This information is current as
of June 14, 2017.
CD164 Monoclonal Antibodies That Block
Hemopoietic Progenitor Cell Adhesion and
Proliferation Interact with the First Mucin
Domain of the CD164 Receptor
Regis Doyonnas, James Yi-Hsin Chan, Lisa H. Butler, Irene
Rappold, Jane E. Lee-Prudhoe, Andrew C. W. Zannettino,
Paul J. Simmons, Hans-Jörg Bühring, Jean-Pierre Levesque
and Suzanne M. Watt
References
Subscription
Permissions
Email Alerts
This article cites 41 articles, 27 of which you can access for free at:
http://www.jimmunol.org/content/165/2/840.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2000 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
J Immunol 2000; 165:840-851; ;
doi: 10.4049/jimmunol.165.2.840
http://www.jimmunol.org/content/165/2/840
CD164 Monoclonal Antibodies That Block Hemopoietic
Progenitor Cell Adhesion and Proliferation Interact with the
First Mucin Domain of the CD164 Receptor1
Regis Doyonnas,* James Yi-Hsin Chan,* Lisa H. Butler,* Irene Rappold,*
Jane E. Lee-Prudhoe,* Andrew C. W. Zannettino,† Paul J. Simmons,‡ Hans-Jörg Bühring,§
Jean-Pierre Levesque,‡ and Suzanne M. Watt2§
R
ecently, we have identified and cloned human CD164, a
novel 80- to 100-kDa type 1 transmembrane sialomucin
that is highly expressed on primitive CD34⫹ hemopoietic
progenitor cells (1– 4) (J.Y.-H. Chan et al., manuscript in preparation). Analyses of transfectants expressing human CD164 have
allowed the identification of at least four mAbs, 103B2/9E10,
105A5, N6B6, and 67D2, that specifically recognize this sialomucin (1– 4). Of these, the interaction of the 103B2/9E10 mAb with
the CD164 receptor inhibits the adhesion of CD34⫹ cells to bone
marrow stromal cells in vitro (1). Interestingly, similar interactions
with the 103B2/9E10 or 105A5 mAbs inhibit the proliferation and
differentiation of primitive CD34⫹ erythroid and granulocytemonocyte progenitors in colony forming assays (J.Y.-H. Chan et
*Medical Research Council Molecular Haematology Unit, Institute of Molecular
Medicine, John Radcliffe Hospital, Headington, Oxford, United Kingdom; †Hanson
Centre for Cancer Research, Adelaide, Australia; ‡Stem Cell Laboratory, Peter MacCallum Cancer Institute, Melbourne, Australia; and §Medizinische Universitätsklinik
II, University of Tubingen, Tubingen, Germany
Received for publication December 15, 1999. Accepted for publication April
25, 2000.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by the United Kingdom Medical Research Council, the
United Kingdom Leukaemia Research Fund, SmithKline Beecham, INTAS/RFBR,
E. U. Biotech. Framework 4, and Taiwan Government Grants (to R.D., J.Y.-H.C.,
L.H.B., I.R., J.L.-P., and S.M.W.), National Health and Medical Research Council of
Australia (to A.C.W.Z., P.J.S., and J.-P.L.), and Deutsche Forschungsgemeinschaft
SFB 510, Project A1 (to H.J.B.).
2
Address correspondence and reprint requests to Dr. Suzanne M. Watt, Medical
Research Council Molecular Hematology Unit, Institute of Molecular Medicine, The
John Radcliffe Hospital, Headington, Oxford, United Kingdom OX3 9DS. E-mail
address: [email protected]
Copyright © 2000 by The American Association of Immunologists
al., manuscript in preparation) and prevents the recruitment of
CD34⫹CD38low/⫺ cells into cycle in response to the cytokines,
IL-3, IL-6, stem cell factor (SCF),3 and G-CSF (1). All these results suggest that CD164 may act as a potent negative signaling
molecule for hemopoietic progenitor cell proliferation. The CD164
Ag, when analyzed with any of the four CD164 mAbs described
above, is expressed during ontogeny on CD34⫹ intra-aortic cell
clusters in human wk 4 –5 embryos and has been shown to be
expressed on primitive human hemopoietic progenitors from fetal
liver, cord blood, and bone marrow (4). The highest cell surface
expression of CD164 epitopes on these cells occurs on the more
primitive subset of CD34⫹ cells (CD34high, AC133high,
CD38low). It is also expressed on the vast majority of the
lin⫺CD34low/⫺CD38low/⫺ cells with the capacity for long term
repopulation of hemopoiesis in an in vivo fetal sheep model (4, 5).
CD164 expression is maintained at a lower level on the surface of
all the committed myeloid and erythroid progenitors, with low or
negligible levels of expression on mature peripheral blood neutrophils and erythrocytes (4). In contrast to their common distribution
pattern on hemopoietic progenitor cells, the CD164 epitopes defined by the 105A5 and 103B2/9E10 mAbs are differentially and
often reciprocally expressed on lymphoid cells, endothelia, postcapillary high endothelial venules, and basal/subcapsular epithelia in hemopoietic and nonhemopoietic tissues, while the N6B6 and 67D2
mAbs react with both the 103B2/9E10⫹ and 105A5⫹ cell subsets (4).
Differential epitope expression has also been described for other
members of the sialomucin adhesion receptor family, to which
3
Abbreviations used in this paper: SCF, stem cell factor; GAG, glycosaminoglycan; PCLP, podocalyxin-like protein; PSGL-1, P-selectin glycoprotein ligand-1;
MAdCAM-1, mucosal addressin cell adhesion molecule-1; GlyCAM-1, glycosylation-dependent cell adhesion molecule-1.
0022-1767/00/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
The novel sialomucin, CD164, functions as both an adhesion receptor on human CD34ⴙ cell subsets in bone marrow and as a
potent negative regulator of CD34ⴙ hemopoietic progenitor cell proliferation. These diverse effects are mediated by at least two
functional epitopes defined by the mAbs, 103B2/9E10 and 105A5. We report here the precise epitope mapping of these mAbs
together with that of two other CD164 mAbs, N6B6 and 67D2. Using newly defined CD164 splice variants and a set of soluble
recombinant chimeric proteins encoded by exons 1– 6 of the CD164 gene, we demonstrate that the 105A5 and 103B2/9E10
functional epitopes map to distinct glycosylated regions within the first mucin domain of CD164. The N6B6 and 67D2 mAbs, in
contrast, recognize closely associated and complex epitopes that rely on the conformational integrity of the CD164 molecule and
encompass the cysteine-rich regions encoded by exons 2 and 3. On the basis of their sensitivities to reducing agents and to sialidase,
O-sialoglycoprotease, and N-glycanase treatments, we have characterized CD164 epitopes and grouped them into three classes by
analogy with CD34 epitope classification. The class I 105A5 epitope is sialidase, O-glycosidase, and O-sialoglycoprotease sensitive;
the class II 103B2/9E10 epitope is N-glycanase, O-glycosidase, and O-sialoglycoprotease sensitive; and the class III N6B6 and 67D2
epitopes are not removed by such enzyme treatments. Collectively, this study indicates that the previously observed differential
expression of CD164 epitopes in adult tissues is linked with cell type specific post-translational modifications and suggests a role
for epitope-associated carbohydrate structures in CD164 function. The Journal of Immunology, 2000, 165: 840 – 851.
The Journal of Immunology
Materials and Methods
Primary Abs
The murine CD164 mAbs, 103B2/9E10 (mIgG3), 105A5 (mIgM), N6B6
(mIgG2a), and 67D2 (mIgG1), were prepared as previously described
(1– 4). The CD66 mAb, clone D14-HD11 (mIgG1), was obtained from the
Fifth Leucocyte Culture Conference (23). The CD33 mAb, clone WM-54
(mIgG1), was obtained from Dakopatts (Glostrup, Denmark). The PE-conjugated CD34 mAb, QBEND-10 (mIgG1), was purchased from Cambridge
Biosciences (Cambridge, U.K.). The CD34 mAbs, clone My10 (mIgG1)
and Tük-3 (mIgG3), were purchased from Becton Dickinson (San Jose,
CA) or were provided by Prof. D. Mason (LRF Center, Department of
Cellular Sciences, Oxford, U.K.), respectively. As comparative negative
controls, irrelevant mAbs of the mIgG1, mIgG2a, mIgM (Dakopatts), and
mIgG3 (Southern Biotechnology Associates, Birmingham, AL) isotypes,
unconjugated or PE conjugated, were used in place of primary Abs. Abs
were used as tissue culture supernatants or purified Ig fractions.
Human bone marrow stromal cells, CD34⫹ cell isolation, and
cell lines
All human cell samples were obtained with patient permission and with
ethical consent of the institutions or hospitals concerned. Human bone
marrow stromal cells were prepared and stained with the CD164 mAbs
using the immunofluorescence technique previously described (2, 4). Human CD34⫹ cells (⬎90% purity) were purified from fresh cord samples
provided by Prof. J. Hows (Southmead Hospital, Bristol, U.K.), using the
Miltenyi Biotech (Bergish Gladbach, Germany) miniMACS CD34 stem
cell isolation kit (2). The human KG1a, KG1B, THP-1, U937, CEM,
RPMI-1788, TF1, and 293T and the mouse MS.5 cell lines were cultured
as previously described (2, 4).
Sialidase and O-sialoglycoprotease treatment of cell lines
Clostridium perfringens sialidase was purchased from Roche (Mannheim,
Germany). Pasteurella haemolytica O-sialoglycoprotein endopeptidase
(O-sialoglycoprotease) was prepared by Cedarlane Laboratories (Hornby,
Canada) and was purchased from Accurate Chemical & Scientific Corp.
(Westbury, NY). For enzymatic treatment, 7 ⫻ 106 KG1a cells were incubated in 300 ␮l of PBS or RPMI with or without 0.1 U of C. perfringens
sialidase or 120 ␮g of O-sialoglycoprotease for 60 min at 37°C. Cells were
then washed with PBS containing 0.2% (w/v) BSA (PBS-BSA) and 0.1%
(w/v) sodium azide before flow cytometric analyses.
