De novo genome assembly: what every biologist should know

technology feature
Judging genomes
334
Assessing assemblers
334
Organism adjustments
336
Taking up the right data
336
Dealing with ambiguity
336
Box 1: Advice for new assemblies
335
De novo genome assembly: what every biologist
should know
Monya Baker
Asked how mature the field of genome
assembly is, Ian Korf at the University of
California, Davis, compares it to a teenager with great capabilities. “It’s got bold
assertions about what it can do, but at the
same time it’s making embarrassing mistakes,” he says. Perhaps the biggest barrier
to maturity is that there are few ways to
distinguish true insight from foolish gaffe.
When a species’ genome is newly assembled, no one knows what’s real, what’s missing, and what’s experimental artifact.
That’s not slowing the pace of assembly.
In 2009, entomologists launched an initiative to sequence 5,000 insect genomes in
a project known as i5k. Shortly thereafter, an international collaboration called
Genome 10K organized around a goal to
sequence thousands of vertebrate species.
As of February 2012, The Genomes OnLine
Database 1 hosted by the Joint Genome
Institute of the US Department of Energy,
in Walnut Creek, California, listed over
15,000 sequencing projects; some 12,000
of these are still in progress or in planning
stages. The Shenzhen, China­–based global
sequencing center BGI has set itself a goal
of sequencing a million human genomes, a
million microbe genomes and another million plant and animal genomes. Researchers
are even eager to do de novo assembly on
human genomes, the better to discover variation that is hidden when sequencing data
are aligned to a reference.
Dozens of computer programs have
been written to turn raw sequencing data
into intact assemblies. But despite the
amount of human, computing and laboratory resources poured into assembly,
key questions remain unanswered. What
Kelly Howe, Lawrence Berkeley Laboratory
npg
© 2012 Nature America, Inc. All rights reserved.
As more genomes are assembled from scratch, scientists are struggling to assess and improve their quality.
Assemblers need copious sequencing data and
informatic exertion to put the genome back
together.
combination of sequencing data and computer algorithms can produce the highestquality assembly? More fundamentally,
once a genome is assembled, how can scientists tell how good it is?
Millions of pieces with multiple copies
As genome assembly programs stitch
together an organism’s chromosomes from
fragmented reads of DNA, they perform
some of the most complex computations in
all of biology. Sanger sequencing, the first
mainstream sequencing technology, produces DNA fragments of up to 1,000 base
pairs; adjacent reads usually overlap by a
couple of hundred base pairs. This essentially turns the haploid human genome
into a blank 30-million-piece jigsaw puzzle,
complicated by the facts that some pieces
are missing altogether and some pieces
contain errors. To compensate, assemblers
need about eight copies of each piece of the
genome.
Short-read sequencing technologies have
made the computational challenge harder.
Next-generation sequencers can read base
pairs at a hundredth to a thousandth of the
cost of Sanger sequencing, but the reads are
much shorter. With short-read sequencing
technologies, the human-genome puzzle
could contain 2 or 3 billion pieces with 100
copies of each piece.
Errors in assembly occur for many
reasons. Pieces are often incorrectly discarded as mistakes or repeats; others are
joined up in the wrong places or orientations. Researchers will be grappling with
these kinds of issues for a while, says Adam
Felsenfeld, director of the Large-Scale
Sequencing program at the National Human
Genome Research Institute (NHGRI), in
Bethesda, Maryland. “Very long, very highquality reads will do wonders for assembly,
and fix many of these issues,” he says. “But
we are not there yet.”
To assemble a genome, computer programs typically use data consisting of single
and paired reads. Single reads are simply
the short sequenced fragments themselves;
they can be joined up through overlapping
regions into a continuous sequence known
as a ‘contig’. Repetitive sequences, polymorphisms, missing data and mistakes eventually limit the length of the contigs that
assemblers can build.
Paired reads typically are about the
same length as single reads, but they
nature methods | VOL.9 NO.4 | APRIL 2012 | 333
technology feature
1. Fragment DNA and sequence
2. Find overlaps between reads
…AGCCTAGACCTACAGGATGCGCGACACGT
GGATGCGCGACACGTCGCATATCCGGT…
npg
© 2012 Nature America, Inc. All rights reserved.
