promoter GALl was monitored with the lux gene cassette as a reporter gene
by measuring the amount of light from yeast cells taken from culture. This result opens
up the possibility of assaying a promoter without disrupting yeast cells. The fused lux gene
under the control of either the chicken ~-actin or the CMV promoter was expressed very
well in COS-7 cells. However, the expressed luciferase was only able to be assayed from
crude extracts of COS-7 cells.
Bioluminescence is a widespread phenomenon
among many different organisms living in the sea. It
also occurs in firefly and beetle species on land. Most
bioluminescence is based on the enzymatic activity of
a group of enzymes called luciferase. For molecular
biology, this activity of bioluminescence is particularly interesting, because it provides a simple way
to detect and follow gene expression. A marine bacterium, Vibrio harveyi, has the ability to emit lights.
This ability is based on the lux operon which is composed of five structural genes (A, B, C, D and E,
Engerbre~t and Silverman, 1984). The luciferase that
catalyzes the light-emitting reaction in V harveyi is a
heterodimeric enzyme that is composed of a (40 kDa,
product of luxA) and ~ (36 kDa , product of luxB) subunits. It uses FMNH2, fatty aldehyde and oxygen to
produce a green light (490 nm in wavelength; Cohn
el ai., 1985; Johnston et ai., 1986). The structural
genes of the luciferase (luxAB) have been used as a
reporter gene to study gene regulation in Bacillus subslilis, Escherichia coli (Karp, 1989; Lampinen et ai.,
1992; Peabody et ai., 1989; Schultz and Yarus, 1990)
and Clostridium perfringes (Phillips-Jones, 1993).
The luxAB have also been used to study promoter activity in plants (Koncz et ai., 1987; Legocki el al.,
1986).
Another type of luciferase is from the firefly Pholinus pyralis. The firefly luciferase uses ATP, oxygen,
and a substrate called luciferin and produces light of
560 nm in wavelength. The structural gene of firefly
luciferase (luc) has also been used as a reporter gene
in many different types of organisms (Brasier el ai.,
1989; David et ai. , 1986; de Wet et ai. , 1987; Williams el ai., 1989).
The substrates for the two luciferases (decanal fo r
the bacterial luciferase and luciferin for the firefly luciferase) have different membrane permeability. Fatty
aldehyde (decanal) is readily permeable to biological
membranes (Belas et ai., 1982; Baldwin et ai., 1984)
and luciferin is not (de Wet et ai., 1987). Therefore,
as a reporter gene, iuxAB has an advantage over luc
in that it can be assayed without disrupting the target
cell. Using luxAB as a reporter gene, Black et ai.
(1993) was able to observe directly from living cells
the spatial expression of a gene involved in heterocyte formation in cyanobacteria with the aid of a microscope equipped with a device that can detect photons. However, luxAB is composed of two separate
genes, and, therefore, it is not adequate to be used as
a reporter gene in eukaryotic cells, since eukaryotic
cells poorly translate prokaryotic multi-cistronic
mRNA. To overcome the problem, the intercistro nic
space between iuxA and luxB was engineered to produce a fused bacterial luciferase gene (lux) which can
encode a functional luciferase composed of one polypeptide (Boylan et ai. , 1989; Chlumsky , 1991; Escher et al., 1989; Kirchner el al., 1989).
In this study, one of the fused lux gene (Chlumsky,
1991, Fig. 1) was engineered to make a luciferase reThe abbreviations used are: FMN, flavin mononucleotide;
NADH, ~-nicotinamide-adenine dinucleotide.
CD 1996 The Korean Society for Molecul ar Biology
Heon Man Lim
Vol. 6 (1996)
375
Original Coding Sequence
S' -A TGCCA TA TCTCAAAGAAAAACAGTAd TIAATATTTTCT AAAAGGAAAGAGAC IATGAAATn'GGA TI ATIC-3'
luxA
-.
luxE
S'-A TGCCA T ATCTCAAAGAAAAACAGATCTI AAQT ATIQTITTAAAkAGGCTCGAGkATTCGAAATTIGGATI A-3'
New Amino Acid Sequence
..; Met Pro Tyr Leu Lys GIn IIe Ser IIe Val Leu Asn Arg Leu Glu His Ser Thr Lys Val Leu Val ....
