Transcriptional Control of the Factor IX Gene: Analysis of Five Cis

From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
Transcriptional Control of the Factor IX Gene: Analysis of Five Cis-Acting
Elements and the Deleterious Effects of Naturally Occurring
Hemophilia B Leyden Mutations
By David J. Picketts, Christopher R. Mueller, and David Lillicrap
Hemophilia B Leyden is a rare form of inherited factor IX
deficiency in which patients experience spontaneous postpubertal recovery of factorIX levels. The mutations resulting
in this disorder are localized in a 40-nucleotide region encompassing the major transcriptional start site for factor IX.
Here we report the further
characterization offive cis-acting
elements inthe factor IX promoter and the
effects on protein
binding and transcriptional activation of fiveLeyden mutations (at nucleotides +13, -5, -6, -20, and -26) that occur
within the proximal three
elements (sites1 through 3). Bandshift studies using nuclear extracts from four different rat
tissues have shown that atleast some of the proteinsbinding to each of the five sites are ubiquitous in nature. The
pattern of DNA binding at site 1 suggests that thiselement
plays an important role in mediating the liver-specific expression of factor IX. Additional studies with liver nuclear
extracts obtainedat several different points in development
have shown an increase in DNA binding at sites 1, 4, and 5
between 1 day and 1 week. Using DNase I footprint analysis
and competition bandshift studies, we have shown that the
binding of nuclear proteins t o each of the mutant sites is
disrupted to a variable extent. There appears t o be some,
although reduced, protein bindingt o all of the mutant oligonucleotides apart from the-26 mutant. In vitro transcription
assays have shown that each of the mutations reduces the
global proximal promoter activity by
-40%. Two double
mutant promoters did not show
any additional downregulation in the in vitro transcription assay. In experiments designed t o assess the relative transcriptional activity mediated from each of the five sites independently, we have
tested artificial homopolymer promoters of each site in the
in vitro transcriptionassay. Thesestudies show thatsites 4
and 5 are the strongest activators and that transactivation
from site5 is furtherenhanced by the albumin
D site-binding
protein. In summary, these investigations show deleterious
bindeffects of each of the Leyden mutations tested on the
ing of trans-acting factors andalso show disruptionof transcriptional activation in a functional in vitro transcription
assay. Our results also show thatcis-acting elements 4 and
5 are the principal activators of this locus.
0 1994 b y The American Society of Hematology.
F
and in some instances, into the lower range of normal (normal, 0.5 to 1.5 U/mL). In contrastwith the postpubertal
recovery seen in all other cases of this disorder, there is one
report of a patient with a mutation at nucleotide -26 who
did not recover factor IX activity after puberty.’’
ThefactorIX
proximal promoter is comprised of five
cis-acting DNA elements.’’ It lacks anidentifiable TATA
sequence and has a reverse CCAAT box sequence between
1 and 5 have been shown
nucleotides -92 and -96. Sites
to bind the liver-enrichedtranscription factor CCAAT/enhancer binding protein (Y (CEBPa), whereas site 5 binds an
additional unidentified protein.’* Site4 is aconsensus nuclear
factor 1 (NF 1) site, and site 3 contains botha consensus
androgen response element anda consensus sequence for
the liver-enriched factor, hepatocyte nuclear factor 4 (HNF4).All of the currentlyidentifiedLeydenmutationsfall
within sites I , 2, and 3, which are the three proximal sites
in the promoter. Recent work has focused on defining the
mechanism responsible for the recovery of factor IX activity
after the onset of puberty. Mutations at both + 13 and -6
result in decreased transcriptional activity when a C E B P a
expression plasmid is cotransfected in transient transfection
experiments.‘j More recently, two reports have suggested that
the -20 mutation affects HNF-4 binding and transactivation,
but not the activity of the androgen receptor; the -26 mutation appears to affect binding and, thus, transactivation by
both proteins.”,” The loss of androgen receptor binding has
been postulated as a mechanism for the lack of recovery of
the -26 mutationafterpuberty.
W e have recently shown
that synergy between C/EBPa and the albumin D site-binding protein (DBP) results in increased transcriptional activity
that compensated for a mutation at the -5 position.”
We now report a comprehensive analysis of the five cisacting elements in the factor IX promoter and describe the
results of experiments with five Leyden mutant promoters.
ACTOR IX IS a vitamin K-dependent glycoprotein that
is involved in the middle phaseof the intrinsic pathway
of coagulation. Inherited absence or dysfunction
of factor
IX results in the X-linked recessive bleeding disorder hemophilia B.’ The molecular pathology of hemophilia B is well
documented.’ Approximately 95% of the documented factor
IX mutations are point mutations and short nucleotideadditions and deletions. In addition to the many heterogeneous
mutations found throughout the protein coding region, there
have been several point mutations described withina 40nucleotide regionencompassing the major transcriptional
start site of the factor IX p r ~ m o t e r . ”These
~
mutations give
rise to a similar phenotype known as hemophilia B Leyden.
Hemophilia B Leyden is characterized by severe or moderately severe factor IX deficiency before puberty.“’ After
puberty, factor IX activity and antigen levels gradually increase, resulting in resolution of the clinical bleeding disorder in adulthood as levels rise to greater
than 0.30 U/mL
From the Departments of Pathology and Biochemistry, Queen’s
University, Kingston, Ontario, Canada.
