Nucleic Acids Research, Vol. 19, No. 12 3403
© 1991 Oxford University Press
pXZd39: a new type of cDNA expression vector for low
background, high efficiency directional cloning
Andrew J.M.Murphy and Robert T.Schimke
Department of Biological Sciences, Stanford University, Stanford, CA 94305, USA
Received January 28, 1991; Revised and Accepted May 10, 1991
ABSTRACT
We have developed a new type of bacteriophage X
vector which provides a strong biological selection
against non-recomblnants that is independent of the
sequences immediately surrounding the cloning site.
This system, which we call 'selective substitution', is
ideally suited for cDNA expression vectors where it is
necessary to flank the cDNA insert with sequence
elements (promoters etc.) required to produce a
biologically active mRNA in vivo. Selective substitution
is a general method, which may be applied to many
types of vectors. In this report, we have specifically
applied selective substitution to the construction of a
new mammalian retrovirus expression vector. The level
of background obtained with this vector (that is, the
number of plaques obtained when the vector is llgated
in the absence of insert DNA) is 0.02% when compared
to ligation with restriction fragments and 0.1% to 0.4%
when compared to ligation with newly synthesized
cDNA. These features have allowed us to easily and
efficiently generate several large cDNA libraries using
total and size selected cDNA.
INTRODUCTION
Due to the large size of the mammalian genome and the broken
intron/exon structure of most mammalian genes, cDNA cloning
is usually an important step in the elucidation of the structure
and function of mammalian genes. While cDNA cloning
techniques had existed for some time (ref. 1, for example), the
introduction of the cloning vector XgtlO (2) was a major technical
advance owing to that vector's high efficiency, ease of use and
inherent low background. Aside from the greater efficiencies and
ease of storage of X over plasmid vectors, the unique advantages
of XgtlO stem from the use of a single EcoRI cloning site within
the cl repressor gene of its bacteriophage genome. Cloning into
this site inactivates the repressor gene allowing recombinants to
form plaques on a special E. colt strain in which nonrecombinants will not grow. This biological selection greatly
reduces background while it alleviates the necessity for efficiencyreducing phosphatase treatment of the vector. Unfortunately, the
XgtlO method of selection against non-recombinants by insertional
inactivation is not conducive to the construction of expression
vectors, since the interrupted cl gene sequences are left flanking
the insert instead of the desired promoter and polyadenylation,
or terminator sequences.
Thus, we have constructed a new X vector which uses 'selective
substitution' instead of insertional innactivation as a mechanism
to achieve a biological selection against non-recombinants. The
system allows large cDNA libraries to be easily constructed in
expression vectors with very low backgrounds. The system also
allows directional cloning of cDNA, effectively doubling the
number of expressible clones compared to non-directional
libraries. Low backgrounds and directional cloning are especially
important for expression cloning of rare cDNAs in mammalian
systems where the efficiency of transfection into the cultured cells
is the limiting step. Extremely low backgrounds are also important
in cases where the cDNA to be cloned may be of poor quality
or of low amounts and uncertain quantity, like after extensive
size selection.
MATERIALS AND METHODS
Genera] cloning methods
Packaging extracts. Packaging extracts were prepared from
BHB2688 and BHB2690 by the modified method of Barbara
Hohn as described (3) except that putrescine was omitted. Phage
were plated on the E. coli strain K802.
Legations in the presence of PEG. Ligation reactions to produce
X vectors and libraries were performed in the presence of 15%
PEG (4) for 1 hour at room temperature at DNA concentrations
of 5 to 15 ng/ml. Ligation products were pelleted by
microcentrifugation for 5 minutes, decanted, carefully
resuspended in a small volume of TE (10 mM TrisCl pH 7.5,
1 mM EDTA) and allowed to sit at room temperature for 20
minutes before in vitro packaging. Some small-scale control
ligations were not pelleted after the 1 hour ligation reaction.
Instead, in these cases, ATP was added to the reaction to a final
concentration of 5 mM and after 20 minutes at room temperature,
a portion of the reaction was added directly to the packaging
extracts. All ligations were performed with approximately
equimolar X vector and insert DNAs.
Plasmid preps. Plasmids were prepared by the LiCl/PEG
procedure (5) essentially as described (6). In addition, pXZd39
to be used as cDNA cloning vector was banded once on CsCl.
