UvA-DARE (Digital Academic Repository)
Adaptation and evolution of drug-resistant Mycobacterium tuberculosis
Bergval, Indra
Link to publication
Citation for published version (APA):
Bergval, I. L. (2013). Adaptation and evolution of drug-resistant Mycobacterium tuberculosis
General rights
It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s),
other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulations
If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating
your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask
the Library: http://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam,
The Netherlands. You will be contacted as soon as possible.
UvA-DARE is a service provided by the library of the University of Amsterdam (http://dare.uva.nl)
Download date: 14 Jun 2017
t
hr
ee
Speci
f
i
cmut
at
i
onsi
nt
heMyc
obac
t
er
i
um
t
uber
c
ul
os
i
sr
poBgenear
eas
s
oci
at
edwi
t
h
i
ncr
eas
eddnaE2expr
es
s
i
on
|
|
|
|
|
F
EMSMi
c
r
obi
ol
ogyL
et
t
er
s2007,
275:
2,
338–
343
It's like what Lenin said... you look for the person who will benefit, and, uh, uh....
- Jeffrey "The Dude" Lebowski
58 | C H A P T E R 3
Abstract
In Mycobacterium tuberculosis (MTB), rifampicin resistance is almost invariably due to
mutations in the rpoB gene, whose function is critical for cell viability. Most of these
mutations, at least initially, impair the fitness of the bacteria but confer a selective
advantage when antibiotic pressure is exerted. Subsequent adaptation may be critical
to restore fitness. The possibility was considered that MTB with mutations in the rpoB
gene elicits a constitutive stress response, increasing the probability of subsequent
adaptation. In order to test this hypothesis, the expression of recA and dnaE2, an
inducible putative error-prone DNA polymerase, was determined in six different
isogenic laboratory-generated rpoB-mutants of MTB. Expression levels were determined
with real-time PCR and the data obtained were compared with those of the wild-type
parent.
In four of the six rpoB mutants, a two- to fivefold induction of dnaE2 was detected
(P<0.05). Thus, the presence of specific mutations in rpoB is not only associated with
impaired fitness but also results in a detectable, moderate yet persistent increase in the
expression of dnaE2 but not recA.
C H A P T E R 3 | 59
Introduction
In Mycobacterium tuberculosis (MTB), antibiotic resistance is predominantly established
by point mutations in specific genes and on very rare occasions by deletions or insertion
elements disrupting certain genes. MTB has never been shown to acquire antibiotic
resistance through the transfer of mobile genetic elements [1] Once established,
(multi)drug-resistant tuberculosis (MDR-TB) has the potential to undermine control
programmes in both the developed and the developing world: a highly successful (i.e.
transmissible and virulent) resistant strain is likely to spread. Understanding the
mechanisms by which MDR strains emerge and subsequently spread could aid the
design of control programmes specifically aimed at minimizing the risk of rapid
emergence and dissemination of MDR strains as well as preserving the efficacy of new
and existing drugs.
Isoniazid and rifampicin are two of the most important and commonly used anti-TB
drugs. The resistance to both isoniazid and rifampicin is associated with treatment
failure and poor clinical response to therapy [2,3]. Combination therapy, consisting of at
least these two drugs, drastically decreases the emergence of drug-resistant TB,
because the probability of a spontaneous multidrug-resistant mutant arising in one
event is close to zero. MDR-TB is by definition resistant to at least rifampicin and
isoniazid. Successful treatment of MDR-TB requires extended therapy with alternative
drugs.
Resistance to rifampicin is primarily acquired by mutations in rpoB, coding for the βsubunit of RNA polymerase. This enzyme is essential for transcription of RNA and hence
for the viability of the cell. Typically, resistance-conferring mutations are restricted to
an 81-bp region of rpoB, with a strong propensity for specific mutations in codons 526,
531 and 516. Mutations outside this region have also been observed and associated
with rifampicin resistance, but they are rare both in vivo and in vitro [4–6].
