Lipid Accumulation and Transforming Growth
Factor-␤ Upregulation in the Kidneys of Rats
Administered Angiotensin II
Kan Saito, Nobukazu Ishizaka, Masumi Hara, Gen Matsuzaki, Masataka Sata, Ichiro Mori,
Minoru Ohno, Ryozo Nagai
Downloaded from http://hyper.ahajournals.org/ by guest on June 14, 2017
Abstract—Abnormal lipid metabolism may play a role in progressive renal failure. We studied whether lipid accumulation
occurs and whether lipid deposits are colocalized with transforming growth factor-␤1 (TGF-␤1) in the kidney of
angiotensin II–infused animals. Oil red O staining showed marked lipid deposition in the tubular epithelial and vascular
wall cells of angiotensin II–treated but not in norepinephrine-treated rats. Histological analyses showed that increased
amounts of superoxide and intense TGF-␤1 mRNA expression were present in lipid-positive tubular epithelial cells in
angiotensin II–infused animals. Protein expression of sterol regulatory element-binding protein 1 (SREBP-1) and
mRNA expression of fatty acid synthase in the kidney were ⬇3 times and 1.5 times, respectively, higher in angiotensin
II–treated rats than in controls. Treatment of angiotensin II–infused animals with an iron chelator, deferoxamine,
attenuated the angiotensin II–induced increases in renal expression of SREBP-1 and fatty acid synthase and normalized
the lipid content in the renal cortical tissues. Abnormal lipid metabolism may be associated with upregulation of TGF-␤1
expression and aberrant iron homeostasis in the kidneys of angiotensin II–infused animals. (Hypertension. 2005;
46:1180-1185.)
Key Words: angiotensin II 䡲 transforming growth factors 䡲 lipids
P
revious studies showed that accumulation of lipids in
nonadipose tissues occurs in certain diseased conditions,
and that it plays a crucial role in the pathogenesis of tissue
damage,1 a phenomenon referred to as lipotoxicity.2 For
example, lipid deposition in the arterial wall3,4 is postulated to
represent an early event in the development of atherosclerosis.5 The accumulation of triglycerides (TGs) in cardiomyocytes6,7 may be associated with contractile dysfunction, and
excess TGs in the liver may promote hepatic fibrosis.8 Lipid
accumulation in the kidney may represent features of glomerular and tubulointerstitial damage.9
We found that long-term administration of angiotensin II
(Ang II) to rats caused marked deposition of iron10 and
upregulation of the expression of transforming growth
factor-␤1 (TGF-␤1) in renal tubular epithelial cells.11 We also
found that iron chelation attenuated the Ang II–induced
upregulation of TGF-␤1 in the kidney, suggesting a possible
link between aberrant iron homeostasis and TGF-␤1 upregulation. However, unexpectedly, histological analysis showed
that upregulation of TGF-␤1 mRNA and deposition of iron
occurred in different tubular cells in most cases. The aims of
the present study were to investigate whether accumulation of
lipids occurs in the kidney of Ang II–infused animals and to
investigate the relationship between lipid accumulation and
TGF-␤1 in terms of localization. We also investigated
whether Ang II infusion alter the expression of genes that
have relation to the lipid metabolism, such as ATP-binding
cassette transporter subfamily A-1 (ABCA1), scavenger receptor class B type 1 (SR-B1), sterol regulatory elementbinding protein 1 (SREBP-1), SREBP-2, 3-hydroxy-3-methylglutaryl– coenzyme A (HMG-CoA) reductase, acetyl-CoA
carboxylase (ACC), stearoyl-CoA desaturase-1 (SCD-1), CoA:diacylglycerol acyltransferase-1 (DGAT-1), and LDL receptor. Furthermore, we investigated whether iron chelation
affects the degree of lipid accumulation in the kidney of Ang
II–infused animals.
Materials and Methods
Animal Models
The experiments were performed in accordance with the guidelines
for animal experimentation approved by the Animal Center for
Biomedical Research, Faculty of Medicine, University of Tokyo.
Ang II–induced hypertension was induced in male Sprague-Dawley
rats (250 to 300 g) by subcutaneous implantation of an osmotic
minipump (Alzet model 2001; Alza Pharmaceutical) as described
previously.12 Briefly, Val5-Ang II (Sigma Chemical) and norepinephrine (Sigma Chemical) were infused at doses of 0.7 mg/kg per
Received March 28, 2005; first decision April 16, 2005; revision accepted August 24, 2005.
