Leukemia (1998) 12, 486–492
 1998 Stockton Press All rights reserved 0887-6924/98 $12.00
http://www.stockton-press.co.uk/leu
Localization of Fas and Fas ligand in bone marrow cells demonstrating
myelodysplasia
M Kitagawa1, S Yamaguchi2, M Takahashi2, T Tanizawa2, K Hirokawa1 and R Kamiyama2
1
Department of Pathology and Immunology, Faculty of Medicine; and 2Division of Morphological Technology, Allied Health Sciences,
Faculty of Medicine, Tokyo Medical and Dental University, Tokyo, Japan
Frequent apoptosis in the bone marrow of patients with myelodysplastic syndromes (MDS) was demonstrated on frozen sections using the terminal deoxytransferase (TdT)-mediated dUTP
nick end labeling (TUNEL) method. The overall mean percentage of TUNEL-positive cells was about 17% in the bone marrow
of MDS, while bone marrow from control cases exhibited a
mean of 3.4% (P ⬍ 0.001). To elucidate the mechanism of
apoptosis in bone marrow cells of MDS, the expression of Fas
antigen and Fas ligand (FasL) was examined by RT-PCR and
immunohistochemistry. All MDS cases showed expression of
Fas mRNA (12/12) and most exhibited an expression of FasL
mRNA (10/12) by RT-PCR. Basically, control cases did not show
positive signals for Fas and FasL mRNA, however, a very weak
band was detected in three cases (3/10) for Fas and in one case
(1/10) for FasL mRNA by RT-PCR. Immunohistochemical examination revealed positive staining for Fas (11/12) and FasL
(12/12) in the bone marrow of MDS, while all the bone marrow
samples from control cases were negative for anti-Fas (0/15)
and for anti-FasL (0/15) antibody. Double staining clarified that
TUNEL-positive apoptotic cells expressed Fas antigen on the
cell surface, although not all Fas-positive cells were TUNEL
positive. The Fas-positive cells of MDS bone marrow included
hematopoietic cells expressing CD34 antigen, neutrophil elastase, a marker for myeloid series of cells, or glycophorin A, a
marker for erythroid cells. However, CD68-positive cells which
were macrophage lineage cells, did not express Fas antigen
strongly. In contrast, positive staining for FasL was detected
in hematopoietic cells and CD68-positive cells in the bone marrow of MDS. These results suggest that the Fas–FasL system
plays an important role in inducing apoptosis in the bone marrow of MDS and works in an autocrine (hematopoietic cell–
hematopoietic cell interaction) and/or paracrine (hematopoietic
cell–stromal cell interaction) manner.
Keywords: myelodysplastic syndromes; apoptosis; Fas; Fas
ligand; bone marrow; RT-PCR; immunohistochemistry
Introduction
Myelodysplastic syndromes (MDS) are a heterogeneous group
of hematological malignancies affecting mainly the middle
aged and elderly.1–3 The majority of affected patients die
within 1–2 years due to overt leukemic transformation or the
complication of hematocytopenias. The development of hematocytopenias despite the presence of cellular marrow is
thought to be due to ineffective hematopoiesis probably associated with frequent apoptosis of hematopoietic cells in the
bone marrow.4,5 In vitro examination revealed that the proliferation as well as death of hematopoietic cells is regulated
by various proteins with stimulatory and inhibitory activities.1
Although the exact function of these substances in vivo has
not yet been elucidated, overexpression of certain cell surface
receptor molecules and/or certain soluble factors by bone
Correspondence: M Kitagawa, Department of Pathology and Immunology, Faculty of Medicine, Tokyo Medical and Dental University,
1-5-45 Yushima, Bunkyo-ku, Tokyo 113, Japan; Fax: 81 3 5803 0123
Received 29 September 1997; accepted 10 December 1997
marrow cells may disrupt hematopoiesis by exerting apoptosis
on hematopoietic cells. Cytokines are a family of proteins that
regulate cellular proliferation and differentiation by binding to