Potassium acetate gradients. For purification of arms and size
fractionation of cDNA 5-20% potassium acetate gradients (3,
7) containing 50 mM Tris pH 8, 10 mM EDTA were formed
3404 Nucleic Acids Research, Vol. 19, No. 12
in SW41 tubes. Centrifiigation was at 20° with the speed and
times given below for each experiment. The potassium acetate
solutions were filtered through 0.45 /t filters before use.
Linear polyacrylamide carrier. Linear polyacrylamide carrier was
prepared as follows. A 15 ml solution was prepared containing
5% polyacrylamide (no bis), 0.3 M sodium acetate pH7,
approximately 50 mg of bromophenyl blue, approximately 50
mg of ammonium persulfate and 100 /tl of TEMED. The solution
was incubated at 65 ° for 30 minutes to allow the acrylamide to
polymerize. The solution became viscous but not solid. After
cooling to room temperature, the linear polyacrylamide was
precipitated by the addition of 30 ml of ethanol. The carrier was
pelleted, resuspended and reprecipitated until the ethanol
supernantant was no longer blue. The final pellet was dried and
resuspended in 15 ml of water. The resultant solution is 5% or
50 mg/ml of linear polyacrylamide carrier. The bromophenyl
blue may act as a chain terminator of acrylamide polymerization
as the longer size fractions (as assayed by sepharose 4B
chromatography) are less blue than the shorter ones.
Construction of p\Zd39
See RESULTS AND DISCUSSION for the rationale behind the
following manipulations.
XZd35B. \Zd35 (8) DNA was ligated to protect the cohesive
ends, digested with BamHI and end-filled using the Klenow
fragment of E. coli pol I. The blunt-ended fragments were then
religated in the presence of PEG and in vitro packaged. The
resultant plaque purified phage, which was identical to \Zd35
except that it lacked both BamHI sites, was digested with Xbal
(one site in each LTR). The gel-purified arms were ligated to
Xbal digested rpZd5 (8) and packaged in vitro. The derivative
having a structure identical to \Zd35, except that it contained
a single BamHI site, was named XZd35B.
rpZd7 and rpZd8. rpZd5 was digested with Kpnl (a single site
in the LTR) and EcoRI and the gel-isolated large fragment was
ligated to a 984 bp Kpnl to EcoRI fragment derived from pLNL6
(9). The EcoRI site was eliminated from the resultant plasmid
(rpZd6) by digesting, end-filling and religating to generate
rpZd6ARI. This plasmid was then digested with BamHI,
phosphatase treated and ligated to the tri-initiator oligonucleotide
duplex (8). The plasmid with the tri-initiator in the productive
orientation was designated rpZd7 while the plasmid containing
the tri-initiator in the opposite orientation was called rpZd8.
\Zd37. After \Zd35B DNA was digested with Xbal, the gelisolated arms were ligated to Xbal-linearized rpZd7 and in vitro
packaged to generate XZd37. This X vector is similar to \Zd35
except that it contains the extended retroviral packaging site from
pLNL6 and a unique BamHI cloning site next to the EcoRI
cloning site.
p\Zd39. \Zd37 DNA digested with BamHI and EcoRI was
ligated to the approximately 1.7 kb BamHI to EcoRI fragment
derived from pEA305 (10) which contains the lambda repressor
gene under the control of the tac promoter. The ligation products
were packaged in vitro and used to infect the lacF* strain DH21
(11). The infected cells were allowed to express antibiotic
resistance after phage absorbtion by adding 1 ml of broth and
incubating at 37° for 1 hour. The cells were then spread onto
plates containing 75 /ig/ml ampicillin, 50 /tg/ml kanamycin and
20 mM Sodium Citrate. A colony was picked and found to
contain a plasmid with the structure of p\Zd39 which was
subsequently purified away from contaminating \Zd37 by calcium
chloride transformation of DH21.
