Biochem. J. (2010) 428, 491–498 (Printed in Great Britain)
doi:10.1042/BJ20100038
491
Cellular nucleic-acid-binding protein, a transcriptional enhancer of c-Myc ,
promotes the formation of parallel G-quadruplexes
Mariana BORGOGNONE, Pablo ARMAS and Nora B. CALCATERRA1
Instituto de Biologı́a Molecular y Celular de Rosario (IBR), Consejo Nacional de Investigaciones Cientı́ficas y Técnicas (CONICET) - Área Biologı́a General, Dpto. de Ciencias Biológicas,
Facultad de Ciencias Bioquı́micas y Farmacéuticas, Universidad Nacional de Rosario, Suipacha 531, S2002LRK Rosario, Argentina
G-rich sequences that contain stretches of tandem guanines can
form four-stranded, intramolecular stable DNA structures called
G-quadruplexes (termed G4s). Regulation of the equilibrium
between single-stranded and G4 DNA in promoter regions is
essential for control of gene expression in the cell. G4s are highly
stable structures; however, their folding kinetics are slow under
physiological conditions. CNBP (cellular nucleic-acid-binding
protein) is a nucleic acid chaperone that binds the G4-forming
G-rich sequence located within the NHE (nuclease hypersensitivity element) III of the c-Myc proto-oncogene promoter. Several
reports have demonstrated that CNBP enhances the transcription
of c-Myc in vitro and in vivo; however, none of these reports have
assessed the molecular mechanisms responsible for this control.
In the present study, by means of Taq polymerase stop assays,
electrophoretic mobility-shift assays and CD spectroscopy, we
show that CNBP promotes the formation of parallel G4s to the
detriment of anti-parallel G4s, and its nucleic acid chaperone
activity is required for this effect. These findings are the first
to implicate CNBP as a G4-folding modulator and, furthermore,
assign CNBP a novel mode-of-action during c-Myc transcriptional
regulation.
INTRODUCTION
suggest that G4 may act as a transcriptional-inducing or
-repressing element in a context-dependent manner.
Generally, formation of G4 structures is slow at micromolar
DNA concentrations and physiological temperatures. The
negative supercoiling generated behind the transcription bubble
can cause unwinding of duplex DNA [10,11], allowing G4 folding
both in vitro and in vivo [12]. However, it remains unclear why
AT-rich sequences would not melt in preference to the GC-rich
sequences, given their large differences in stability. This suggests
that G4 formation might not be possible unless certain proteins
accelerate the folding kinetics.
In the present study, we investigated the role played by CNBP
(cellular nucleic-acid-binding protein), a single-stranded nucleicacid-binding protein that binds to the G4 sequence in NHE III
[13], and activates c-Myc transcription in vitro [14] and
in vivo [15–17]. CNBP is a small protein formed by an RGG
box and seven CCHC zinc knuckle domains [13]. CNBP acts as
a nucleic acid chaperone, affecting the duplex stability of c-Myc
NHE III in an ATP-independent way [13]. The chaperone activity
depends mainly on the N-terminal region of the protein, which
comprises the RGG box and the first CCHC motif [15]. CNBP
shares its essential structural domains with two other proteins that
display nucleic acid chaperone activity: FMRP (Fragile X mental
retardation protein) and the HIV-1 NC (nucleocapsid) protein
[13,15]. The RGG boxes present in CNBP and FMRP are the
major structural motifs responsible for their biochemical features
[15,18]. Additionally, the CCHC zinc knuckles from CNBP are
able to replace the human HIV-1 NC protein zinc knuckles without
affecting viral structure and function [19].
Since FMRP [20] and NC [21,22] are nucleic acid chaperones
that modify G4 stability we asked whether CNBP could function
The nucleobase guanine is capable of self-assembling to form
Hoogsteen hydrogen-bonded motifs called G-tetrads. G-rich
sequences that contain stretches of tandem guanines can form
intramolecular, four-stranded structures called G-quadruplexes or
G4s. Recent studies have shown that potential G4-forming motifs
are present in more than 40 % of human genes [1], and are strongly
enriched in transcriptional regulatory regions in warm-blooded
animals [2]. In addition, a correlation between G4s and gene
functions may exist because they are under-represented in tumour
suppressor genes and over-represented in proto-oncogenes [3].
These findings led to the hypothesis that G4 DNA is a regulatory
motif situated in regulatory elements, acting as a molecular switch
that can modulate the role of the host functional regions by
transition in DNA structure [4].
The human c-Myc gene has provided interesting insight into
the potential impact of G4 DNA on gene expression. Regulation
of human c-Myc involves three major promoters: P0, P1 and P2
[5]. The NHE (nuclease hypersensitivity element) III, a region
that controls 75–95 % of the total c-Myc transcription, is located
upstream of the P1 promoter [6]. The G-rich strand of NHE III
can fold as a G4, and it has long been assumed that the c-Myc G4
functions as a transcriptional repressor element. This repressor
effect has been well-documented using the G4-stabilizing ligand
TMPyP4 [meso-tetra(N-methyl-4-pyridyl)porphine] and DNA
mutations that disrupt G4 formation [6,7]. However, recent reports
show that blocking G4 folding with a LNA (locked nucleic acid)
complementary strand leads to repression of c-Myc expression
[8]. Moreover, polyamines induce c-Myc overexpression by
promoting G4 formation [9]. Taken together, these findings
Key words: cellular nucleic-acid-binding protein (CNBP), nuclease hypersensitivity element (NHE), nucleic acid binding,
nucleic acid chaperone, single-stranded nucleic acid, transcriptional regulation.
Abbreviations used: CNBP, cellular nucleic-acid-binding protein; EMSA, electrophoretic mobility-shift assay; FMRP, Fragile X mental retardation protein;
G4, G-quadruplex; GST, glutathione transferase; NC, nucleocapsid; NHE, nuclease hypersensitivity element; TBA, thrombin-binding aptamer; TBE,
Tris/borate/EDTA; TMPyP4, meso-tetra(N -methyl-4-pyridyl)porphine.
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2010 Biochemical Society
492
Table 1
M. Borgognone, P. Armas and N. B. Calcaterra
Oligonucleotides used in the present study
The Pu18 sequence is indicated in bold in both G4-template and G4-template-mut. The underlined G-to-A mutations in G4-template-mut lead to destabilization of the G4 structure [6].