specific receptors on target cells. In the bone marrow of
patients with MDS, clonal disorders with trilineage dysplasia,
interactions of abnormal clone cells with stromal cells including macrophages, fibroblastic cells and endothelial cells may
be important for cytokine production.6 Hematopoietic cells as
well as stromal cells have been reported to express a wide
range of substances which may play complex regulatory roles
in hematopoiesis.7–9 We have reported previously that the
number of macrophage lineage cells significantly increased in
the bone marrow of MDS patients as compared with that of
the control or de novo AML bone marrow.10 Furthermore,
bone marrow macrophages express tumor necrosis factor
(TNF)␣ and interferon (IFN)-␥ which have an accelerating
effect on apoptosis.11 Regarding the induction of apoptosis,
two factors are known to bind to receptors, induce apoptosis
and kill the cells within hours.12,13 One of them is TNF-␣ and
the other is Fas ligand (FasL). Fas, the receptor for FasL, is a
type I membrane protein and a member of the TNF receptor
family. Binding of FasL to Fas or cross-linking of Fas with
agonistic antibodies induces apoptosis in Fas-bearing cells.
Thus, in the present study, the contribution of the Fas–FasL
system to the induction of apoptosis was examined in bone
marrow samples from MDS patients. To further clarify the cells
responsible for apoptosis, the distribution and cell type of Fas
or FasL expressing cells was determined in the bone marrow
of MDS.
Recently, reverse transcriptase (RT)-polymerase chain reaction (PCR) amplification has proven to be a sensitive method
for the detection of very low expression of mRNA from limited
clinical samples.14,15 This study therefore attempted to investigate Fas and FasL in MDS in vivo using RT-PCR and then to
immunohistochemically demonstrate the localization of Fas
and/or FasL producing cells in the bone marrow.
Materials and methods
Patients
Bone marrow samples of trephin biopsy and partly autopsy
material were taken from 17 patients with MDS; four with
refractory anemia (RA), one with RA with ring sideroblasts
(RARS), four with RA with excess of blasts (RAEB), five with
RAEB in transformation (RAEB-T) and three with chronic
myelomonocytic leukemia (CMMoL). The samples were
embedded in OCT compound (purchased from Sakura, Tokyo,
Japan), frozen using liquid nitrogen, cryosectioned and investigated for frequency of apoptotic cells and the expression of
Fas and FasL. A diagnosis of MDS was based on FAB criteria.1
None of the patients had received specific therapeutic agents
prior to the study. The range of age in MDS patients was 44–
Fas and Fas-L in MDS bone marrow
M Kitagawa et al
83 (62.2 ± 10.9, mean ± s.d.) and male:female ratio was 12:5.
Bone marrow samples from 18 individuals with no hematological disorders were used as controls (age range 21–84,
mean ± s.d., 62.8 ± 15.7; male:female, 11:7).
UV fluorescence after staining with ethidium bromide.
␸X174/HaeIII-cut DNA was run in parallel as a molecular
weight marker. Then, the density of bands was measured by
scanning imager, Image Quant (Molecular Dynamics, Sunnyvale, CA, USA).
Detection of apoptotic cells by end labeling method
Immunohistochemistry
To determine apoptotic cells on frozen tissue sections by terminal deoxytransferase (TdT)-mediated dUTP nick end labeling (TUNEL), the in situ cell death detection kit, fluorescein
(Boehringer Mannheim, Mannheim, Germany) was used. The
method was a modified version of the biotin–peroxidase system detection method described previously.16 Briefly, frozen
sections were fixed with 4% paraformaldehyde solution for
20 min, washed with phosphate-buffered saline (PBS), incubated in 0.1% sodium citrate-0.1% Triton X-100 for 2 min,
washed with PBS and then incubated with fluorescein isothiocyanate (FITC)-labeled dUTP and TdT at 37°C for 60 min.