Flow cytometric analyses
All analyses were conducted at 4°C. The sialidase- or O-sialoglycoprotease-treated and the untreated cell lines were blocked with FcR-blocking
agent (Miltenyi Biotech) according to the manufacturer’s instructions and
then labeled with the CD164 mAbs; with the CD34 mAbs, Tük-3 and
My10; or with isotype-matched control mAbs followed by FITC-antiisotype-specific secondary Abs (Southern Biotechnology Associates) as
detailed above. Cells were also stained with PE-conjugated QBEND-10 or
an irrelevant PE-mIgG1 according to the manufacturer’s protocol. After the
addition of 2 ␮g/ml propidium iodide (Sigma, St. Louis, MO), cells were
analyzed on a FACSCalibur using CellQuest software (both from Becton
Dickinson, Sunnyvale, CA) (2). Experiments were repeated on at least
three independent occasions.
Generation of full-length CD164 cDNA splice variant constructs
CD164 isoforms were PCR amplified from templates subcloned in the
pMOS-Blue-T vector (Amersham, Aylesbury, U.K.) after the RT-PCR
analyses.4 The CD164(E1– 6) and CD164(E⌬5) cDNA templates were derived from human kidney, while the CD164(E⌬4) cDNA template was
derived from human spleen. PCR amplifications were conducted using the
Expand high fidelity PCR system (Roche) with 100 ng of the CD164(E1–
6), CD164(E⌬5), or CD164(E⌬4) cDNAs, and 1 ␮M concentrations of the
F164 forward primer (5⬘-3⬘ GATCGCGGCCGCCGCTGAGGACAC
GATGTCGCGG) containing a NotI restriction enzyme site and the reverse
R6BCD164 SpeI primer (5⬘-3⬘ GGACTAGTTTACAGAGT GTGGTA
ATTTCGT) containing a SpeI restriction site after the stop codon. The
samples were digested with NotI and SpeI restriction enzymes and subcloned into a similarly digested pEFBos-HPC4-TM vector (24) that removed the HPC4-TM sequence. Positive clones were sequenced as described below, and Maxipreps of each cDNA were prepared using the
Promega Megaprep separation protocol (Promega, Madison, WI) according to the manufacturer’s instructions.
Production of transient transfectants expressing CD164 cDNA
splice variants
The CD164 splice variant cDNAs were transfected into MS.5 mouse stromal cells at 40 –50% confluence using calcium phosphate as a facilitator
(2–10 ␮g of plasmid DNA/well of a 24-well tissue culture plate). At 2 days
post-transfection, cells were resuspended and washed twice in PBS and
lysed directly in 4⫻ modified Laemmli reducing sample buffer (0.05%
(w/v) bromophenol blue, 10% (v/v) glycerol, 0.5% (w/v) SDS, and 5 mM
DTT in 0.1 M Tris-HCl, pH 6.8) containing 1⫻ Complete protease inhibitors (Roche) and resolved by 6 or 10% SDS-PAGE before immunoblotting
as described below. Transiently transfected cells were also fixed in situ in
4
J. Y.-H. Chan, J. E. Lee-Prudhoe, B. Jorgensen, G. Ihrke, R. Doyonnas, A. C. W.
Zannettino, P. J. Simmons, V. J. Buekle, and S. M. Watt. Submitted for publication.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
CD164 belongs. The expanding family of sialomucin receptors
includes CD34, PCLP, PSGL-1 (CD162), CD45RA, MAdCAM,-1,
Sgp200, GlyCAM-1, and CD43 (reviewed in Refs. 6 –10). These
molecules are expressed on hemopoietic progenitor cells and/or on
associated stromal, macrophage, T lymphoid, and/or endothelial
cells in hemopoietic microenvironments, where they function in
regulating hemopoiesis, leukocyte trafficking, inflammatory responses, or T cell activation. They are all serine and threonine rich,
allowing the potential for extensive O-linked glycosylation. They
are either secreted or transmembrane molecules with the ability to
extend well above the glycocalyx to promote ligand interactions.
The diversity of these sialomucin receptors is further enhanced by
alternative splicing and by cell-specific glycosyltransferase-mediated sialyl, fucosyl, or sulfate modifications of their oligosaccharide side chains, which alter mucin function and allow it to be
regulated independently of the rest of the molecule (reviewed in
Refs. 6 –10). Epitope characterization of these receptors has been
very helpful in defining the relationship between the post-translational modifications occurring on these molecules and their specific distribution and functions in various tissues. Some of the sialomucins interact with selectin ligands in vitro, a process that may
be abrogated by sialidase or O-siaolglycoprotease treatment of the
sialomucin (reviewed in Refs. 6 –10). Their ligand specificities depend on post-translational modifications of the peptide or oligosaccharide side chains, which are tissue specific. For example, correct sulfation and glycosylation allow CD34, PCLP, GlyCAM-1,
Sgp200, and MAdCAM-1, to act as high affinity ligands for Lselectin on high endothelial venules of peripheral lymph nodes or
endothelia of Peyer’s patches (reviewed in Refs. 6 –10). Like
CD164, the PSGL-1, CD34, and CD43 sialomucins may also function as signaling molecules that regulate cell proliferation (11–18),
possibly by enabling other receptor-ligand interactions to occur.
These diverse functions are thought to be the result, at least in part, of
cell type- and stage-specific oligosaccharide modifications, particularly those involving sialylation (19 –22; reviewed in Refs. 6 –10).
In this article we report for the first time the identification of
novel isoforms of CD164 and of three classes of epitopes on the
CD164 sialomucin. Two of these, the class I and II epitopes, have
been shown previously to encompass sites that regulate the adhesion and proliferation of CD34⫹ cell subsets in vitro (1) (J. Y.-H.
Chan et al., manuscript in preparation). These epitopes are differentially glycosylated regions located on the N-terminal mucin-like
domain of the CD164 molecule that is encoded by exon 1 of the
CD164 gene. This study together with our previous analysis suggest
that these glycosylation-dependent epitopes are regulated through cell
type-specific post-translational modifications of CD164.
841
842
24-well plates using a 1-ml 50/50 mixture of acetone/methanol and stained
with each CD164 mAb or with an irrelevant isotype-matched control mAb
followed by HRP-conjugated goat anti-mouse Ig (Dakopatts) at a 1/1000
dilution (4). Cells were counterstained with Harris’ hematoxylin (Surgipath, Eynesbury, U.K.) and viewed under a Leitz inverted microscope
(Leica U.K. Ltd., Milton Keynes, U.K.). Images were captured on a JVC
3-CCD color video camera using the Neotech JVC application (Datacell,
Maidenhead, U.K.).
Triton X-100 insolubility studies
KG1a cells (8 ⫻ 104) were resuspended in 1% (v/v) Triton X-100 lysis
buffer (20 mM Tris-HCl, 1% (v/v) Triton X-100, 150 mM NaCl, and 1⫻
Complete protease inhibitors) and incubated for 30 min at 4°C. After centrifugation at 14,000 rpm for 15 min at 4°C, the supernatant or soluble
fraction and the pellet or insoluble fraction, resuspended by the addition of
250 ␮l of nonreducing 1⫻ Laemmli buffer, were collected. After the addition of Laemmli loading buffer containing 5 mM DTT, the lysate proteins
from both fractions were boiled for 5 min, resolved on 8% SDS-PAGE, and
immunoblotted as described above.
Generation of recombinant soluble chimeric proteins
in the culture supernatants were affinity isolated on protein A-Sepharose (4
Fast Flow; Pharmacia Biotec, Piscataway, NJ) and analyzed as described
previously (26).
Purification of CD164 native molecules from KG1a cells
A soluble fraction of detergent lysate was prepared from 2 ⫻ 108 KG1a
cells as described for Triton X-100 insolubility studies. This material was
passed twice over a 1-ml column of protein A-Sepharose. The unbound
material was then passed over a 1-ml protein A-Sepharose to which 1 mg
of purified N6B6 mAb had been bound and covalently coupled with dimethyl pimelimidate (Pierce, Rockford, IL). After washing with PBS containing 0.1% Triton X-100, the bound material was eluted with 100 mM
triethylamine containing 0.1% Triton X-100 and neutralized with 0.1 vol of
3 M Tris (pH 6.8); a 1/200 dilution of the resulting material was analyzed
on SDS-PAGE followed by Western blotting with CD164 mAbs.
Enzymatic treatment and immunoblotting of modified soluble
constructs
Five-microgram aliquots of the lyophilized CD164(E1–3)-Fc* and
CD164(E1– 6a)-Fc* constructs or a 1/50 dilution of lyophilized CD164
purified from KG1a cells were left untreated or were treated for 16 h at
37°C with N-glycosidase F (200 ␮U/ml; Flavobacterium meningosepticum
enzyme; Roche) in 10 mM sodium phosphate buffer, pH 6; with sialidase
(500 ␮U/ml C. perfringens enzyme; Roche) in 10 mM sodium phosphate
buffer, pH 6; with O-glycosidase (50 ␮U/ml Streptococcus pneumoniae
enzyme; Oxford Glycosystems, Abingdon, U.K.) in 100 mM sodium citrate/phosphate buffer, pH 6; with ␣-fucosidase (250 ␮U/ml bovine kidney
enzyme; Oxford Glycosystems) in 100 mM sodium citrate/phosphate
buffer, pH 6, separately or in combination for the removal of N- and Olinked carbohydrates. The soluble constructs CD164(E1–3)Fc* and
CD164(E1– 6a)-Fc* were also treated with 250 ␮g/ml O-sialoglycoprotease in PBS containing 1 mM CaCl2, pH 7.2. The CD33-Fc construct was
used as a negative control. All samples were heated for 5 min at 95°C in
2⫻ Laemmli sample buffer (5% (v/v) glycerol, 0.25% (w/v) SDS, and
0.025% (w/v) bromophenol blue in 0.05 M Tris-HCl, pH 6.8) with 5 mM
DTT and electrophoresed on 10% SDS-PAGE gels. One gel was stained
with Coomassie blue. Four gels were transferred onto polyvinylidene difluoride Immobilon membranes (Millipore, Watford, U.K.) at 9 V for 1 h
using a Semiphor semi-dry blot apparatus (Pharmacia Biotech) following
the manufacturer’s directions. The membranes were blocked overnight at
4°C in PBS-T (PBS with 0.05% (v/v) Tween-20) buffer plus 5% (w/v)
nonfat powdered milk and then incubated with primary Ab for 30 min at
room temperature. After washing in PBS-T, a peroxidase-conjugated goat
anti-mouse Ig (Dakopatts) Ab diluted 1/5000 in PBS-T was applied for a
further 30 min. Following extensive washing in PBS-T, blots were developed using the ECL system (Amersham) as described by the manufacturer.