Name
Sequence (5 →3 )
Primer (28 bases)
G4-template (77 bases)
G4-template-mut (77 bases)
Pu18 (18 bases)
TBA (15 bases)
T30695 (16 bases)
TAATACGACTCACTATAGCAATTGCGTG
TCCAACTATGTATACTGAAGAGGGTGGGGAGGGTGGGGAAAATTAGCAACACGCAATTGCTATAGTGAGTCGTATTA
TCCAACTATGTATACTGAAGAGGGTGAGGAGAGTAGGGAAAATTAGCAACACGCAATTGCTATAGTGAGTCGTATTA
AGGGTGGGGAGGGTGGGG
GGTTGGTGTGGTTGG
GGGTGGGTGGGTGGGT
in a similar way. We report in the present paper the effect of
CNBP on the formation kinetics of G4s by using Taq polymerase
stop assays, EMSAs (electrophoretic mobility-shift assays) and
CD spectroscopy. Our studies reveal that CNBP promotes the
formation of parallel G4s, and its nucleic acid chaperone activity
is required for this effect. Moreover, we show that a natural
proteolytic form of CNBP, which is able to down-regulate
c-Myc expression in vivo [15], lacks the capability of folding
G-rich sequences into G4s. The present study provides an insight
into the role of CNBP-mediated G4 folding that may affect gene
expression at the transcriptional and translational levels.
EXPERIMENTAL
Materials
Oligonucleotides were purchased from Invitrogen; their
sequences are listed in Table 1. The cationic porphyrin TMPyP4
was purchased from Frontier Scientific. A stock solution
(190 mM) was diluted to working concentrations immediately
before use.
Prediction of G4 in oligonucleotide sequences
G4-template and G4-template-mut sequences were in silico
analysed using the QGRS Mapper (http://bioinformatics.ramapo.
edu/QGRS/index.php), QuadFinder version 1.0 (http://miracle.
igib.res.in/quadfinder) and Quadparser (http://www.quadruplex.
org/?view=quadparser_web) web servers.
Labelling of oligonucleotides
Oligonucleotide 5 -end-labelling was performed by incubating the
oligonucleotides with T4 polynucleotide kinase and [γ -32 P]ATP
for 2 h at 37 ◦C. Labelled oligonucleotides were purified by
Sephadex G-25 gel-filtration chromatography [23].
purified wild-type or mutant recombinant proteins or TMPyP4 (at
different concentrations) in the presence of 0.025 μg/μl poly(dIdC) · (dC-dI) and 1 μg/μl BSA (as non-specific competitors).
Afterwards, 0.05 units/μl Taq DNA polymerase, 10 mM MgCl2
and 10 mM dNTPs were added, and the mixture was
incubated at 37 ◦C for 30 min. The Taq polymerase extension
reaction was stopped by adding 10 μl of stop buffer (10 mM
NaOH, 95 % formamide, 0.05 % Xylene Cyanol and 0.05 %
Bromophenol Blue) and loaded on to 15 % polyacrylamide
gels containing 7 M urea and 28 % formamide. Gels were
dried and exposed to a Storage Phosphor Screen (Amersham
Biosciences/GE Healthcare), which was subsequently scanned
on a STORM 860 PhosphorImager using ImageQuant
5.2 software. Relative amounts of stop and full-length products
were quantified from radioactive bands, and the stop/full-length
ratio was normalized by assigning the value of 1 arbitrary unit
to the stop/full-length ratio obtained for the maximum CNBP
concentration, as indicated.
CD spectroscopy
DNA oligonucleotides (2 μM) in reaction buffer were heated
at 95 ◦C and then slowly cooled to 25 ◦C. Depending on the
experiment, no ion or different concentrations of (NH4 )2 SO4 were
added to the reaction buffer before heating. Wild-type or mutant
CNBP protein or TMPyP4 was added and incubated at 37 ◦C
for 30 min prior to CD spectroscopy. CD spectra were recorded
with a Jasco-810 spectropolarimeter using a quartz cell of 1-cm
optical path-length, an instrument scanning speed of 100 nm/min,
with a response time of 1 s, and over a wavelength range of 230–
320 nm. The reported CD spectrum of each sample represents the
average of four scans taken at 37 ◦C. The spectral contribution of
buffers, salts, TMPyP4 and proteins was subtracted as appropriate
by using the software supplied with the spectrometer.
Purification of non-folded and intramolecular G4 structures
Purification of recombinant proteins
Wild-type and site-directed deletion Chaunus arenarum CNBP
mutants were expressed as GST (glutathione transferase) fusion
proteins in Escherichia coli DH5α cells and purified to
homogeneity by affinity chromatography, as described previously
[15].
Taq polymerase stop assay
DNA template (6 nM) and 5 -end-labelled primer (6 nM) were
annealed in reaction buffer (10 mM Tris/HCl, pH 8) by heating
to 95 ◦C and then slowly cooling to 25 ◦C. Depending on the
experiment, 50 mM (NH4 )2 SO4 , 100 mM KCl, 100 mM LiCl, or
no ion were added to the reaction buffer before heating. Next,
the annealed template was incubated for 30 min at 37 ◦C with
c The Authors Journal compilation c 2010 Biochemical Society
Purification of intramolecular G4 structures was performed
according to a method described by Qin et al. [24]. In brief,
the 5 -end 32 P-labelled Pu18 oligonucleotide (100 nM) in 10 mM
Tris/HCl buffer (pH 8), with or without 50 mM (NH4 )2 SO4 or
100 mM KCl was heated to 95 ◦C and then slowly cooled
to 25 ◦C. TMPyP4 (700 nM) was added to an aliquot of G4
folded in 100 mM KCl, and all reactions were incubated for
an additional 2 h at 25 ◦C. DNA samples were resolved by
20 % non-denaturing polyacrylamide gel electrophoresis in the
presence of 12.5 mM NaCl and 12.5 mM KCl in 0.5 × TBE
[Tris/borate/EDTA (1 × TBE = 45 mM Tris/borate and 1 mM
EDTA)] buffer at 8 W and 4 ◦C. Non-folded and monomolecular
G4 bands were cut from the gel and eluted by soaking overnight
in 0.1 % SDS, 1 mM EDTA (pH 8) and 1 mM MgCl2 at 37 ◦C.
DNA was ethanol precipitated, rinsed and resuspended in the
CNBP promotes parallel G4s formation
493
same buffers that were used for folding. Finally, non-folded and
G4 purity was assessed by 20 % non-denaturing polyacrylamide
gel electrophoresis.
EMSAs
EMSAs were performed as described previously [13]. Briefly,
binding reactions were carried out in a final reaction volume of
20 μl for 30 min at 37 ◦C. Probes were added to a final concentration of 2 nM in the presence of increasing amounts of purified
fusion proteins. NaCl was omitted from the binding solution,
and different monovalent cations were added. Figure legends
specify the amount or concentration of protein used in each
experiment. Reactions were resolved on 8 % polyacrylamide gels
containing 5 % glycerol in 0.5 × TBE buffer, as indicated.
Gels were dried, exposed to a Storage Phosphor Screen
(Amersham Biosciences/GE Healthcare), and subsequently
scanned on a STORM 860 PhosphorImager using ImageQuant
5.2 software. Apparent dissociation constants (K d ) were estimated
from the intensity of radioactive bands, as described previously
[13].
RESULTS
CNBP is a single-stranded nucleic-acid-binding protein.
