MODELING THE
STRUCTURE OF DNA
Discuss with your table partner:
Review the components of a DNA nucleotide. Determine
what the initials stand for each of the three parts of the
four nucleotide model pieces.
DS ______________________________
P ________________________________
NB ______________________________
4 Types of NB
A ______________________________
T ______________________________
C ______________________________
G ______________________________
Each group of four will make a model for a six nucleotide
sequence of a gene.
Review the sequence of the gene your group has been
assigned and determine which nucleotides you will need
to cut out. It will be a total of 12 nucleotides for your
group because the DNA molecule is a double strand of
nucleotides.
Remember that :
A pairs with _______
C pairs with _______
Below is a portion of the nucleotide sequence for the
hemoglobin A gene.
TACCACGACAGAGGACGGCTGTTCTGGTTGGCAGTTCCGCGG
ACCCCGTTCCA
Group 1: TACCAC
Group 2: GACAGA
Group 3: GGACGG
Group 4: CTGTTC
Group 5: TGGTTG
Group 6: GCAGTT
Group 7: CCGGCG
Group 8: GACCCC
Group 9: GTTCCA
Determine how the nucleotides fit together in
the DNA molecule and attach them together.
o Have all the letters face-up on all the
nucleotides (strands will be antiparallel with
lettering upside-down for one strand)
o Use clear tape to attach the DS to P
o Use removable stickers to attach the
complementary NB’s together. Place stickers
on the X’s.
Describe what part(s) of the nucleotide
forms the backbone (2 sides)
of the molecule. _______________________
_____________________________________
_____________________________________
Describe what part(s) of the nucleotide
forms the rungs across the DNA molecule.
_____________________________________
_____________________________________
Why are these described as complementary
base pairs. ___________________________
_____________________________________
Explain how one strand of DNA could be used as a
template to construct a new strand of DNA.
_____________________________________________
_____________________________________________
_____________________________________________
Bond between sugar and phosphate
Which type of bond is found between the
sugar and phosphate group- covalent or
hydrogen?
____________________
Is it a stronger or weaker bond? (Why is it
represented with a solid line in the diagram
and represented with scotch tape in our
model)?
_____________________________
Bond between nitrogen pairs
Which type of bond is found between
nitrogen base pairs- covalent or hydrogen?
_________________________________
Is it a stronger or weaker bond? (Why is it
represented with a dotted line in the
diagram and removable tape in our model
______________________________
Discuss with your table partner:
The type of bonding between the nitrogen base pairs can
allow the two strands to be separated.
Predict two processes in the cell that involve the DNA
strands being separated, but require that the genetic
sequence remains intact.
__________________________
__________________________
Hints:
o All cells in an organism have identical sets of its
chromosomes. What must occur as an organism
produces more cells?
o What is the function of each gene?