Sections were then observed by fluorescein microscopy and
the TUNEL-positive cell ratio was determined by dividing the
number of positively stained cells by the total cell number
(counting more than 500 cells).
Preparation of RNA samples and amplification
method
RNA was isolated from frozen bone marrow samples by a
guanidium isothiocyanate solubilization/LiCl precipitation
procedure. Tissue RNA (250 ng) was used as a template for
the amplification reactions. Oligonucleotides as specific primers for Fas and FasL were synthesized by a commerical laboratory (Life Technologies Oriental, Tokyo, Japan). The
sequences of primers were as follows: Fas: 5′ PCR primer
CCTACCTCTGGTTCTTACGT, 3′ PCR primer GGCTTTGTCTGTACTCCT; FasL: 5′ PCR primer CAAGTCCAACTCAAGGTCCATGCC, 3′ PCR primer CAGAGAGAGCTCAGATACGTTTGAC; ␤-actin: 5′ PCR primer AAGAGAGGCATCCTCACCCT, 3′ PCR primer TACATGGCTGGGGTGTTGAA. The expected sizes of PCR products were 265 bp for
Fas, 345 bp for FasL and 218 bp for ␤-actin. Complementary
(c)DNA was synthesized by using Rous-associated virus
reverse transcriptase (Takara Biomedicals, Kyoto, Japan). The
PCR reaction was performed as described.9,14,15 As a control
reaction of PCR, ␤-actin was also used in each run. Briefly,
250 ng of the RNA was used for RT-PCR. For cDNA synthesis,
250 ng in 20 ␮l of sample RNA solution was heated at 65°C
for 5 min and cooled rapidly. After adding 20 U of ribonuclease inhibitor (Takara, Japan), 5 ␮l of 2 mM dNTP (dATP,
dCTP, dGTP, dTTP; Perkin Elmer, Applied Biosystems
Divisions, Foster City, CA, USA) and 3 U of Rous-associated
virus reverse transcriptase (Takara, Japan), the mixture was
incubated at 42°C for 60 min, then heated at 95°C for 5 min
and cooled rapidly. The PCR reaction mixture contained 5 ␮l
of cDNA, 2.5 ␮l of 10 × PCR buffer, 11 ␮l of 20 mM MgCl2,
2 ␮l of 2 mM dNTP, 11.35 ␮l of DEPC-water, 100 pM 5′ and
3′ primer, and 2.5 U of thermostable Taq polymerase (Perkin
Elmer Cetus, Norwalk, CT, USA). The amplification was achieved with a DNA thermal cycler (Perkin Elmer Cetus). After
denaturing at 94°C for 10 min, the amplification was conducted for 35 cycles at 94°C for 30 s, 55°C for 30 s and 72°C for
60 s. This was followed by re-extension for 10 min at 72°C.
Ten milliliter aliquots of the product samples were analyzed
by electrophoresis on a 1.8% agarose gel and visualized by
To examine the distribution of Fas or FasL expressing cells in
the bone marrow, a polyclonal rabbit antibody against Fas
(BIOMOL Research Laboratories, Plymouth Meeting, PA,
USA) or a monoclonal antibody against FasL (C-20; Santa
Cruz Biotechnology, Santa Cruz, CA, USA) was applied to
frozen sections. Sections were then incubated with fluorescein
isothiocyanate (FITC)-conjugated anti-rabbit IgG antibody
(DAKO, Glostrup, Denmark) or FITC-conjugated anti-mouse
IgG antibody (Pharmingen, San Diego, CA, USA). For double
staining of Fas or FasL immunostaining and the TUNEL
method, immunostaining was performed first using tetramethyl rhodamine isothiocyanate (TRITC)-conjugated secondary
antibodies (DAKO) and then, TUNEL staining was performed
using FITC-labeled dUTP. To define the cell type on the same
sections, the distribution of hematopoietic precursor cells,
myeloid series of cells, erythroid series of cells, or bone marrow macrophages was determined by double immunostaining
of Fas/FasL with anti-CD34 antibody (NU4A-1; Nichirei,
Tokyo, Japan), anti-neutrophil elastase antibody (DAKO), antiglycophorin A antibody (DAKO), or anti-CD68 antibody (KP1; DAKO). This was followed by incubation with TRITC-conjugated anti-mouse IgG (DAKO). Control procedures included
the substitution of equivalent concentrations of a heavy chainmatched monoclonal antibody of irrelevant specificity and the
staining of bone marrow sections from control cases. Sections
were observed and analyzed using a confocal laser scanning
microscope (TCS NT; Leica, Heerbrugg, Switzerland).