Therefore, in the present study, we used single-stranded nucleic
acid templates for various experimental approaches widely
employed for the study of G4s in an attempt to gain insight into
the role of CNBP on G4 formation and stability.
Taq polymerase stop assays and EMSAs
The polymerase stop assay is a widely used method to
evaluate the ability of a DNA sequence to form stable G4
structures. In this assay, primer extension using Taq polymerase
leads to premature stops at G4s, which represent an obstacle to
DNA synthesis. Briefly, a short primer complementary to the
3 -end of a single-stranded G-rich DNA template is extended
using Taq DNA polymerase. In the absence of monovalent cations,
only a weak shorter extension product (stop product) is observed,
but in the presence of cations or cations plus stabilizing agents
(e.g. TMPyP4), the stop product increases in intensity [6]. To
analyse the effect of CNBP on the NHE III region of the cMyc promoter, Taq polymerase stop assays were performed using
an oligonucleotide G4-template (Table 1) containing the 18nucleotide fragment of the c-Myc NHE III (named Pu18 in a
previous report [7]) and comprising the four G-tracts involved
in the biologically relevant G4 structures [7]. As listed in
Table 1, the central G-rich Pu18 sequence of the G4-template
is flanked at the 5 -end by a short sequence of 20 bases and
at the 3 -end by a sequence of 39 bases, which anneals with a
complementary oligonucleotide (Table 1) that functions as the
primer for Taq polymerization. A mutant 18 nucleotide sequence
that impairs G4 folding [6] was used instead of Pu18 to generate
the G4-template-mut oligonucleotide (Table 1). Both template
sequences were analysed in silico to determine potential G4
motifs. According to the three predictors used, the G4-template
can form different G4 structures depending on the combinations
of G-tracts and loops used, but all of them are folded within the
18 bases of Pu18. On the other hand, regardless of the predictor
used, the analysis of G4-template-mut did not show any potential
G4 motif. Hence, G4-template Taq extension should yield a stop
product of ≈ 40 bp, whereas the extension of G4-template-mut
should yield a full-length product of 77 bp.
Figure 1 Effect of different monovalent cations and TMPyP4 on G4
formation
Taq polymerase stop assays were performed using G4-template. (a) Prior to the reaction, the
DNA template was heated and slowly cooled in the presence of 100 mM KCl, 50 mM (NH4 )2 SO4
and 100 mM LiCl, or in the absence of cations (no ion). (b) DNA template folded in the
presence of 50 mM (NH4 )2 SO4 was incubated with the indicated concentrations of TMPyP4. The
electrophoretic mobilities of stop and full-length products and of primer are shown by arrows
on the right side of the figure. flp, full-length product; sp, stop product; p, primer.
Inspection of CNBP structural domains does not provide
straightforward clues to predict the effect of CNBP on G4s.
Hence, we first looked for an experimental condition in which
G4s were not strongly stabilized so that both stop and full-length
products could be detected. Thus an increase in the amount of
stop product should be observed if CNBP promotes the folding
of G4s, or, conversely, an increase in the full-length product
should be detected if the protein unfolds G4s. We addressed the
effect of different monovalent cations and their concentrations
on the Taq polymerase stop assay because the stability of G4s
strongly depends on the presence of cations [25]. In the presence
of KCl at concentrations ranging from 5 mM (results not shown)
to 100 mM, the stop product was mainly observed (Figure 1a,
lane 1). As expected, in the presence of 100 mM Li+ (Figure 1a, lane 4) or in the absence of cations (Figure 1a, lane 3),
the full-length product was mainly observed. In the presence
of 100 mM NH4 + , the Taq polymerase stop assay resulted in a
two-band electrophoretic pattern of stop and full-length products
(Figure 1a, lane 2). Furthermore, TMPyP4 increased stop-product
intensity in a concentration-dependent manner, confirming that
the observed stop product was actually due to G4 folding
(Figure 1b). Based on these data, 100 mM NH4 + was the
experimental condition chosen for analysing the CNBP effect
on the formation of G4s with the Taq polymerase stop assay. It
should be noted that NH4 + has been used for the same purpose in
a previous study [26].
Increasing amounts of CNBP (ranging from 0.18–1.8 μM)
caused an increase in the stop-product intensity (Figure 2a),
whereas the full-length product was mainly observed when the
G4-template-mut and the highest CNBP concentration were used
(Figure 2b). This effect was due to CNBP itself because the
presence of GST did not affect the Taq polymerase extension
electrophoretic pattern (Figure 2a). No changes in stop-product
intensity were observed with the addition of CNBP when the
G4-template was folded in the absence of ions or in the presence
of 100 mM Li+ (Figure 2c). The effect of CNBP was better
assessed by the stop/full-length ratio for each experimental
condition (Figure 2d). Because CNBP binds G-rich sequences
with relatively high affinity [13], we evaluated whether CNBP
binding caused steric hindrance that might prevent DNA extension
by Taq polymerase. We analysed the CNBP binding affinities to
G4-template and G4-template-mut (folded in the same conditions
used for Taq polymerase stop assays, i.e. 100 mM NH4 + ) by
c The Authors Journal compilation c 2010 Biochemical Society
494
M. Borgognone, P. Armas and N. B. Calcaterra
Figure 3 Analysis of CNBP-binding affinity for G4-template and G4template-mut by EMSA
Prior to use in binding reactions, both labelled G4-template and G4-template-mut probes were
heated and slowly cooled in the presence of 50 mM (NH4 )2 SO4 . Free and shifted probe bands
are indicated by arrows on the left-hand side of the Figure.
Figure 2 Analysis of the effect of CNBP on G4 formation by Taq polymerase
stop assays
Taq polymerase stop assays were performed using DNA templates that had been heated and
slowly cooled in the absence of ions or in the presence of 100 mM LiCl or 50 mM (NH4 )2 SO4 , and
then incubated with CNBP at different concentrations. (a) Taq polymerase stop assay performed
using G4-template and molar protein/template ratios of 30:1, 100:1, 150:1 and 300:1. The
control reaction was carried out by adding GST at the highest molar protein/template ratio.
(b) Taq polymerase stop assay performed using G4-template-mut and a molar protein/template
ratio of 300:1. (c) Taq polymerase stop assay performed using G4-template folded in the absence
of ions or in the presence of 100 mM Li+ at a molar protein/template ratio of 300:1. (d) Histogram
for each experimental condition analysed in (a), (b) and (c), representing the stop/full-length
product ratio normalized to the highest molar CNBP/template ratio (lane 5 in a). flp, full-length
product; sp, stop product; p, primer.
EMSAs, and observed that CNBP bound G4-template and G4template-mut with similar affinities (Figure 3). The fact that in
similar experimental conditions CNBP bound the wild-type and
mutant probes with similar affinity, but the stop in polymerization
was observed only with the wild-type probe, indicates that this
stop was due to the presence of a G4 in the wild-type probe
and not to a steric hindrance of bound CNBP molecules. Taken
together, our results indicate that CNBP favours the formation of
G4s, although the process requires the presence of a stabilizing
ion.