MTB carrying specific single nucleotide polymorphisms in any one of the three most
commonly mutated rpoB codons exhibit a high level, clinically significant, resistance to
rifampicin. Most mutations conferring resistance to rifampicin, at least initially, impair
the fitness of the bacteria [7,8], but obviously confer a selective advantage within a
patient when antibiotic pressure is exerted. Subsequent genetic adaptation after the
acquisition of primary resistance, resulting in additional drug resistance or restoration
of fitness, is probably essential for newly resistant strains to become a public health
threat [9]. It is possible that this required adaptation can only be accomplished through
a very narrow range of specific additional mutations. Therefore, most mutational
pathways would lead to evolutionary ‘dead-ends’ and the mutational routes to a
successful MDR strain may be quite constrained [10,11].
60 | C H A P T E R 3
The requirement for subsequent adaptation after the acquisition of primary resistance
may select for phenotypes that, in addition to the resistant phenotype, also lead to the
generation of increased genetic diversity [12,13]. Several bacterial mechanisms can
increase the mutation rate, with the SOS responses being the most studied [14,15]. In
most species, the SOS response is, transient, recA/lexA mediated, typically triggered by
DNA damage and results in error-prone DNA replication.
In contrast to the transient hypermutation resulting from an SOS response, a wide
variety of genetic defects can permanently reduce replication fidelity. Mostly, these
defects are located in genes involved with postreplicative DNA repair, such as mutHLS
[16,17]. Another mechanism reducing replication fidelity is translational stress-induced
mutagenesis (TSM), caused by mutations in genes encoding tRNAs or tRNA-modifying
genes [18]. In addition, mutA mutator cells are shown to have an altered range of
spontaneous mutations [19]. Recently, similar observations have been made in one of
our laboratory-generated MTB rpoB mutants, where an S522L mutation in rpoB led to a
divergent distribution of secondary resistance mutations as well as a slight increase in
the mutation frequency [6]. RNA polymerase is (like tRNA) critical for the accurate
production of proteins, raising the possibility that certain mutations in rpoB may also
result in an increased mutation rate. Furthermore, certain mutations in rpoB have been
shown to affect the constitutive expression of genes involved with the SOS response in
specific strains of Escherichia coli [20].
DNA damage in MTB has been shown to result in the increased expression of an
inducible DNA polymerase DnaE2 [21]. Based on work on DnaE2 from another Grampositive species, Streptococcus pyogenes, this enzyme is thought to be a low-fidelity
DNA polymerase that efficiently miss-incorporates nucleotides into DNA [22].
Additionally it appears from experiments performed on MTB-infected mice that dnaE2mediated mutagenesis plays a role in the adaptation and evolution of drug resistance in
vivo [21].
In light of these observations, the possibility was considered that the acquisition of
specific mutations in the MTB rpoB gene may elicit a constitutive stress response. In
order to test this hypothesis, the expression of recA and dnaE2 was compared in recent
isogenic laboratory generated rpoB mutants of MTB with their sensitive parent.
I N T R O D U C T I O N | 61
Materials and methods
SELECTION
OF RPOB MUTANTS
The strains used in this study are spontaneous mutants derived from MTB72
(ATCC35801), the wild-type parent strain, picked after one or two rounds of selection
with rifamycins (Table 1) under conditions that were described previously [6]. Mutations
in rpoB were identified previously by sequencing a 271-bp region containing the 81-bp
hotspot and, if no mutation was detected in this region, an additional 365-bp region at
the N-terminus [6].
MTB72
R190
R1
R4
R46
B66
Parent
strain
MTB72
MTB72
MTB72
MTB72
MTB72
RB14
R190
Strain
Selected with
8 μg/ml RIF
8 μg/ml RIF
8 μg/ml RIF
8 μg/ml RIF
0.8 μg/ml RFB
8 μg/ml RIF, then
0.8 μg/ml RFB
Mutations identified
in rpoB-sequence
None
S522L
H526Y
H526D
S531L
S531W
RIF MIC
(μg/ml)
4
32
>256
>256
>256
>256
RFB MIC
(μg/ml)
<1
<1
64
>128
64
>128
S522L, V176F
ND
ND
Table 1. Description of the strains used in this study. RIF, rifampicin; RFB, rifabutin; ND, not
determined.