4. Assemble contigs into scaffolds
Michael Schatz, Cold Spring Harbor
3. Assemble overlaps into contigs
Genome assembly stitches together a genome
from short sequenced pieces of DNA.
come from either end of DNA fragments
that are too long to be sequenced straight
through. Depending on the preparation
technique, that distance can be as short as
200 base pairs or as large as several tens
of kilobases. Knowing that paired reads
were generated from the same piece of
DNA can help link contigs into ‘scaffolds’,
ordered assemblies of contigs with gaps in
between. Paired-read data can also indicate the size of repetitive regions and how
far apart contigs are.
Assessing quality is made more difficult
because sequencing technology changes
so quickly. In January of this year, Life
Technologies launched new versions
of its Ion Torrent machines, which can
purportedly sequence a human genome
in a day, for $1,000 in equipment and
reagents. In February, Oxford Nanopore
Technologies announced a technology that
sequences tens of kilobases in continuous
stretches, which would allow genome
assembly with much more precision and
drastically less computational work. Other
companies, such as Pacific Biosciences,
also have machines that produce long
reads, and at least some researchers are
already combining data types to glean the
advantages of each.
Software engineers who write assembly
programs know they need to adapt. “Every
time the data changes, it’s a new problem,”
says David Jaffe, who works on genome
assembly methods at the Broad Institute
in Cambridge, Massachusetts. “Assemblers
334 | VOL.9 NO.4 | APRIL 2012 | nature methods
are always trying to catch up to the data.”
Of course, until a technology has been
available for a while, it is hard to know
how much researchers will use it. Cost,
ease of use, error rates and reliability are
hard to assess before a wider community
gains more experience with new
procedures. Luckily, ongoing efforts for
evaluating short-read assemblies should
make innovations easier to evaluate and
incorporate.
Judging genomes
In the absence of a high-quality reference
genome, new genome assemblies are often
evaluated on the basis of the number of scaffolds and contigs required to represent the
genome, the proportion of reads that can be
assembled, the absolute length of contigs
and scaffolds, and the length of contigs and
scaffolds relative to the size of the genome.
The most commonly used metric is N50,
the smallest scaffold or contig above which
50% of an assembly would be represented.
But this metric may not accurately reflect
the quality of an assembly. An early assembly of the sea squirt Ciona intestinalis had an
N50 of 234 kilobases. A subsequent assembly extended the N50 more than tenfold, but
an analysis by Korf and colleagues showed
that this assembly lacked several conserved
genes, perhaps because algorithms discarded repetitive sequences2. This is not an isolated example: the same analysis found that
an assembly of the chicken genome lacks 36
genes that are conserved across yeast, plants
and other organisms. But these genes seem
to be missing from the assembly rather than
the organism: focused re-analysis of the raw
data found most of these genes in sequences
that had not been included in the assembly.
Though the sea squirt and chicken
genomes were assembled several years ago,
such examples are still relevant because
assembly is more difficult with the shorter
reads used today, says Deanna Church, a
staff scientist at the US National Institutes of
Health who leads efforts to improve assemblies for the mouse and human genomes.
“In my experience, people do not look at
assemblies critically enough,” she says.
Assessing assemblers
Right now, when researchers describe a
new assembler, they often run it on a new
data set, making comparisons difficult. But
a few projects are examining how different
assemblers perform with the same data.
The goal is to learn both how to assemble
high-quality genomes and how to recognize
a high-quality assembly. For the Genome
Assembly Gold-standard Evaluations
(GAGE), scientists led by Steven Salzberg
at Johns Hopkins University School of
Medicine assembled four genomes (three
of which had been previously published)
using eight of the most popular de novo
assembly algorithms3.
Two other efforts, the Assemblathon
and dnGASP (de novo Genome Assembly
Assessment Project), have taken the form of
competitions. Teams generally consisted of
the software designers for particular assemblers, who could adjust parameters as they
thought best before submitting assembled
genomes for evaluation. Performance was
evaluated using simulated data from computer-designed genomes4.
The point is not identifying the best
overall assembler at a particular point
in time, but finding ways to assess and
improve assemblers in general, says Ivo
Gut, director of the National Genome
Analysis C enter in Spain, who ran
dnGASP. dnGASP compared assembly
teams’ performance on a specially designed
set of artificial chromosomes: three derived
from the human genome, three from the
chicken genome, and others representing the fruit fly, nematode, brewer’s yeast
and two sp ecies
of mustard plant.