From the Departments of Cardiovascular Medicine (N.I., K.S., G.M., M.S., M.O., N.R.), and Diabetes and Metabolic Disease (M.H.), University of
Tokyo Graduate School of Medicine, Japan; and Department of Pathology (I.M.), Wakayama Medical College, Japan.
Reprint requests to Nobukazu Ishizaka, MD, PhD, Department of Cardiovascular Medicine, University of Tokyo, Graduate School of Medicine, Hongo
7-3-1, Bunkyo-ku, Tokyo 113-8655, Japan. E-mail [email protected]
© 2005 American Heart Association, Inc.
Hypertension is available at http://www.hypertensionaha.org
DOI: 10.1161/01.HYP.0000184653.75036.d5
1180
Saito et al
TABLE 1.
Ang II and Renal Lipid Deposition
1181
Body Weight, Blood Pressure, and Serum Levels of TC and TGs
Group
No.
Body Weight
(g)
Systolic Blood
Pressure (mm Hg)
TC
(mg/dL)
TGs
(mg/dL)
Control
6
309⫾3
131⫾3
50.9⫾2.6
20.5⫾2.1
Ang II
10
230⫾14†
192⫾4†
65.2⫾4.7*
42.7⫾4.4†
Ang II⫹deferoxamine
10
232⫾5†
196⫾7†
55.0⫾2.4
25.6⫾4.9
9
292⫾2†
196⫾6†
52.8⫾2.8
16.7⫾1.7
Norepinephrine
*P⬍0.05 and †P⬍0.01 vs untreated control.
Downloaded from http://hyper.ahajournals.org/ by guest on June 14, 2017
day and 2.8 mg/kg per day, respectively, for 7 days.12 An iron
chelator, deferoxamine (a kind gift from Novartis, Basel, Switzerland) was subcutaneously administered at a dose of 200 mg/kg per
day while rats were receiving Ang II. Deferoxamine did not
significantly affect the blood pressure of Ang II–infused rats.
analysis software Statistica version 5.1 J for Windows (StatSoft Inc).
A value of P⬍0.05 was considered to be statistically significant.
Measurement of Lipid Contents in the Serum and
Renal Cortex
Administration of Ang II for 7 days slightly but significantly
increased the serum levels of TC and TGs compared with the
respective levels in control rats. These increases in the serum
TC and TG levels were suppressed by treatment with an iron
chelator (Table 1). Similarly, Ang II increased the contents of
TC and TGs in the renal cortical tissues, and these increases
were suppressed by treatment with an iron chelator (Table 2).
A pressor dose of norepinephrine did not increase the serum
levels of TC or TGs nor the content of TC or TGs in renal
cortical tissues.
Serum levels of total cholesterol (TC) and TGs in each sample were
measured by enzymatic methods (SRL) using Total Cholesterol E
Test Wako and Triglycerides E Test Wako (Wako Pure Chemicals),
respectively.
Western Blot Analysis, Immunohistochemistry,
and In Situ Hybridization
Western blot analysis was performed as described previously.13
Polyclonal antibodies against ABCA1 (Novus Biologicals), SR-B1
(Novus Biologicals), SREBP-1 (Santa Cruz Biotechnology), and
SREBP-2 (Santa Cruz Biotechnology) were used at dilutions of
1/1000, 1/1000, and 1/500, respectively. Immunohistochemistry was
performed as described previously.13 For this purpose anti–SREBP-1
antibody was used at a dilution of 1/200. In situ hybridization was
performed as described previously.11
Oxidative Fluorescent Microscopy
Staining with the oxidative fluorescent dye dihydroethidium (DHE)
was performed as described previously.11 Fluorescence intensity was
obtained for ⱖ6 fields for each section. The fluorescent intensity in
Ang II–treated group was presented as the percentage of that of
untreated control group.