~
Figure 1. Top, Nucleotide sequences corresponding to the end of the luxA and beginning of the luxB genes. The underlined
sequences show the possible ribosomal binding site for the luxB gene. Middle, Nucleotide sequences of the fused lux gene.
j
1
The bold characters represent those bases that are substituted. The underlined bases are those that are inserted . Bottom, New
~
amino acid seq uences of the fused luciferase. These newly inserted amino acids are shown in bold characters (Chlumsky,
...
1991).
porter gene cassette to facilitate cloning, and the gene
cassette was used to analyze induction and repression
of the yeast gal promoter in yeast without disrupting
cells. The gene cassette was also expressed in COS-?
cells with different eukaryotic promoters.
Materials and Methods
tagenic primer (5'-AATAAGGAAAGCTTATGAAATT-3') was used to generate the 5'-HindIII site and
the resulting plasmid was designated as pHL132.
Another primer (5'-CCACTCGTAAGCTTTAACTGAT-3') was used for making the 3 '-Hind III site (Fig.
2B) making a plasmid called pHL133. The fused lux
gene with the two HindIIl sites was constructed by replacing an EcoRI-BamHI DNA fragment of pHLl33
(5'-portion of the lux gene) with that of pHL132 containing the 5 '-Hind III site. The resulting plasmid was
designated as pHL134.
Cells, media and reagents
COS-7 cells were maintained in Dulbecco' s Modified Eagle Media (DMEM, Gibco-BRL) supplemented with 10% fetal calf serum, and 2 mM of
glutamine (Gibco-BRL). A yeast strain YPH274 (ura
3) was grown in YEPD medium (1 % yeast extract,
2% pepto ne, 2% dextrose) and the transformants
were selected in YNB medium (0.67 % yeast nitrogen
base, 2% dextrose). Dextrose in these media was replaced with either galactose or raffinose when needed.
E. coli strains were grown in LB medium. Ampicillin
was added to the LB medium in a final concentration
of 100 mg/ml when required. Purified bacterial luciferase, and decanal were purchased from Sigma. Flavin mononucl eotide (FMN), reduced ~-Nicotinamide­
aden ine dinucleotide (NADH), and NAD(P)H:FMN
ox idoreductase (FMN reductase) were purchased
from Boeheringer Mannheim.
Construction of other plasmids
To express the lux gene in COS-7 cells, the gene
cassette was placed under two different eukaryotic
promoters. To clone the lux gene under control of the
chicken ~-actin promoter, the HindIII gene cassette
isolated from pHL134 was cloned in the HindIII site
of pAGS-3 (Miyazaki et ai. , 1989) making pHL135
(Fig. 2c). In pHL136 the cassette was cloned in the
HindIII site of pcDNAI (Invitrogen) placing the lux
gene under the CMV promoter. The yeast expression
vector of the lux gene (PHLl38) was constructed by
cloning the gene cassette into the HindIII site of
pSEYC68 (Emr et ai., 1986) installing the lux gene
under the promoter GALl (Fig. 2C).
Making the fused lux gene HindII! cassette
The fused lux gene originally cloned in pAB5
(Ch lumsky, 1991, Fig. 2A) was isolated as a 2.5 kb
SalI-Smal DNA fragment and cloned in SalI-SmaI
sites of pBluescript SK+ (Stratagene) generating pHL
122. Uracil-containing single-stranded DNA of pHL
122 was prepared from the E. coli strain CJ236
(Kunkel, 1985) by using the helper phage M13K07
(Viera and Messing, 1987). The single-stranded DNA
of pHL122 was used as a DNA templ ate for in vitro
mutagenesis as described in Kunkel (1985). A mu-
Transformation of COS-7 and yeast cells
Plasmid DNA was introduced to COS-7 cells by
electroporation. Before transformation, plasmid DNAs
were isolated by CsCI-ultracentrifugation and the prepared DNAs were checked by agarose gel electrophoresis to ensure that more than 90% of DNA
was supercoiled. DNA concentration was adjusted to
1 ).l.g/).l.l. COS-7 cells grown to a sub-confluent density on 10 em petridish were detached by EDTA treatment (2 mM EDTA in PBS buffer) and pelleted by
centrifugation (3,000 x g for 5 min). Cells from 7
Expression of the Fused lux Gene
376
Mol. Cells
Fused lux gene
B
I
Start
Stopl
5'-CAAATAAGGAAATGTIATG--------ACCACTCGTAACGTIT AACT-3'
A
Site-directed
mutagenesis
AAGCTI
AAGCTI
t
pABS
Fused lux gene
HindIII digestion
5.60 Kb
C;L____~lux~g~e~ne~H~in~d~Ir=r~c~as~s~et~te~_____L,..J
Sail
HindIII
c
p-actin promoter
lux gene cassette
SV40 polyA signal
pHL135
CMV promoter
lux gene cassette
SV40 polyA signal
pm.,136
gall 0 promotc:<r gall promoter
pm., 138
lux gene cassette
URA3
Figure 2. A) The plasmid map of pAB5 showing some of restriction enzyme sites. The fused lux gene was originally cloned in this plasmid. B) A schematic representation of constructing the HindIII lux gene cassette. The underlined sequences
were changed to generate HindIII sites by site directed mutagenesis. C) Various plasmids used to express the fused lux gene
in yeast (pHL138) and COS-7 cells (pHL135 and pHL136). The lux gene is under the control of the chicken p-actin promoter (pHL135), and of the CMV promoter (PHL136). In pHL138, the GALl promoter drives the transcription of the lux
gene.