BACTERIAL
GROWTH CONDITIONS
Bacteria were cultured in Middlebrook 7H9 (Difco, BD, Sparks, MD), supplemented with
oleic acid-albumindextrose-catalase (OADC, BD), in a shaking incubator at 37 °C. For
each strain, a liquid starting culture was made by inoculating pure colonies from slopes
into 10 mL culture medium. When these cultures reached the logarithmic growth phase,
0.5 mL was transferred to 9.5 mL fresh, nonselective medium and bacteria were grown
for 6 days.
Validation of the real-time PCR method was performed by measuring the effect of 6
days of exposure to 0.2 μg mL−1 mitomycin C (MMC) (Sigma-Aldrich Chemie BV,
Zwijndrecht, the Netherlands) on the parent strain.
RNA
ISOLATION
All RNA isolations were performed on at least three independent cultures for each strain
studied. To stabilize the bacterial RNA, cells were treated with RNAprotect Bacteria
Reagent (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol.
Four milliliters of culture per strain (2 mL for the parent strain) was used, containing
between 107 and 108 cells, incubated for 30 min and 700 μL RLT buffer was added
(RNeasy Mini Kit, Qiagen) containing β-mercaptoethanol. Cells were mechanically
62 | C H A P T E R 3
disrupted by adding them to matrix A (FastDNA Kit, Q-BIOgene, CA) and shaking 30
times per second in a Retsch horizontal shaker for 5 min. After centrifugation at 5000 g
for 30 s, 350 μL of the supernatant was transferred to a new tube and 250 μL 96%
ethanol was added. RNA isolation was continued with the RNeasy Mini Kit (Qiagen),
following the manufacturer's protocol for bacteria. Finally, DNA was digested by
treatment with RNAse-free DNAse (Promega, Leiden, the Netherlands) for 30 min at
room temperature.
REVERSE
TRANSCRIPTION
Immediately after RNA isolation, the iScript Select cDNA Synthesis Kit (Bio-Rad
Laboratories, CA) was used in combination with gene-specific primers on 2 μL RNAsamples to make first-strand DNA. The primers [21,23] had a final concentration of 125
nM and targeted recA, sigA and dnaE2 (Table 2).
Gene
Forward primer (5′→3′)
Reverse primer (5′→3′)
Reference
recA
sigA
dnaE2
ACCGGCGCGCTGAATA
CCGATCTCGTTGGACCAGA
CCGGTGGAATGGGCG
CGCGGAGCTGGTTGATG
CCTCGCTGTCTTCGATGAAAT
AATTTCACCAAGCCGATTGC
[23]
[23]
[21]
Table 2. Primers used in this study
R E A L - T I M E PCR
The primers used for the real-time PCR are described in Table 2 [21,23]. Real-time PCR
reactions were performed with the iQ5 iCycler using the iQ SYBR Green Supermix (both
from Bio-Rad). Both gnd [23] and sigA were included as reference genes, but ultimately
only sigA was used for normalization of RNA levels in all experiments, because in the
experiments sigA expression levels were the most stable. In each experiment, MTB72
was included as a control condition. Changes in the gene expression levels were
measured with the 2−ΔΔCt method [24,25]. Three to seven independent biological
replicates were tested for each mutant. Before initiation of the experiments, the assay
was validated to ensure the efficiency and reproducibility of the RNA extraction, DNA
digestion, reverse transcriptase (RT)-PCR and real-time PCR by testing the parent strain
after induction of the SOS response with 0.2 μg mL−1 MMC.