Single-stranded nucleic-acid-binding proteins may influence
the folding of a nucleic acid in two ways depending on their
binding properties. Proteins highly specific for a nucleic acid
structure shift the equilibrium between unfolded and folded forms
towards the folded structure by trapping it into a highly specific
protein–nucleic acid complex. Other proteins, which show broad
sequence-specificity but bind single-stranded nucleic acids with
high affinity, catalyse the conformational rearrangement of
unfolded or misfolded nucleic acids into proper three-dimensional
folding. A main difference between these two types of nucleicacid-binding proteins is that the specific ones remain bound to the
folded nucleic acid structure, whereas the less-specific proteins
are no longer needed once the nucleic acid is folded and can be
removed without altering the nucleic acid conformation [27,28].
Taking this into account, two modes-of-action for CNBP may be
c The Authors Journal compilation c 2010 Biochemical Society
possible: (i) CNBP may shift the equilibrium in favour of G4s
by forming a highly specific protein–nucleic acid complex; or
(ii) CNBP may catalyse folding of G4s and subsequently release
them. If the first possibility is true, CNBP should bind G4s with
higher affinity than non-folded sequence. Conversely, a higher
binding affinity for G-rich non-folded DNA should be observed
if the second possibility is true. To address this, we analysed
(by EMSAs) the affinity of CNBP for intramolecular G4s and
non-folded DNA using the G4-forming sequence of G4-template,
Pu18, as a probe. Pu18 was folded in the absence of ion or in the
presence of NH4 + , K+ and K+ plus TMPyP4, and then G4 and
non-folded structures were purified by native gel electrophoresis
(Figure 4a). The purity of probes was subsequently analysed
by native polyacrylamide electrophoresis (Figure 4b). The
NHE III of the c-Myc promoter predominantly folds as
parallel G4s, although a small anti-parallel population may exist
[8]. Moreover, c-Myc G4 may adopt multiple interconverting
conformers (chair and basket fold or propeller type) [6,29]. This
may explain the smeared-pattern observed in Figure 4(b).
For EMSAs, 100 mM Li+ was added to a fraction of the purified
Pu18 folded in the absence of ion to ensure the impairment of
G4s and rule out possible ionic strength effects. CNBP bound
non-folded DNA with high affinity, whereas a 100-fold lower
affinity was determined for G4s, regardless of the cation and
folding condition used (Figure 4c and Supplementary Figure S1
at http://www.BiochemJ.org/bj/428/bj4280491add.htm). It is
important to note that, even in the presence of monovalent cations,
a significant amount of G4-template probe remained unfolded
(Figure 4a) and that CNBP has 100-fold more affinity for nonfolded G-rich sequences than G4s (Figure 4c). Therefore bandshifts observed in Figure 3 may correspond to CNBP bound to
residual unfolded DNA rather than the folded G4 structures. On
the other hand, small amounts of residual non-folded DNA may be
present in purified G4s used for EMSAs, as shown in Figure 4(c),
which could lead to an overestimation of the affinity of CNBP for
G4s.
The results described so far suggest that CNBP exerts a
catalytic effect, accelerating the formation of G4 structures and
not remaining bound to G4s due to its low affinity for this structure.
CNBP promotes parallel G4s formation
495
Figure 5 Spectroscopic characterization of the effect of CNBP on G4
formation
Figure 4 Analysis of the CNBP-binding affinity for G4 and non-folded Pu18
by EMSA
(a) Radioactively labelled Pu18 was heated and slowly cooled in the absence of cations or
in the presence of 50 mM (NH4 )2 SO4 , 100 mM KCl or 100 mM KCl+0.7 μM TMPyP4, and
then subjected to 20 % non-denaturing polyacrylamide gel electrophoresis. G4 and non-folded
structures are indicated by arrows on the left-hand side of the Figure. (b) The purity of G4 and
non-folded Pu18 was assessed by 20 % non-denaturing polyacrylamide gel electrophoresis.
(c) EMSA performed using each purified DNA probe and the indicated concentrations of CNBP.
The cation concentration for each binding reaction is indicated below the Figure. Free and shifted
probe bands are indicated by arrows on the left-hand side of the Figure.
CD measurements
The effect of CNBP on the formation of G4s was further analysed
by CD spectroscopy using a set of oligonucleotides able to fold as
parallel or anti-parallel G4s. It is well-known that guanines of a
parallel quadruplex display an anti-conformation of the glycosyl
bonds, resulting in a positive ellipticity maximum centred on
264 nm and a small negative peak centred around 240 nm in the
CD spectrum. In contrast, guanines in an anti-parallel quadruplex
have alternating syn- and anti-glycosyl conformations along each
strand, exhibiting a maximum centred around 295 nm and a
minimum centred around 265 nm [30]. In the present study, we
used Pu18 [7], the HIV aptamer T30695 [31] and TBA (thrombinbinding aptamer) [32] (Table 1), which were folded as G4s in
the presence of NH4 + . Pu18 and T30695 spectra were similar,
showing maxima at ≈ 262 nm (Figures 5a and 5c). Conversely, the
TBA CD spectrum showed a maximum at ≈ 295 nm (Figure 5e).
Thus, in the presence of NH4 + , the CD spectrum of TBA was
in accordance with an anti-parallel structure, whereas the CD
signatures of T30695 and Pu18 were consistent with parallel
(a) CD spectrum of Pu18 folded in the absence of stabilizing cations (dotted/dashed line) or
in the presence of 10 mM (solid line) or 50 mM (dotted line) (NH4 )2 SO4 . (b) CD spectrum of
Pu18 folded in the presence of 10 mM (NH4 )2 SO4 (solid line) and then incubated with CNBP
(dotted/dashed line) or GST (dashed line) as a control. (c) CD spectrum of T30695 folded
in the absence of stabilizing cations (dotted/dashed line) or in the presence of 1 mM (solid
line) or 5 mM (dashed line) (NH4 )2 SO4 . (d) CD spectrum of T30695 folded in the presence
of 1 mM (NH4 )2 SO4 (solid line) and then incubated with CNBP (dotted/dashed line) or GST
(dashed line) as a control. (e) CD spectrum of TBA folded in the absence of stabilizing cations
(dotted/dashed line) or in the presence of 10 mM (solid line) or 50 mM (dotted line) (NH4 )2 SO4 .
(f) CD spectrum of TBA folded in the presence of 10 mM (NH4 )2 SO4 (solid line) and then
incubated with CNBP (dotted/dashed line) or GST (dashed line) as a control. In all cases, DNA
and protein concentrations were 2 μM, which represents a molar protein/DNA ratio of 1:1. CNBP
and GST spectra were subtracted from the oligonucleotide spectra shown in (b), (d) and (f).
structures [7]. An intermediate concentration of NH4 + and a molar
CNBP/oligonucleotide ratio of 1:1 (i.e. 2 μM each) were used to
analyse the CNBP effect on G4s. The presence of CNBP increased
the Pu18 and T30695 maxima signal intensity at ≈ 262 nm
(Figures 5b and 5d), thus providing strong evidence that CNBP
induces the formation of parallel G4s from single-stranded DNA.