Submitted March 5, 1994; accepted July 7, 1994.
Supported by grants from the Canadian MRC (to D.P.L. and
C.R.M.). D.J.P. and D.P.L. are recipients of Research Fellowship
and Career Scientist Awards, respectively, from the Ontario Ministry
of Health and C A M . is a Research Scientist of the National Cancer
Institute of Canada.
Address reprint requests to David Lillicrap, MD, FRCPC, Deparfment of Pathology, Richardson Laboratory, Queen’s University,
Kingston, Ontario, Canada K7L 3N6.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with I 8 U.S.C. section 1734 solely to
indicate this fact.
0 1994 by The American Society of Hematology.
0006-4971/!?4/8409-00$3.00/0
2992
Blood, Vol 84,No 9 (November l ) , 1994: pp 2992-3000
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
2993
FACTOR IX GENETRANSCRIPTION
In studies using nuclear protein extracts from a variety of
tissues, we have documented the tissue-specific binding of
proteins to all five cis-acting sequences. In addition, using
liver nuclear extracts, we have examined the developmental
changes in the pattern of gel-retarded complexes at each of
the five sites. In studies of the mutant promoters, we have
shown decreased binding of trans-acting factors to the mutant cis-acting sequences and have documented, in a quantifiable in vitro transcription assay, that all the mutations result
in decreased transcriptional activity. We have also shown
that sites 4 and 5 are the strongest activators at this locus
and that transactivation from site 5 can be further enhanced
by the transcription factor DBP.
MATERIALS AND METHODS
Plasmid constructs. The factor IX wild type (WT) and -5 mutant pUC plasmids were described previously.’* They encompass
nucleotides -285 to +21 ofthe factor IX promoter. For in vitro
transcription reactions, the WT- and -5-pUC plasmids were digested
with HindIII and Sac I and purified on low melting-point agarose.
These fragments were then cloned into the G-freenATA vector
derived from the Alu-7 plasmid described in Gorski et a1.I4 To
prepare this vector, the sequence containing the -35 to +22 region
of the albumin gene and the G-free cassette was amplified by polymerase chain reaction (PCR) and cloned into the Sac I and EcoRI
sites of the pBS’ vector (Stratagene, La Jolla, CA). This produces
a vector with the pBS+ multilinker from HindIII to Sac I, upstream
of the albumin TATA sequence and the G-free cassette. Inclusion
of the albumin TATA sequence in this construct was required after
initial studies of the native TATA-less factor IX promoter showed
products derived from multiple transcriptional start sites. The WT
G-free construct was used asa template to construct the other Leyden
mutants by site-specific PCR mutagenesis using the method of Jones
and Howardi5 with the modifications described below. The mutant
oligonucleotides used were: F9 A+ 13G: 5’-ACCACTTTCACAGTCTGC; AAAGTGTCAGACGTGGTG-5’;F9 A-5T: 5”GGTACAACTAATCGTCCIIT, TTGATTAGCAGGAACCATG-5’;F9
G-6C: 5”GGTACAACTAATCCACCTTA; TTGATTAGGTGGAAT-5‘; F9 T-20A: 5”AGCTCAGCTTGTACTTAGGT; TCGAACATGAATCCA-5’; F9 G-26C: 5”AGCTCAGCTTCTACTTTGGT; and TCGAAGATGAAACCA-5’.
Fragments spanning the multilinker cloning site were amplified
using the mutant primer and the universal reverse-sequencing primer
in one reaction and the complementary mutant primer and a primer
located at the 3’ end of the G-free cassette in the second reaction.
Amplifications were in I X Vent DNA polymerase buffer (New England Biolabs, Beverly, MA) with 200 pmoVL each deoxynucleotide
triphosphate (dNTP), 50 pmol of each primer, 42 ng template DNA,
and 2 U Vent DNA polymerase. The reaction mix was denatured
for 2 minutes at 99°C before 25 amplification cycles (denatured at
99°C for 30 seconds, annealed at 55°C for 30 seconds, and extended
at 72°C for 1 minute). One microliter from each reaction was then
added to a final PCR reaction mix containing 50 pmol of the reverse
sequencing primer and the 3‘ G-free primer. The full-length product
was amplified by an initial five-cycle reaction (97°C for 30 seconds,
37°C for 30 seconds, and 72°Cfor 1 minute) followed by the 25-cycle
reaction described above. The PCR products were then digested with
EcoRI and HindIII, purified on low-gelling-temperature agarose and
cloned into PBS’ (Stratagene). The G-freeRATA clones were then
digested with HindIII and Sac I and cloned into PBS+.
Nuclearextractpreparations.
Nuclear extracts were prepared
from adult-rat tissues (liver, spleen, kidney, and brain) at a concentration of 5 to 10 pgIpL, according to Gorski et al (1986),j4 with
the modifications described in Maire et a1 (1989).16 Additional liver
nuclear extracts were prepared from male rats at l day, 1 week, 2
weeks, and 1 month of life.