Results
Frequency of apoptotic cells in the bone marrow
To confirm the frequent apoptosis in bone marrow cells of
MDS patients, the TUNEL-positive cell ratio was determined
and compared in frozen tissue sections between MDS and
control bone marrow (Figure 1a and b). As shown in Table 1,
in bone marrow of MDS cases, more than 12% of cells were
TUNEL positive (12.6–25.3%, mean ± s.d.; 17.2 ± 4.9%),
whereas less than 6% were positive in control bone marrow
(1.1–5.6%, mean ± s.d.; 3.4 ± 1.5%). The difference between
MDS and control cases was significant by Student’s t-test
(P ⬍ 0.001). Among subtypes of MDS cases, the TUNEL-positive cell ratio of RA or RAEB cases was larger than that of
RAEB-T or CMMoL cases. The differences were significant
between RAEB and RAEB-T (P ⬍ 0.01) and RAEB and
CMMoL (P ⬍ 0.02).
Expression of mRNA for Fas or FasL in the bone
marrow
So as to examine very low levels of mRNA expression in bone
marrow cells, RT-PCR was performed using RNA from frozen
bone marrow tissues. This method revealed the expression of
Fas or FasL mRNA, as defined by a 265 bp and a 345 bp PCR
487
Fas and Fas-L in MDS bone marrow
M Kitagawa et al
488
a
b
Figure 1
Detection of apoptotic cells in the bone marrow from an MDS (a, RA, original magnification × 200) and control (b, original magnification × 200) case by the TUNEL method. Note that many of the nuclei of bone marrow cells from MDS patients are labeled with FITC-labeled
dUTP by the TUNEL method.
Table 1
Frequency of apoptotic cells in bone marrow cells
(TUNEL method)
Cases
Number
TUNEL-positive cell ratio (%)
MDS
RA
RAEB
RAEB-T
CMMoL
13
3
4
4
2
17.2 ± 4.9*
17.9 ± 6.3
22.1 ± 2.9**,***
14.0 ± 1.9**
12.9 ± 0.4***
Control
15
3.4 ± 1.5*
The numbers of cases of each subtype are different from those
in Materials and methods, for example, RARS could not be determined. This was because the sample was too small for full
examination.
Differences were significant by Student’s t-test *P ⬍ 0.001,
**P ⬍ 0.01, ***P ⬍ 0.02.
product, respectively. As shown in Figure 2, control cases
showed no expression of Fas mRNA (lanes 1–3), while the
majority of MDS cases exhibited positive signals for Fas
mRNA (lanes 4–7). In MDS cases developing overt leukemia,
signals for Fas expression were very weak (lanes 8 and 9). As
shown in Figure 2, bone marrow samples from MDS patients
showed strong expression of FasL mRNA, whereas those from
control cases showed no distinct expression, although one
case exhibited a very weak band for FasL mRNA. As expected,
signals for ␤-actin (positive control) were detected in all the
bone marrow samples by RT-PCR reaction. However, because
the bands for ␤-actin in lanes 1–3 and 9 were weak compared
to the bands in other lanes, we measured the density of bands
for Fas as well as ␤-actin of each lane and calculated the ratio
of the density Fas/␤-actin. In control cases, the ratio was
0.13 ± 0.03 (mean ± s.d.), while the ratio was 0.84 ± 0.17 in
MDS cases. Difference was significant by Student’s t-test
(P ⬍ 0.002). As expected, the ratio of MDS cases developing
overt leukemia (0.23 ± 0.11) was significantly lower than
those of MDS cases (P ⬍ 0.05). Similarly, the ratio of the density of bands FasL/␤-actin was calculated as 0.19 ± 0.10 in
control, 1.10 ± 0.43 in MDS cases and 0.98 ± 0.08 in MDS
cases developing overt leukemia. Differences were significant
between control and MDS (P ⬍ 0.03) and control and MDS
cases developing overt leukemia (P ⬍ 0.005).