dishes were resuspended in 1.75 ml of DMEM containing 20% fetal calf serum. For electroporation, 20
Ilg of plasmid DNA was added to 250 III of the cell
6
solution (containing about 10 cells) in a 2 mm electroporation cuvette, and the cuvette was left in ice for
10 min. Electroporation was performed with 300 V
and 25 IlFD using a Gene Pulser (BIO-RAD). The cuvette was kept on ice for 10 min and cells were plated out on a 10 em petridish containing 15 ml of
DMEM with 20% fetal calf serum.
Yeast YPH274 (ura3) was made competent by the
lithium acetate method (Ito et ai., 1983) and 2 Ilg of
plasmid DNA (PHL138) was used for transformation .
Transformed cells were plated on a solid medium of
YNB, and incubated at 25 °C for 48 h.
Luciferase assay and Western blot analysis
For in vivo luciferase assay from COS-7 cells, cells
were detached from the petridish 24 h after electroporation, washed (3,000 x g for 5 min) twice in
PBS buffer, and resuspended in 50 III of phosphate
buffer (50 mM of potassium phosphate pH 7.0,
1 mM of dithiothreitol). To 1 ml of the lux buffer (50
mM of potassium phosphate pH 7.0, 50 mM of ~­
6
mercaptoethanol) in a luminometer cuvette, 10 cells
(about 10 Ill) were added, and the cuvette was placed
in the luminometer. The reaction began with the injection of 100 III of 0.2% decanal (in lux buffer).
Light emitted from the reaction was integrated for
7
30 s. To assay the luciferase expressed in yeast, 10
cells harboring pHL138 grown in YEPGal (dextrose
in YEPD was replaced with galactose) were taken
directly from the culture and placed in a luminometer
cuvette. One hundred III of 0.2% decanal was injected to initiate the reaction and emitted light was integrated for 10 s.
For in vitro luciferase assay, COS-7 cells
resuspended in 50 III of the lux buffer (see above)
were lysed by the repeated (3 times) thaw-and-freeze
method (37°C and dry ice), and centrifuged at 12,000
x g for 5 min. The resulting supernatant was transferred to a new microfuge tube for enzyme assay. A
typical luciferase assay reaction mixture in 500 III
volume was set up in a luminometer cuvette. The fo l-
Vol. 6 (1996)
Heon Man Lim
lowing ingredients, 10 )1.1 of the extract, 1 )1.1 of 10
mM NADH, 1 )1.1 of 100 mM FMN, 1 )1.1 FMN reductase (0.02 U) were added sequentially to 400 )1.1 of
the lux buffer, and the reaction was initiated by injecting 100 )1.1 of 0.2% decanal. Lights from the reaction were integrated for 30 s.
For Western blot analysis, COS-7 cell extracts
(containing 150 )1.g of proteins) prepared as above
were boiled with the same volume of the sample loading buffer (Sambrook et aI., 1989) for 3 min, and
loaded on 12% SDS-polyacrylamide gel. Proteins
separated were blotted onto a nitrocellulose membrane using a Semi-Phore transfer unit (Hoefer Scientific Instruments). The membrane was developed as
suggested by Sambrook et al. (1989) using a polyclonal antibody raised against the fused bacterial luciferase.