ELISA analysis of proteins
Maxisorp 96-well Nunc (Life Technologies) or Immulon 4 (Dynatech, Dynal, Oslo, Norway) flat-bottom ELISA plates were coated with untreated or
enzyme-treated chimeric proteins (10 ␮g/ml) in PBS overnight at 4°C,
washed, and then blocked with PBS containing 2% (w/v) BSA (fraction V;
Sigma) and 0.02% (v/v) Tween-20 before incubation with CD164, CD66a,
and CD33 or appropriate isotype-matched negative control mAbs. The assays were developed with alkaline phosphatase-conjugated goat antimouse Ig (1/4000 dilution; Dakopatts) and para-nitrophenylpentene (Sigma), and the absorbance was read at 405 nm in a Bio-Rad model 450 plate
reader (Bio-Rad Laboratories, Hercules, CA) (2).
Competitive binding assays
Maxisorp plates were coated with CD164(E1–3)-Fc* and washed using the
same conditions as for the ELISA analysis. CD164(E1–3)-Fc*-coated constructs were then blocked with 103B2/9E10, 105A5, N6B6, or 67D2 as
undiluted tissue culture supernatants or with isotype-matched negative control Abs at 10 ␮g/ml. After washing, each CD164 mAb was added to the
preblocked constructs, and their reactivities were determined by the addition of FITC-conjugated anti Ig isotype-specific secondary Abs. The fluorescence was detected on a Cytofluor II microplate fluorescence reader
(PerSeptive Biosystems, Hertford, U.K.) using a wavelength of 485 nm for
excitation. The percent binding was calculated as follows: 100 ⫺ [(fluorescence reading for each CD164 mAb binding to the CD164(E1–3)-Fc*
protein in the presence of the blocking CD164 mAb) divided by (fluorescence reading for each CD164 mAb binding to the CD164(E1–3)-Fc* protein in the presence of the appropriate isotype matched negative control
mAb) ⫻ 100]. Results are presented as the mean ⫾ SD of triplicate determinations, and the experiment was repeated twice.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Soluble extracellular domain deletion cDNA constructs prepared on the
basis of the exon organization and containing regions encoded by exon 1
(CD164(E1)), exons 1 and 2 (CD164(E1–2)), exons 1–3 (CD164(E1–3)),
exons 1– 4 (CD164(E1– 4)), and exons 1– 4 plus the extracellular region of
exon 6 (6a; CD164(E⌬5)) were generated by PCR amplification of the
corresponding cDNA fragments from the CD164(E⌬5) cDNA in the
pGEM-T vector (1). Constructs containing exons 1–5 (CD164(E1–5)) and
exons 1– 6a (CD164(E1– 6a)) were produced from a template generated by
PCR amplification of the CD164(E1– 6) cDNA (J. Y.-H. Chan et al., manuscript in preparation) derived from a normal human colon sample (Clontech, Palo Alto, CA). PCR amplifications were conducted using the Expand
high fidelity PCR system (Roche). Oligonucleotide primers (Genosys Biotechnologies Europe, Cambridge, U.K.) containing NotI or XhoI restriction
enzyme sites (as underlined below) were used for PCR and were: F164
forward primer (5⬘-3⬘), GATCGCGGCCGCCGCT GAG GAC ACG ATG
TCG CGG for all the PCR amplifications plus one of the following reverse
amplification primers for each exon; R164(E1), ATCCCTCGAGGG TGC
CGG AGT GGT GAC CAG; R164(E2), ATCCCTCGAGTC TTT ACA
TTC TAT CCA AAA; R164(E3), ATCCCTCGAGAC GGA ACA GAA
GTC TGT CGT; R164(E4), ATCCCTCGAGGT AGA ATTGGC TGT
TGG CAC; R164(E5), ATCCCTCGAGGT TGT ACC TGA TGT AGT
AAC; and R164(E6a), ATCCCTCGAGAA GGT AGA CTT TCG CAC
AGG. The CD164(E1,2,4) and CD164(E1,3,4) cDNA constructs were produced using a two-step PCR strategy. In the first step, exon 1 (E1), exons
1 and 2 (E1,2), exons 3 and 4 (E3,4), and exon 4 (E4) were amplified
individually using as the respective forward primers: F164 F(E1, 3), ACC
ACT CCG GCA CCA GAT GAG AGC TAT TGT TCA; and F(E2, 4),
TGG ATA GAA TGT AAA GTT TCC ACG GCC ACT CCA; and as the
respective reverse primers: R(E1, 3), TGA ACA ATA GCT CTC ATC
TGG TGC CGG AGT GGT; and R(E2, 4) TGG AGT GGC CGT GGA
AAC TTT ACA TTC TAT CCA) and R164 (E4). To generate the
CD164(E1,2,4) cDNA, 5 ␮l of the E1, E2, and E4 PCR products were
allowed to anneal together for 10 min at 66°C and thus provided the template for the second step PCR. For the CD164(E1, 3,4) cDNA, 5 ␮l of E1
and E3,4 PCR products were annealed as described above and provided the
template for subsequent PCR amplification. These PCR amplifications
were conducted as described above using the F164 forward and R164(E4)
reverse primers for both constructs. Soluble recombinant chimeric extracellular domain cDNA Fc-mutated (Fc*) constructs were prepared by digesting the PCR with NotI and XhoI restriction enzymes and subcloning
these into the similarly digested IgMu/pEFBOS vector (24), which was
provided by Prof. P. Kincade (University of Oklahoma, Norman, OK) and
was designed to prevent FcR binding. The non-Fc-mutated constructs,
hCD66a-Fc (25) and hCD33(VC)-Fc (26), were prepared in the pIG vector
as previously described and used as controls in ELISA and Western blotting analyses. The cDNA inserts were sequenced on a Perkin-Elmer ABIPRISM 377 DNA sequencer (Perkin-Elmer-Applied Biosystems, Foster
City, CA) according to the manufacturer’s protocol using pEFBos forward
primer at position 1701–1718 bp (CTCAAGCCTCAGACAGTG), pEFBos
reverse primer at position 2845–2828 bp (GGGAGACCTGATACTCTC),
pIG specific forward and reverse primers (25, 26), or primers specific for
the cDNA sequences. The sequences were analyzed using Sequencher and
MacVector software programs (Oxford Molecular, Oxford, U.K.). The Fc
and mutated Fc* fusion plasmids were transfected into 293T cells at 70 –
80% confluence using calcium phosphate as a facilitator (25 ␮g of plasmid
DNA/15-cm diameter tissue culture plate). The Fc/Fc* chimeras produced
EPITOPE MAPPING OF CD164 FUNCTIONAL DOMAINS
The Journal of Immunology
843
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 1. Structure and sequences
of the CD164 isoforms. A, Schematic
representations of the CD164(E1– 6),
CD164(E⌬4), and CD164(E⌬5) sialomucins. u, mucin domains; 䡺, the cysteine-rich domain; 䡬, potential N-linked
carbohydrates; horizontal bars with or
without arrows, potential O-linked carbohydrates; arrows, potential sialic acid
motifs on O-linked carbohydrates. B,
cDNA of CD164(E1– 6) and its deduced amino acid sequences indicated
in triplet codons. E1 to E6 represent
exon-encoded domains. E6a, E6b, and
E6c are regions of exon 6 that encode
the extracellular domain, the transmembrane region (TM), and the cytoplasmic
tail, respectively. The two dark gray
boxes represent the two mucin domains. ‰, the cysteine residues; 䡬 , the
predicted O-linked carbohydrate residues; u , the predicted N-linked carbohydrate residues. The transmembrane
region is underlined and shadowed. The
putative glycosaminoglycan attachment
site is indicated in the lightly shaded
box, and the potential tyrosine kinase
phosphorylation site is shown by an asterisk. The GenBank accession number
is AF263279.
Immunoblotting of cell lysates
The equivalent of 8 ⫻ 10 exponentially growing cell lines or 1 ⫻ 10
cultured human bone marrow stromal reticular, cord blood CD34⫹ purified
cells or bone marrow mononuclear cells were resuspended in 1⫻ nonreducing Laemmli loading buffer (62.5 mM Tris-HCl, 2% (w/v) SDS, 10%
(v/v) glycerol, and 0.1% (w/v) bromophenol blue, pH 6.8) containing 1⫻
Complete protease inhibitors (Roche) plus 5 mM DTT as described above
and boiled for 5 min, and lysate proteins were fractionated using 6 or 10%
SDS-PAGE. The proteins were transferred to polyvinylidene difluoride Immobilon membranes and immunoblotted with either the CD164 mAbs or
isotype-matched negative controls as described above.
4
4
Results
Identification of three isoforms of CD164
We have defined the genomic structure of human CD164 (J. Y.-H.
Chan et al., manuscript in preparation) and have shown that this
gene comprises six exons (E1– 6) that undergo alternative splicing
to generate at least three isoforms. These are the full-length isoform,
CD164(E1– 6), the originally identified CD164 or CD164(E⌬5)
isoform that lacks exon 5, and the CD164(E⌬4) variant that has
exon 4 spliced out. The full-length isoforms are shown diagrammatically in Fig. 1A. The peptide encoded by exon 1 is predicted
to be heavily glycosylated with three potential N-linked glycosylation sites and nine potential O-linked glycosylation sites (Fig. 1).
This exon 1 generates the first mucin-like domain of CD164. Peptides encoded by exons 2 and 3 do not contain any predicted Olinked glycosylation sites, but each possesses two potential
N-linked glycosylation sites, and they contain all eight cysteine
residues from the extracellular domain. This defines the cysteine-rich
region that separates the two mucin domains. The second mucin-like
domain is defined by peptides derived from exons 4, 5, and 6, which,
like the exon 1-encoded peptide, is predicted to be very highly Oglycosylated, with six potential sites encoded on exon 4, 10 on exon
5, and seven on exon 6. In addition, peptides encoded by exons 4 and
6 have one potential N-linked glycosylation site each (Fig. 1). Thus,
CD164(E⌬4) and CD164(E⌬5) have a smaller second mucin domain
comparatively to the CD164(E1– 6) molecule. This CD164(E1– 6)
844
EPITOPE MAPPING OF CD164 FUNCTIONAL DOMAINS
molecule contains a putative membrane-proximal glycosaminoglycan
attachment site situated at the splice junction between peptides derived from exons 5 and 6. This is missing in the CD164(E⌬5)
isoform.