The case distribution of up-regulation of Fas as well as FasL
mRNA in bone marrow samples is summarized in Table 2. All
Table 2
Frequency of positive signals for Fas and FasL in bone
marrow cells (RT-PCR assay and immunohistochemistry) (number of
positive cases/total of cases)
Cases
MDS
RA
RARS
RAEB
RAEB-T
CMMoL
Control
Figure 2
Detection of mRNAs for Fas, FasL and ␤-actin by RTPCR. In contrast to negative signals in control cases (lanes 1–3), positive bands for Fas (265 bp) were observed in MDS cases (lanes 4–9;
4, RAEB-T; 5, RAEB; 6, RA; 7, RA; 8, CMMoL developing overt leukemia; 9, RAEB-T developing overt leukemia). RT-PCR signals for FasL
mRNA (345 bp) were also detected in bone marrow samples from
MDS patients. Although three control cases showed faint signals for
Fas and one case was positive for FasL, signals were very weak compared to those of MDS cases. An RT-PCR reaction for ␤-actin (218 bp)
was performed as an internal control, and positive signals were
observed in all the samples examined.
Fas
FasL
RT-PCRa
IMHa
RT-PCR
IMH
12/12
4/4
ND
2/2
4/4
2/2
11/12
3/3
0/1
3/3
4/4
1/1
10/12
4/4
ND
2/2
3/4
1/2
12/12
3/3
1/1
3/3
4/4
1/1
0 (3)/10b
0/15
0 (1)/10c
0/15
ND, not determined.
a
IMH, immunohistochemistry. In a few cases, the amount of mRNA
prepared from the bone marrow samples was insufficient for RTPCR reaction. In addition, immunohistochemical analysis could not
be performed in a few cases because the sample was too small to
estimate the reaction.
b
Very weak reaction for Fas mRNA was observed in three control
cases by RT-PCR.
c
One control case exhibited a very weak band for FasL mRNA by
RT-PCR.
Fas and Fas-L in MDS bone marrow
M Kitagawa et al
of the MDS cases expressed Fas mRNA (12/12, 100%), while
none of the control samples (0/10) showed distinct signals
although a very weak reaction was observed in three cases.
The differences in the frequency of Fas mRNA expressing
cases were statistically significant between MDS and control
(Fisher’s exact test, P ⬍ 0.001). Similarly, positive RT-PCR signals for FasL mRNA were observed in the majority of MDS
cases (10/12, 83%) (Table 2) and the ratio of positive cases to
total cases was significantly higher than that of control cases
(0/10) (P ⬍ 0.001 by Fisher’s exact test).