Preparation of vector for cloning
A culture of p\Zd39 in DH21 was grown in media containing
75 /ig/ml ampicillin, 50 /ig/ml kanamycin and 20 mM Sodium
Citrate. Plasmid was purified and 50 /tg was digested with BamHI
and EcoRI. After phenol extraction, half of the reaction mixture
was layered onto each of two potassium acetate gradients and
centrifuged at 27,000 rpm for 15 hr. The vector pellets under
these conditions while the X repressor containing sniffer fragment
and any contaminating chromosomal fragments remain in the
body of the gradient. The tubes were decanted by inversion and
the excess liquid wiped off with a paper towel. The pelleted vector
was then resuspended in TE and ethanol precipitated to remove
traces of salt.
cDNA synthesis
First strand synthesis. First strand cDNA synthesis was
performed in a 100 /tl reaction containing the buffer supplied
by the manufacturer (BRL), 7 /tg of poly A + RNA isolated from
mouse A9 cells, 5 /tg oligo dT]2_i8 (Pharmacia), 500 /tM each
of the four dNTPs (Pharmacia), 16 /iCi of 32P dCTP (3000
Ci/mmole, Amersham) and 1600 units of Moloney reverse
transcriptase (BRL). After 1 hour at 37°C the reaction was
terminated by the addition of EDTA to 25 mM and phenol
extraction. Unincorporated nucleotides and oligo dT were
removed by chromatography over a 5 ml G100 (Pharmacia)
column pre-equilibrated in TE plus 300 mM sodium Acetate.
First strand yield was determined by counting aliquots of the
reaction before and after G100 chromatography.
Tailing. After ethanol precipitation, the first strand cDNA was
tailed in a 100 /il reaction containing the cDNA, 50 mM
potassium cacodylate pH 7.2, 1 mM CoCl2, 0.1 mM DTT,
0.12mMdGTP and 125 units of terminal transferase
(Boehringer) at 37° for 15 minutes. The reaction was terminated
by the addition of 5 /d of 0.5 M EDTA, phenol extracted, ethanol
precipitated and resuspended in 25 /tl of TE.
Second strand synthesis. The G-tailed first strand cDNA was
combined with 2 /tl of oligo dC12_ig (2 /tg//tl, Pharmacia) and
10 /tl of lOXnick salts (200 mM Tris pH 7.5, 100 mM
(NH^SO^ 1 M KC1) and annealed at 45° for 10 minutes and
37° for 10 minutes and then placed on ice. The reaction was
adjusted to 100 /tl final volume containing 4 mM MgCl2, 150
/tM /3-NAD, 200 /tM each dNTPs, 32 /tCi of 32P dCTP, 5 units
of RNAse H (Boehringer), 5 units of E. coli DNA ligase (New
England Biolabs) and 20 units of E. coli DNA polymerase I (New
England Biolabs) and incubated at 15° for 1 hour and 22° for
1 hour. The reaction was terminated, the double stranded cDNA
chromatagraphed on G100 and the yield determined as for the
first strand.
Methylation and linker addition. The double stranded cDNA was
methylated in a 100 /tl reaction containing 10 mM Tris pH 7.5,
50 mM NaCl, 1 mM EDTA, 0.1 mM DTT, 80 /tM S-adenosyl
methionine, 32 units of BamHI methylase (New England Biolabs)
and 40 units of EcoRI methylase (New England Biolabs). After
phenol extraction and ethanol precipitation, the methylated cDNA
Nucleic Acids Research, Vol. 19, No. 12 3405
was ligated to 3 /tg of phosphorylated R5 linker (sequence =
AATTCGGATCCGAATT) using T4 DNA ligase overnight at
15°. The next day the ligation reaction was heat inactivated at
65° for 20 minutes and digested with 750 units of BamHI and
50 units of EcoRI. This reaction was then terminated with EDTA
and phenol extraction. Vector-ready cDNA was generated after
G100 chromatography and ethanol precipitation.
Tissue culture
Wgd5 and methods for retroviral transduction by transient
expression / co-cultivation have been described (8). WOP cell
are described in (12). PA317 is described in (13). Fao is described
in (14). All cell lines were maintained in Dulbecco's Modified
Eagle's Medium plus 10% fetal bovine serum and 50 /tg/ml
gentamycin.
RESULTS AND DISCUSSION
Description of the selective substitution method
In the pXZd39 system (see Fig. 1), a biological selection is
achieved by inserting a constitutively expressed version of the
X cl repressor gene between asymmetric BamHI and EcoRI
cloning sites of the bacteriophage X derived retrovinis expression
vector XZd37. The action of the repressor gene prevents pXZd39
from growing as a lytic X phage. However, it can be propagated
as a large plasmid, because plasmid replication origins and
antibiotic resistance genes reside elsewhere within the vector.