The CD164 mAbs do not distinguish between the different
CD164 splice variants but recognize distinct domains on CD164
Reactivity of mAbs with splice variants of CD164
FIGURE 2. Functional effects of the CD164 mAbs, 103B2/9E10 and
105A5, in vitro. A, Human bone marrow CD34⫹ cells (104) labeled with
51
Cr were incubated at 4°C in RPMI 1640 medium with 2% FCS containing 2 ␮g/100 ␮l of the CD164 mAbs, 103B2/9E10 and 105A5, or with a
cocktail of mAbs to the VLA-4 and VLA-5 integrins, P4C2 and PHM2, or
a cocktail of isotype-matched mIgG3 and mIgM nonbinding negative control mAbs and then transferred to each well of a 96-well plate containing
104 allogeneic cultured human bone marrow stromal reticular cells per
well. Unbound cells were removed, and adhesion was quantitated by liquid
scintillation counting of Triton X-100-solubilized lysates. Data are presented as the mean ⫾ SEM for three experiments as a percentage of the
control adhesion in the presence of the nonbinding mAb control, which has
been normalized to 100%. B, Human bone marrow CD34⫹ cells (103) were
cultured in triplicate in serum-deprived medium containing 10 ng/ml of
each of the recombinant human cytokines, IL-1␤, IL-3, IL-6, G-CSF, GMCSF, and SCF, in the presence of 10 ␮g/ml of the CD164 mAbs, 103B2/
9E10 and 105A5, or with isotype-matched mIgG3- and mIgM-negative
control mAbs. Additional factors and mAbs were added on days 7, 14, and
21 of culture. Nucleated cells were harvested on day 28 and counted. Data
are the mean ⫾ SEM (n ⫽ 3) of nucleated cells generated in the presence
of the negative isotype-matched control mAbs, which have been normalized to 100%. C and D, Human bone marrow CD34⫹ cells (103) were
incubated with 30 ␮g/ml of the CD164 mAbs, 103B2/9E10 and 105A5, or
the isotype-matched mIgG3 or mIgM negative controls for 1 h at 4°C. Cells
were plated in 0.9% methocel supplemented with 10 ng/ml each of recombinant human IL-1␤, IL-3, IL-6, G-CSF, GM-CSF, erythropoietin, and
SCF. Results are the mean ⫾ SEM for three experiments, expressed as a
percentage of the value in day 14 clonogenic cells, CFU-GM (C), or erythrocyte blast-forming units (BFU-E) (D), from cultures containing CD164
mAbs over those containing the negative isotype-matched mAbs, which
have been normalized to 100%. E, Terasaki wells were coated with 0.5 ␮l
of 30 ␮g/ml CD164 mAb, 103B2/9E10, with an isotype-matched negative
control mIgG3 mAb, or with an anti-␤1 integrin mAb, P4C2. Single
CD34⫹CD38low/⫺ human bone marrow cells were added to each well and
cultured in serum-deprived medium containing IL-3 (10 ng/ml), IL-6 (10
All four CD164 mAbs stain CD34⫹ hemopoietic cell subsets (1–
4), and as shown in Fig. 3A, they all stain cultured human bone
marrow stromal reticular cells. cDNAs encoding the three CD164
splice variants, CD164(E1– 6), CD164(E⌬5), and CD164(E⌬4),
were transiently transfected into the mouse stromal cell line, MS.5,
and their protein products were analyzed by immunohistochemistry and immunoblotting. All the CD164 mAbs reacted with the
splice variants produced by these cells, indicating that the epitopes
recognized by the 103B2/9E10, 105A5, N6B6, and 67D2 mAbs
were not located on or did not encompass peptides encoded by
exons 4 and 5. This is illustrated in Fig. 3B for two of the CD164
mAbs, N6B6 and 103B2/9E10. On Western blots probed with
103B2/9E10, 105A5, or N6B6, the apparent m.w. of the proteins
expressed by the splice variants varied slightly, but fell within the
range of 80 –100 kDa that is observed for CD164 on human bone
marrow, on bone marrow stromal reticular cells, on CD34⫹ hemopoietic progenitors, and on a set of hemopoietic cell lines representing different lineages. Examples of the protein products detected with these mAbs after SDS lysis of hemopoietic cell lines
are shown in Fig. 3C (lanes 1–7) and Fig. 4. These mAbs identified
the different CD164 epitopes on cell lines representing different
hemopoietic lineages to differing degrees, but were all strongly
reactive with the most immature CD34⫹ hemopoietic multipotential progenitor cell line, KG1a (Fig. 4A). This is consistent with our
findings that all CD164 epitopes identified to date are highly expressed on the most primitive CD34⫹ cell subsets from normal
bone marrow, cord blood, and fetal liver (1– 4). Some variability in
apparent m.w. was also apparent among the cell lines, with the
promonocytic cell line, THP-1 (Fig. 4A), and the myelomonocytic
cell line, HL60 (data not shown), exhibiting the lowest electrophoretic mobilities of SDS-PAGE. It is unclear from the present
studies if this molecular mass variability is due to glycosylation
ng/ml), G-CSF (100 ng/ml), and SCF (100 ng/ml). One hundred twenty
wells were analyzed for each set of conditions. Plates were monitored on
day 10 of culture to determine which cells underwent at least one cell
division. The data are expressed as the mean ⫾ SD percentage of dividing
cells compared with the mIgG3-negative control culture, which was normalized to 100%.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Our initial studies identified four mAbs, 103B2/9E10, 105A5,
N6B6, and 67D2, that recognize human CD164 when expressed in
FDCP-1 transfectants (1– 4). Two of the mAbs, 103B2/9E10 and
105A5, mediate functional effects in vitro (1) (J. Y.-H. Chan et al.,
manuscript in preparation). These effects, which are summarized in
Fig. 2, indicate that while the 103B2/9E10 mAb can partially inhibit the adhesion of CD34⫹ cells to bone marrow stroma (Fig.
2A), both the 103B2/9E10 and 105A5 mAbs inhibit nucleated cell
production in liquid cultures (Fig. 2B) and colony formation by
primitive granulocyte-monocyte (Fig. 2C) and erythroid (Fig. 2 D)
precursors in clonogenic assays from CD34⫹ cells. From single
cell studies, the 103B2/9E10 mAb has been shown to prevent recruitment of CD34⫹CD38low/⫺ cells into cycle in the presence of
IL-3, IL-6, G-CSF, and SCF (Fig. 2E).
The Journal of Immunology
845
FIGURE 4. Immunoblot analyses
of CD164 from hemopoietic cell
lines. A, TF1 (lane 1), KG1a (lane 2),
KG1b (lane 3), U937 (lane 4), THP1
(lane 5), CEM (lane 6), and RPMI
1788 (lane 7) cells, were lysed in
SDS-Laemmli lysis buffer containing
5 mM DTT and resolved by 10%
SDS-PAGE before immunoblotting
with N6B6, 103B2/9E10, or 105A5
as indicated below each blot. B, KG1a
cells were lysed with 1% SDS (lane
1) or 1% Triton X-100 (lanes 2 and
3). The Triton X-100-insoluble fraction was solubilized in SDS before
analysis. The distribution of the
CD164 monomer and dimer and the
⬎220-kDa complex between the Triton X-100-soluble (lane 3) and Triton
X-100-insoluble (lane 2) fractions
was assessed by immunoblotting with
the four CD164 mAbs as indicated
below each blot. The Mr markers were
the same as those shown in Fig. 3C.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 3. Expression of CD164
epitopes by stromal reticular cells and
MS.5 transfectants. A, Immunofluorescence staining of cultured human bone
marrow stromal reticular cells with
CD164 mAbs: mAb 103B2/9E10 (a),
mAb 105A5 (c), mAb N6B6 (e), and
mAb 67D2 (g). Isotype-matched negative
control mAbs for each CD164 mAb are
shown as insets (b, d, f, and h). B, MS.5
cells were transfected with CD164(E1– 6)
(a and e), CD164(E⌬4) (b and f),
CD164(E⌬5) (c and g), or left untransfected (d and h). Cells were stained with
either N6B6 (a– d) or 103B2/9E10 (e– h)
using the immunoperoxidase technique.
C, Immunoblot analyses of CD164. Nontransfected MS.5 cells (lane 1) or MS.5
cells transfected with the different CD164
splice variants are shown: CD164(E1– 6)
(lane 2), CD164(E⌬4) (lane 3), and
CD164(E⌬5) (lane 4) were lysed in Laemmli SDS lysis buffer containing 5 mM
DTT and immunoblotted with N6B6
(lanes 1– 4). Human bone marrow cells
(lanes 5 and 8), CD34⫹ purified cord
blood cells (lanes 6 and 9), or cultured
bone marrow stromal reticular cells
(lanes 7 and 10) were lysed and immunoblotted with N6B6 (lanes 5–7) or 67D2
(lanes 8 –10). Molecular mass markers
were myosin (220 kDa), phosphorylase b
(97.4 kDa), BSA (69 kDa), OVA (46
kDa), and carbonic anhydrase (31 kDa).
846
EPITOPE MAPPING OF CD164 FUNCTIONAL DOMAINS
Reactivity of mAbs with CD164 domain truncation mutants.