In addition, the
contest organizers
included special
‘challenge chromosomes’ that tested
assembler performance on various
repetitive structures, divergent
alleles and other
Competitions for
genome assembly
difficult content.
bring developers
The data set
together to exchange
for these calibraadvice and ideas, says
tion chromosomes
Ivo Gut.
should be freely
available later this
year. “You can run [the reference data set]
through your assembler and post the results
back on the server. And then you can optimize your results,” says Gut. Researchers can
tune assembly parameters for their genome
of interest and benchmark the performance
of new versions of their assemblers, getting an early indication of an assembler’s
performance with a modest investment of
computational time, he explains. The
technology feature
Ian Korf has a warning for newcomers to de novo
genome assembly: “This is not an easy science
problem. Expect errors and tread carefully.”
npg
© 2012 Nature America, Inc. All rights reserved.
calibration set is intended for assemblers
that run on data produced by Illumina
sequencers.
But optimization on artificial data may
not be optimization at all, says Jaffe. “It’s
not a good use [of resources] to optimize
on things that are different from reality,” he
says. No matter how much effort is put into
mimicking experimental artifacts and biases, simulated data won’t mirror actual data
well, he says. Salzberg agrees. “Some assemblers perform beautifully on simulated data
but fall down on actual data,” he says.
Assemblathon organizer Korf admits
that simulated data are not ideal, but says
they offer a huge practical advantage. Even
the best published reference genomes contain mistakes, and contests require the use
of unpublished data, he says. “For judging
assembly programs, it’s nice [for the
judges] to know the answer.” But Korf says
Assemblathon 1 and the proliferation of
sequencing projects have literally changed
the game. Assemblathon 2 supplied real
sequencing data for a parrot, cichlid fish
and boa constrictor whose genomes have
not yet been published. Results should be
announced later this year.
The Assemblathon, dnGASP and GAGE
all showed that even the best assemblers
make numerous and important errors.
Biologists working with genomes of newly
sequenced species should remember that,
says Salzberg. “All these assemblies are
drafts. The quality is not anywhere close
to what you were getting from Sanger
assemblies.” Newer assemblies may be a
Box 1 Advice for new assemblies
If you want a genome assembled....
Seek help. For dnGASP and Assemblathon, some teams simply fed data into an assembler and applied all the default settings.
Those teams performed poorly, and even running an assembler on its default settings requires considerable computational expertise.
“The developer of software normally knows how to use it best,” says Ivo Gut. Researchers also need help planning and making their
libraries.
Know what you want. Assemblers have different strengths and weaknesses. Someone who cares about how large swaths of the
genome are arranged would value longer, more accurate contigs. A scientist who cares about having correct reading frames for genes
would be more concerned about finer-grained errors.
Take the transcriptome, too. Analyzing transcribed regions can vastly improve assemblies. “Every de novo genome project should
have a parallel RNA-seq project,” says Ian Korf. Besides identifying the intron-exon structure within genes, he says, this can help
assess the accuracy of assembly, inform scaffold construction and help train algorithms that find genes.
Be realistic about computer resources. Scientists who are considering using a desktop version of a genome assembler must calibrate
expectations to the size of the genome they hope to analyze. One study that compared eight assemblers found that only three
programs worked on the approximately 250-megabase bumble bee genome. One required certain kinds of data that weren’t available.
For four of the others, the genome was simply too big for the computer’s memory.
If you want to analyze a newly assembled genome….
Don’t assume that features missing from the assembly are missing from the organism. If there are ten closely related genes in the
genome, the assembly program may not be able to tease those apart, and some genes may be dropped. If researchers really care
about a specific gene or other feature, they should consider targeted resequencing. “Don’t take as Gospel the output of an assembly
program,” says Benedict Paten. “If your paper is going to rely on that [finding], it is absolutely essential that you do PCR and other
follow-up experiments.”
Compare alternate assemblies. Although combining assemblies is still difficult, looking at different assemblies may give researchers
the information they need. For example, two assemblies of the cow genome each have similar numbers of genes that have not been
put together properly, but the genes involved are different.
Turn the assembly tracks on. Though there are as of yet few local measures that assess genome quality, savvy biologists should be
on the lookout for trouble. Many misassemblies can be identified by a measure known as the compression-expansion statistic, says
Michael Schatz at Cold Spring Harbor Laboratory. “This is one of the few sensitive and specific metrics for identifying insertions and
deletions in an assembly without requiring a reference genome.”
Regions that have considerably lower read depth than the rest of the assembly may represent a single polymorphic locus that
the assembler has classified as two distinct loci. If the read depth is too high, an assembler may have merged repetitive regions,
particularly a type of repetitive sequence known as segmental duplication. If a gene or region of interest is near a gap between
contigs, researchers should be suspicious. Also, if the tracker indicates high levels of both discordant and concordant data, the region
may be polymorphic, with differences between homologous chromosomes.