Cleavage of the large plasmid with BamHI and EcoRI excises
the Xrepressorgene which is then physically separated from the
vector 'arms' by pelleting the arms through a potassium acetate
gradient under conditions whereby the repressor gene fragment
stays in the body of the gradient. The isolated arms are then
ligated to cDNA which has been constructed to contain an EcoRI
5' end and a BamHI 3' end (see cDNA cloning and size selection
below). The ligation products are packaged in vitro into X phage
particles which are, in turn, plated onto a lawn of bacteria. Phage
from the resultant plaques are harvested and these constitute the
final amplified library.
Any vector DNA which is not cut with both BamHI and EcoRI
can reform a DNA molecule which contains the tac-cl fragment
instead of a cDNA insert. These molecules can be packaged but
they will not form a plaque upon plating due to the action of
the tac-cl gene, and thus, they will not contribute to the
background of non-recombinants. Since EcoRI and BamHI
cohesive ends can not be ligated to each other at any appreciable
rate by T4 DNA ligase, the only potential contributions to
background are from i.) extraneous contaminating endo- or
exonucleases, which are minimal due to the high quality of
modern commercial restriction enzymes and the fact that a large
excess of enzyme is not required to digest the vector DNA by
this technique or ii.) mutations within the tac-cl gene or operator
sequences, which are selected against during the growth of the
svxo
Rt
fl«m
rwofcin
ori pBRoii
-XZd37 (44.5 kb)
R1 B«m
^ A
»-^
insert to generate pXZd39
uc
promoter
d
Digest with R1 and Bam
isolate vector and ligate to cDNA
T
package and amplify
Figure 1. Schematic representation of vector construction and use. Not drawn to scale. The various steps in the construction and use of p\Zd39 are described in
the text. Bacteriophage X DNA, restriction fragments and concatamers are shown as linear. The p\Zd39 plasmid is shown as a circle. The tac-cl fragment is stippled
while cDNA is stnped. Rl = EcoRI, Bam = BamHI. LTR = long terminal repeat. ori=origin of replication.
3406 Nucleic Acids Research, Vol. 19, No. 12
p\Zd39 since they would cause the plasmid to enter lytic growth
and kill the cell. This latter is an advantage over even the XgtlO
system, as repressor mutants of that phage form clear plaques
which have a growth advantage over the wild type during its
propagation.
Construction of pXZd39 from \Zd35
pXZd39 was constructed from \Zd35 (8) in three steps (see
MATERIALS AND METHODS for details). First, a Bam site
in the right X arm was removed leaving a unique Bam cloning
site. Second, the extended retroviral packaging sequence from
pLNL6 (9) was added. And third, an approximately 1.7 kb Bam
to EcoRl fragment from pEA305 (10) containing the X cl
repressor gene under the control of the tac promoter was inserted
at the cDNA cloning site. The presence of this highly expressed
X repressor gene in the construct effectively prevents its
propagation as a phage (eliminating any background from uncut
vector) while allowing it to be maintained as a plasmid. The tac
promoter is so strong, however, that the large amount of repressor
that is generated from this hybrid gene is toxic in wild-type cells
(10). Thus, pXZd39 is grown in DH21 (11), a strain which
overproduces the lac repressor 50 fold and, thus, down regulates
the tac promoter. pXZd39 grows well in this host with typical
yields being greater than 1 milligram of plasmid per liter of
culture.
and as outlined in Fig. 2. This method of cDNA synthesis is a
modification of published protocols (8, 15, 16, 17) which is highly
efficient and produces cDNA with a high proportion of 5' ends
(15) which can be directionally cloned.
Starting with 7 /*g of polyA+ RNA, a yield of 1.2 /tg of first
strand cDNA was calculated by incorporation of radioactive
nucleotide. Curiously, the yield of second strand cDNA was
calculated to be 2 ng, implying that either these yields were
miscalculated (a possibility, since very small volumes were
removed for scintillation counting) or 0.8 /tg of the second strand
yield was derived from non-templated or 'rolling hairpin'
synthesis. The yield of double stranded cDNA at this point was
estimated to be 3.2 fig, an average between the first and second
strand yields, but doubled to account for double-strandedness.