Real-Time RT-PCR
Real-time quantitative PCR was performed by LightCycler (Roche
Diagnostics). Gene expression was normalized to the endogenous
control GAPDH mRNA in each sample, and then the amount of
target gene expression in the sample from treated animals was
expressed as the percentage of that in the untreated control. The
following primers and probes were used: for HMG-CoA reductase:
forward 5⬘ GACACTTACAATCTGTATGATG 3⬘; reverse 5⬘ CTTGGAGAGGTAAAACTGCCA 3⬘; for ACC: forward 5⬘ GAATTTGTCACCCGCTTTGG 3⬘, reverse 5⬘ TGGAGCGCATCCACTTGA 3⬘; for SCD-1: forward 5⬘ CCTTAACCCTGAGATCCCGTAGA 3⬘, reverse 5⬘ AGCCCATAAAAGATTTCTGCAAA 3⬘; for
DGAT-1, forward: 5⬘ TCTTCCTACCGGGATGTCAATC 3⬘, reverse 5⬘ TCCCTGCAGACACAGCTTTG 3⬘; for LDL receptor,
forward: 5⬘ TCCTCATCCTGCCTAAGT 3, reverse 5⬘ TGTAGTGCTTGTGCTACAGAG 3⬘; for plasminogen activator inhibitor-1
(PAI-1), forward: 5⬘ TCCTCATCCTGCCTAAGT 3⬘, reverse 5⬘
TGTAGTGCTTGTGCTACAGAG 3⬘; and for GAPDH: forward 5⬘
TGAACGGGAAGCTCACTGG 3⬘, reverse 5⬘ TCCACCACCCTGTTGCTGTA 3⬘.
Statistical Analysis
Data are expressed as the mean⫾SEM. We used ANOVA followed
by a multiple comparison test to compare raw data before expressing
the results as a percentage of the control value using the statistical
Results
Serum and Tissue Lipids Contents
Lipid Staining
Oil red O staining of kidney sections showed no apparent
lipid deposition in the kidneys of untreated rats (Figure 1A).
On the other hand, in Ang II–infused rats, marked accumulation of oil red O–stainable lipid was observed in tubular
epithelial cells in kidney sections (Figure 1B). Lipid deposition was not apparent in kidney sections from the norepinephrine-infused rats (Figure 1C). Staining of serial sections
showed that lipid deposits that were positively stained by oil
red O (Figure 1D) could also be stained positively by Sudan
black (Figure 1E). In Ang II–infused rats, the percentage of
cells that were positive for iron deposition decreased after the
treatment with an iron chelator (Figure 1F).
Staining for Superoxide, Lipids, and Iron
We previously found that superoxide production was increased in tubular epithelial cells that contain granular materials in the kidneys of Ang II–infused rats,11 and that majority
of the cells that contained these granular materials were not
positive for iron staining.10,11 In the current study, staining of
serial sections showed that tubular cells found to contain
granular material on differential interference contrast (DIC)
images were positive for oil red O staining, indicating that
TABLE 2.
Lipid Contents in the Renal Cortex
Group
n
TC
(␮g/mg wet weight)
TGs
(␮g/mg wet weight)
Control
6
4.3⫾0.6
5.6⫾0.8
Ang II
10
6.4⫾0.7*
8.3⫾0.8*
Ang II⫹deferoxamine
10
4.2⫾1.1
5.1⫾1.3
9
3.8⫾1.1
5.0⫾1.5
Norepinephrine
*P⬍0.05 vs untreated control.
1182
Hypertension
November 2005
Figure 1. Lipid staining. A, Kidney section from a control rat. B, D, and E, Kidney sections from Ang II–infused rats. C,
Kidney section from a norepinephrine
(NE)-infused rat. F, Kidney section from a
rat treated with Ang II and deferoxamine
(DFO). D and E are serial sections. Lipid
droplets were not observed in the kidney
of control rats (A). Marked lipid droplets,
mainly in the tubular epithelium, were
observed by oil red O staining in the kidney of hypertensive rats induced by Ang
II (B) but not by NE (C). Lipid droplets
shown by oil red O staining (D) were also
stained positive for Sudan black (E). Iron
chelation seemed to decrease the fraction of tubular cells with lipid deposition
(F). Original magnification ⫻200.