Although the addition of CNBP in a molar ratio of 2:1 with
respect to the probe showed the same effect, measurements of
optical absorption at 350 nm revealed some aggregation when the
protein concentration was higher than 3 μM. Therefore this result
is not shown. The addition of CNBP to TBA in a 1:1 molar ratio
caused a maximum shift from 295 nm to ≈ 266 nm (Figure 5f),
which may be due to a structural transition from anti-parallel to
parallel. The observed effects were due to CNBP itself because
the presence of GST did not modify the CD spectra (Figures 5b,
5d and 5f). Proteins, salt and buffer spectra were subtracted from
oligonucleotide spectra, as described in the Experimental section.
CNBP increases c-Myc NHE III parallel G4 formation to the
detriment of anti-parallel G4
Usually, the formation of intramolecular G4s requires four Gtracts. However, even for a given set of four G-tracts, there may
c The Authors Journal compilation c 2010 Biochemical Society
496
M. Borgognone, P. Armas and N. B. Calcaterra
Figure 6 Comparative analysis of the effect of CNBP and TMPyP4 on G4
formation
(a) Taq polymerase stop assays performed using CNBP and TMPyP4. G4-template was folded in
the presence of 50 mM (NH4 )2 SO4 and then incubated with CNBP (lane 2), TMPyP4 (lane 3) or
both (lane 4). CNBP and TMPyP4 concentrations were 1.2 μM. The control reaction was carried
out by incubating the G4-template without protein or TMPyP4 (lane 1). flp, full-length product;
sp, stop product; p, primer. (b) CD spectra of Pu18 folded in the presence of 10 mM (NH4 )2 SO4
and then incubated with CNBP (dotted/dashed line), TMPyP4 (dashed line) or both (dotted line).
The control reaction was carried out by incubating Pu18 without protein or TMPyP4 (solid line).
For CD data, CNBP and TMPyP4 concentrations were 2 μM and 20 μM respectively.
be several possible intramolecular G4 topologies, which differ
by strand orientations, syn/anti distributions and/or loop folding
connections. The c-Myc NHE III contains six G-tracts, five of
which contain three or four guanines per tract [33]. Seenisamy
et al. [7] demonstrated that c-Myc G4 can form a mixture of
biologically relevant parallel isomers, which are converted into a
mixed parallel/anti-parallel G4 in the presence of TMPyP4. We
asked whether CNBP is able to promote the c-Myc parallel G4
folding even in the presence of TMPyP4. To answer this, we
assessed the simultaneous effect of TMPyP4 and CNBP by Taq
polymerase assays and CD spectroscopy. Taq polymerase stop
assays were performed using G4-template folded as G4 in the
presence of 100 mM NH4 + and then incubated with TMPyP4,
CNBP or both in the reaction media. CNBP/G4-template,
G4-template/TMPyP4 and CNBP/G4-template/TMPyP4 molar
ratios were 200:1, 1:200 and 200:1:200 respectively. The effect
of TMPyP4 on Taq polymerase stop assays was greater than that
observed for CNBP (Figure 6a). However, in the presence of both
TMPyP4 and CNBP, the electrophoretic pattern was similar to that
observed in the presence of CNBP alone, suggesting a competition
between CNBP and TMPyP4 for particular subpopulations of
G4s.
To further examine this phenomenon, Pu18 CD spectra in
the presence of TMPyP4, CNBP and both were recorded. CD
measurements were performed using Pu18 probe folded as
G4 in the presence of an intermediate concentration of NH4 +
(20 mM), as described above. The Pu18 CD spectrum was greatly
changed by the addition of Pu18/TMPyP4 in a ratio of 1:10; the
intensity of the 262 nm ellipticity was reduced, and an increase
in the ellipticity around 290 nm was observed (Figure 6b).
Pu18/TMPyP4 ratios lower than 1:4 did not significantly
changed the Pu18 CD spectrum and the most clear change was
observed at the Pu18/TMPyP4 ratio of 1:10 (Supplementary Figure S2 at http://www.BiochemJ.org/bj/428/bj4280491add.htm).
The result indicates a change in Pu18 folding topology from
a parallel to an anti-parallel structure or a mixed-type G4
that showed both parallel and anti-parallel characteristics.
Interestingly, the simultaneous addition of CNBP and TMPyP4 at
a CNBP/Pu18/TMPyP4 molar ratio of 1:1:10 generated a Pu18
CD spectrum typical of parallel G4s (Figure 6b). CNBP/Pu18
molar ratios greater than 1:1 were not tested to prevent protein
c The Authors Journal compilation c 2010 Biochemical Society
Figure 7 Requirement of the CNBP nucleic acid chaperone activity for
G4 folding promotion
(a) Taq polymerase stop assays performed using G4-template folded in the presence of 50 mM
(NH4 )2 SO4 and then incubated with wild-type CNBP, CNBPRGG , CNBP1-RGG and CNBP5−7
mutant proteins at a final concentration of 1.2 μM. flp, full-length-product; sp, stop product;
p, primer. (b) Histogram representing the stop/full-length ratio for each experimental condition
analysed in (a), normalized to the highest molar CNBP/template ratio (lane 2 in a). (c) CD
spectra of Pu18 folded in the presence of 10 mM (NH4 )2 SO4 and then incubated in the absence
of protein (solid line), with wild-type CNBP (dotted/dashed line) or CNBP1-RGG (dashed line)
at final concentrations of 2 μM.
aggregation. Therefore CNBP was less represented than TMPyP4
in the reaction medium, and thus the effect of CNBP on G4
may have been underestimated. Our results suggest a competition
between CNBP and TMPyP4, even when TMPyP4 is 10-fold
more concentrated. Moreover, they confirm that CNBP induces
structural transitions that favour parallel G4 conformers over those
stimulated by TMPyP4 in the NHE III element of the c-Myc
promoter.