In vitro transcription. The in vitro transcription assays were
performed as described in Gorski et al (1986).14The individual factor
IX promoter sites were ligated unidirectionally to obtain oligomers
of 11 copies for site 2, 9 copies for sites 1 and 4,and 5 copies for
sites 3 and 5. The fragments were filled in with Klenow and cloned
in front of the G-freeRATA cassette at the BamHI and Sal I sites
in the forward direction. The oligonucleotides used to make the
homopolymer constructs were described previously.’2
DNase Iprotection assays. Probes for DNase I protection assays
were prepared as described previously.lz The footprint assays were
performed as described in Lichtsteiner et al (1987)” except for the
following modifications. The binding reaction was incubated on ice
for 15 minutes before DNase I digestion. DNase I digestion was for
2 minutes with the probe alone. The DNase I digestion was stopped
by the addition of 200 pL of a solution containing 100 mmoVL
TRIS (pH 7.5). 10 mmoVL EDTA, 100 mmol/L NaC1, and 0.1%
sodium dodecyl sulfate. Proteinase K (100 pg) and yeast tRNA (10
pp) were added to the samples and digested for 30 minutes at 37°C.
Gel mobility shz$ and supershift assays. Gel mobility shift
assays were performed as described in Lichtsteiner et al (1987)”
except that the binding reactions were incubated for 15 minutes on
ice before the samples were loaded on a 6% nondenaturing polyacrylamide gel. One microgram of nuclear extract was used for each
binding reaction. In the competition assays, the unlabeled competitor
oligonucleotide was added to the binding reaction at the same time
as the labeled oligonucleotide probe for each site. In the site-l supershift experiment, 1 pL of each of the four antitranscription factor
antisera was added I O minutes after the addition of nuclear extract
and the incubation was continued for 10 minutes on ice (CEBPa
antibody was a gift from Dr Steve McKnight [Howard Hughes Research Laboratories, Carnegie Institution of Washington, Baltimore];
CEBPP and C/EBP6 antibodies were purchased from Santa Cruz
Biotechnology Inc [Santa Cruz, CA]; and the DBP antibody was a
gift from Dr Ueli Schibler, [University of Geneva, Geneva, Switzerland]).
RESULTS
The occurrence of natural mutations in the factor IX promoter, which result in a similar developmentally regulated
phenotype, provides a unique opportunity to study the function of this clinically significant promoter. We now present
new information relating to the five cis-acting elements in
the promoter by examining the tissue-specific and developmental regulation of the factors interacting with these sites
and have assessed the effect of five different Leyden mutations on the binding of these proteins and on in vitro transcription.
Tissue and developmental bandshifi assays. Previous reports assessing the pattern of trans-acting proteins binding
to the factor IX promoter have used a variety of purified and
recombinant protein preparations as well as liver nuclear
extracts. In this study, we have used bandshift assays employing nuclear extracts from four different tissues (liver,
spleen, kidney, and brain) and a human hepatoma cell line
(HepG2) to assess the tissue specificity of the factors binding
to all five of the cis-acting sites (Fig 1A). A very heterogeneous complex is formed between site l and factors present
in the liver, with no discernible difference between extracts
prepared in the morning and at night. Several more distinct
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
2994
B
PICKETS, MUELLER, AND LlLLlCRAP
I
( I d l w 2w l m Ad Id l w 2wlm
I I I I I I I I I
Site 4
Site 3
Site 2
Site 1
I
Ad Id l w 2w l m Ad
I I I I I I
I Idlw
I
Site 5
2w l m Ad
I
I
I
I
IId
I
l w 2w Im Ad
I I I I
l
7
C
I
2
3
U1
ANTI-SERA TO
0DBP
C/EBP
U
cn
z
a
S
Supershift
Bound
Fig 1. (A) Results of bandshift assays using radiolabeled oligonucleotide probes corresponding t o sites 1 through 5 and nuclear extracts (1
pglreaction) prepared from various adult-rat tissues anda human hepatoma cell line. Lane designations are B, brain; K, kidney; S,spleen; HG.
HepG2 cells; L
A
, liver (morning sample); LP, liver (evening sample). Gel-retarded complexes can be seen with each of the five sites and all
tissues and the cell linestudied. (B) Results of a developmental bandshiftassay using male rat liver
nuclear extracts (1 pglreactionl obtained
at 1 day, 1 week, 2 weeks, 1 month, and adulthood. Apart from the increase in complex formation from l day t o 1 week seen at sites 1,4,
and 5, similar gel-retarded complexes are seen at all developmental time points with radiolabeled probes corresponding t o all five of the
promoter elements. (C) An antibody supershift analysis of site 1, with rat-liver nuclear extracts. The left-hand lane shows the patternof gelretarded protein-DNAcomplexes without the additionof antisera, and the foursubsequent lanes show the patternof bound and supershifted
complexes after incubation with antibodies t o CIEBPrr, ClEBPp, ClEBP6,and DBP. A densitometric quantificationof the bound and
supershifted
404b. CIEBPP 20%. and DBP 5%.
complexes shows that the relative contributions
t o binding at site1 are ClEBPcr
-
complexes are formed with factors present in other tissues
and in the dedifferentiated HepG2 extracts. In each case, the
complexes are significantly less abundant than the factors in
the liver (fivefold difference). The pattern of a DNA-protein
-
-
"smear" seen with the liver extracts at site 1 is typical of
a site that interacts with members of the C E B P family and
represents binding by a heterogeneous mixture of homodimers and heterodimers of these factors. This is consistent
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
FACTOR IX GENE TRANSCRIPTION
with the previous characterization of this site as ahighaffinity CIEBPa site:''
a finding thatis further substantiated
by the results of a supershift assay for CEBPa at this site
(Fig 1C). This analysis also indicates that site 1 binds C/
EBPp and DBP to a lesser extent.