Downloaded from http://hyper.ahajournals.org/ by guest on June 14, 2017
observed granular materials are lipid droplets (Figure 2A and
2B). Cells with granular materials (ie, lipid droplets) had
increased superoxide production (Figure 2B through 2G),
which is consistent with a previous report.11 The levels of
superoxide detected by DHE oxidation were increased after
Ang II administration (control 100⫾10%, n⫽4 versus Ang II
209⫾30%, n⫽4; P⬍0.01). Only a small fraction of lipidpositive cells were found to be positive for iron deposition
(Figure 2H and 2I, asterisks), which is again consistent with
previous findings.11
In Situ Hybridization for TGF-␤1
The antisense but not sense (Figure 3A) probes for TGF-␤1
mRNA showed positive staining in tubular epithelial cells
(Figure 3B and 3D). Cells that expressed increased levels of
TGF-␤1 mRNA contained oil red O–stainable lipid deposits
(Figure 3C and 3E). Higher magnification revealed that cells
with increased levels of TGF-␤1 mRNA contained lucid granular materials, which were presumably lipid droplets (Figure
3F). Lipid deposition was occasionally observed in the vascular
wall cells, in which increased TGF-␤1 mRNA expression was
Figure 2. Lipid, superoxide, and iron
staining. A and H, Oil red O staining. B
and E, Nomarski DIC image. C and F,
DHE staining. D and G, Overlay. I, Iron
staining. A and B and H and I are serial
sections. B through D (higher magnifications) and E through G (lower magnifications) are the same sections. Although
lipid deposition and iron deposition are
observed in different tubular cells in most
cases, colocalization could be observed
in some tubular cells (H and I, asterisks).
Original magnification ⫻200 (A, H, and I).
Bar⫽20 ␮m (C and F). GM indicates
glomerulus.
Saito et al
Ang II and Renal Lipid Deposition
1183
Downloaded from http://hyper.ahajournals.org/ by guest on June 14, 2017
Figure 3. Lipid staining and in situ hybridization for TGF-␤1 mRNA. Sections of unfixed frozen kidney samples were used. A, In situ
hybridization using the TGF-␤1 sense probe (background). B, D, F, H, and J, In situ hybridization using the TGF-␤1 antisense probe. A
through C, D and E, G and H, and I and J are serial sections. Tubular epithelial cells with increased expression of TGF-␤1 mRNA are also
positive for lipid deposition (B and C ⫻200; D and E ⫻100). Higher magnification shows granular materials in the cells with increased expression of TGF-␤1 mRNA (F). Vascular wall cells with lipid deposits (G) expressed increased levels of TGF-␤1 mRNA (H), and those without lipid
deposits (I) did not express increased levels of TGF-␤1 mRNA (J). Also note that tubular cells that contain lipid droplets (I) expressed an
increase level of TGF-␤1 mRNA (J). Original magnifications ⫻200 (A through C and G through J); ⫻100 (D and E); and ⫻400 (F).
observed (Figure 3G and 3H). On the other hand, vascular wall
cells that did not contain lipid deposition did not express
increased levels of TGF-␤1 mRNA (Figure 3I and 3J).
Regulation of Genes Related to Lipid Metabolism
and PAI-1
Western blot analysis showed that the expression of SREBP-1
and ABCA1 but not AR-B1 was increased in the kidneys of Ang
II–treated animals (Figure 4A and 4B). Administration of
norepinephrine did not significantly alter the expression of
SREBP-1, and Ang II–induced upregulation of SREBP-1 was
suppressed by iron chelation. (Figure 4C and 4D). Immunohistochemical and histological analysis showed that Ang II increased protein expression of SREBP-1 in the tubular cells,
where deposition of oil red O–stainable lipid was positive
(Figure 5).
Expression of HMG-CoA reductase, ACC, SCD-1, DGAT-1,
LDL receptor, and fatty acid synthase (FAS) in the control
kidney were examined by quantitative RT-PCR. In the kidney of
control (n⫽10) and Ang II–infused (n⫽11) animals, expression
of these genes were as follows: HMG-CoA reductase 100⫾7%
versus 129⫾18%, respectively (P⫽NS); ACC 100⫾7% versus
84⫾5%, respectively (P⫽NS); SCD-1 100⫾41% versus 99⫾50%,
respectively (P⫽NS); DGAT-1 100⫾17% versus 83⫾8, respectively (P⫽NS); LDL receptor 100⫾30% versus 165⫾20%,
respectively (P⬍0.05); and FAS 100⫾10% versus
153⫾25%, respectively (P⬍0.05). Deferoxamine suppressed Ang II–induced upregulation of LDL receptor
(76⫾9%; n⫽5; P⫽NS versus control) and FAS mRNA
(70⫾19%; n⫽6; P⫽NS versus control). Ang II infusion
increased PAI-1 mRNA expression in the kidney (control
100⫾22%; n⫽11 versus Ang II 191⫾24%, n⫽10;
P⬍0.01), which was again suppressed by deferoxamine
(137⫾30%; n⫽5; P⫽NS versus control).