Results
Making the lux gene cassette
The lux gene was originally cloned as a 2.8 kb HindIII-BglII DNA fragment in a pUC9 derived plasmid
pAB5 (Fig. 2A). Colonies of an E. coli strain MC
1061 harboring pAB5 emitted a green light in a dark
room when the substrate was supplied as vapor from
a drop (about 2 )1.1) of decanal placed on the lid of
the petridish. To facilitate future cloning works of
placing the lux gene under various promoters, and to
remove the 5'-untranslated region of the gene, a gene
cassette containing only the open reading frame was
made by introducing two HindIII sites that flank the
lux gene using a site-directed mutagenesis method
(Kunkel, 1985). For the site-directed mutagenesis, the
fused lux gene was isolated as a 2.0 kb SmaI-SaII
DNA fragment from pAB5 and cloned to pBluescript
digested with Sma I and San generating a plasmid
designated as pHL122. Using pHL122, one HindIII
site was constructed right in front of the start codon
ATG, and the other site, which includes the second
and third bases of the stop codon (TAA) , was placed
at the 3'-end of the gene (Fig. 2B). This gene cassette
as a 2.0 kb HindIII DNA fragment was cloned in the
HindIII site of pUC9 (placing the gene cassette under
control of the promoter lacZ). Bioluminescence was
observed (by the naked eye) from colonies of MC
1061 harboring the resulting plasmid, confirming that
the constructed gene cassette makes the functionally
competent luciferase (data not shown).
Expression of the lux gene cassette in yeast
The 2.0 kb HindIII gene cassette was cloned in the
HindIII site of a yeast-E. coli shuttle vector pSEYC
68, which has the marker gene URA3. This plasmid
exists as a single copy in yeast due to the centromere
genes (CEN4, ARSl). This cloning placed the gene
cassette under the control of the yeast promoter GALl,
and the resulting plasmid was called pHL138 (Fig.
2c). A yeast strain YPH274 (ura) was transformed
377
with pHL138 and the transforrnants were grown in
both liquid and solid medium containing 2% galactose. Unlike in E. coli, bioluminescence from single
colonies of YPH274/pHL138 grown on a solid galactose medium were not detected by the naked eye.
However, when bioluminescence was measured direct7
ly from 10 yeast cells grown in a liquid galactose
medium, it gave 35,000 counts/10 s suggesting that
the lux gene is expressed and fully functional in yeast.
As a control, the same number of YPH274 cells
(without the lux gene) gave about 60 counts/10 s.
These results suggest a possibility that, without disrupting cells, the lux gene could be employed to assay a promoter activity in yeast. The reason why the
yeast cells gave less light than E. coli cells (not
enough light to be seen by the naked eye from yeast
colonies) could be that there is a lesser amount of
free FMNH2 in the cytosol of yeast cells than in that
of E. coli cells.
Analysis of induction and repression of the GALl
promoter by bioluminescence
To test fulther the possibility of using the lux gene
cassette as a more convenient reporter gene than the
frequently used reporter genes (luc, cat, lacZ), induction and repression of the GALl promoter by
which the lux gene is controlled was analyzed. Thus,
in this experiment, the promoter activity was measured by the amount of light emitted from 0.5 ml of cells
growing in liquid culture, eliminating the time-consuming and laborious procedures required to assay the
conventional reporter genes such as cat and lacZ.
Transcription from GALl promoter can be induced
by galactose (Hopper et al., 1978; St. John and Davis,
1981) and repressed by glucose (Adams, 1972; Matsumoto et aI., 1981). Therefore, to see induction,
YPH274 harboring pHL138 (YPH274/pHL138) was
grown in YEPR liquid medium containing 2% raffinose instead of dextrose where the GALl promoter
is repressed. When the culture reached an A 600
(optical density measured with 600 nm in wavelength)
of 1.0, galactose (final concentration of 2%) was added to observe induction. To detect repression YPH
274/pHL138 was grown in YEPG (YEPD with 2%
galactose instead of dextrose), and when an A 600 of
the culture reached 1.0, glucose was added in a final
concentration of 2%. Bioluminescence and optical
density were measured directly from 0.5 ml of growing cells every hour. The amount of light (counts) accumulated in 10 s was taken and adjusted to that of
7
10 cells. This adjusted value was plotted against
time. As shown in Figure 3A, without addition of
either galactose or glucose, cells maintained a certain
amount of bioluminescence. However, it started to increase right after the addition of galactose, and it began to decrease when glucose was added, clearly demonstrating induction and repression of the GALl
promoter. Actual cell growth (in the raffinose medium) during the experiment is shown in Figure 3B.