M A T E R I A L S A N D M E T H O D S | 63
STATISTICAL
ANALYSIS
The normalized fold expression was calculated separately for each replicate sample of
each mutant. To determine the statistical significance of the obtained results, a twosample t-test was performed on the individual normalized fold expression values,
obtained from each mutant, vs. the expression values obtained from the parent strain.
This way, it was determined whether there was a significant difference in the means
between each mutant and the parent. Values were considered to be significantly
different from the wild type if P<0.05, and an average ≥2-fold induction was observed.
64 | C H A P T E R 3
Results
The ability of our assay to detect changes in dnaE2 expression was confirmed by
measuring an increase in dnaE2-expression levels in the parent strain upon induction of
DNA damage. Exposure of the rifampicin-sensitive parent strain to MMC for 6 days
resulted in an average increase in dnaE2 expression of 45.39 times (SD 24.72) and an
average increase in recA expression of 18.65 times (SD 10.75).
Seven isogenic MTB strains, derived from previous experiments conducted in our
laboratory, were studied: a wild-type MTB laboratory strain, five of its spontaneous rpoB
mutants selected with rifampicin/rifabutin and one consecutive double rpoB mutant
that was selected from the S522L mutant in a second round of selection with rifabutin
[6]. The relationship between all strains used in this study and their relevant genotypes
are indicated in Table 1. All strains were first inoculated onto antibiotic-containing
plates and plated for purity, after which DNA was extracted and the rpoB gene was
sequenced. Cultures were incubated for six days when RNA was extracted and a
sequential RT-PCR was performed to synthesize first-strand DNA for the real-time PCR.
The SOS response was measured by determining recA and dnaE2 expression by real-time
PCR, using sigA as a reference gene. Initially, gnd was also included as a reference gene
[23], but data normalized with gnd were less reproducible and therefore not included in
the results. The experiment was repeated between three and seven times using
independent cultures and biological replicates for each experiment (Table 3). Duplicate
samples were analysed from each culture.
recA
dnaE2
MTB
strain
Mutation(s) in
rpoB
Normalized
fold
expression
Replicates
tested
(independent
cultures)
Normalized fold
expression
Replicates
tested
(independent
cultures)
R190
S522L
1.38 (P=0.25)
9 (5)
2.17 (P=0.046)
9 (5)
R1
H526Y
0.55 (P=0.14)
3 (3)
1.58 (P=0.30)
3 (3)
R4
H526D
2.54 (P=0.090)
7 (7)
3.21 (P=0.0072)
9 (7)
R46
S531L
1.40 (P=0.12)
3 (3)
1.79 (P=0.34)
3 (3)
B66
S531W
1.59 (P=0.086)
7 (5)
4.33 (P=0.0018)
9 (5)
RB14
S522L, V176F
2.06 (P=0.17)
5 (5)
3.81 (P=0.0048)
9 (5)
Table 3. Expression of recA and dnaE2 in selected isogenic rpoB-mutants compared with the parent
strain (MTB72). Statistically significant values (P<0.05) are shown in bold. The number of
experimental and biological replicates from which the values are calculated is indicated.
Statistical analysis (t-test) was used to compare the normalized fold expression data
[24] obtained from each mutant with that of the wild-type parent. Statistically
R E S U L T S | 65
significant induction of recA, the initiator of the SOS cascade, was not detected in any of
the mutant strains studied (Table 3). However, the expression of dnaE2 was moderately,
but significantly increased in R190 (2.17 times, P=0.046), RB14 (3.81 times, P=0.0048),
B66 (4.33 times, P=0.0018) and R4 (3.21 times, P=0.0072) (see Table 3). Although the
absolute values varied between experiments, the overall trend with respect to the
induced dnaE2 expression was observed in all experiments.
66 | C H A P T E R 3
Discussion
In our laboratory MMC-mediated induction of genes involved with stress responses,
measured by real-time PCR, produced values comparable to those obtained from similar
induction-experiments reported previously in the literature [21]. Using this assay, the
levels of recA and dnaE2 were measured in laboratory-generated rpoB mutants in
standard culture media without external stress and these levels were compared with
those obtained from the parent strain under identical conditions. The results presented
here clearly show that for three strains carrying less common rpoB mutations [5] and
one double mutant that were tested, there is a moderate but persistent increase in the
expression of dnaE2. Differences in recA expression levels were smaller and did not
reach statistical significance.