Discussion
In the present study, we showed that long-term administration
of Ang II but not norepinephrine caused robust accumulation
of oil red O–stainable lipid in tubular epithelial cells and
vascular wall cells in the rat kidney. Increased expression of
Figure 4. Western blot analysis of genes related to lipid metabolism. A and B, Expression of ABCA1, SR-B1, SREBP-1, and
SREBP-2 in the kidney of Ang II–infused animals. A, Representative Western blots. The size of the SREBP-1 bands shown in
the figures was ⬇70 kDa and thus judged to correspond to the
mature form. B, Summary of data from 5 to 7 experiments in
each group. C and D, Effects of iron chelation and norepinephrine on SREBP-1 expression. C, Representative Western blots.
D, Summary of data from 5 to 7 experiments in each group.
1184
Hypertension
November 2005
Figure 5. Localization of SREBP-1 and lipids. A through C, SREBP-1 staining. D, Oil red O staining. A, Kidney section from a control
rat. B through D. Kidney sections from Ang II–infused rats. C and D are serial sections. Original magnifications ⫻200 (A and B); ⫻400
(C and D).
Downloaded from http://hyper.ahajournals.org/ by guest on June 14, 2017
TGF-␤1 mRNA, shown by in situ hybridization, and increased amount of superoxide, shown by DHE staining, were
observed in cells with lipid deposition.
We showed previously that administration of Ang II to rats
induces the expression of ferritin and heme oxygenase-1,13 an
enzyme for heme degradation, in the renal tubular cells,10 and
that tubular epithelial cells with increased expression of these
proteins were positive for Prussian blue–stainable iron.10 We
found that Ang II–induced aberrant iron homeostasis may
have modulatory effects on the extent of urinary protein
excretion10 and on the expression of genes that have relation
to anti-aging14 and fibrogenesis.11 However, notably, in situ
hybridization showed that the localization of upregulation of
TGF-␤1 mRNA and deposition of iron were found to occur in
different renal tubular cells.11 In addition, cells that contain
granular materials observed by DIC were also negative for
iron staining.11 In the current study, the granular materials
observed in the tubular cells were identified as lipid droplets,
and cells with lipid deposition were found to have intense
expression of TGF-␤1 mRNA and increased levels of
superoxide.
Lipid deposition in the kidney may not be a rare phenomenon in certain animal models15–17 and in humans.18 Several
investigators advocated that it may play a crucial role in the
development of renal damage, which might be, in part,
mediated by the peroxydized lipids.17,19,20 Guijarro et al21
reported that dietary-induced hyperlipidemia increased the
renal expression of collagen and TGF-␤.22,23 Eddy et al20
showed that diet-induced hypercholesterolemia induced renal
lipid deposition and upregulation of TGF-␤ expression in the
kidney of uninephrectomized rats. To the best of our knowledge, the present study is the first to demonstrate the
colocalization of lipid deposits and increased TGF-␤1 mRNA
expression in animal models of human diseases.
Several previous studies suggested that Ang II may affect
circulating lipid content. Hanefeld et al24 showed that treatment of hypertensive patients with Ang II type 1 (AT1)
receptor blocker significantly reduced the plasma TC level.
The AT1 receptor blocker was potent in reducing the plasma
TG level,25 and conversely, Ang II infusion increased the
plasma TG levels by stimulating hepatic TG production in
rats.26 In our animal models, the plasma levels of TC and TGs
also increased after Ang II infusion. Thus, it is possible that
lipid deposition in the kidney occurred in response to the
increased level of circulating lipids.
In the present study, we also found that expression of
SREBP-1 and FAS was increased in the kidney of Ang
II–infused animals. Previous studies showed the possible link
between Ang II and FAS expression in the adipocyte.27 Our
data suggested that Ang II may also increase FAS expression
in the kidney, which might result in the increased production
of lipids. Sun et al28 reported that SREBP-1 expression is
upregulated in the kidney of diabetic animals. Interestingly,
Sun et al also showed that induction of SREBP-1 caused
upregulation of not only FAS but also of TGF-␤1 in the
kidney.28 Together with our findings, it is suggested that
altered renal expression of lipogenesis-related genes may
play a crucial role in the regulation of TGF-␤1 expression.