Promoting formation of G4s depends on CNBP nucleic acid
chaperone activity
In a previous study, we showed that a CNBP mutant that lacks the
first CCHC zinc knuckle and the RGG box (CNBP1-RGG ), thus
mimicking a natural CNBP proteolytic form identified in Xenopus
laevis [34] and C. arenarum [35], acts as a dominant-negative
protein during X. laevis embryogenesis by down-regulating
c-Myc expression [15]. This mutant, and another that only lacks
the basic domain RGG box (CNBPRGG ), preserve a weak singlestranded DNA-binding capability, but fail to act as nucleic
acid chaperones [15]. Moreover, we observed that a C-terminal
deletion mutant that lacks the three last CCHC motifs (CNBP5−7 )
preserves the single-stranded DNA-binding capability and shows
a slightly reduced nucleic acid chaperone activity [15]. In the
present study, we performed Taq polymerase stop assays and
CD spectroscopy using the wild-type and CNBP mutant forms
mentioned above to address the CNBP structural requirements
for the promotion of G4 folding. CNBPRGG and CNBP1-RGG
mutants failed to increase the stop-product formation observed
with wild-type CNBP. Conversely, the CNBP5−7 mutant showed
CNBP promotes parallel G4s formation
lower activity than the wild-type, but higher activity than the other
two mutants (Figure 7a). This finding indicates that, although the
basic N-terminal region is important for promoting G4 folding, it
is not the only motif responsible for this activity. Stop/full-length
ratios for each protein are shown in Figure 7(b). In addition, the
Pu18 CD spectrum signature was not changed by the presence
of CNBP1−RGG (Figure 7c). These results indicate that the same
motifs involved in nucleic acid chaperone activity are necessary
for promoting the formation of G4s suggesting that the G4-folding
capability of CNBP is a direct consequence of its nucleic acid
chaperone activity. Moreover, these findings suggest that specific
proteolysis of CNBP may operate as a cellular strategy for c-Myc
transcriptional regulation.
DISCUSSION
We have shown that CNBP promotes in vitro the formation of
parallel intramolecular G4s, acting as a chaperone for Hoogsteen
bond formation. The CCHC and RGG motifs can form multiple
pockets that may interact with unfolded nucleic acids and
cause a co-folding or ‘induced fit’ of the protein and a G-rich
single-stranded nucleic acid [13,15]. CNBP may catalytically
direct the formation of G4s by bringing unpaired guanines into
close proximity through iterative annealing/melting cycles, thus
facilitating intramolecular hydrogen Hoogsteen bonding. Then,
CNBP could release the G4s as a consequence of its relative low
affinity for G4 compared with single-stranded DNA.
The stimulating role of CNBP on c-Myc expression was
demonstrated both in vitro and in vivo in several laboratories
and using different animal models [14–17,36]. Interestingly, a
recent report demonstrates that spermine and spermidine, which
perturb G4-duplex equilibrium in favour of parallel G4 formation,
stimulated c-Myc expression both in vitro and in vivo [9]. The
basic N-terminal region of CNBP, mainly the RGG box, shares
several biochemical features with spermine and spermidine, and
is required for the promotion of G4 folding. Hence, it is tempting
to speculate that, in a similar mode of action of polyamines,
CNBP enhances c-Myc transcriptional expression by promoting
parallel G4 formation. Although additional studies are required to
determine the specificity of the N-terminal region for promoting
G4s formation, this region is conserved in vertebrates, and its loss
leads to c-Myc transcriptional repression in vivo [15].
Conversely, previous studies reported a repressive role for
c-Myc G4 [6,7,37]. In some of these studies, c-Myc G4 was
stabilized by the pharmacological agent TMPyP4 [6,7]. This
drug induces a conformational conversion from parallel into
either a parallel/anti-parallel mixture or anti-parallel-type G4
[7,38]. The finding that the simultaneous addition of CNBP and
TMPyP4 generated a CD spectrum typical of parallel c-Myc G4
demonstrates that CNBP promotes the folding of the parallel G4 to
the detriment of the anti-parallel conformer. Hence, both CNBP
and TMPyP4 favour G4 formation; nonetheless, the structural
conformers promoted by each one are different and may explain
their different effects. Other studies have shown that nucleolin
suppresses c-Myc expression by facilitating the formation of
c-Myc parallel G4 upon binding them with high affinity and
selectivity [37]. Conversely, CNBP enhances c-Myc expression,
and in the present study we showed that it catalyses the parallel
G4 folding releasing them. The molecular environment of c-Myc
G4 in the presence of either nucleolin or CNBP would be different
and, consequently, have suppressive or enhancer effects on gene
expression respectively. This also explains why CNBP was not
present in the set of ten proteins identified as binding to c-Myc
G4 [37].
497
The transcriptional control of the c-Myc gene has been
explained in a model that involves the conversion of doublestranded DNA into G4 [39]. In this model, binding of TMPyP4
inhibits c-Myc transcription by stabilizing a parallel/anti-parallel
G4 structure, whereas CNBP and hnRNP K (heterogeneous
nuclear ribonucleoprotein K) act as transcriptional enhancers
[7]. However, a recent genome-wide analysis led to a model
wherein parallel formation of G4s in the transiently denatured
DNA of basal transcription bubbles prevents duplex renaturation
and facilitates transcription reinitiation by maintaining an open
DNA structure [40]. Although there are significant differences
between the experimental conditions used in this work and the
in vivo environment, data provided in the present study lead us
to hypothesize about a mode-of-action of CNBP during c-Myc
transcriptional regulation. During c-Myc basal transcription, the
progression of the transcription machinery generates positive and
negative supercoiling ahead of and behind the moving complex
respectively. As a consequence of negative supercoiling, NHE III
can form a local single-stranded DNA region. CNBP might bind to
the G-rich tract of NHE III, catalyse the folding of parallel G4, and
eventually release them. The folded G4 may generate a relatively
open DNA structure that facilitates the reinitiation of transcription
and, furthermore, recruit specific sets of transcription factors that
ultimately activate gene expression.
G4 structures can regulate transcription, as well as translation
[41]. Besides binding to single-stranded DNA, CNBP interacts
with RNA molecules [34,35,42] and regulates protein translation
[42,43]. The biological function of CNBP was mostly assessed
during vertebrate embryonic development, wherein it modulates the expression of genes required for normal rostral
head development [15,16,36]. Therefore during embryonic
development, CNBP might participate in gene transcription
and mRNA translation control through promotion of G4s
folding in G-rich regions present in specific nucleic acid
sequences.
Further research is currently underway to completely elucidate
the relationship between CNBP and regulation of gene expression
through G4s. Knowledge on the detailed mechanism of proteinfacilitated formation of G4s, which is one of the most remarkable
phenomena in protein–nucleic acid interactions, should be of great
significance in understanding formation of G4s in living cells.
Such studies may also open up new opportunities in the fight
against aberrant cellular processes.
AUTHOR CONTRIBUTION
Mariana Borgognone contributed by carrying out most of the Taq polymerase stop assays
and CD spectra experiments. Pablo Armas generated and purified recombinant wild-type
and mutant CNBPs, and carried out most of the EMSAs. Mariana Borgognone and Pablo
Armas purified intramolecular G4s and non-folded G-rich sequences. Table 1 and the
Figures were created by Mariana Borgognone and Pablo Armas. Nora Calcaterra helped
in the design of experiments, the collection and analysis of results, and writing the
manuscript. Mariana Borgognone and Pablo Armas also contributed in the discussion of
the results and designing experiments.
ACKNOWLEDGEMENTS
We thank to Dr Néstor Carrillo for his comments on the manuscript.