Localization of Fas or FasL expressing cells in the
bone marrow of MDS patients
As the mRNA of Fas or FasL was overexpressed in bone marrow cells of MDS patients, immunohistochemical staining was
performed to localize the Fas or FasL expressing cells on bone
marrow tissue sections. Cells with distinct surface staining
were determined as Fas positive, although several scattered
signals of non-cellular/non-specific staining was observed in
each sample. As shown in Figure 3a, Fas-positive cells were
diffusely distributed in the bone marrow of MDS patients. For
FasL staining, cell surface as well as cytoplasmic signals was
demonstrated as positive. Although FasL was also positive in
most of the hematopoietic cells (Figure 3c), we could not distinguish the production from the binding of FasL on the cell
surface by immunohistochemical staining. Control bone marrows did not show remarkable signals for Fas (Figure 3b) and
FasL (Figure 3d). All the bone marrow samples from MDS
patients and control cases were negatively stained when the
irrelevant control antibody was used in substitution of primary
antibodies (data not shown). The number of cases shown to
have Fas- or FasL-positive bone marrow cells by immunohistochemistry is summarized in Table 2. As expected from the
results by RT-PCR, Fas (11/12) as well as FasL (12/12) was
expressed in the majority of bone marrow samples from MDS
cases in contrast to control bone marrow which expressed
neither. Double staining by the TUNEL method and immunohistochemistry revealed that the apoptotic cells of MDS
bone marrow (FITC, green) were Fas positive (TRITC, red),
although not all Fas expressing cells were positive with the
TUNEL method (Figure 3e). The majority of apoptotic cells
(FITC, green) were also positively stained with anti-FasL antibody (TRITC, red) (Figure 3f).
To determine the type of cells expressing Fas or FasL, double immunostaining for Fas/FasL and cell markers was performed. Positive signals for Fas/FasL were determined with
FITC-conjugated secondary antibodies as green color and
positive staining for cell markers were shown by TRITC-conjugated secondary antibodies as red color. Double-positive cells
were exhibited with yellow color by the combination of green
and red color. The CD34-positive cells, neutrophil elastasepositive cells and glycophorin A-positive cells were also positively stained with anti-Fas or anti-FasL antibody (Figure 3g, h
and i). In addition to hematopoietic cells, FasL was localized
to the cytoplasm of scattered cells with irregular-shaped cytoplasm. In shape these cells resembled bone marrow stromal
cells and not hematopoietic cells. Double immunostaining for
FasL and CD68 antigen, a marker for macrophage lineage
cells, clarified that FasL producing irregular-shaped cells were
basically CD68-positive, suggesting that these cells were
mainly of bone marrow macrophage lineage (Figure 3j). In
contrast, Fas-positive cells expressed little CD68 antigen (data
not shown).
Discussion
Bone marrow cells from MDS patients are known to have
unbalanced growth characteristics17–20 but the underlying
mechanisms causing them are still unclear. A high rate of
apoptosis explains the ineffective hematopoiesis observed in
MDS. Using plastic-embedded bone marrow biopsy samples
and an in situ end labeling technique, Raza et al4,21 found
that ⭓ 75% of all hematopoietic cells were apoptotic in the
bone marrow of MDS patients. Kanter et al22 also reported
massive apoptosis in MDS bone marrow cells of formalinfixed paraffin-embedded tissue sections. However, much
fewer cells were evaluated as apoptotic based on morphology23 or a TUNEL technique on bone marrow smears.24,25
In the present study, we examined the apoptotic cells by the
TUNEL method using frozen bone marrow samples and demonstrated that the mean percentage of apoptotic cells in the
bone marrow of MDS was 17.2% which was comparable to
the rate determined by TUNEL method using bone marrow
smears. Although there are no clear explanations for the difference in the rate of apoptosis observed in various studies, the
main difference may be ascribed to the fixation of bone marrow samples.24 Alternatively, the apoptotic cells may immediately be phagocytized by macrophages and such figures may
not be detected in frozen sections.
In the present study, results of Fas/FasL expression analysis
by RT-PCR technique correlated well with those by immunohistochemical staining. However, in one case of MDS, RTPCR method failed to demonstrate FasL expression by bone
marrow cells, while bone marrow cells of the case were positively stained with immunohistochemical staining. This may
result from the fact that the number of FasL expressing cells
in this case was rather small because the distinct expression
was limited to CD68-positive macrophage lineage cells.