We also found that Ang II infusion increased the renal
expression of LDL receptor. Whether this phenomenon is the
underlying mechanism of increase in the cortical TC content
after Ang II infusion should be investigated in future
experiments.
Although underlying mechanisms that link between iron
and lipid dysregulation in the kidney remain unknown, there
are several possibilities. First, tubular cells in proteinuric
states carry large amounts of lipids, and fatty elements may
be correlated with the degree of proteinuria.29 Thus, iron
chelation may have suppressed renal lipid deposition by
decreasing the urinary excretion of protein.10 Second, in the
current study, iron chelation reduced the increase in plasma
lipid content in Ang II–infused animals. Because hyperlipidemia may cause lipid accumulation in the renal tubular
cells,30 deferoxamine may have suppressed renal lipid accumulation by lowering circulating lipids.31 Third, Zager et
al32,33 reported the possible relationship between (heme) iron
overload and regulation of lipogenesis-related genes in the
kidney.32 We found that expression of Ang II–induced
upregulation of FAS mRNA was inhibited by iron chelation.
Thus, aberrant iron homeostasis may directly modulate expression of lipogenesis-related genes in the kidney. However,
if so, whether certain paracrine substances would be released
from the iron-positive cells that may alter the expression of
lipogenesis-related genes should be investigated because iron
deposition and lipid accumulation occurred in the different
tubular cells.
Saito et al
Downloaded from http://hyper.ahajournals.org/ by guest on June 14, 2017
In the present study, Ang II infusion also induced lipid
deposition in the vascular wall cells, in which TGF-␤1 mRNA
expression was found to be upregulated. It has been shown that
Ang II plays a crucial role in the lipid deposition in the arterial
wall, an early event of atherogenic processes,34 and TGF-␤
upregulation in the aortas.35,36 We are now examining whether
upregulation of TGF-␤1 mRNA in the kidney is a downstream
event of lipid deposition and whether lipid deposition also
occurs in the aorta in the Ang II–infused rat.
In conclusion, long-term administration of Ang II caused
robust accumulation of lipids in the rat kidney. TGF-␤1 mRNA
expression and superoxide production were found to be increased in renal tubular cells and vascular wall cells that
contained oil red O–stainable lipids. Iron chelation suppressed
the increases in serum lipid levels and in the lipid content of the
renal cortical tissues in Ang II–infused rats. These findings
collectively suggest the existence of a relationship among altered
lipid metabolism, aberrant iron homeostasis, and the extent of
renal injury in the kidneys of Ang II–infused rats.
Acknowledgments
This work was supported by grants in aid for scientific research from the
Ministry of Education, Science, and Culture of Japan (13671098). We
are highly appreciative of Kyoko Furuta, Kazuko Komatsumoto, and
Naoko Amitani for their excellent technical assistance.
References
1. Schaffer JE. Lipotoxicity: when tissues overeat. Curr Opin Lipidol. 2003;
14:281–287.
2. Unger RH. Lipotoxic diseases. Annu Rev Med. 2002;53:319 –336.
3. Barnes SE, Weinberg PD. Two patterns of lipid deposition in the cholesterol-fed rabbit. Arterioscler Thromb Vasc Biol. 1999;19:2376 –2386.
4. Nunnari JJ, Fisher M, White SD. Inhibition of lipid deposition in the
hypercholesterolemic rat by clentiazem, a calcium channel blocker. Exp
Mol Pathol. 1992;57:193–204.
5. Rogers KA, Karnovsky MJ. A rapid method for the detection of early stages of
atherosclerotic lesion formation. Am J Pathol. 1988;133:451–455.
6. Sharma S, Adrogue JV, Golfman L, Uray I, Lemm J, Youker K, Noon
GP, Frazier OH, Taegtmeyer H. Intramyocardial lipid accumulation in the
failing human heart resembles the lipotoxic rat heart. FASEB J. 2004;18:
1692–1700.
7. Zhou YT, Grayburn P, Karim A, Shimabukuro M, Higa M, Baetens D,
Orci L, Unger RH. Lipotoxic heart disease in obese rats: implications for
human obesity. Proc Natl Acad Sci U S A. 2000;97:1784 –1789.