To characterize the epitopes recognized by the different CD164
mAbs, a set of nine domain truncation mutants were produced in
293T cells: CD164(E1)-Fc*, CD164(E1–2)-Fc*, CD164(E1–3)-Fc*,
CD164(E1– 4)-Fc*,
CD164(E1–5)-Fc*,
CD164(E⌬5)-Fc*,
CD164(E1– 6a)-Fc*, CD164(E1, 2, 4)-Fc*, and CD164(E1, 3, 4)-Fc*
(Fig. 5A). On SDS-PAGE, all purified soluble constructs were resolved as single glycosylated protein bands, except CD164(E1)Fc*, which occurred as two isoforms: one highly glycosylated and
one lacking some oligosaccharide side chains (Fig. 5A). This was
confirmed by the fact that the additional lower molecular mass
band was not recognized by 103B2/9E10 (data not shown), which
is dependent on both N- and O-linked glycosylation for binding,
but is detected by the 105A5 mAb, which binds sialic acid moieties
Table I. Reactivity of CD164 mAbs with domain truncation-soluble recombinant CD164 proteinsa
mAbs
Soluble Constructs
103B2/9E10
105A5
N6B6
67D2
Ig-negative control
CD164(E1)-Fc*
CD164(E1–2)-Fc*
CD164(E1–3)-Fc*
CD164(E1–4)-Fc*
CD164(E1–5)-Fc*
CD164(E⌬5)-Fc*
CD164(E1–6a)-Fc*
CD164(E1,2,4)-Fc*
CD164(E1,3,4)-Fc*
CD66a-Fc
1.276 ⫾ 0.152
1.217 ⫾ 0.189
1.098 ⫾ 0.199
1.318 ⫾ 0.021
1.421 ⫾ 0.017
1.428 ⫾ 0.039
1.254 ⫾ 0.294
1.269 ⫾ 0.128
1.531 ⫾ 0.037
0.156 ⫾ 0.018
0.916 ⫾ 0.221
0.599 ⫾ 0.059
0.814 ⫾ 0.045
0.710 ⫾ 0.012
0.720 ⫾ 0.010
0.750 ⫾ 0.065
0.741 ⫾ 0.126
0.734 ⫾ 0.058
0.625 ⫾ 0.049
0.145 ⫾ 0.011
0.150 ⫾ 0.009
0.147 ⫾ 0.006
1.392 ⫾ 0.194
1.508 ⫾ 0.000
1.452 ⫾ 0.127
1.472 ⫾ 0.147
1.249 ⫾ 0.262
0.163 ⫾ 0.006
0.198 ⫾ 0.013
0.146 ⫾ 0.016
0.150 ⫾ 0.009
0.136 ⫾ 0.002
0.790 ⫾ 0.143
0.992 ⫾ 0.125
0.934 ⫾ 0.142
0.832 ⫾ 0.170
0.857 ⫾ 0.132
0.159 ⫾ 0.006
0.150 ⫾ 0.006
0.138 ⫾ 0.004
0.159 ⫾ 0.011
0.147 ⫾ 0.010
0.138 ⫾ 0.009
0.159 ⫾ 0.071
0.136 ⫾ 0.001
0.145 ⫾ 0.001
0.164 ⫾ 0.007
0.133 ⫾ 0.002
0.135 ⫾ 0.001
0.145 ⫾ 0.011
a
The ELISA was performed as described in Materials and Methods, with the CD66a-Fc protein acting as a negative control for binding. The Ig-negative control represents
a mixture of irrelevant isotope-matched mIgG1, mIgG2a, mIgG3, and mIgM mAbs that do not react with CD164. Results shown are means ⫾ SD triplicate measurements from
one experiment and were consistent when repeated three times. The CD66a-Fc soluble protein, but not the CD164-Fc* domain deletion constructs, reacted with the CD66 mAb,
D14-HD11, giving an ELISA reading of 1.872 ⫾ 0.140.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 5. N6B6 and 67D2 mAbs recognize conformationally dependent epitopes. A, CD164-Fc* domain truncated chimeric proteins. Two
micrograms of each purified protein were resolved by 10% SDS-PAGE
under reducing conditions and visualized with Coomassie blue. Approximate
molecular masses deduced from electrophoretic mobilities are: CD164(E1)Fc*, 50 kDa (lane 1); CD164(E1–2)-Fc*, 65 kDa (lane 2); CD164(E1–3)-Fc*,
80 kDa (lane 3); CD164(E1– 4)-Fc*, 90 kDa (lane 4); CD164(E1–5)-Fc*, 95
kDa (lane 5); CD164(E⌬5)-Fc*, 95 kDa (lane 6); CD164(E1– 6a)-Fc*, 100
kDa (lane 7); CD164(E1, 2, 4)-Fc*, 80-kDa (lane 8), and CD164(E1, 3, 4)Fc*, 75 kDa (lane 9). B, Aliquots of the CD164(E1–3)-Fc* soluble chimeric
proteins were treated with different concentrations of DTT (0 –100 mM), analyzed by 10% SDS-PAGE, and immunoblotted with the CD164 mAbs
103B2/9E10, 105A5, N6B6, and 67D2. Human CD33-Fc was resolved with 5
mM DTT and immunoblotted with each CD164 mAb and is represented a
negative control (Co). The molecular mass markers were the same as those
shown in Fig. 3C.
differences among CD164 molecules on different hemopoietic lineages or reflects the expression of different CD164 splice variants.
These studies are currently under investigation. It was of further
interest to note that while the monomeric form of CD164 (80 –100
kDa) was found after SDS lysis of cells with all four CD164 mAbs,
the 67D2 mAb also detected a band with an apparent Mr ⬎220
kDa. This is illustrated in Fig. 3C (lanes 8 –10) on a blot of human
bone marrow, of human cord blood CD34⫹ hemopoietic cells, and
of cultured bone marrow stromal reticular cells. This additional
high molecular mass band may represent a Triton X-100-insoluble
form of the CD164 molecule caused by multimeric association,
cytoskeletal interaction with its cytoplasmic tail, or glycosaminoglycan (GAG) modification. This insoluble form remains accessible to binding by the 67D2 mAb, but not by the other three CD164
mAbs. To test this possibility, we lysed KG1a cells with Triton
X-100 and collected the Triton X-100-soluble and -insoluble fractions. These fractions were then boiled with SDS lysis buffer containing 5 mM DTT and subjected to SDS-PAGE followed by immunoblotting with the different CD164 mAbs. As indicated in Fig.
4B, all CD164 mAbs reacted with the 80- to 100-kDa CD164
monomer and with the 160- to 180-kDa CD164 dimer in the Triton
X-100-soluble fraction as has been documented previously for Triton X-100 lysis conditions (1). In contrast, 67D2 was the only
CD164 mAb to react with a Mr species ⬎220 kDa that was derived
from the Triton X-100-insoluble fraction (Fig. 4B, 67D2, lane 2).
Since this insoluble form of CD164 has been identified at 320 kDa,
it could represent a tertrameric form of the molecule. Further studies are in progress to identify this hypothetical tetrameric association and to characterize possible cytoskeletal elements or GAGs
that might bind to the CD164 sialomucin.
The Journal of Immunology
847
on O-linked glycans (see below). To localize the epitopes for these
mAbs more precisely, the 103B2/9E10, 105A5, N6B6, and 67D2
mAbs were analyzed in a solid phase ELISA assay for their reactivities with the soluble CD164-Fc* domain deletion constructs.
The 103B2/9E10 and 105A5 mAbs recognized all nine soluble
proteins, indicating that they react with the region encoded by exon
1 (Table I). N6B6 and 67D2 recognized the CD164(E1–3)-Fc*,
CD164(E1– 4)-Fc*, CD164(E1–5)-Fc*, CD164(E1– 6a)-Fc*, and
CD164(E⌬5)-Fc* proteins, but not the CD164(E1)-Fc* and
CD164(E1–2)-Fc* constructs (Table I), suggesting either that they
reacted minimally with epitopes encoded by exon 3 or with specific epitopes created by tertiary folding of exons 1–3. To determine whether the N6B6 and 67D2 mAbs reacted exclusively with
epitopes on exon 3 or with more complex epitopes on multiple
exons, two additional soluble proteins CD164(E1, 3, 4)-Fc* and
CD164(E1, 2, 4)-Fc* were generated. These were encoded by exons 1, 2, and 4 or exons 1, 3, and 4 and linked to the mutated Fc
region of human IgG1. As expected, the 103B2/9E10 and 105A5
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 6. Sialidase and O-sialoglycoprotease treatment of KG1a cells identifies three
classes of CD164 epitopes. KG1a cells were untreated or enzymatically digested for 1 h at 37°C,
then stained with CD164 mAbs (unbroken lines)
or isotype-matched negative control mAbs (dotted
lines). CD34 mAbs class I (My10), class II
(QBEND-10), and class III (Tük3) were used in
parallel to stain KG1a cells, and values are shown
in the table with their isotype-matched negative
controls. Cells were analyzed for fluorescence
staining using a FACScalibur flow cytometer. For
each Ab, the upper histogram represents the staining of untreated cells; the middle histogram shows
the staining of sialidase-treated cells; and the
lower histogram shows the staining of O-sialoglycoprotease-treated cells. Values represent the median fluorescence intensity (MFI) ⫾ SD for three
individual experiments.
mAbs reacted with both these proteins. However, the N6B6 and
67D2 mAbs did not (Table I). These results were verified by immunoblotting of the CD164-Fc* series with the CD164 mAbs
(data not shown) and demonstrate that the latter mAbs require the
exon 3-encoded peptide for epitope recognition, but that they are
unable to identify the exon 3-derived peptide in the absence of the
exon 2-encoded region. In competitive binding assays, the 103B2/
9E10 and 105A5 mAbs did not significantly compete with one
another or with the N6B6 or 67D2 mAbs for binding to the
CD164(E1–3)-Fc*-soluble protein. For example, when the 103B2/
9E10 mAb was used to block binding of the 105A5, N6B6, and
67D2 mAbs to the CD164(E1–3)-Fc* construct, no inhibition was
observed (0.5 ⫾ 0.4, 1.6 ⫾ 0.4, and 2.4 ⫾ 1.3% inhibition, respectively). Similarly, the 105A5 mAb did not block the binding of
103B2/9E10, N6B6, or 67D2 mAbs (0.3 ⫾ 1, 2.5 ⫾ 0.4, and 1.9 ⫾
0.5% blocking, respectively). However, N6B6 partially blocked
the binding of 67D2 and vice versa (73.8 ⫾ 0.5 and 47.1 ⫾ 0.9%
inhibition, respectively), but did not substantially block that of
848
EPITOPE MAPPING OF CD164 FUNCTIONAL DOMAINS
while 103B2/9E10 and 105A5 epitopes were not affected by DTT
even at high concentrations (Fig. 5B). These results indicate that
the N6B6 and 67D2 mAbs recognize conformationally dependent
epitopes, involving disulfide bond formation between exons 2 and
3 as shown in Fig. 1A.