Expression of the Fused lux Gene
378
Mol. Cells
A
100000
B
~---------------------------------------.
-....
10
E
c
10000
0
0
2% glucose
to
>-
1000
III
C
o
....
......
....'"s::
;
U
(1)
"0
«l
100
(.)
....a.
0
10
L-~~
-5
__
~~
__
~~
__
~~
__
~-L
o t ime (hou r)
__
~~~
__
~~
.1
10
5
-5
0
10
5
time (h ou r )
Figure 3. A) Induction (triangle) and repression (rectangle) of the yeast GALl promoter analyzed by light emitted from 0.5
ml of growing yeast cells harboring the lux gene. For induction, cells were grown in a medium containing 2% raffinose, and
2% galactose was added at time zero (arrow). For repression, 2% glucose was added to the cells grown in a medium containing 2% galactose at time zero (arrow). B) This graph represents the actual growth of YPH274 (ura) harboring pHL138
during the experiment shown in A.
Expression of the lux gene cassette in COS-7 cells
To express the bacterial lux gene in mammalian
cells, a gene cassette was cloned under the control of
the chicken ~-actin (Miyzaki et at., 1989) and CMV
promoters (Fig. 2C), and the resulting plasmids (PHL
136 for CMV promoter, and pHL135 for ~-actin promoter) were introduced to COS-7 cells by electroporation. The chicken ~-actin promoter was shown
to express a higher level of transcription than the
CMV promoter in different cell types (Miazaki et at.,
1989). Twenty four hours after electroporation, cells
attached to the bottom of the petridish were collected
and the level of expression was measured by Western
blot analysis. The result (Fig. 4) showed that in COS7 cells (Janes 5 and 6), the fused luciferase is expressed with the same molecular weight of the one
that is expressed in E. coli (lane 3), whereas the purified bacterial luciferase from V. harveyi (Jane 2)
showed a and ~ subunits with a molecular weight of
40 and 36 kDa, respectively. However, COS-7 cells
harboring pHL137 (lux under ~-actin promoter) produced more amount of the fused luciferase than COS7 cells with pHL136 (lux under CMV promoter), suggesting that the ~-actin promoter was expressed better
than the CMV promoter in COS-7 cells.
Measurement of bioluminescence from COS-7 cells
First, bioluminescence from intact COS cells harboring the plasm ids was measured by the following
experiment. Twenty four hours after electroporation,
cells attached were harvested and resuspended in a
phosphate buffer (see Materials and Methods), and
1
l06k
~
80k
~
2
3
4
5
.
6
7
~ fu sed
.,...,.
LUX
protein
49 .5k.~
.--
.....
32.~
Figure 4. Western blot analysis of the fused bacterial luciferase. Lane 1, molecular weight marker (Low range prestained SDS-PAGE standards from Bio-Rad); lane 2, purified luciferase from V. harveyi (0.5 Ilg); lane 3, the fused
luciferase (LUX) expressed in E. coli; lane 4, LUX expressed in yeast with pHL138; lane 5, LUX expressed in
COS-7 cells harboring pHL135; lane 6, LUX expressed in
COS-7 cells containing pHL136; lane 7, crude extract of
COS-7 cells harboring pBluescript. Though 360 Ilg of total
yeast protein was loaded on lane 4, the LUX band was too
faint to be seen. The reason why the LUX band was too
faint could be, I believe, that the lux gene exists as a single
copy in yeast. In lanes 5, 6, and 7, 150 Ilg of protein was
loaded.