Damage-induced expression of dnaE2 can increase the mutation rate (and thus the
genetic variation) up to 20–50 times in MTB [21]. In MTB, the expression of dnaE2
appears to be RecA dependent as after DNA damage, with MMC, no induction of dnaE2
was detected in a RecA mutant [26]. The ability to increase the rate of mutation may be
of benefit for a bacterial population under severe conditions. In this sense, stressinduced mechanisms, such as the SOS response, have been proposed to be a driving
force behind (bacterial) evolution and are thus important for the development of drug
resistance and adaptive mutations [27]. Many environmental factors, including
exposure to antibiotics [28], have been shown to induce a stress (SOS) response and
increase the mutation rate. The persistent expression of dnaE2 associated with
mutations in the rpoB gene demonstrated here may be a factor in subsequent bacterial
adaptation. In a previous study, changes in both recA and dnaE2 expression were
measured after induction of DNA damage in MTB [21]; the measured increases in the
expression levels of dnaE2 were always higher (approximately twofold) than for recA. As
this relation between recA and dnaE2 expression was also observed in the initial
experiments with MMC, this could explain why the increase in recA expression did not
reach significant levels in the experiment; dnaE2 was never induced more than five
times in the mutants studied.
The dnaE2-expression levels that were detected are negatively correlated with the
prevalence of the corresponding rpoB mutations in clinical isolates and the in vitro
fitness reported in the literature [7]: the mutations that elicited the highest increase in
dnaE2 expression (H526D, S531W and S522L/V176F) are rarely found in clinical isolates,
whereas the H526Y and S531L mutations, which did not induce a detectable increase in
dnaE2 expression, are the two most common rpoB mutations seen both clinically and in
the laboratory [4]. The increased dnaE2 expression associated with the uncommon
mutations is probably in part a reflection of the reduced fitness of bacteria carrying
these mutations.
D I S C U S S I O N | 67
It is unclear whether bacterial stress induced by rpoB mutations that confer resistance
to rifampicin/RFB has a significant effect on the subsequent acquisition of further
resistance and adaptation of the bacteria. The range of secondary rpoB mutations
acquired by strain R190 (S522L) has been studied previously and a significant shift was
observed from the spectrum of mutations observed in clinical isolates as well as in the
first round of selection [6]. It is tempting to speculate that this may be partly due to an
increase in the expression of dnaE2 as a consequence of the altered rpoB gene.
Although other factors may also be important, reduced fitness may allow detrimental
mutations to exist in the genome, because any negative effect would be reduced in an
already unfit organism. This could potentially lead to a higher mutation frequency
because there is a wider range of additional mutations available.
Mutations in a gene as critical for bacterial survival as rpoB most likely have effects on
many areas of cellular function [29,30]. It is probable that all rpoB mutants tested, and
perhaps all strains carrying mutations in rpoB have an altered expression of a wide
range of genes but that changes in the expression levels of the studied genes in the
‘fitter’ mutants are too subtle to be unequivocally detected by the methods used.
The effects that were measured could merely be a marker for the reduced fitness as a
consequence of rpoB mutations or could indicate a higher propensity to develop further
adaptive mutations. A recent study showed that bacteria with disabled SOS responses
were unable to acquire drug resistance [27], and mice infected with an MTB dnaE2
knockout strain had a lower bacterial load and longer survival times than those infected
with wild-type MTB [21]. In addition, it has recently been shown by comparing the
growth rates of in vitro rpoB-mutants of MTB with genetically related drug-resistant
patient isolates that even the fittest mutants (S531L) initially have a small but
detectable fitness deficit. Experiments on clinical isolate pairs indicated that
subsequent adaptation had restored fitness in four of the five sensitive/resistant
patient isolate pairs studied [9]. This indicates that subsequent adaptive mutation is
almost certainly required for even the fittest rpoB mutants and a moderately induced
stress response in these isolates would be expected to facilitate this adaptation. It is
tempting to speculate that the moderately increased dnaE2-expression levels, such as
described here, may also lead to an equally moderate increase in the mutation rate.