N- and O-linked oligosaccharide side chains are involved in
epitope recognition by CD164 mAbs
Only the 105A5 epitope is C. perfringens sialidase sensitive
FIGURE 7. Enzymatic treatment of the soluble CD164(E1–3)-Fc* protein and the native CD164 protein purified from KG1a cells distinguishes
the CD164 epitopes. Chimeric CD164(E1–3)-Fc* (A–D) or native CD164KG1a (E–H) purified proteins were lyophilized and treated with different
glycosidases. Proteins were incubated with N-glycanase (N), O-glycosidase (O), sialidase (S), ␣-fucosidase (F), O-sialoglycoprotease (P), O-glycosidase and sialidase (OS), or sialidase and ␣-fucosidase (OSF) as indicated above the immunoblots. The untreated proteins (U) were incubated
under the same conditions as the treated molecules. Each sample was electrophoresed on 10% SDS-PAGE gels (0.2 ␮g protein/lane) before immunoblotting with CD164 mAbs 103B2/9E10 (A and E), 105A5 (B and F),
N6B6 (C and G), and 67D2 (D and H). The molecular mass markers were
the same as those shown in Fig. 3C.
105A5 or 103B2/9E10 (14.7 ⫾ 0.6 and 1.2 ⫾ 2.5% inhibition for
N6B6, and 15.1 ⫾ 0.7 and 0% inhibition for 67D2, respectively).
The N6B6 and 67D2 epitopes are conformationally dependent
In view of the fact that exons 2 and 3 contain all eight cysteine
residues that occur in the extracellular domain (Fig. 1B), we considered the possibility that disulfide bridges may strongly influence
the conformation of CD164 and thus be intrinsic to the epitopes
recognized by the CD164 mAbs. As shown in Fig. 5B, in the
absence of reducing agents, the soluble CD164(E1–3)Fc* construct formed dimers via disulfide linkages at the hinge region of
the human IgG1 Fc, while in 5 mM DTT or above, the protein was
monomeric. Treatment of the CD164(E1–3)-Fc* soluble recombinant protein with increasing concentrations of DTT resulted in the
loss of the epitopes recognized by N6B6 and 67D2. Reducing conditions (ⱖ20 mM DTT) were sufficient to perturb the N6B6 and
67D2 epitope reactivities on the CD164(E1–3)-Fc* construct,
Our results show that by treating hemopoietic cell lines, such as
KG1a, which expresses the CD164 epitopes, with C. perfringens
sialidase, we were able to abrogate binding by the 105A5 mAb, but
not with the other CD164 mAbs tested (Fig. 6). The failure of the
105A5 mAb to immunoblot either the CD164(E1–3)-Fc* soluble
protein or the CD164(KG1a) protein after treatment with C. perfringens sialidase confirmed that the 105A5 epitope was sialic acid
dependent (Fig. 7, B and F). Using the fact that N-glycanase did
not remove the 105A5 epitope from CD164(E1–3)-Fc* or
CD164(KG1a) (Fig. 6, B and F) and that O-glycosidase is unable
to digest long chain O-linked glycans without prior sialidase treatment, it appears that the sialic acids intrinsic to the 105A5 epitope
are most likely situated on O-glycosylated chains attached to the
exon 1-encoded peptide and not on N-linked oligosaccharides (Fig.
1B). In contrast to the 105A5 epitope, the 103B2/9E10, N6B6, and
67D2 epitopes were not affected by C. perfringens sialidase treatment of either KG1a cells (Fig. 6), or CD164(KG1a) protein (Fig.
7, E, G, and H) or the soluble CD164(E1–3)-Fc* protein (Fig. 7,
A, C, and D). This was confirmed in an ELISA analysis in which
the four CD164 mAbs were examined for their ability to bind to
the native or sialidase-treated soluble CD164(E1–3)-Fc* construct
attached to microtiter wells. In these experiments, sialidase treatment reduced the binding of the 105A5 mAb by 76 ⫾ 1%, but did
not reduce the binding of the other CD164 mAbs (data not shown).
Both the 105A5 and 103B2/9E10 epitopes are Osialoglycoprotease sensitive
Preincubation of KG1a cells with O-sialoglycoprotease significantly reduced the binding of the 103B2/9E10 and 105A5 mAbs as
measured by flow cytometry (Fig. 6). The other CD164 epitopes
were not affected by this treatment. To confirm these studies, the
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Deglycosylation experiments were conducted to determine
whether oligosaccharide residues contribute to the CD164 epitopes
recognized by the 103B2/9E10, 105A5, 67D2, and N6B6 mAbs. In
the first set of experiments the KG1a cell line was treated with
sialidase or O-sialoglycoprotease and analyzed by flow cytometry
for CD164 mAb binding (Fig. 6). The CD34 mAbs, My10,
QBEND-10, and Tük-3, which recognize epitopes that are differentially sensitive to sialidase and O-sialoglycoprotease, served as
controls for this analysis (Fig. 6). In the second set of experiments,
CD164(E1–3)-Fc* soluble proteins and CD164 purified from
KG1a cells (CD164(KG1a)) were subjected to N-glycanase, Oglycosidase, sialidase, ␣-fucosidase, and O-sialoglycoprotease
treatments, either separately or together, as indicated in Fig. 7. In
these latter experiments O-sialoglycoprotease and N-glycanase
treatment alone or in combination with the other enzymes dramatically decreased the apparent molecular mass of the soluble constructs. However, sialidase and O-sialoglycoprotease treatment of
the native CD164(KG1a) molecule reduced its mobility in SDSPAGE due to the removal of negative charges present on sialic
acid (Fig. 7, E–H). After O-glycosidase treatment only partial deglycosylation was observed on CD164(E1–3)-Fc*, since two bands,
the original CD164 and a lower Mr band of 60-kDa, were detected
after electrophoresis.
The Journal of Immunology
849
CD164(E1–3)-Fc* protein or the CD164(KG1a) protein was
treated with O-sialoglycoprotease, and the resulting protein was
analyzed in the presence of 5 mM DTT on SDS-PAGE followed
by immunoblotting with the CD164 mAbs. By Coomassie blue
analysis, this treatment of the soluble protein reduced its apparent
Mr to approximately 65 kDa (data not shown). Neither the 103B2/
9E10 nor the 105A5 mAbs bound to this 65-kDa fragment,
whereas both N6B6 and 67D2 were found to bind (Fig. 7, C and D,
respectively). These experiments were repeated with CD164(E1– 6a)Fc*, and the same decrease in the apparent molecular mass was observed (data not shown), indicating than the first mucin domain
contained the only cleavage site for the O-sialoglycoprotease enzyme. The sensitivity of CD164 epitopes to O-sialoglycoprotease
was similar to that of purified CD164(KG1a) (Fig. 7, E–H). These
studies demonstrate the partial removal of the exon 1-encoded region identified with 105A5 and 103B2/9E10 mAbs from CD164
on KG1a cells, and its complete removal from the soluble
CD164(E1–3)-Fc* molecule by O-sialoglycoprotease treatment.
Furthermore, they indicate that the region encoded by exon 1 is not
essential for epitope recognition by the N6B6 and 67D2 mAbs.
The N6B6 and 67D2 mAbs bind deglycosylated CD164
Recognition of the 103B2/9E10 epitope requires N-linked
carbohydrate attachment
The CD34 mAbs have been classified into three classes based on
their sensitivities to sialidase and O-sialoglycoprotease (27). Thus,
by comparing CD164 mAbs with the CD34 mAb classes, it has
been possible to subtype the CD164 mAbs into three analogous
categories. Like the CD34 epitope, My10, the CD164 epitope,
105A5, is sensitive to both C. perfringens sialidase and O-sialoglycoprotease treatments and can be classified as a class I epitope
(Fig. 8). The CD164 epitope, 103B2/9E10, is similar to the CD34
epitope, QBEND 10, in that it is sensitive to O-sialoglycoprotease,
but not to C. perfringens sialidase, and can be classified as a class
II epitope (Fig. 8). Interestingly, this 103B2/9E10 epitope is also
sensitive to N-glycanase digestion. The CD164 epitopes, N6B6
and 67D2, and the CD34 epitope, Tük3, are insensitive to both
The 103B2/9E10 epitope (but not the 105A5, N6B6, or 67D2
epitopes) was sensitive to N-glycanase treatment either on soluble
CD164(E1–3)-Fc* protein or CD164(KG1a) protein (Fig. 7). This
was confirmed in an ELISA analysis in which the four CD164 mAbs
were examined for the ability to bind to the native or N-glycanasetreated soluble CD164(E1–3)-Fc* construct attached to microtiter
wells. In these experiments removal of N-linked carbohydrates reduced the binding of the 103B2/9E10 mAb by 63.1 ⫾ 6.9%, but did
not reduce the binding of the other CD164 mAbs (data not shown).
Hence, the 103B2/9E10 epitope is dependent on the N-linked carbohydrates of exon 1 (Fig. 1).
Our results demonstrate that the N6B6 and 67D2 epitopes on
CD164(E1–3)-Fc* or on CD164(KG1a) are not removed by the
deglycosylation procedures used, since N6B6 and 67D2 still recognize the different deglycosylated forms (Fig. 7, C, D, G, and H).
Only N-glycanase and O-sialoglycoprotease treatments of the soluble chimeric molecule appear to reach complete deglycosylation,
since treatment with O-glycosidase only partially removed the Olinked carbohydrates. This is evidenced by the fact that the 80-kDa
molecule is the major band detected by Coomassie blue staining
(data not shown), with an additional weaker band at approximately
60 kDa being detected by immunoblotting with the N6B6 and
67D2 mAbs (Fig. 7, C and D), but not with 103B2/9E10 or 105A5
mAbs (Fig. 7, A and B). This partial digestion with O-glycosidase
was improved by the prior addition of exoglycosidases such as
sialidase or ␣-fucosidase (Fig. 7, C and D, lanes OS and OSF), but
even in the presence of these enzymes, O-glycosidase did not completely digest the original CD164(E1–3)-Fc* protein.