Sites 2 and 3 are characterized by what appears to be a
discrete complex present in all of the extracts. Further analysis of these complexes by fractionation of the proteins on
heparin agarose indicates that the site 2 protein is likely a
single complex that elutes at 400 mmol/L NaCl. In contrast,
the factors binding to site 3 can be separated into two distinct
fractions eluting at 200 and 500 mmol/L NaCl. This observation is consistent with the fact that site 3 has previously
been characterized as binding both HNF-4 and the androgen
receptor.''.'3
Site 4 is known to bind NF 1,which is present in all
tissues, and the more abundant complex formed in the liver
is caused by the presence of more liver-specific forms of
this factor.I7Experiments with recombinant CIEBPa indicate
that this factor binds to this site to a limited degree." Site
5, in our previous studies, was shown to bind an unknown
factor in addition to CIEBPa. This unknown factor, which
forms a discrete complex, appears to be present in all of the
other tissues examined, suggesting that it may be a ubiquitous protein.
Examining the developmental regulation of all of these
sites in the liver indicates that asignificant induction of DNA
binding activity (threefold increase) occurs at sites l, 4, and
5 betweenday 1 and1 to 2 weeksof age (Fig 1B). This
is the periodwhenterminal
differentiation occursandis
associated with the induction of factors such as CIEBPP,
which binds to site 1. A second complex with site 3 was
also observed from 1 to 2 weeks of age. This is before
puberty in the rat and, thus,is unlikely to represent induction
of the androgen receptor. No specific changes are observed
between 1 month of age (pen-pubertal) and the adult, which
corresponds to the period in humans when
phenotypic recovery occurs. However, given the difficulty
of resolving multiple complexes at a given site, this finding is not unexpected.
Effect of Leyden mutations on protein binding. We recently reported that an Ato T transversion at nucleotide -58
greatly decreased the affinity for protein binding to site 2 of
the factor D( promoter in DNase I protection assays.'* To
determine if other Leyden mutations at each of the three
proximal sites disrupted protein binding to the corresponding
mutant sites and to assess the possible disruption of protein
binding to adjacent sites, we synthesized promoter templates
corresponding to mutations at + l 3 (A to G; site 1) , -6 (G
to C; site 2), -20 (T to A; site 3), and -26 (G to C; site 3).
Each of these templates was studied in DNase I footprint
assays using rat-liver nuclear extracts. All of the mutations,
with the exception of the substitution at + 13, resulted in the
loss of DNase I protection at the site in which the mutation
was located (Fig 2). The + l 3 mutation located in site 1 has
previously been shown to disrupt the binding of CIEBPCX.~
Repeating the footprints of the + l 3 mutant template with
both heat-treated extracts, which preferentially retain C/
EBPa activity, and with recombinant CEBPa showed that
CEBPa could notoccupy site 1whenthemutationwas
2995
present (data not shown). The footprint obtained with nonheat-treated extracts is presumably the result of other factors
such as CIEBPP binding to this site.
Oligonucleotides for sites 1 , 2 , 3 , and each of the Leyden
mutant constructs were radiolabeled and examined in gel
mobility shift assays for protein binding (Fig 3, A through
C).The +l3 and -5 mutant probes showed slightly reduced
complex formation compared with the WT probes (70% and
86% binding, respectively). In contrast, the -6, -20, and
-26 mutant oligonucleotides showedverypoorcomplex
formation (5%, 3 8 , and 0%, respectively). To assess the
relative affinities of the mutantsites, protein binding to radiolabeled WT oligonucleotides was competed with either WT
or mutant unlabeled oligonucleotides at 50 or 100 times the
WT probe concentration. The + l 3 oligonucleotide showed
poor competition, with a discrete retarded complex remaining even with a 100-fold
excess of the unlabeled mutant
competitor. This presumably represents the preferential competition of all of the other site-l binding factors with the
exception of CEBPcu, which forms the remaining complex.
The -5 oligonucleotide competed poorly for the site-2 complexand the -6 oligonucleotide showed no competition,
indicating that the -6 mutation has a more profound effect
on binding of the currently unknown protein that interacts
with site 2. Studies with the -20 and -26 oligonucleotides
showed markedly reduced competition compared with the
WT site-3 probe. Two other groups have shown thatoligonucleotides containing the -20 or -26 nucleotide change compete weakly (the -20 mutation) or not at all (the -26 mutation) for HNF-4 binding to this site.11313
In vitro transcription analysis of full-length mutant promoters. Having documented the disruption of protein binding at each of the mutant promoter
sites in footprint and
bandshift experiments, we have gone on to perform studies
to assess the functional consequences of this effect. An in
vitro transcription assay was used" in which the
WT and
mutant promoters were cloned upstream of a G-free vector
that contained the -35 to +22 region of the albumin gene
including the TATA box (G-Free/TATA cas~ette).'~
As described above, the inclusion of the TATA sequence in this
construct was required to produce a single discrete transcript
that could be readily quantified.The activity of the different
mutants was compared with the transcriptional activity of a
G-free cassette under the control of the adenovirus major
late promoter. Although this assay may have limitations in
exactly reflecting the magnitude of the in vivo effect of these
mutations, it is an excellent in vitro method for comparing
the relative effect on transactivation of each of the five promoter mutations.Figure 4 shows the results of a single experiment in panel A and the mean values obtained from five
experiments in panel B. All of the mutations resulted in a
decrease in transcriptional activity to 60%or less of the WT.