According to several mathematical models as well as in vitro studies, moderate rather
than strong mutators have the highest chances of survival [31,32]; adaptation of
bacteria after selection for streptomycin resistance has been shown to ‘fix’ resistance
mutations in populations of E. coli, reversion to the sensitive genotype after adaptation
resulted in a loss of fitness [33].
Studies of the effects and interactions of different resistance mutations on the
adaptation of MTB are warranted as they may allow future treatment regimens to be
68 | C H A P T E R 3
designed more rationally in order to minimize the selection of devastating multidrugresistant strains [11,34].
Acknowledgements
The authors would like to thank Colin Ingham for critically reading the manuscript and
Stephen Gillespie for helpful discussions. This work was partly funded by the EU 6th
Framework Programme TBAdapt.
A C K N O W L E D G E M E N T S | 69
References
1. Ramaswamy S, Musser JM (1998) Molecular genetic basis of antimicrobial agent
resistance in Mycobacterium tuberculosis: 1998 update. Tubercle and Lung Disease 79: 329.
2. Hershfield E (1999) Tuberculosis: 9. Treatment. CMAJ 161: 405-411.
3. Cox H, Kebede Y, Allamuratova S, Ismailov G, Davletmuratova Z et al. (2006) Tuberculosis
recurrence and mortality after successful treatment: impact of drug resistance. PLoS Med
3: e384.
4. Morlock GP, Plikaytis BB, Crawford JT (2000) Characterization of spontaneous, in vitroselected, rifampin-resistant mutants of Mycobacterium tuberculosis strain H37Rv.
Antimicrobial Agents and Chemotherapy 44: 3298-3301.
5. Heep M, Brandstatter B, Rieger U, Lehn N, Richter E et al. (2001) Frequency of rpoB
mutations inside and outside the cluster I region in rifampin-resistant clinical
Mycobacterium tuberculosis isolates. J Clin Microbiol 39: 107-110.
6. Anthony RM, Schuitema ARJ, Bergval IL, Brown TJ, Oskam L et al. (2005) Acquisition of
rifabutin resistance by a rifampicin resistant mutant of Mycobacterium tuberculosis
involves an unusual spectrum of mutations and elevated frequency. Annals of Clinical
Microbiology and Antimicrobials 4.
7. Billington OJ, Mchugh TD, Gillespie SH (1999) Physiological cost of rifampin resistance
induced in vitro in Mycobacterium tuberculosis. Antimicrobial Agents and Chemotherapy
43: 1866-1869.
8. Mariam DH, Mengistu Y, Hoffner SE, Andersson DI (2004) Effect of rpoB Mutations
Conferring Rifampin Resistance on Fitness of Mycobacterium tuberculosis. Antimicrobial
Agents and Chemotherapy 48: 1289-1294.
9. Gagneux S, Long CD, Small PM, Van T, Schoolnik GK et al. (2006) The competitive cost of
antibiotic resistance in Mycobacterium tuberculosis. Science 312: 1944-1946.
10. Counago R, Chen S, Shamoo Y (2006) In vivo molecular evolution reveals biophysical
origins of organismal fitness. Mol Cell 22: 441-449.
11. Weinreich DM, Delaney NF, DePristo MA, Hartl DL (2006) Darwinian evolution can follow
only very few mutational paths to fitter proteins. Science 312: 111-114.
12. Martinez JL, Baquero F (2000) Mutation frequencies and antibiotic resistance.
Antimicrobial Agents and Chemotherapy 44: 1771-1777.
13. Blazquez J (2003) Hypermutation as a factor contributing to the acquisition of
antimicrobial resistance. Clin Infect Dis 37: 1201-1209.