Expect lower quality in difficult regions. Some genomes are harder to assemble than others. In general, the larger the genome, the
more mistakes. But if a scientist’s region of interest has a high percentage of guanine and cytosine content or a lot of repeats, that
scientist should be particularly wary: DNA amplification and assembly technologies deal poorly with such content.
nature methods | VOL.9 NO.4 | APRIL 2012 | 335
npg
© 2012 Nature America, Inc. All rights reserved.
technology feature
hundredth to a thousandth the cost, he says,
“but people are going to be very disappointed if they expect too much [from them].”
Benedict Paten, a computational biologist at the University of California, Santa
Cruz, who is analyzing Assemblathon
results in hopes of applying lessons to vertebrate sequencing
projects, has a more
optimistic view.
“I was concerned
when I started it
that it was all hype,”
he says, “but I was
reassured, for the
amount of money,
by just how good
“Some genomes will
the assemblies
be easier to assemble
could be.”
than others,” says
But determinBenedict Paten.
ing how good an
ass e mbly is c an
be difficult. “We would love to be able to
do that,” says Korf, “to say ‘That’s a 5-star
genome’,” but reality is more complicated.
The Assemblathon evaluated some hundred metrics in terms of how complete and
accurate the assemblies were. Though N50
did correlate, roughly, with genome quality, scientists concluded that no set of metrics was perfect. “People have used these
as a yardstick for quality, but that’s naive,”
says Paten. “There is no way to come up
with a single best metric.”
Improvements in one metric often come
at the expense of others. So-called conservative assemblers require extensive overlap
and robust data to join reads into contigs
and contigs into scaffolds; they have lower
error rates, but the contigs and scaffolds are
much shorter and so reveal less about how
a genome is organized. Aggressive assemblers produce longer contigs and scaffolds but are more likely to join regions in
the wrong order and orientation. Though
researchers are working out ways to identify
telltale signs of misassemblies and correct
them, errors are hard to detect.
In addition to trying to find metrics or
a set of metrics that serve as surrogates for
assembly quality, researchers should see
how accurately assemblers perform with
data sets for well-characterized genomes,
like mouse and human, says Jaffe. And
other assessments need to be more standardized, he says: most assembly papers
analyze how many genes are identified in
a genome, or how much of a transcriptome
can be found in an assembly, but methods
336 | VOL.9 NO.4 | APRIL 2012 | nature methods
of analysis vary so much that results are
hard to interpret and hard to compare.
Organism adjustments
The accuracy and completeness of a genome
assembly depends not just on computer
programs and sequencing technologies, but
also on the characteristics of the genome to
be assembled. GAGE evaluated assemblers
using data on two relatively complicated
bacterial genomes (one harboring multiple
plasmids), human chromosome 14 and the
bumblebee genome. For human chromosome 14, one widely used assembler omitted only 1.7% of the reference assembly
sequence. But although it placed first for this
metric with the human chromosome, the
program was in last place for Rhodobacter
sphaeroides, omitting 7.5% of the genome.
The best approach to genome assembly
varies by organism, says Daniel Rokhsar,
eukaryotic group leader at the Joint Genome
Institute, who has worked on plant, fungal
and animal genomes. Solutions that are
routine for small bacterial genomes are
impossible or impractical for eukaryotes.
Laboratory strains of worms, fish and mice
are often so inbred that there is little heterozygosity, simplifying sequence assembly.
And the size, spacing and arrangement of
repetitive regions vary in ways that can trip
up assemblers. “There are realities that come
into play that can be genome dependent in
ways that we don’t really understand,” says
Rokhsar.
The sea squirt is a good example. Human
genomes vary between individuals at a rate
of about 1 base pair per 1,000, explains
Rokhsar. Sea squirts are much more polymorphic: about 1 in every 50–100 base pairs
differ between homologous chromosomes.
When an assembler encounters reads that
are slightly different from each other, it must
decide whether the reads are derived from
the same locus or from repetitive regions.
Faulty assumptions about rates of polymorphism can cause assemblers to drop genes,
particularly members of closely related gene
families.
Current data formats force genome
assemblies to be inaccurate, says Jaffe. For
example, he says, it may be clear that a locus
contains a string of thymines, but not how
many. Or scientists may know that a section is repeated but not how many times,
or that one locus is highly variable. Such
information is hard to include in an assembly because the current data format, called
FASTA, cannot represent such uncertainties,
explains Jaffe, who is working with the
Assemblathon group on a new version,
called FASTG, that will “let assemblers show
what the possibilities are.”