An additional examination of theactivity of two double
mutants ( + l 3 and -5 [sites 1 and 21, and -5 and -20 [sites
2 and 31) that retainthe function of sites 3 and1, respectively,
showed that they were not significantly more
debilitated than
the lowest of the two single mutations in each combination
(Fig 4B).
The extent of transcriptional disruption resulting from the
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
PICKETS, MUELLER, AND LILLICRAP
2996
WT
0 S 10300 S
-5
-6
-20
-26
+13
l0300 S 10300 S 1 0 3 0 0 S 1 0 3 0 0 S 1 0 3 0
51
I
2
i
1
.
Leyden mutations in this assay, compared with their in vivo
effects, suggests that other regulatory elements that are not
being tested in this system may also play a role in generating
the Leyden phenotype.
In vitro transcription analysis cfhomopolymeric elements.
To assess the independent transactivation potential of each
of the five cis-acting sequences in the proximal promoter,
oligonucleotides corresponding to each of the five sites were
concdtamerized and cloned into the G-freeRATA cassette.
This strategy has been shown previously to be an effective
method to characterize the role of individual cis-acting elements in a complex
The number of monomeric sites contained in each of the
constructs ranged from 5 to 1 1 . In the case of the albumin
promoter, previous studies have indicated that no significant
difference in transcriptional activation is evident in homopolymers containing between S and 12 copies of the monomeric site (unpublished data). The homopolymeric constructs were examined for promoter activity, standardized
with the adenovirus major late-promoter activity and compared with the activity of the G-FreeRATA plasmid that did
not contain an insert (Fig 5 , A and B). Sites 4 and 5 were
the strongest transactivators with site I also showing some
activity. The liver specificity of site-S-mediated transactiva-
Fig 2. DNase I footprint analysis of the W and
five mutant promoter constructs.
Increasing
amounts of protein have been incubated with each
promoter template (0 t o 30 p g from left to right).
The position of the five DNase l-protectedsequences
is shown at the left of the figure. Binding ofrat-liver
nuclear proteins is shown to be variably disrupted
at the sites of the mutations. In the -5, -6, and -20
mutant studies, obvious disruption of the footprints
at sites 2 and 3, respectively, is documented. In the
-26 mutant study, the footprint disruption is subtle
and is best observedin the 5-pg nuclear-extract lane.
The picture of the + l 3 mutant study shows persistence ofthe footprint inthe first half ofthis site (the
distal part of site 1 in the + l 3 construct has run off
the bottom of the gel because ofthe smaller size of
this construct; it is 5 nucleotides shorter than the
other templates). The continued protection at this
site is presumably caused byproteins other than C/
EBPtr that bind site 1 (eg, CIEBPPI.
tionis also supported by the observation that an in vitro
transcription assay performed with kidney nuclear extracts
shows only 18% of the activity seen with liver extracts
(data not shown). In this assay, sites 2 and 3 do not appear to
mediate independent transcriptional activation. These results
suggest that transactivation of the factor IX promoter is
mainly caused by the binding of factors to sites 4 and S , and
that the three proximal sites may play a different role in
mediating transcription from this locus.
Finally, in light of our previous observation concerning a
transcriptional recovery mechanism involving the peripubertal onset of expression of DBP, we studied the effect of this
trans-acting factor on each of the five sites in the in vitro
transcription assay. Recombinant DBP was added to the in
vitro transcription reactions of the homopolymer promoter
sites and transcriptional activation was quantified with reference to the adenovirus control transcript (Fig 5 , A and B).
Only site S showed an increase in transcriptional activity
with the addition of DBP.
-
DISCUSSION
In this study we have used a quantifiable in vitro transcription assay to examine the effects of various Leyden mutations on binding of cognate factors and on the efficiency of
N
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
FACTOR IX GENE
2997
Fig 3. Competitionbandshift
assays using
oligonucleotides
from sites 1through 3 of the factor IX promoter and rat-livernuclear extracts. Gel-retarded complexes are indicated by an arrow
to the left of the figure in each
instance. (A) Lanes 1 and 2 show
the binding of rat-liver nuclear
protein t o WT and + l 3 mutant
probes for
site
1. Lanes 3
through 6 show the results of
competition studies using a radiolabeled WT probe and molar
excesses, as indicated, of unlabeled WT and + l 3 mutant competitor oligonucleotides. (B1
Lanes 1 through 3 show binding
of radiolabeled WT, -5, and -6
oligonucleotides from site 2 of
the factor IX promoter. Competition bandshifts are shown in
lanes 4 through 9 with a radiolabeled WT probeandmolar
excesses,as indicated, of unlabeled
-5, and -6 oligonucleotides. (Cl Lanes 1 through 3
showbandshift assays with a
WT site-3 probeand -20 and
-26 mutant probes, respectively. Lanes 4 through 9 show
competition bandshifts using a
radiolabeled WT probe and molar excesses, asindicated, of
-20, and -26 mutant oligonucleotides.
L
FACIDR M PROMOTER SITE 1
WT.
WT.