6
the cell number was counted . To 10 cells, decanal
was added and emitting lights were counted by a luminometer. Unlike.in yeast, the level of lights from
cells with the lux gene were almost the same as that
from cells without the lux gene (200 counts in 30 s)
suggesting either that the expressed bacterial luciferase became inactive or that the internal con-
Vol. 6 (1996)
COS·7 cells
5
aclin . lux
4
CMY·lux
3
pBlusc ript
2
SV2cat
1
100
Heon Man Lim
1000
10000
100000
Counts/ lO ce lls/30 sec
Figure 5. In vitro assay of the fused luciferase expressed
in COS-7 cells. Crude extracts prepared from COS-7 cells
harboring various plasmids were assayed for luciferase activity (see Materials and Methods). Lane 1, pSVcat
(Cornelia et aL, 1982); lane 2, pBluescript; lane 3, pHL
136; lane 4, pHL135; lane 5, no plasmid. Note that the xaxis is shown in a log scale.
centration of FMNH2 was too low to support the lightemitting reaction of the luciferase. Thus, cells were
lysed (by repeated freeze and thaw) and the luciferase
in cell extracts was assayed by supplying FMNH2
which was generated by the reduction of FMN by
NAD(P):FMN oxidoreductase (see Materials and
6
Methods). Crude extracts made fro m 10 COS-7 cells
with pHL135 (actin-lux) generated 93,000 counts and
that with pHL13 6 (CMV-lux) showed 45,000 counts
in 30 s (crude extracts obtained from cells without
the lux gene showed around 200 counts in 30 s, Fig.
5). These results are consistent w ith the amount of luciferase protein detected by Western blot analysis
(Fig. 4). These results also demonstrate that the fused
bacterial luciferase is active when expressed in COS-7
cells and that, unlike in yeast, to assay the luciferase
expressed, cells must be lysed. I also tri ed adding
FMNH2 to intact cells with the substrate decanal, but
the results were negative.
Discussion
Many reporter genes such as lacZ, cat, and luc that·
could be used to analyze promoter activity have been
developed. In most cases, assaying th ese genes requires preparation of cell extracts or cell membranes
permeable to the substrates, which inevitably destroy
cells. Therefore, it is not possible to assay the reporter genes form live cells in real tim e. In this
respect, the bacterial luciferase from V harveyi beco mes usefu l, due to the fact that decanal, a substrate
of the enzyme, is readily permeable to cell membranes (Baldwin et al. , 1984).
The fused bacterial luciferase gene (lux) from V
harveyi was expressed in E. coli, yeast, and COS-7
cells, and the expressed luciferase was active in all
three differe nt cell types. Most importantly, the lu-
379
ciferase expressed in yeast was able to be assayed
directly from live cells without disrupting them.
However, in COS-7 cells, luciferase activity was not
detected from live cells, probably due to the low concentration of free FMNH2. It is likely that, in mammalian cells, the FMNH2 that is involved in the electron transport system is localized in mitochondria.
Thus, I tried to fuse the yeast mitochondrial signal sequence of the FI-ATPase ~ subunit (Bedwell et al. ,
1989) to the N-terminal end of the luciferase to lead
the translated luciferase to mitochondria. But the signal sequence-luciferase fusion protein was not active
(H. M . Lim unpublished data). Our data also suggests
that the chicken ~-actin promoter can drive transcription more actively than the CMV promoter (Fig. 5).
With the aid of the cooled charge-coupled device
(CCD) camera attached to a microscope, one can actually observe bioluminescence from cells expressing
bacterial luciferase. Recently, using the luxAB gene,
the expression and regulation of the hetR gene of Anabaena (cyanobacteria) was observed in real time during development of heterocyte formation (Black et al.,
1993), and the circadian clock mutants of cyanobacteria were screened (Kondo et aL, 1994). Though
these works were done in prokaryotic cyanobacteria,
it is possible to observe gene expression and regulation in yeast with the fu sed lux gene along with a
CCD camera.
Acknowledgments
The author would like to thank Dr. Jin Mi Kim for
her thorough review of the manuscript
This work was supported by Korea Science and Engineering Foundation grant #941-0500-015-2 to Heon
M. Lim.
References
Adams, B. (1972) 1. Bacterial. 111,308-313.
Baldwin, T. 0., Berends,T., Bunch, T. D., Holzman, T. F.,
Rausch, S. K., Shamasky, L , Treat, M. L, and Ziegler,
M. M. (1984) Biochemistry 23, 3663-3667.
Bedwell, D. M., Strobel, S. A. , Yun, K. , 10ngeward , G. D .,
and Emr, S. D. (1989) Mol. Cell. BioI. 9, 1014-1025.