After losses during the methylation and linker addition
procedures, a final yield of 1.8 /ig of double stranded cDNA with
5' EcoRI and 3' BamHI sites was obtained. A small portion of
this (75 ng = 1/24 of the total) was ligated to 2 jtg of prepared
p\Zd39 vector, and the ligation products packaged in vitro. Small
aliquots of the packaging reaction were plated and the plaques
counted revealing that 1.44X106 independent clones had been
obtained. This corresponds to an efficiency of 4.9 X106 clones
per /tg of polyA+ RNA with a background of 0.3% (Table 1).
It is notable that this high cloning efficiency and low background
was achieved without titration or very accurate quantitation of
the input cDNA.
Control ligations with cloned fragments
As a first test of the cloning system, 100 ng of pXZd39 vector,
prepared for cloning as described in MATERIALS AND
METHODS, was ligated to an approximately equimolar amount
of pBR322 cut with EcoRI and BamHI. Digestion of pBR322
with EcoRI and BamHI produces two fragments of 375 and 3988
base pairs, both of which possess one EcoRI end and one BamHI
end. A second control ligation contained 100 ng of vector DNA,
but no pBR322 DNA. One quarter of the ligation reactions were
in vitro packaged, aliquots were plated onto E.coli lawns and
plaques were counted the next day. As shown in Table 1,
approximately 500 fold more plaques were obtained when
pBR322 DNA was included in the ligation, a sizable increase
over background.
oigo oT, R«vtrw Transcripts**
dQTP. Tefmlnal Tr«n»*erm»e
oigodC, poll
cDNA cloning and size selection
Double stranded cDNA was synthesized from mouse A9 cell
poly A + RNA as described in MATERIALS AND METHODS
Table 1. Cloning efficiencies of various inserts in p\Zd39. The number of plaque
forming units (pfu) after in vitro packaging were determined for each ligation
by counting a representative dilution containing more than 50 plaques, except
in the case of 'no insert' in which 10 ng of vector plated yielded 18 plaques.
The backgrounds were determined by dividing the number of pfu/^g of vector
for the control ligation (1.8x 103) by the number of pfu//tg of vector for the test
ligation. The mass of cDNA was estimated as described in the text for total
(unfractionated) cDNA. The mass of cDNA in each size fraction was calculated
as the ratio of radioactivity in that fraction to the total amount of radioactivity
loaded multiplied by the total yield of cDNA. All ligations were performed using
equimolar amounts of vector and insert, using the apparent average sizes of cDNA
fractions to determine their molar amounts.
insert
pfu//ig of vector background
pnx//ig of insert
no insert
pBR Bam + EcoRI
total cDNA
fractions 1 - 4
fractions 5 - 1 0
1.8X1O3
9.9x10*
7.2X10 3
5.0X10 3
1.8xl0 6
N/A
9.9 X107
1.9xl0 7
5.3X1O6
2.5xlO 7
N/A
0.02%
0.3%
0.4%
0.1%
Bam & EcoRI mMhytas*
R5 0I90, T4 Igua
CH,
AATTCGGATCCGAATTCCCCCC TTAAGCCTACGCTTAACGGGGG-
CH,
CH,
-AAAAAAAATTCCGATCCGAATT
-ITTIITTTAACCCTAGGCTTAA
-JUUWAAAATTCG
-TTI1111TAACCCTAG
% utoct or done droctiy
Figure 2. Schematic representation of method of cDNA synthesis. The method
of cDNA synthesis is fully described in the text. PolyA+ RNA is represented
as a broken line. First and second strand cDNA is represented as a solid line.
Poly A tails and oligonucleotide tracts are shown as shorter than actual length
to save space. The 5' end of the RNA and the second (top) strand cDNA is on
the left, while the 5' end of the first (bottom) strand cDNA is on the right. Internal
methylated nucleotides are represented as CH3.