FAC'IUK IX PROMOTER SITE 3
transcription of this gene. This assay uses rat-liver nuclear
extracts as a source of trans-acting factors to regulate transcription, and as such, may represent a more physiologically
relevant test of transcriptional activation than other models
based on cultured cells that may be deficient in critical transacting factors. First, the basis for the liver-specific expression
of factor IX was examined using bandshift assays with nuclear extracts from four different tissues in conjunction with
oligonucleotides corresponding to all of the factor IX elements. Only site 1 exhibited significantly more protein binding to it in the liver extracts. This is in keepingwiththe
previous identification of site I as a high-affinity CEBPa
binding site, a finding that we have confirmed in a supershift
assay in this study. Site S has also been identified as a C/
EBPa binding site" but in this study, the tissue-specific
differences in C/EBP binding are masked by the presence
of a non-tissue-specific protein whose identity is unknown.
Thus, from the results of this study and our previous report,
the primary tissue-specific elements for this promoter appear
to be sites I and S, with C/EBPa being the main tissuespecific regulator of this gene through these sites. Consistent
with this observation is the strong transcriptional activity of
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
PICKETS, MUELLER,ANDLILLICRAP
2998
+ l 3 -5
W+13 -5 -6 -20 -26 -5 -20
A
-
Alb
Experimental
Internal Control
B
Transcriptional Activity of the Leyden Promoters
I
I
I
Wild Type
I
Average Activity
( n = 5)
I Standard
Deviation
n-1
I
100
I 1 7
I
10
1
-5
I
64
1
9.4
2.1
.a
49
8.0
-20
-26
+ 13,-5
50
7.0
49
8.5
38
9.0
31
5.4
-F,
-90
1
children. However, we have observed no apparent changes
in the pattern of DNA binding activity at any of thefive
sites between the peripubertal period and adulthood, corresponding to the time when phenotypic recovery occurs in
hemophilia B Leyden.
Our previous report of a potential mechanismfor the spontaneous postpubertal improvement of the Leyden phenotype,
suggests that the liver-enriched transcription factor, DBP,
plays an important role in mediating this recovery.” In the
rat, the onset of DBP expression is in the peripubertal period,
and DBP levels are higher in older rats.I9 DBP appears to
mediate its effect through an enhancement of binding of C/
EBPa to the two distal promoter elements, with an especially
marked effect at site 5.’’ This effect may be masked in the
bandshift assays by the presence of other factors; however,
the addition of DBP to the in vitro transcription assay clearly
results in significant transcriptional enhancement solely from
site 5. In the context of the full-length promoter, wecan
A
+m
1
2
3
4
5
-
4
2
3
4
s
-
Fig 4. (A) Autoradiogram showing the results of a single in vitro
with a WT factor IX
transcription assay. The studies were performed
five mutant promoters(+13, -5, -6, -20, and -26).
promoter (W),
two double mutant promoters
(+13/-5 and -5/-20), a promoterless
G-free cassette, and the albumin promoter using rat-liver nuclear
extracts. In each case, the experimental transcript was quantified
after normalization with thecorresponding transcript under the control of the AdML promoter.(B) Tabulated results of five in vitro transcription assays using theWT and various Leyden mutant promoters.
The average transcriptional activity and standard deviation are detailed for each construct.
site S and, to a lesser extent, site I . Site 4, which binds a
liver-specific form of NF 1 as well as having a low affinity
for C/EBPa, also shows some activator function. Thus, it
appears that this site also contributes to a modest degree to
the overall tissue-specific activity of the factor IX promoter.
Levels of circulating factor IX show a changing developmental profile in normal subjects. Normal childhood levels
of factor IX arc about 7S% of adult levels.” These levels
increase by =2S% into adulthood and continue to increase
by = I % per year throughout life.”.” C/EBPa, which appears to be the prime regulator of this gene, is expressed in
the fetal liver and its level appears to stay relatively constant
after this point.”’ This likely establishes the basal transcriptional activity of the factor IX gene. The analysis of developmental liver nuclear extracts has shown a significant increase
in DNA binding activity between 1 day and 1 week, at sites
I , 4, and 5. Most of the increase at site 1 is caused by the
induction of CEBPP, which occurs at this time and is known
to bind to this site. Some of the increase in site 5 activity is
also caused by C/EBPP, but in addition, appears to involve
the induction of the unknown ubiquitous factor that also
binds to this site. These changes may be responsible for the
gradual increase in levels of factor IX that occur in normal
B
Transcriptional Activity of the Factor IX
Proximal Promoter Skes
Fdd Increase
Average Activity
+ DBP
In =31
GF construct
Site 1 (9 copies)
Site 2 (11 copies)
Site 3 (5 copies)
site 4 (9 copies)
Site 5 ( 5 copies)
1.19
I
1
1.9
6.82
1.o
6.08
3.1
Fig 5. (A) An in vimo transcription assay with rat-liver nuclear
extracts using homopolymers of the five cisacting
sequences in the
a promoterless G-free cassette (-1. The results
factor IX promoter and
on the right
of the autoradiogramhave been performed with recombinant DBP added t o the liver nuclear extracts. In each instance,
the experimental transcript has been quantified in relation t o the
corresponding control transcript directed by the AdML promoter.
(B)
Results of five in vitro transcription assays using the homopolymerized sites 1 through 5 of the factor IX promoter with In = 3) and
without (n = 6 ) added DBP.