8. Ramesh S, Sanyal AJ. Hepatitis C and nonalcoholic fatty liver disease.
Semin Liver Dis. 2004;24:399 – 413.
9. Moorhead JF, Chan MK, El-Nahas M, Varghese Z. Lipid nephrotoxicity
in chronic progressive glomerular and tubulo-interstitial disease. Lancet.
1982;2:1309 –1311.
10. Ishizaka N, Aizawa T, Yamazaki I, Usui S, Mori I, Kurokawa K, Tang
SS, Ingelfinger JR, Ohno M, Nagai R. Abnormal iron deposition in renal
cells in the rat with chronic angiotensin II administration. Lab Invest.
2002;82:87–96.
11. Saito K, Ishizaka N, Aizawa T, Sata M, Iso ON, Noiri E, Ohno M, Nagai
R. Role of aberrant iron homeostasis in the upregulation of transforming
growth factor-beta1 in the kidney of angiotensin II-induced hypertensive
rats. Hypertens Res. 2004;27:599 – 607.
12. Ishizaka N, de Leon H, Laursen JB, Fukui T, Wilcox JN, De Keulenaer
G, Griendling KK, Alexander RW. Angiotensin II-induced hypertension
increases heme oxygenase-1 expression in rat aorta. Circulation. 1997;
96:1923–1929.
13. Aizawa T, Ishizaka N, Taguchi J, Nagai R, Mori I, Tang SS, Ingelfinger
JR, Ohno M. Heme oxygenase-1 is upregulated in the kidney of angiotensin II-induced hypertensive rats: possible role in renoprotection.
Hypertension. 2000;35:800 – 806.
14. Saito K, Ishizaka N, Mitani H, Ohno M, Nagai R. Iron chelation and a
free radical scavenger suppress angiotensin II-induced downregulation of
klotho, an anti-aging gene, in rat. FEBS Lett. 2003;551:58 – 62.
Ang II and Renal Lipid Deposition
1185
15. Fujihara CK, Padilha RM, Zatz R. Glomerular abnormalities in long-term experimental diabetes. Role of hemodynamic and nonhemodynamic factors and
effects of antihypertensive therapy. Diabetes. 1992;41:286–293.
16. Coimbra TM, Janssen U, Grone HJ, Ostendorf T, Kunter U, Schmidt H,
Brabant G, Floege J. Early events leading to renal injury in obese Zucker
(fatty) rats with type II diabetes. Kidney Int. 2000;57:167–182.
17. Chander PN, Gealekman O, Brodsky SV, Elitok S, Tojo A, Crabtree M,
Gross SS, Goligorsky MS. Nephropathy in Zucker diabetic fat rat is
associated with oxidative and nitrosative stress: prevention by chronic
therapy with a peroxynitrite scavenger ebselen. J Am Soc Nephrol. 2004;
15:2391–2403.
18. Lee HS, Lee JS, Koh HI, Ko KW. Intraglomerular lipid deposition in
routine biopsies. Clin Nephrol. 1991;36:67–75.
19. Dominguez JH, Tang N, Xu W, Evan AP, Siakotos AN, Agarwal R,
Walsh J, Deeg M, Pratt JH, March KL, Monnier VM, Weiss MF, Baynes
JW, Peterson R. Studies of renal injury III: lipid-induced nephropathy in
type II diabetes. Kidney Int. 2000;57:92–104.
20. Eddy AA. Interstitial inflammation and fibrosis in rats with diet-induced
hypercholesterolemia. Kidney Int. 1996;50:1139 –1149.
21. Guijarro C, Kasiske BL, Kim Y, O’Donnell MP, Lee HS, Keane WF.
Early glomerular changes in rats with dietary-induced hypercholesterolemia. Am J Kidney Dis. 1995;26:152–161.
22. Miyajima A, Chen J, Lawrence C, Ledbetter S, Soslow RA, Stern J, Jha
S, Pigato J, Lemer ML, Poppas DP, Vaughan ED, Felsen D. Antibody to
transforming growth factor-beta ameliorates tubular apoptosis in unilateral ureteral obstruction. Kidney Int. 2000;58:2301–2313.
23. Benigni A, Zoja C, Corna D, Zatelli C, Conti S, Campana M, Gagliardini
E, Rottoli D, Zanchi C, Abbate M, Ledbetter S, Remuzzi G. Add-on
anti-TGF-beta antibody to ACE inhibitor arrests progressive diabetic
nephropathy in the rat. J Am Soc Nephrol. 2003;14:1816 –1824.