FUNDING
This work was supported by the Agencia Nacional de Promoción Cientı́fica y Tecnológica
(ANPCyT) [grant numbers PICT 33299 and 00648 (to N.B.C.), PICT 00738 (to P.A.)]; and
Consejo Nacional de Inuestigaciones Cientı́ficas y Técnicas (CONICET) [grant number
PIP 00480 (to P.A.)]. P.A. and N.B.C. are staff members, whereas M.B. is a fellow of
CONICET.
c The Authors Journal compilation c 2010 Biochemical Society
498
M. Borgognone, P. Armas and N. B. Calcaterra
REFERENCES
1 Huppert, J. L. and Balasubramanian, S. (2007) G-quadruplexes in promoters throughout
the human genome. Nucleic Acids Res. 35, 406–413
2 Zhao, Y., Du, Z. and Li, N. (2007) Extensive selection for the enrichment of G4 DNA motifs
in transcriptional regulatory regions of warm blooded animals. FEBS Lett. 581,
1951–1956
3 Maizels, N. (2006) Dynamic roles for G4 DNA in the biology of eukaryotic cells. Nat.
Struct. Mol. Biol. 13, 1055–1059
4 Du, Z., Zhao, Y. and Li, N. (2009) Genome-wide colonization of gene regulatory elements
by G4 DNA motifs. Nucleic Acids Res. 37, 6784–6798
5 Marcu, K. B., Bossone, S. A. and Patel, A. J. (1992) Myc function and regulation. Annu.
Rev. Biochem. 61, 809–860
6 Siddiqui-Jain, A., Grand, C. L., Bearss, D. J. and Hurley, L. H. (2002) Direct evidence for
a G-quadruplex in a promoter region and its targeting with a small molecule to repress
c-MYC transcription. Proc. Natl. Acad. Sci. U.S.A. 99, 11593–11598
7 Seenisamy, J., Rezler, E. M., Powell, T. J., Tye, D., Gokhale, V., Joshi, C. S., Siddiqui-Jain,
A. and Hurley, L. H. (2004) The dynamic character of the G-quadruplex element in the
c-MYC promoter and modification by TMPyP4. J. Am. Chem. Soc. 126, 8702–8709
8 Kumar, N., Patowary, A., Sivasubbu, S., Petersen, M. and Maiti, S. (2008) Silencing
c-MYC expression by targeting quadruplex in P1 promoter using locked nucleic acid trap.
Biochemistry 47, 13179–13188
9 Kumar, N., Basundra, R. and Maiti, S. (2009) Elevated polyamines induce c-MYC
overexpression by perturbing quadruplex-WC duplex equilibrium. Nucleic Acids Res. 37,
3321–3331
10 Kouzine, F., Sanford, S., Elisha-Feil, Z. and Levens, D. (2008) The functional response of
upstream DNA to dynamic supercoiling in vivo . Nat. Struct. Mol. Biol. 15, 146–154
11 Lavelle, C. (2008) DNA torsional stress propagates through chromatin fiber and
participates in transcriptional regulation. Nat. Struct. Mol. Biol. 15, 123–125
12 Sun, D. and Hurley, L. H. (2009) The importance of negative superhelicity in inducing the
formation of G-quadruplex and i-motif structures in the c-Myc promoter: implications for
drug targeting and control of gene expression. J. Med. Chem. 52, 2863–2874
13 Armas, P., Nasif, S. and Calcaterra, N. B. (2008) Cellular nucleic acid binding protein
binds G-rich single-stranded nucleic acids and may function as a nucleic acid chaperone.
J. Cell. Biochem. 103, 1013–1036
14 Michelotti, E. F., Tomonaga, T., Krutzsch, H. and Levens, D. (1995) Cellular nucleic acid
binding protein regulates the CT element of the human c-myc protooncogene. J. Biol.
Chem. 270, 9494–9499
15 Armas, P., Aguero, T. H., Borgognone, M., Aybar, M. J. and Calcaterra, N. B. (2008)
Dissecting CNBP, a zinc-finger protein required for neural crest development, in its
structural and functional domains. J. Mol. Biol. 382, 1043–1056
16 Chen, W., Liang, Y., Deng, W., Shimizu, K., Ashique, A. M., Li, E. and Li, Y. P. (2003) The
zinc-finger protein CNBP is required for forebrain formation in the mouse. Development
130, 1367–1379
17 Shimizu, K., Chen, W., Ashique, A. M., Moroi, R. and Li, Y. P. (2003) Molecular cloning,
developmental expression, promoter analysis and functional characterization of the
mouse CNBP gene. Gene 307, 51–62
18 Gabus, C., Mazroui, R., Tremblay, S., Khandjian, E. W. and Darlix, J. L. (2004) The fragile
X mental retardation protein has nucleic acid chaperone properties. Nucleic Acids Res.
32, 2129–2137
19 McGrath, C. F., Buckman, J. S., Gagliardi, T. D., Bosche, W. J., Coren, L. V. and Gorelick,
R. J. (2003) Human cellular nucleic acid-binding protein Zn2+ fingers support replication
of human immunodeficiency virus type 1 when they are substituted in the nucleocapsid
protein. J. Virol. 77, 8524–8531
20 Menon, L., Mader, S. A. and Mihailescu, M. R. (2008) Fragile X mental retardation
protein interactions with the microtubule associated protein 1B RNA. RNA 14,
1644–1655
21 Kankia, B. I., Barany, G. and Musier-Forsyth, K. (2005) Unfolding of DNA quadruplexes
induced by HIV-1 nucleocapsid protein. Nucleic Acids Res. 33, 4395–4403
Received 4 January 2010/12 March 2010; accepted 15 April 2010
Published as BJ Immediate Publication 15 April 2010, doi:10.1042/BJ20100038
c The Authors Journal compilation c 2010 Biochemical Society
22 Lyonnais, S., Gorelick, R. J., Mergny, J. L., Le Cam, E. and Mirambeau, G. (2003)
G-quartets direct assembly of HIV-1 nucleocapsid protein along single-stranded DNA.
Nucleic Acids Res. 31, 5754–5763
23 Sambrook, J., Fritsch, E. F. and Maniatis, R. (1989) Labeling the 5 terminus of DNA with
bacteriophage T4 polynucleotide kinase. In Molecular Cloning: A Laboratory Manual
(Ford, N. and Nolan, C., eds), pp. 10.59–10.61, Cold Spring Harbor Laboratory Press,
Cold Spring Harbor
24 Qin, Y., Rezler, E. M., Gokhale, V., Sun, D. and Hurley, L. H. (2007) Characterization of the
G-quadruplexes in the duplex nuclease hypersensitive element of the PDGF-A promoter
and modulation of PDGF-A promoter activity by TMPyP4. Nucleic Acids Res. 35,
7698–7713
25 Guschlbauer, W., Chantot, J. F. and Thiele, D. (1990) Four-stranded nucleic acid structures
25 years later: from guanosine gels to telomer DNA. J. Biomol. Struct. Dyn. 8, 491–511
26 Giraldo, R., Suzuki, M., Chapman, L. and Rhodes, D. (1994) Promotion of parallel DNA
quadruplexes by a yeast telomere binding protein: a circular dichroism study. Proc. Natl.