Belas, R., Mileham, A., Cohn, D., Hilmen, M., Simon, M.,
and Silverman, M. (1982) Science 218,791 -793.
Black, T. A. , Cai, Y., and Wolk, C. P. (1993) Mol. Microbia!. 9, 77-84.
Boylan, M., Pelletier, 1., and Meighen, E. A. (1989) I . Bio!.
Chern. 264, 1915-1918.
Braiser, A. R., Tate, 1. E., and Habencr, 1. F. (1989)
Biotechniques 7, 1116-1122.
Chlumsky, 1. L (1991) Ph. D. Thesis, Texas A & M University, Texas, USA.
Co hn, D. I-L, Mileham, A. 1., Simon M. I. , Nealson, K. J-L ,
Rausch, S. K., Bonam, D., and Baldwin, T. O. (1985) i .
Bio!. Chem. 260, 6139-6146.
David, W., Wood, K. V., DeLuca, M., de Wet, 1. R., Helinski, D. R., and Howell, S. H. (1986) Science 234, 856-
380
Expression of the Fused lux Gene
859.
de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R.,
and Subramani, S. (1987) Mol. Cell. BioI. 7, 725-737.
Emr, S. D., Vassarotti, A., Garrett, J., Geller, B. L., Taketa,
M. , and Douglas, M. G. (1986) 1. Cell BioI. 102, 523533.
Engerbrecht, J., and Silverman, M. (1984) Proc. Natl. A cad.
Sci. USA 81, 4154-4158.
Escher, A., O'Kane, D. J., Lee, J., and Szalay, A. A. (1989)
Proc. Natl. Acad. Sci. USA 86, 6528-6532.
Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982)
Mol. Cell. BioI. 2, 1044-1051.
Hopper, J., Broach, J., and Rowe, L. (1978) Proc. Natl.
Acad. Sci. USA 75, 2878-2882.
Ito, H., Fukuda, Y., and Kimura, A. (1983) 1. Bacterial.
153, 163-168.
St. John, T ., and Davis, R. (1981) 1. Mol. BioI. 152, 285315.
Johnston, T. c., Thompson, R. B., and Baldwin, T. O.
(1986) 1. BioI. Chem. 261, 4805-4811.
Karp, M. (1989) Biochim. Biophys. Acta 1007, 84-89.
Kirchner, G., Roberts, 1. R., Gustafson , G. D., and Ingolia,
T. D. (1989) Gene 81, 349-354.
Koncz, c., Olsson, 0 ., Langridge, W. H. R., Schell, J., and
Szalay, A. A. (1987) Proc. Natl. A cad. Sci. USA 84, 131135.
Mol. Cells
Kondo, T., Tsinoremas, N. F., Golden, S. S., Johnson, C.
H. , and Kutsuna, S. (1994) Science 266, 1233-1236.
Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. USA 82, 488492.
Lampinen, J., Koivisto, L., Wahlsten, M., Mantsala, P., and
Karp, M. (1992) Mol. Gen. Genet. 231, 499-504.
Legocki, R. P., Legocki, M., Baldwin, T. 0., and Szalay,
A. A. (1986) Proc. Natl. Acad. Sci. USA 83, 9080-9084.
Matsumoto, K., Toh-e, A., and Oshima, Y. (1981) Mol.
Cell. Bioi. 1, 83-93.
Miyazaki, 1.-1., Takaki, S., Araki, K., Tashiro, F., Tominaga, A., Takatsu, K., and Yamamura, K.-1. (1989)
Gene 79, 269-277.
Peabody, D. S., Andrews, C. L., Escudero, K. W., Devine,
J. H., Baldwin, T. 0 ., and Bear, D. G. (1989) Genes 75,
289-296
Phillips-Jones, M. K. (1993) FEMS Microbial. Lett. 106,
265-270.
Sambrook, 1. Fritisch, E. F., and Maniatis, T. (1989) Molecular Cloning, 2nd Ed, Cold Spring Harbor, New York.
Schultz, D. W., and Yarns, M. (1990) 1. Bacterial. 172,
595-602.
Williams, T. M., Burlein, J. E., Ogden, S., Kricka, L. 1.,
ans Kant, J. A. (1989) Anal. Biochem. 176, 28-32.
Viera, J., and Messing, J. (1987) Methods Enzymol. 153, 311.