Nucleic Acids Research, Vol. 19, No. 12 3407
The remainder of the cDNA was size fractionated by
centrifugation over a potassium acetate gradient at 30,000 rpm
for 17.5 hours. Fractions of 0.5 ml were withdrawn from the
bottom of this gradient and precipitated at - 2 0 ° for 30 minutes
after the addition of 5 /tg of linear polyacrylamide carrier and
1 ml of ethanol. A significant amount of radioactivity was also
present, apparently pelleted, at the bottom of the gradient. This
was resuspended and ethanol precipitated in parallel with the other
fractions. Each fraction was resuspended in 50 /tl of TE, and
5 /xl of each of the first 17 (out of 22) fractions was
electrophoresed on an agarose gel. The gel was fixed, dried and
exposed to X-ray film (Fig. 3). An interesting feature of the
gradient is the apparent partial aggregation of material in both
the gradient and the gel with a size of about 2.8 kb (marked by
arrows in Fig. 3). This material, which may represent the
mysterious excess second strand synthesis described above, does
not seem to be clonable since no stimulation above background
was observed when the pellet fraction was ligated to pXZd39
vector.
The remainder of fractions 1 through 4 (95 ng of cDNA) were
pooled and ligated to 1 ng of prepared p\Zd39 vector to generate
a sub-library of 5 x 105 clones with a calculated background of
0.4% (Table 1). The remainder of fractions 5 through 7 (177
ng of cDNA) were pooled and ligated to 2.5 /tg of prepared
p\Zd39 vector to generate a second sub-library of 4.45 X106
clones with a calculated background of only 0.1 % (see Table 1).
Analysis of cDNA length
The total A9 library and the size selected library derived from
fractions 1 through 4 were amplified and 'released' by
P
bottom
1 2 3
8
9
10
11 12
13 14
15
1« 17
Figure 3. Size fraction of cDNA over a potassium acetate gradient. Double
stranded cDNA was size fractionated on a potassium acetate gradient as described
in the text. Twenty-two 0.5 ml fractions were collected from a 20 guage syringe
needle punctured into the bottom of the gradient. Material which had pelleted
to the bottom of the gradient was also resuspended. A portion of each of the
bottom 17 fractions (marked 1 through 17) were electrophoresed on an agarose
gel along with a portion of the pellet (marked P) and cold size markers (1 kb
ladder, BRL; marked m). The positions of the size markers were marked by boring
a hole in the gel at the appropriate position with a pasteur pipet. The gel was
acid fixed, dried onto filter paper and exposed to X-ray film for 3 hours with
an intensifying screen at -80° along with dots of radioactive ink. The positions
of the size markers were transfered by aligning the 'hot dots' on the gel with
their images on the autoradiogram. The arrows mark material of apparent mobility
of 2.8 kb which seems to aggregate in both the gradient and gel.
homologous recombination in vivo (8). A small portion of the
released library DNA (about 1 ng) was transformed into bacteria
and several random colonies (10 from the total library and 20
from the size selected library) were picked and analyzed as to
the presence and sizes of cDNA inserts by digestion of miniprep
DNAs with EcoRI and BamHI. This analysis (not shown)
revealed that 1 of the clones from the total library and 4 clones
from the size selected library did not have inserts. However, with
one exception, these insertless clones did not have the right sized
vector band, suggesting either that they are aberrant release
products or that they have lost one of the restriction sites during
cloning. This was confirmed by picking 35 separate plaques from
the amplified library and isolating plasmid DNA from each using
a scaled down release protocol. This analysis (not shown)
revealed that 34 of the 35 clones had inserts which were excisable
with BamHI and EcoRI. The remaining clone had apparently lost
one of its cloning sites as it was linearized by BamHI plus EcoRI
digestion to a size larger than vector alone. In addition, we have
recently developed a new non-retroviral cloning vector in which
a more efficient release mechanism utilizing site specific
recombination has been employed along with selective
substitution, and every one of the greater than 50 independent
isolates from a library constructed in this new vector have
contained inserts (Murphy et al., manuscript in preparation).
The average size of inserts from the total A9 library was 550
bp, with the largest being 950 bp, whereas the average size of
inserts from the size selected (fractions 1 through 4) library was
1,650 bp, with the longest being 4.4 kb. About 1/3 of the inserts
from the size selected library were greater than 2 kb (Table 2,
left side). Thus, a large enrichment for long cDNAs has been
made by the size selection process. Surprisingly, about 1/3 of
the inserts from the size selected library were also less than 1
kb, even though very little of the cDNA from fractions 1 through
4 appears to be this small (Fig. 3). The average size of inserts
from this library also seems to be smaller that the apparent
average size of the cDNA in fractions 1 through 4. A similar
observation can be made for the average sizes of inserts from
the total library. Two factors may contribute to this discrepancy.