Identification of three classes of CD164 epitopes
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
FIGURE 8. Schematic representation of CD164 epitopes deduced from glycosidase treatments.
850
C. perfringens sialidase and O-sialoglycoprotease enzymes and
can therefore be classified as class III epitopes (Fig. 8). From our
results on the differential binding of the N6B6 and 67D2 mAbs to
the Triton X-100-insoluble cell fraction (Fig. 4), we are able to
group the class III epitopes into two subclasses. The subclass IIIA
mAb N6B6 does not bind to the 320-kDa Triton X-100-insoluble
material, whereas the subclass IIIB mAb 67D2 reacts with the
Triton X-100-insoluble material.
Discussion
hemopoietic progenitor cell differentiation (33). More significantly, on high endothelial venules, the CD34 isoform displays the
class II and III, but not class I epitopes (34), thereby implicating
the class II rather than the class I epitopes in the high affinity
adhesion of these cells to L-selectin on lymphocytes.
The variable glycosylation of CD164 observed here for different
cell types is by no means uncommon. One feature of many glycoproteins is microheterogeneity, which is due at least in part to
the attached glycan chains. This heterogeneity is nonrandom and
reproducible for a given protein synthesized by a specific cell type
under defined conditions, a feature reflected when the physiological relevance of protein glycosylation is considered. While it is
interesting to examine the differential glycosylation of the CD164
molecule in different cell lineages and tissues, examination of the
glycosylation pattern by enzymatic treatment (Fig. 8) provides insight into the possible functional relevance of post-translational
processing. Glycans can serve as recognition determinants for or as
modulators of cell-cell, cell-matrix, and protein-(glyco)protein interactions. They can also be involved in either adhesive or antiadhesive interactions. Both roles may be played by the same molecule depending on the tissues in which these glycoproteins are
expressed and on the type of specific carbohydrate modifications
that have been processed. This is further demonstrated by the wide
diversity of glycosyltransferases and protein machinery present in
a particular cell type, necessary for the production of a molecule
with functionally relevant glycosylation (35). In many cases partial
occupancy of potential glycosylation sites has correlated effects on
physiological attributes. Particularly striking examples of the complexities of variable glycosylation site occupancy upon the biological attributes of a protein are illustrated by GM-CSF and CD44.
Human GM-CSF exhibits variable N-linked glycosylation site occupancy, which plays an important role in its biological activity.
Indeed, it has been demonstrated that there is an inverse correlation
between biological activity and the extent of N-glycosylation, suggesting that N-linked glycans down-regulate the bioactivity of the
molecule (36, 37). The 85-kDa isoform of CD44 on hemopoietic
cells, on the other hand, acts as a ligand for hyaluronan produced
by endothelial cells when it is sulfated on O-linked oligosaccharides in response to TNF-␣ stimulation (38). Other examples of
post-translational modification influencing biological activity are
by no means rare. Modifications involving O-linked oligosaccharide or tyrosine sulfation on CD34, PCLP, GlyCAM-1, and
PSGL-1 on high endothelial venules or on specific leukocyte types
are responsible for their high affinity specificity for L-selectin in
vitro (reviewed in Ref. 10). Since the interaction of sialomucins
with selectin ligands generally promotes the rapid proadhesive
tethering of leukocytes to endothelia under conditions of flow in
vitro, it has been postulated that these interactions result in tissuespecific homing and recirculation of lymphocytes to high endothelial venules in lymph nodes and mucosal lymphoid tissues and the
accumulation of leukocytes at sites of inflammation. Despite this,
controversy still surrounds the ligand specificity of these sialomucins and the functional significance of such sialomucin-ligand interactions in vivo (35). For example, L- and E-selectins function as
ligands for CD34, yet both sialidase/O-sialoglycoprotease-dependent and O-sialoglycoprotease-independent adhesion of leukocytes
to high endothelial venules have been described (9; reviewed in
Ref. 10). Finally, gene knockout studies in mice indicate that GlyCAM-1 and CD34, at least by themselves, are not responsible for
L-selectin-mediated lymphocyte recruitment into peripheral
lymph nodes, although eosinophil recruitment into the lung following allergen challenge is down-regulated in CD34-deficient
mice (14, 39).
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Our previous studies have demonstrated that CD164 is expressed
on CD34⫹ hemopoietic progenitor cells and bone marrow stroma
(1– 4). Evidence that 103B2/9E10 mAb inhibits the adhesion of
CD34⫹ cells to bone marrow stroma and that this same mAb or the
105A5 mAb prevents recruitment of quiescent hemopoietic progenitor cells into cell cycle (1) has heightened interest in this molecule. In this paper we have identified for the first time three
classes of epitopes on CD164: the class I 105A5, the class II
103B2/9E10, and the class III N6B6 and 67D2 epitopes. We have
shown previously that these epitopes are differentially distributed
on distinct cell types in the adult (4). The variation in epitope
distribution observed may be explained by the experiments conducted in this paper. Analyses of mAb binding to splice variants
and to soluble domain deletion constructs of human CD164 as well
as analyses of the differential sensitivity of CD164 epitopes to
sialidase, O-sialoglycoprotease, and N-glycanase digestions indicate that both the class I and class II epitopes of CD164 encompass
different oligosaccharide modifications of the first mucin domain
of CD164. The class I epitope is associated with long chain sialylated O-linked glycans, while the 103B2/9E10 class II epitope is
dependent on both N- and O-linked glycosylation of CD164. The
class III epitopes, N6B6 and 67D2, appear to be more dependent
on the peptide backbone than on carbohydrate modifications.
These latter epitopes are not removed by any of the glycosidases
used, but encompass the cysteine-rich domain that is encoded by
exons 2 and 3 of the CD164 gene and that forms a link between
mucin domains I and II. Moreover, 67D2 appears to recognize a
Triton X-100-insoluble form of CD164 that could represent a tetrameric form of CD164, an aggregate formed by interaction with
cytoskeletal elements, or a CD164 isoform modified by GAG attachment as described previously for CD44 (28, 29) and syndecan
(30). Thus, N6B6 and 67D2 mAbs appear to predominantly identify the core CD164 peptide upon which specific oligosaccharide
modifications encompassing the 103B2/9E10 and 105A5 epitopes
are arrayed and are responsible for both their more restricted patterns
of expression and the functional significance of this molecule.
The classification of the CD164 epitopes presented in this paper
is reminiscent of certain structural features of the CD34 molecule.
Three classes of epitopes on CD34 have been defined on the basis
of their sensitivities to sialidase and O-sialoglycoprotease treatments (27, 31, 32). Like CD164, the CD34 class I epitopes are
sialidase/O-sialoglycoprotease sensitive, the class II epitopes are
removed by O-sialoglycoprotease, and the class III epitopes are
insensitive to digestion by both enzymes. Furthermore, although
not as dramatic as the differential tissue distribution of the class I
and II epitopes of CD164, there are some reports on the differential
expression of CD34 epitope classes. For example, while the three
classes of CD34 epitopes are equally expressed on immature hemopoietic progenitor cells and immature leukemic blasts (AMLM0/1), class I and class II epitopes are less likely to be expressed
on more mature progenitors and on the AML-M3 and -M4/5 leukemic blasts than class III epitopes. This suggests a more rapid
down-regulation of the CD34 class I and II epitopes during normal
EPITOPE MAPPING OF CD164 FUNCTIONAL DOMAINS
The Journal of Immunology
Our previous studies have demonstrated that while all the
CD164 epitopes discussed here are expressed on the phenotypically most primitive hemopoietic progenitor cells, it is the class II
epitope, 103B2/9E10, that has been shown to elicit a very potent
regulatory effect on stem cell proliferation/adhesion in in vitro systems. In this respect, CD164 resembles other sialomucins, such as
PSGL-1, CD34, and CD43, in that interaction of both sialomucins
with specific mAbs regulates cell proliferation. In the case of
CD43 and PSGL-1, this receptor binding is functional and specific
to a particular progenitor cell stage of differentiation (11, 13, 16,
40 – 43). Whether the biochemical mechanisms regulating cell proliferation following the engagement of CD164 receptor on
CD34⫹CD38low/⫺ cells are similar to those observed for CD34,
CD43, and PSGL-1 is as yet unknown (11, 13, 15–18, 40 – 43).
However, as indicated in this paper and from our current research,
with the characterization and better understanding of functional
epitopes on progenitor cells, new tools are now available that will
allow us to answer such questions.
We thank Profs. Sir D. J. Weatherall and L. Kanz for their support.
References
1. Zannettino, A. C. W., H.-J. Bühring, S. Niutta, S. M. Watt, M. A. Benton, and
P. J. Simmons. 1998. The sialomucin CD164 (MGC-24v) is an adhesive glycoprotein expressed by human hematopoietic progenitors and bone marrow stromal
cells which serves as a potent negative regulator of hematopoiesis. Blood
92:2613.
2. Watt, S. M., H.-J. Bühring, I. Rappold, J. Y.-H. Chan, J. Lee-Prudhoe, T. Jones,
A. C. W. Zannettino, P. J. Simmons, D. Sheer, R. Doyonnas, et al. 1998. CD164
a novel sialomucin on CD34⫹ and erythroid subsets is located on human chromosome 6q21. Blood 92:849.
3. Zannettino, A. C. W., I. Rappold, H.-J. Bühring, S. M. Watt, M. A. Benton,
S. Nuitta, and P. J. Simmons. 1997. CD164 (MGC-24v) workshop panel report.
In Leucocyte Typing VI. T. Kishimoto, H. Kikutani, A. E. G. Ch. von den Borne,
S. M. Goyert, D. Y. Mason, M. Miyafaka, L. Moretta, K. Okumura, S. Shaw, T.
A. Springer, K. Sugamura, and H. Zola, eds. Garland Publishing, New York,
p. 456.
4. Watt, S. M., L. H. Butler, M. Tavian, H.-J. Bühring, I. Rappold, P. J. Simmons,
A. C. W. Zannettino, D. Buck, A. Fuchs, R. Doyonnas, et al. 2000. Functionally
defined CD164 epitopes are expressed on CD34⫹ cells throughout ontogeny but
display distinct distribution patterns in adult hematopoietic and non-hematopoietic tissues. Blood 95:3113.