Acad. Sci. U.S.A. 91, 7658–7662
27 Cristofari, G. and Darlix, J. L. (2002) The ubiquitous nature of RNA chaperone proteins.
Prog. Nucleic Acid Res. Mol. Biol. 72, 223–268
28 Russell, R. (2008) RNA misfolding and the action of chaperones. Front. Biosci. 13, 1–20
29 Phan, A. T., Modi, Y. S. and Patel, D. J. (2004) Propeller-type parallel-stranded
G-quadruplexes in the human c-myc promoter. J. Am. Chem. Soc. 126, 8710–8716
30 Dapic, V., Abdomerovic, V., Marrington, R., Peberdy, J., Rodger, A., Trent, J. O. and Bates,
P. J. (2003) Biophysical and biological properties of quadruplex oligodeoxyribonucleotides. Nucleic Acids Res. 31, 2097–2107
31 Jing, N., Gao, X., Rando, R. F. and Hogan, M. E. (1997) Potassium-induced loop
conformational transition of a potent anti-HIV oligonucleotide. J. Biomol. Struct. Dyn. 15,
573–585
32 Macaya, R. F., Schultze, P., Smith, F. W., Roe, J. A. and Feigon, J. (1993)
Thrombin-binding DNA aptamer forms a unimolecular quadruplex structure in solution.
Proc. Natl. Acad. Sci. U.S.A. 90, 3745–3749
33 DesJardins, E. and Hay, N. (1993) Repeated CT elements bound by zinc finger proteins
control the absolute and relative activities of the two principal human c-myc promoters.
Mol. Cell. Biol. 13, 5710–5724
34 Pellizzoni, L., Lotti, F., Maras, B. and Pierandrei-Amaldi, P. (1997) Cellular nucleic acid
binding protein binds a conserved region of the 5 UTR of Xenopus laevis ribosomal
protein mRNAs. J. Mol. Biol. 267, 264–275
35 Calcaterra, N. B., Palatnik, J. F., Bustos, D. M., Arranz, S. E. and Cabada, M. O. (1999)
Identification of mRNA-binding proteins during development: characterization of Bufo
arenarum cellular nucleic acid binding protein. Dev. Growth Differ. 41, 183–191
36 Weiner, A. M., Allende, M. L., Becker, T. S. and Calcaterra, N. B. (2007) CNBP mediates
neural crest cell expansion by controlling cell proliferation and cell survival during rostral
head development. J. Cell. Biochem. 102, 1553–1570
37 Gonzalez, V., Guo, K., Hurley, L. and Sun, D. (2009) Identification and characterization of
nucleolin as a c-myc G-quadruplex-binding protein. J. Biol. Chem. 284, 23622–23635
38 Zhang, H., Xiao, X., Wang, P., Pang, S., Qu, F., Ai, X. and Zhang, J. (2009) Conformational
conversion of DNA G-quadruplex induced by a cationic porphyrin. Spectrochim. Acta A
Mol. Biomol. Spectrosc. 74, 243–247
39 Hurley, L. H., Von Hoff, D. D., Siddiqui-Jain, A. and Yang, D. (2006) Drug targeting of the
c-MYC promoter to repress gene expression via a G-quadruplex silencer element. Semin.
Oncol. 33, 498–512
40 Du, Z., Zhao, Y. and Li, N. (2008) Genome-wide analysis reveals regulatory role of G4
DNA in gene transcription. Genome Res. 18, 233–241
41 Huppert, J. L., Bugaut, A., Kumari, S. and Balasubramanian, S. (2008) G-quadruplexes:
the beginning and end of UTRs. Nucleic Acids Res. 36, 6260–6268
42 Gerbasi, V. R. and Link, A. J. (2007) The myotonic dystrophy type 2 protein ZNF9 is part
of an ITAF complex that promotes cap-independent translation. Mol. Cell. Proteomics 6,
1049–1058
43 Schlatter, S. and Fussenegger, M. (2003) Novel CNBP- and La-based translation control
systems for mammalian cells. Biotechnol. Bioeng. 81, 1–12
Biochem. J. (2010) 428, 491–498 (Printed in Great Britain)
doi:10.1042/BJ20100038
SUPPLEMENTARY ONLINE DATA
Cellular nucleic-acid-binding protein, a transcriptional enhancer of c-Myc ,
promotes the formation of parallel G-quadruplexes
Mariana BORGOGNONE, Pablo ARMAS and Nora B. CALCATERRA1
Instituto de Biologı́a Molecular y Celular de Rosario (IBR), Consejo Nacional de Investigaciones Cientı́ficas y Técnicas (CONICET) - Área Biologı́a General, Dpto. de Ciencias Biológicas,
Facultad de Ciencias Bioquı́micas y Farmacéuticas, Universidad Nacional de Rosario, Rosario, Argentina.
Figure S1
Isotherms and fits for CNBP binding to folded and unfolded G4
The radioactively labelled G4-forming probe Pu18 was folded and bound in different conditions. (a) and (b) Folded in the absence of cations and bound in the presence of 100 mM LiCl. (c) and (d)
Folded and bound in the absence of cations. (e) and (f) Folded and bound in the presence of 50 mM (NH4 )2 SO4 . (g) and (h) Folded and bound in the presence of 100 mM KCl. (i) and (j) Folded
and bound in the presence of 100 mM KCl + 0.7 μM TMPyP4. (a), (c), (e), (g) and (i) represent the percentage of shifted probe as a function of the CNBP concentration. In (a) and (c), K d values
were estimated from the fitted curve (hyperbola, single rectangular, two-parameter) as the CNBP concentration that shifts 50% of the probe. (b), (d), (f), (h) and (j) represent the CNBP concentration
as a function of the bound/unbound probe ratio. K d values were estimated as the slope of the fitted linear regression.
1
To whom correspondence should be addressed (email [email protected]).
c The Authors Journal compilation c 2010 Biochemical Society
M. Borgognone, P. Armas and N. B. Calcaterra
Figure S2 CD spectra showing the effect of different concentrations of
TMPyP4 on G4
CD spectra of Pu18 folded in the presence of 10 mM (NH4 )2 SO4 and then incubated without
TMPyP4 (black line) or with different molar Pu18 /TMPyP4 ratios of 1:2 (green line), 1:4 (blue
line), 1:6 (red line), 1:8 (orange line) and 1:10 (pink line). As the concentration of TMPyP4 was
increased from 4 to 20 mM, the value of the CD signal decreased at 262 nm and increased
around 290 nm. The concentration of Pu18 was 2 mM.
Received 4 January 2010/12 March 2010; accepted 15 April 2010
Published as BJ Immediate Publication 15 April 2010, doi:10.1042/BJ20100038
c The Authors Journal compilation c 2010 Biochemical Society