First, analysis of the insert sizes of random clones will lead to
a number average size for the inserts, whereas the display of
homogeneously labeled cDNA on a gel will lead to an apparent
mass average size. The mass average is inherently larger than
the number average, since a 2 kb cDNA will contain twice the
radioactivity of a 1 kb cDNA. Second, longer cDNAs may be
less clonable than shorter ones. In this case, construction of size
selected libraries might be especially crucial in the expression
cloning of cDNAs derived from long messages, and a low
background vector such as the one we are describing would be
especially useful in the construction.
Table 2. Size distribution of inserts before and after retroviral transduction. The
number of clones (#) analysed which contained inserts in each size range and
the percentage of clones (%) within each size range are shown. The source of
clones before and after transduction is described in the text. *One of these inserts
was longer than 3,000 bp and one was longer than 4,000 bp.
(BEFORE)
(AFTER)
size of insert
0-999 bp
1,000-1,999 bp
2,000 bp or more
5
6
>*
31
38
31
13
5
0
72
28
0
3408 Nucleic Acids Research, Vol. 19, No. 12
Retroviral transduction of the size selected cDNA library
Efficiency of retroviral transduction. The XZd vectors were
originally designed to efficiently and stably transform a large
range of cell types by retroviral transduction (8). For reasons
which are not relevant to the present discussion, we attempted
to transduce a derivative of the rat hepatoma cell line Fao (14)
with the size selected A9 library. Since rat cells are relatively
poorly infectable by these retroviruses, we chose a two step
approach in which the library was first transduced, by transient
expression using the Wgd5 producer (8), into the amphotrophic
producer cell line PA317 (13). By selection with G418, a library
of stable producers representing about 160,000 independent
colonies of PA317s was thus established. These colonies were
pooled and used as a source of high titer virus to transduce the
Fao derivative cells by co-cultivation. In this second step
transduction, about 225,000 G418 resistant colonies were
obtained.
cDNA length after retroviral transduction. Individual colonies
of Fao cells were isolated, and the Zd inserts were rescued by
WOP cell fusion (8) and plasmid DNA was digested with EcoRI
and BamHI to excise rescued cDNA inserts. As shown in Table
2, these cDNA inserts were, on average, smaller than those of
the original size selected library. Thus, it seems that the short
cDNAs ( < 2 kb) may be enriched for after two rounds of
retroviral transduction. Further work will determine whether the
apparent size skewing remains after analysis of a greater number
of clones, and whether it is due to some correctable feature of
this vector (like the presence of the retroviral donor splice site).
While transduction using an earlier XZd vector has been shown
to be efficient enough to expression clone three independent
copies of the rare thymidine kinase cDNA out of 200 plates
screened (8), this cDNA was only 1 kb in length. Presumably
biologically active thymidine kinase cDNAs would be four fold
more abundant using the present system since the previous library
was not directional and contained a 50% background of nonrecombinants. This has not yet been tested directly.
Aside from retroviral transduction, the high efficiency, ease
of use and low cloning background of pXZd39 make it potentially
useful as a cloning vector to drive transient expression in the
mouse WOP cell system (12, 18) in a manner analogous to the
successful COS cell transient expression system (e.g. 19, 20).
p\Zd39 should also prove useful in stable transformation systems
using either X phage particle transfection (21) or high efficiency
plasmid transfection (22).
Additional uses for selective substitution vectors
The selective substitution system can, in the future, be
incorporated into a new class of cDNA cloning vectors. These
vectors, like pXZd39, will consist of phage X arms surrounding
plasmids which can be released by either homologous
recombination (8), M13 replication functions (23) or site specific
recombination. The plasmid portions of these vectors will contain
polylinkers as well as sequences for the expression of cDNAs
in various prokaryotic or eukaryotic systems. These vectors will
derive the advantages of the selective substitution system Oow
background, greater ease of cloning), the advantages of X phage
cloning vectors (high cloning efficiency, ease of amplification
and storage) and the advantages of plasmid vectors (small size,
high yield, simplified analysis).