5. Almeida-Porada, G., H.-J. Bühring, S. M. Watt, P. J. Simmons, G. Rathke,
S. Scheding, L. Kanz, W. Brugger, and E. D. Zanjani. 1999. CD164 defines an
immature subset of human bone marrow CD34-negative stem cells. Blood
94:462a.
6. Varki, A. 1997. Perspectives series: cell adhesion in vascular biology. J. Clin.
Invest. 99:158.
7. McEver, R. P., and R. D. Cummings. 1997. Perspectives series: cell adhesion in
vascular biology. J. Clin. Invest. 100:485.
8. Ostberg, J. R., R. K. Barth, and J. G. Frelinger. 1998. The Roman god Janus: a
paradigm for the function of CD43. Immunol. Today 19:546.
9. Clark, R. A., R. C. Fuhlbrigge, and T. A. Springer. 1998. L-selectin ligands that
are O-glycoprotease resistant and distinct from MECA-79 antigen are sufficient
for tethering and rolling of lymphocytes on human endothelial venules. J. Cell
Biol. 140:721.
10. Gonzalez-Amaro, R., and F. Sanchez-Madrid. 1999. Cell adhesion molecules:
selectins and integrins. Crit. Rev. Immunol. 19:389.
11. Bazil, V., J. Brandt, S. Chen, M. Roeding, K. Luens, A. Tsukamoto, and
R. Hoffman. 1996. A monoclonal antibody recognizing CD43 (leukosialin) initiates apoptosis of human hematopoietic progenitor cells but not stem cells. Blood
87:1272.
12. Wiken, M., P. Bjorck, B. Axelsson, and P. Perlmann. 1989. Enhancement of
human B-cell proliferation by a monoclonal antibody to CD43. Scand. J. Immunol. 29:363.
13. Levesque, J. P., A. C. W. Zannettino, M. Pudney, S. Niutta, D. N. Haylock,
K. R. Snapp, G. S. Kansas, M. C. Berndt, and P. J. Simmons. 1999. PSGL-1mediated adhesion of human hematopoietic progenitors to P-selectin results in
suppression of hematopoiesis. Immunity 11:369.
14. Cheng, J., S. Baumhueter, G. Cacalano, K. Carver-Moore, H. Thibodeaux,
R. Thomas, H. E. Broxmeyer, S. Cooper, N. Hague, M. Moore, et al. 1996.
Hematopoietic defects in mice lacking the sialomucin CD34. Blood 87:479.
15. Bazil, V., J. Brandt, A. Tsukamoto, and R. Hoffman. 1995. Apoptosis of human
hematopoietic progenitor cells induced by crosslinking of surface CD43, the major sialoglycoprotein of leukocytes. Blood 86:502.
16. Bazil, V., J. E. Brandt, and R. Hoffman. 1997. Resistance of human hematopoietic stem cells to a monoclonal antibody recognizing CD43. Stem Cells 15:13.
17. Hu, M. C., and S. L. Chien. 1998. The cytoplasmic domain of stem cell antigen
CD34 is essential for cytoadhesion signaling but not sufficient for proliferation
signaling. Blood 91:1152.
18. Krause, D. S., M. J. Fackler, C. I. Civin, and W. S. May. 1996 CD34: structure,
biology and clinical utility. Blood 87:1.
19. Ardman, B., M. A. Sikorski, and D. E. Staunton. 1992. CD43 interferes with
T-lymphocyte adhesion .Proc. Natl. Acad. Sci. USA 89:5001.
20. Zhang, K., D. Baeckstrom, H. Brevinge, and G. C. Hansson. 1997. Comparison
of sialyl-Lewis a-carrying CD43 and MUC1 mucins secreted from a colon carcinoma cell line for E-selectin binding and inhibition of leukocyte adhesion.
Tumor Biol. 18:175.
21. Baum, L. G., M. Pang, N. L. Perillo, T. Wu, A. Delegeane, C. H. Uittenbogaart,
M. Fukuda, and J. J. Seilhamer. 1995. Human thymic epithelial cells express an
endogenous lectin, galectin-1, which binds to core 2 O-glycans on thymocytes
and T lymphoblastoid cells. J. Exp. Med. 181:877.
22. Tsuboi, S., and M. Fukuda. 1997. Branched O-linked oligosaccharides ectopically expressed intransgenic mice reduce primary T-cell immune responses.
EMBO J. 16:6364.
23. Skubitz, K. M., K. Micklem, and E. van der Schoot. 1995. CD66 and CD67
cluster workshop report. In Leucocyte Typing V. S. F. Schlossman, L. Boumsell,
W. Gilks, J. M. Harlan, T. Kishimoto, M. Morimoto, J. Ritz, S. Shaw, R. Silverstein, T. Springer, T. F. Tedder, and R. F. Todd, eds. Oxford University Press,
Oxford, U.K., p. 889.
24. Oritani, K., and P. W. Kincade. 1996. Identification of stromal cell products that
interact with pre-B cells. J. Cell. Biol. 134:771.
25. Teixeira, A. M., J. Fawcett, D. L. Simmons, and S. M. Watt. 1994. The N-domain
of the biliary glycoprotein (BGP) adhesion molecule mediates homotypic binding: domain interactions and epitope analysis of BGPc. Blood 84:211.
26. Watt, S. M., J. Williamson, H. Genevier, J. Fawcett, D. L. Simmons, A. Hatzfeld,
S. A. Nesbitt, and D. R. Coombe. 1993. The heparin binding PECAM-1 adhesion
molecule is expressed by CD34⫹ hematopoietic precursor cells with early myeloid and B-lymphoid cell phenotypes. Blood 82:2649.
27. Sutherland, D. R., K. M. Abdullah, P. Cyopick, and A. Mellors. 1992. Cleavage
of the cell-surface O-sialoglycoproteins CD34, CD43, CD44, and CD45 by a
novel glycoprotease from Pasteurella haemolytica. J. Immunol. 148:1458.
28. Perschl, A., J. Lesley, N. English, R. Hyman, and I. S. Trowbridge. 1995. Transmembrane domain of CD44 is required for its detergent insolubility in fibroblasts.
J. Cell Sci. 108:1033.
29. Neame, S. J., C. R. Uff, H. Sheikh, S. C. Wheatley, and C. M. Isacke. 1995. CD44
exhibits a cell type dependent interaction with Triton X-100 insoluble, lipid rich,
plasma membrane domains. J. Cell Sci. 108:3127.
30. Carey, D. J., K. M. Bendt, and R. C. Stahl. 1996. The cytoplasmic domain of
syndecan-1 is required for cytoskeleton association but not detergent insolubility.
J. Biol. Chem. 271:15253.
31. Sutherland, D. R., S. M. Watt, G. Dowden, K. Karhi, M. A. Baker, M. F. Greaves,
and J. E. Smart. 1988. Structural and partial amino acid sequence analysis of the
human hemopoietic progenitor cell antigen CD34. Leukemia 2:793.
32. Watt, S. M., K. Karhi, K. Gatter, A. J. W. Furley, F. E. Katz, L. E. Healy,
L. J. Altass, N. J. Bradley, D. R. Sutherland, R. Levinsky, et al. 1987. Distribution
and epitope analysis of the cell surface membrane glycoprotein (HPCA-1) associated with human hemopoietic progenitor cells. Leukemia 1:417.
33. Steen, R., G. E. Tjonnefjord, G. Gaudernack, L. Brinch, and T. Egeland. 1996.
Differences in the distribution of CD34 epitopes on normal haemopoietic progenitor cells and leukaemic blast cells. Br. J. Haematol. 94:579.
34. Baumhueter, S., M. S. Singer, W. Henzel, S. Hemmerich, M. Renz, S. D. Rosen,
and L. A. Lasky. 1993. Binding of L-selectin to the vascular sialomucin CD34.
Science 262:436.
35. Lowe, J. B. 1997. Selectin ligands, leukocyte trafficking, and fucosyltransferase
genes. Kidney Int. 51:1418.
36. Ding, D. X.-H., J. C. Vera, M. L. Heaney, and D. W. Golde. 1995. N-glycosylation of the human granulocyte-macrophage colony-stimulating factor receptor ␣
subunit is essential for ligand binding and signal transduction. J. Biol. Chem.
270:24580.
37. Cebon, J., N. Nicola, M. Ward, I. Gardner, P. Dempsey, J. Layton, U. Duhrsen,
A. W. Burgess, E. Nice, and G. Morstyn. 1990. Granulocyte-macrophage colony
stimulating factor from human lymphocytes: the effect of glycosylation on receptor binding and biological activity. J. Biol. Chem. 265:4483.
38. Maiti, A., G. Maki, and P. Johnson. 1998. TNF-␣ induction of CD44-mediated
leukocyte adhesion by sulfation. Science 282:941.
39. Suzuki, A., D. P. Adnrew, J.-A. Gonzalo, M. Fukumoto, J. Spellberg,
M. Hashiyar, H. Takimoto, N. Gerwin, I. Webb, G. Molineux, et al. 1996. CD34deficient mice have reduced eosinophil accumulation after allergen exposure and
show a novel crossreactive 90-kD protein. Blood 87:3550.
40. Moore, T., S. Huang, L. W. Terstappen, M. Bennett, and V. Kumar. 1994. Expression of CD43 on murine and human pluripotent hematopoietic stem cells
J. Immunol. 153:4978.
41. Woodman, R. C., B. Johnston, M. J. Hickey, D. Teoh, P. Reinhardt, B. Y. Poon,
and P. Kubes. 1998. The functional paradox of CD43 in leukocyte recruitment:
a study using CD43-deficient mice. J. Exp. Med. 188:2181.
42. Anzai, N., A. Gotoh, H. Shibayama, and H. E. Broxmeyer. 1999. Modulation of
integrin function in hematopoietic progenitor cells by CD43 engagement: possible involvement of protein tyrosine kinase and phospholipase C-␥. Blood 93:
3317.
43. Rosenstein, Y., A. Santana, and G. Pedraza-Alva. 1999. CD43, a molecule with
multiple functions. Immunol. Res. 20:89.
Downloaded from http://www.jimmunol.org/ by guest on June 14, 2017
Acknowledgments
851