24. Hanefeld M, Abletshauser C. Effect of the angiotensin II receptor antagonist valsartan on lipid profile and glucose metabolism in patients with
hypertension. J Int Med Res. 2001;29:270 –279.
25. Okada K, Hirano T, Ran J, Adachi M. Olmesartan medoxomil, an angiotensin II
receptor blocker ameliorates insulin resistance and decreases triglyceride production in fructose-fed rats. Hypertens Res. 2004;27:293–299.
26. Ran J, Hirano T, Adachi M. Chronic Ang II infusion increases plasma
triglyceride level by stimulating hepatic triglyceride production in rats.
Am J Physiol Endocrinol Metab. 2004;287:E955–E961.
27. Kim S, Dugail I, Standridge M, Claycombe K, Chun J, Moustaid-Moussa
N. Angiotensin II-responsive element is the insulin-responsive element in
the adipocyte fatty acid synthase gene: role of adipocyte determination
and differentiation factor 1/sterol-regulatory-element-binding protein 1c.
Biochem J. 2001;357:899 –904.
28. Sun L, Halaihel N, Zhang W, Rogers T, Levi M. Role of sterol regulatory
element-binding protein 1 in regulation of renal lipid metabolism and
glomerulosclerosis in diabetes mellitus. J Biol Chem. 2002;277:
18919 –18927.
29. Neuman M, West M, Zimmerman HJ. The relationship between proteinuria and fatty elements in the urine sediment. Am J Med Sci. 1961;
241:617– 624.
30. Chatterjee S, Kwiterovich PO Jr, Gupta P, Erozan YS, Alving CR,
Richards RL. Localization of urinary lactosylceramide in cytoplasmic
vesicles of renal tubular cells in homozygous familial hypercholesterolemia. Proc Natl Acad Sci U S A. 1983;80:1313–1317.
31. Cutler P. Deferoxamine therapy in high-ferritin diabetes. Diabetes. 1989;
38:1207–1210.
32. Zager RA, Johnson AC, Hanson SY, Shah VO. Acute tubular injury
causes dysregulation of cellular cholesterol transport proteins. Am J
Pathol. 2003;163:313–320.
33. Johnson AC, Yabu JM, Hanson S, Shah VO, Zager RA. Experimental
glomerulopathy alters renal cortical cholesterol, SR-B1, ABCA1, and
HMG CoA reductase expression. Am J Pathol. 2003;162:283–291.
34. Uehara Y, Urata H, Ideishi M, Arakawa K, Saku K. Chymase inhibition
suppresses high-cholesterol diet-induced lipid accumulation in the
hamster aorta. Cardiovasc Res. 2002;55:870 – 876.
35. Sambhi MP, Swaminathan N, Wang H, Rong H. Increased EGF binding
and EGFR mRNA expression in rat aorta with chronic administration of
pressor angiotensin II. Biochem Med Metab Biol. 1992;48:8 –18.
36. Kim S, Ohta K, Hamaguchi A, Omura T, Yukimura T, Miura K, Inada Y,
Ishimura Y, Chatani F, Iwao H. Angiotensin II type I receptor antagonist
inhibits the gene expression of transforming growth factor-beta 1 and
extracellular matrix in cardiac and vascular tissues of hypertensive rats.
J Pharmacol Exp Ther. 1995;273:509 –515.
Lipid Accumulation and Transforming Growth Factor-β Upregulation in the Kidneys of
Rats Administered Angiotensin II
Kan Saito, Nobukazu Ishizaka, Masumi Hara, Gen Matsuzaki, Masataka Sata, Ichiro Mori,
Minoru Ohno and Ryozo Nagai
Downloaded from http://hyper.ahajournals.org/ by guest on June 14, 2017
Hypertension. 2005;46:1180-1185; originally published online October 3, 2005;
doi: 10.1161/01.HYP.0000184653.75036.d5
Hypertension is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2005 American Heart Association, Inc. All rights reserved.
Print ISSN: 0194-911X. Online ISSN: 1524-4563
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://hyper.ahajournals.org/content/46/5/1180
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Hypertension can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Hypertension is online at:
http://hyper.ahajournals.org//subscriptions/