Selective substitution might also be used to construct new X
vectors for the cloning of genomic DNA. In this case, the vector
arms would be cloned into a plasmid containing the tac-cl gene
using a single restriction site. The arms could then be grown as
a plasmid, an easier and higher yield method than the preparation
of phage DNA. Digestion and potassium acetate gradient
sedimentation would yield a clean preparation of vector arms
which would have very low background.
ACKNOWLEDGEMENTS
All of the constructs described in this paper are readily available.
Requests for materials should be addressed to the corresponding
author.
We would like to thank Jurgen Brosius for providing pEA3O5,
Dusty Miller for pLNL6 and PA317 and Doug Hanahan for
DH21. We would also like to thank Ada Szeto, who constructed
XZd35B with A. M. while they were in the laboratory of Dr.
Argiris Efstratiadis, Susan Thorpe who helped in the construction
of pXZd39 and all of the members of the Efstratiadis and Schimke
laboratories for advice and encouragement. A. M. was supported
by a grant from the John D. and Helen T. Me Arthur foundation
during initial phases of this work and later by a Postdoctoral
Fellowship (#PF-3314) from the American Cancer Society.
REFERENCES
1. Maniatis, T., Kee, S.G., Efstratiadis, A and Kafatos, F.C. (1976) Cell 8,
163-182.
2. Huynh, T.V., Young, R.A. and Davis, R.W. (1985) In Glover, D.M. (ed.),
DNA aoning-A Practical Approach. IRL Press, Oxford, Vol.1, pp. 49-78.
3. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning:
A Laboratory Manual. Cold Spring Harbor Laboratory, Cdd Spring Harbor.
4. Pheiffer, B.H. and Zimmerman, S.B. (1983) Nucleic Acids Res. 11,
7853-7871.
5. Treisman, R. (1985) Cell 42, 889-902.
6. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning:
A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring
Harbor.
7. Aruffo, A. and Seed, B.(1987) Proc. Natl. Acad. Sci. USA 84,8573-8577.
8. Murphy, A.J.M. and Efstratiadis, A. (1987) Proc. Nat. Acad. Sci. USA
84, 8277-8281.
9. Bender, M.A., Palmer, T.D., Gelinas, R.E. and Miller, A.D.(1987) J. Virol.
61, 1639-1646.
10. Amann, E., Brosius, J. and Ptashne, M. (1983) Gene 25, 167-178.
11. Hanahan, D.(1983) J. Mol. Biol. 166, 557-580.
12. Dailey, D. and Basilico, C. (1985) J. Virol. 54, 739-749.
13. Miller, A.D. and Buttimore, C. (1986) Mol. Cell. Biol., 6, 2895-2902.
14. Deschatrette, J. and Weiss, M.C. (1974) Biochimic 56, 1603-1611.
15. Land, H., Grez, M., Hauser, H., Lindenmaier, W. and Schutz, G. (1981)
Nucleic Acids Res. 9, 2251-2266.
16. Okayama, H. and Berg, P. (1982) Mol. Cell. Biol. 2, 161-170
17. Gubler, U. and Hoffman, B.J. (1983) Gene 25, 263-269
18. Veldman, G.M., Lupton, S. and Kamen, R. (1985) Mol. Cell. Biol. 5,
649-658.
19. Wong, G.C., Witek, J.S., Temple, P.A., Wilkens, K.M., Leary, A.C.,
Luxenberg, D.P., Jones, S.S., Brown, EX., Kay, R.M., Orr, E.C.,
Shoemaker, C , Golde, D.W., Kaufman, R.J., Hewick, R.M., Wang, E.A.
and Clark, S.C. (1985) Science 228, 810-815
20. Seed, B. and Aruffo, A. (1987) Proc. Natl. Acad. Sci. USA 84, 3365-3369.
21. Ishiura, M., Hirose, S., Uchida, T., Hamada, Y., Suzuki, Y. and Okada,
Y. (1982) Mol. Cell. Biol. 2, 607-616
22. Chen, C. and Okayama, H. (1987) Cell. Biol. 7, 2745-2752.
23. Short, J.M., Fernandez, J.M., Sorge, J.A. and Huse, W.D. (1988) Nucleic
Acids Res. 16, 7583-7600.