14. Radman M (1975) SOS repair hypothesis: phenomenology of an inducible DNA repair
which is accompanied by mutagenesis. Basic life sciences 5 A: 355-367.
15. Friedberg EC, Wagner R, Radman M (2002) Specialized DNA polymerases, cellular survival,
and the genesis of mutations. Science 296: 1627-1630.
16. Horst JP, Wu TH, Marinus MG (1999) Escherichia coli mutator genes. Trends Microbiol 7:
29-36.
17. LeClerc JE, Li B, Payne WL, Cebula TA (1996) High mutation frequencies among
Escherichia coli and Salmonella pathogens. Science 274: 1208-1211.
18. Murphy HS, Humayun MZ (1997) Escherichia coli cells expressing a mutant glyV (glycine
tRNA) gene have a UVM-constitutive phenotype: implications for mechanisms underlying
the mutA or mutC mutator effect. J Bacteriol 179: 7507-7514.
19. Balashov S, Humayun MZ (2004) Specificity of spontaneous mutations induced in mutA
mutator cells. Mutat Res 548: 9-18.
70 | C H A P T E R 3
20. Kogoma T (1994) Escherichia coli RNA polymerase mutants that enhance or diminish the
SOS response constitutively expressed in the absence of RNase HI activity. J Bacteriol
176: 1521-1523.
21. Boshoff HIM, Reed MB, Barry III CE, Mizrahi V (2003) DnaE2 polymerase contributes to in
vivo survival and the emergence of drug resistance in Mycobacterium tuberculosis. Cell
113: 183-193.
22. Bruck I, Goodman MF, O'Donnell M (2003) The essential C family DnaE polymerase is
error-prone and efficient at lesion bypass. J Biol Chem 278: 44361-44368.
23. Brooks PC, Movahedzadeh F, Davis EO (2001) Identification of some DNA damageinducible genes of Mycobacterium tuberculosis: apparent lack of correlation with LexA
binding. J Bacteriol 183: 4459-4467.
24. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time
quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408.
25. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res 29: e45.
26. Rand L, Hinds J, Springer B, Sander P, Buxton RS et al. (2003) The majority of inducible
DNA repair genes in Mycobacterium tuberculosis are induced independently of RecA. Mol
Microbiol 50: 1031-1042.
27. Cirz RT, Chin JK, Andes DR, de Crecy-Lagard V, Craig WA et al. (2005) Inhibition of
mutation and combating the evolution of antibiotic resistance. PLoS Biol 3: e176.
28. Gillespie SH, Basu S, Dickens AL, O'Sullivan DM, Mchugh TD (2005) Effect of subinhibitory
concentrations of ciprofloxacin on Mycobacterium fortuitum mutation rates. J Antimicrob
Chemother 56: 344-348.
29. Ingham CJ, Furneaux PA (2000) Mutations in the ss subunit of the Bacillus subtilis RNA
polymerase that confer both rifampicin resistance and hypersensitivity to NusG.
Microbiology 146 Pt 12: 3041-3049.
30. Maughan H, Galeano B, Nicholson WL (2004) Novel rpoB mutations conferring rifampin
resistance on Bacillus subtilis: global effects on growth, competence, sporulation, and
germination. J Bacteriol 186: 2481-2486.
31. Taddei F, Radman M, Maynard-Smith J, Toupance B, Gouyon PH et al. (1997) Role of
mutator alleles in adaptive evolution. Nature 387: 700-702.
32. Denamur E, Matic I (2006) Evolution of mutation rates in bacteria. Mol Microbiol 60: 820827.
33. Schrag SJ, Perrot V, Levin BR (1997) Adaptation to the fitness costs of antibiotic
resistance in Escherichia coli. Proc Biol Sci 264: 1287-1291.
34. Chait R, Craney A, Kishony R (2007) Antibiotic interactions that select against resistance.
Nature 446: 668-671.
R E F E R E N C E S | 71