Taking up the right data
GAGE evaluated how much better genome
assemblers performed if protocols included
additional error-correction steps to remove
faulty reads before assembly. Sequencing
machines themselves are equipped with
computational filters to remove misread
sequences as well as those that contain
sequences from artifacts of library preparation and contaminating bacteria, but
these filters aren’t perfect, says Salzberg.
“If you have a read that has even two or
three bases that don’t belong, then as soon
as that read gets put into a contig, the contig can’t be extended.” Even small errors on
1% of the relevant reads can break up the
assembly, he says. Including additional
error-correction algorithms produced
bigger N50s and also reduced rates of
misjoining.
And some of the most important
work occurs before sequencing starts.
Researchers should make sure to minimize
sequencing errors, get high enough coverage, and get long enough reads and properly
spaced paired reads.
“Everyone is talking
about the assembly,
but that depends on
the sequencing, and
that depends on the
library [which is fed
into the sequencer],”
says Korf.
Assemblies
might also improve “If you are trying to
get the best assembly,
i f a s s e m b l e r s you should run
were designed to multiple assemblies
incorporate more multiple times,” says
kinds of data. “We Steven Salzberg.
used transcribed
RNA in the past to correct and improve
Sanger assemblies,” says Salzberg, “but it
is not yet part of any production-ready
assembler [that uses short reads].” As part
of Assemblathon 2, contestants had access
to multiple kinds of data, such as sequence
reads produced by different sequencing
technologies. However, data outside short
reads are underutilized, says Korf.
Dealing with ambiguity
Biologists can still use overall metrics
to get a sense of how cautious to be,
says Gene Robinson, an entomologist
at the University of Illinois in UrbanaChampaign, who worked with Salzberg on
GAGE and is also leading the i5K effort.
“Two things that biologists need to know
about de novo assembly are ‘How much
of the genome is estimated to be included
in the assembly?’ and ‘How many different unconnected pieces does the assembly involve?’” he says. Those parameters
indicate how easy it will be to perform
comparative, functional and evolutionary
analyses on a genome sequence.
If a particular area of the genome seems
to be poorly assembled, targeted sequencing could be considered, says Felsenfeld.
In some cases, it will make sense to home
in on genomic regions of high biological interest, perhaps propagating certain
regions in fosmids or bacterial artificial chromosomes. Such studies are too
expensive to be conducted over the whole
genome, he says, but could be worthwhile for some regions. “Perfection is
impractical,” he says. “Do the best you can,
and then refine it.”
No matter what
sequencing technology is used to
build a genome,
biologists should
tr y to anticipate
just what might be
wrong with their
“Taking two
assemblies and
assemblies (Box 1).
determining which
“Rea listica lly
is the best is not an
speaking, most
easy question,” says
genomes are never
Deanna Church.
going to get the polishing that human
and mouse got,” says Church. And even
those well-characterized genomes contain
major omissions. ‘Polishing’ efforts on the
final mouse genome revealed nearly 140
megabases of new sequence. Moreover,
thousands of genes in the refined regions
were evolutionarily recent and specific to
mice; high levels of duplication had made
them resistant to assembly 5 . In other
work, Evan Eichler of the University of
Washington and colleagues found that
a de novo assembly of a human genome
was missing 420 megabases of repeated
sequence and over 2,000 protein-coding
exons6.
Ideally, genomicists should work out
more metrics for particular regions of the
genome, not just for the genome as a whole,
says Felsenfeld. “People like to talk about an
absolute quality, but there is none,” he says.
“You have to ask about the quality relative
to likely uses.”
Monya Baker is technology editor for
Nature and Nature Methods
([email protected]).
1. Pagani, I. et al. Nucleic Acids Res. 40, D571–579
(2012).
2. Parra, G., Bradnam, K., Ning, Z., Keane, T. &
Korf, I. Nucleic Acids Res. 37, 289–297 (2009).
3. Salzberg, S.L. et al. Genome Res. 22, 557–567
(2012).
4. Earl, D. et al. Genome Res. 21, 2224–2241 (2011).
5. Church, D.M. et al. PLoS Biol. 7, e1000112 (2009).
6. Alkan, C., Sajjadian S. & Eichler, E.E. Nat.
Methods 8, 61–65 (2011).
npg
© 2012 Nature America, Inc. All rights reserved.
technology feature
nature methods | VOL.9 NO.4 | APRIL 2012 | 337