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
2999
FACTOR IX GENE TRANSCRIPTION
Site
Site
Site
Site
Site
5
4
3
2
1
C/EBP a
C/EBP R
DBP
5'
C/EBP a
NF 1
AR
HNF-4
?
CiEBP a
ClEBP R
DBP
U3'
Leyden Mutations
Fig 6. Schematic diagram of the factor IX promoter showing the
five cis-acting sites examined in thisstudy and indicating the transacting factors, documented either inthis study or inother repOrts6.9.11.12.13t o bind to these sites.
postulatethat the increasedactivitymediated
fromsite 5
would likely lead to the general activation of transcription.
This observation further supports the importanceof this site
in the recovery of the mutant Leyden promoters and may
also play a role in the continued increase in factor IX levels
throughout adulthood seen in normal subjects.
We have shown that all five of the Leyden mutations that
we have studied result in decreased protein binding by both
DNase I protection assays and competition bandshift assays.
Using aquantifiable in vitrotranscriptionassay
we have
shown that these same mutations decrease the efficiency of
transcription of this gene by at least 40%. The ability of the
+ l 3 mutation to interfere
with
transcription,
despite
allowing other factors to still bind to site 1, indicates that
C/EBPa is the primary effector for this site. Both the -5
and -6 mutations have similar effects on in vitro transcription despite the -6 mutation being much more debilitated
inits binding of thesite-2factor.The
situation withthe
mutationsinsite 3 is more complicated. As expected, the
-20 mutation still binds some protein, presumably the androgen receptor, whereas the -26 mutation looses all binding activity. However, despitetheir differential bindingcapabilities, they are equally defective in promoter activity.
Double mutants, which incorporate two different mutations,
are no more defective than the single mutants.
In light of the peripubertal timing of recovery of the
Leyden phenotype, the role of androgens in this disorder has
been explored by several previous studies.'1,2s,26The results
of our experiments do not exclude
an effect of the androgen
receptor, which may further increase transcription from the
mutant promoters. However, we propose that
this effect may
not be through a direct enhancement of transactivation, but
rather by increasing protein binding to site 3, thereby improving the stability of the transcriptional initiation complex.
A similar role has been proposed for the progesteronereceptor, for whichexperimental
evidence hasbeenobtained
showingthatbinding
to a progesterone response element
facilitates the formation of a stable preinitiation complex,
thus augmenting transcriptional i n i t i a t i ~ n .In~ ~further support of this proposal, site 3 was not an activator of transcription with nuclear extracts in our homopolymer in vitro transcription assay. Factor IX is a TATA-less
and
details of the cis-acting elementsthat optimize the assembly
and stability of the general transcriptional apparatus in this
situation are lacking. A consensus initiator element'" does
not appear to be present, and one possibility is that elements
1 through 3 act together as a siteof assembly of the preinitiation complex. Understanding the role that androgensplay in
controlling the expression of factor IX is further complicated
by the factthat no one has documented strong
transactivation
from the native promoter
after cotransfection of an androgenreceptor expression plasmid,"
and finally, if the androgen
receptor had a strong effect on transcription of the factor IX
gene, one might expect to see lower levels of factor IX in
normal prepubertal males and differences in factorIX activity between males and females,neither of which is thecase."
In conclusion, our analysis of the independent contributions of each of the five cis-acting elements in the factor 1X
promotershows that thetwo distal elements, sites 4 and
5 , are the strongest mediators of transcriptional activation,
whereasthethreeproximalelements,
withinwhich
the
Leyden mutations have been described,appeartoact
by
anothermechanism.Postpubertalrecovery
of theLeyden
phenotype may bemediated by the combinationof increased
activation from site5 because of the onset ofDBP expression
and binding at site 3 of the androgen receptor (Fig 6). Our
data fromthe homopolymer in vitro transcription assays suggests that the role of androgen receptor binding at this site
may not be to directly transactivate this locus.
REFERENCES
I . Thompson AR: Structure, function, and molecular defects of
factor IX. Blood 67565, 1986
2. Giannelli F, GreenPM,HighKA,Sommer
S, LillicrapDP,
LudwigM,Olek
K, ReitsmaPH,GoossensM,Yoshioka
A,
Brownlee GG: Haemophilia B: Databese of pointmutationsand
shortadditionsanddeletions--Thirdedition,1992.NucleicAcids
Res 20:2027, 1992 (suppl)
3. Reitsma PH, Bertine RM, Ploos van Amstel JK, Riemans A,
BrietE:Theputativefactor
IX genepromotor in hemophiliaB
Leyden. Blood 72:1074, 1988
4. Reitsma PH, Mandalaki T, Kasper CK, Bertina RM, Briet E:
Two novel point mutations correlate with an altered developmental
expressionof blood coagulationfactor IX (hemophiliaBLeyden
phenotype). Blood 73:743, 1989
S. Crossley M, Winship PR, Austen DEG, Rizza CR, Brownlee
GC: A less severe form of Haemophilia B Leyden. Nucleic Acids
Res 18:4633, 1990
6.Crossley M, BrownleeGG:Disruption of a C E B P binding
site in thefactor 1X promoter is associatedwithhaemophilia B.
Nature 34S:444, 1990
7. Royle G, Van De Water NS, Berry E, Ockelford PA, Browett
PJ: Haemophilia B Leyden arising de novo by point mutation in the
putative factor TX promoter region. Br J Haematol 77: 19 I , I991
8. PickettsDJ,D'SouzaC,BridgePJ,LillicrapD:AnAtoT
transversion at position -S of the factor IX promoter results in hemophilia B. Genomics 12:161, I992
9. Reijnen MJ, Peerlinck K, Maasdam D, Bertina RM, Reitsma
PH: Hemophilia B Leyden: Substitution o f thymine for guanine at
position -21 results in a disruption of a hepatocyte nuclear factor 4
binding site in the factor IX promoter. Blood 82: 1S I , I993
10. Briet E, Bertina RM, Van Tilburg NH, Veltkamp JJ: Hemophilia B Leyden:A sex linkedhereditarydisorderthatimproves
after puberty. N Engl J Med 306:788, 1982
I 1. Reijnen MJ, Sladek FM, Bertina RM, Reitsma PH: Disruption
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
3000
of a binding site for hepatocyte nuclear factor 4 results in hemophilia
B Leyden. Proc Natl Acad Sci USA 89:6300, 1992
12. Picketts DJ, Lillicrap DP, Mueller CR: Synergy between transcription factors DBP and C/EBP compensates for a haemophilia B
Leyden factor IX mutation. Nature Genet 3: 175, 1993
13. Crossley M, Ludwig M, Stowell KM, De Vos P, Olek K,
Brownlee GG: Recovery from hemophilia B Leyden: An androgenresponsive element in the factor IX promoter. Science 257:377, 1992
14. Gorski K, Carneiro M, Shibler U: Tissue-specific in vitro
transcription from the mouse albumin promoter. Cell 47:767, 1986
15. Jones DH, Howard BH: A rapid method for site-specific mutagenesis and directional subcloning by using the polymerase chain
reaction to generate recombinant circles. Biotechniques 8:178, 1990
16. Maire P, Wuarin J, Schibler U: The role of cis-acting promoter
elements in tissue-specific albumin gene expression. Science
244:343, 1989
17. Lichtsteiner S, Wuarin J, Schibler U: The interplay of DNAbinding proteins on the promoter of the mouse albumin gene. Cell
5 1:963, 1987
18. Sawadogo M, Roeder RG: Factors involved in specific transcription by human RNA poymerase 11: Analysis by a rapid and
quantitative in vitro assay. Proc Natl Acad Sci USA 824394, 1985
19. Mueller CR, Maire P, Schibler U: DBP, a liver-enriched transcriptional activator, is expressed late in ontogeny and its tissue
specificity is determined posttranslationally. Cell 61:279, 1990
20. van der Hoorn FA, Tamasky HA: Factors involved in regulation of the RT7 promoter in a male germ cell-derived transcription
system. Proc Natl Acad Sci USA 89:704, 1992
21. Andrew M, Vegh P, Johnston M, Bowker J, Ofosu F, Mitchell
PICKETS, MUELLER, AND LlLLlCRAP
L: Maturation of the hemostatic system during childhood. Blood
80:1998, 1992
22. Simpson NE, Biggs R: The inheritance of Christmas factor.
Br J Haematol 8:191, l962
23. Sweeney JD, Hoernig LA: Age-dependent effect on the level
of factor IX. Am J Clin Pathol 99:687, 1993
24. Birkenmeier EH, Gwynn B, Howard S, Jerry J, Gordon JI,
Landshulz WH, McKnight SL: Tissue-specific expression, developmental regulation, and genetic mapping of the gene encoding
CCAAT/enhancer binding protein. Genes Dev 3: 1146, 1989
25. Hirosawa S, Fahner JB, Salier J-P, Wu C-T, Lovrien EW,
Kurachi K: Structural and functional basis of the developmental
regulation of human coagulation factor IX gene: Factor 1X Leyden.
Proc Natl Acad Sci USA 87:4421, 1990
26. Yao S-N, DeSilva AH, Kurachi S, Samuelson LC, Kurachi
K: Characterization of a mouse factor IX cDNA and developmental
regulation of thefactor IX gene expression in liver. Thromb Haemost
65:52, 1991
27. Klein-Hitpass L, Tsai SY, Weigel NL, Allan GF, Riley D,
Rodriguez R, Schrader WT. Tsai M-J, O’Malley BW: The progesterone receptor stimulates cell-free transcription by enhancing the formation of a stable preinitiation complex. Cell 60:2427, 1990
28. Yoshitake S, Schach BG, Foster DC, Davie EW, Kurachi W:
Nucleotide sequence of the gene for human factor IX (antihaemophilic factor B). Biochem J 24:3736, 1985
29. Anson DS, Choo KH, Rees DJG, Giannelli F, Gould K, Huddleston JA, Brownlee GG: The gene stucture of human anti-haemophilic factor IX. EMBO J 3:1053, 1984
30. Smale ST, Baltimore D: The “Initiator” as a transcription
control element. Cell 57:103, 1989
From www.bloodjournal.org by guest on June 14, 2017. For personal use only.
1994 84: 2992-3000
Transcriptional control of the factor IX gene: analysis of five cisacting elements and the deleterious effects of naturally occurring
hemophilia B Leyden mutations
DJ Picketts, CR Mueller and D Lillicrap
Updated information and services can be found at:
http://www.bloodjournal.org/content/84/9/2992.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.