The death of cells during embryogenesis, metamorphosis,
endocrine-dependent tissue atrophy and normal tissue turnover is programmed, mediated by a process of apoptosis.13
However, apoptosis is also mediated by a cytokine and its
receptor in some cases.4 Binding of FasL to Fas or cross-linking
of Fas with agonistic antibodies induces apoptosis in Fas-bearing cells.12,26,27 On the other hand, TNF-␣ induces apoptosis
and activates transcription factor NF-␬B.12,27 Furthermore,
TGF-␤ induced apoptosis in a myeloid leukemic cell
line.28–30 Previously, we have reported overexpression of
TNF-␣ and IFN-␥ in the bone marrow of MDS patients.11 Raza
et al4,21 also observed an increase of TNF-␣, TGF-␤ and IL1␤ in the bone marrow of MDS. Sato et al31 have reported that
IFN-␥,TNF-␣ and FasL can mediate potent inhibitory signals in
hematopoietic cells. Fas antigen expression on CD34-positive
bone marrow cells was increased by TNF-␣ and IFN-␥ in vitro.
Such a mechanism would be consistent with the observation
by Maciejewski et al32,33 that Fas receptor on CD34-positive
hematopoietic precursor cells is upregulated by various cytokines including TNF-␣, and with the suggestion that subsequent cell death is Fas-mediated.
Lepelley et al24 have found increased Fas antigen
expression in marrow cells (mostly erythroblasts) in about
50% of MDS patients. Gersuk et al34 have shown that marrow
mononuclear cells of patients with MDS strongly expressed
Fas and FasL compared to the cells of a normal individual. By
flow cytometric analysis, the fluorescence intensity for Fas on
bone marrow cells from MDS patients was stronger than in
normal controls, suggesting a higher antigen density on the
cell surface.34 The number of FasL expressing bone marrow
mononuclear cells of MDS patients was also increased com-
489
Fas and Fas-L in MDS bone marrow
M Kitagawa et al
490
a
b
c
e
f
g
h
i
j
d
Figure 3
(a–d) Immunohistochemical staining with anti-Fas (a, b) and anti-FasL (c, d) antibodies. Note that the majority of bone marrow cells
are positively stained with anti-Fas antibody as well as anti-FasL antibody in MDS (a, c, RAEB-T, original magnification × 200) in contrast to
control cases which are negative (b, d, × 200). (e) Double staining with anti-Fas antibody and the TUNEL method of a bone marrow section
from an MDS patient (RAEB-T, × 200). The TUNEL-positive cells expressed Fas antigen on the cell surface. (f) FasL was also positive in TUNELpositive bone marrow cells of MDS (RAEB, × 300). (g) Double immunostaining for CD34 antigen (TRITC, red) and Fas antigen (FITC, green)
shows that CD34 antigen is positive in some bone marrow cells and these cells are also positive with anti-Fas immunostaining (RA, × 200).
Double-positive cells are yellow (arrowheads). (h) Double immunstaining for neutrophil elastase (TRITC) and Fas (FITC) (RA, × 200) indicating
that myeloid series of cells expressed Fas antigen on the cell surface (arrowheads). (i) Double immunostaining for glycophorin A (TRITC) and
FasL (FITC) (RAEB, × 200). Glycophorin A-positive erythroblasts are FasL positive (yellow, arrowheads), while red blood cells are glycophorin
A single positive (red). (j) FasL is positively stained not only in hematopoietic cells but also in the cytoplasm of irregular-shaped cells. Double
immunostaining with anti-CD68 antigen antibody and anti-FasL antibody shows that irregular-shaped cells of the bone marrow are double
positive (TRITC and FITC, yellow, arrowheads) (RARS, × 200).
Fas and Fas-L in MDS bone marrow
M Kitagawa et al
pared to control bone marrow cells.34 Recently, Bouscary et
al25 have shown that patients with MDS had upregulation of
Fas expression on total bone marrow nuclear cells, CD34positive, CD33-positive and glycophorin-positive bone marrow cells compared to controls. No statistical correlation
could be found between Fas expression and apoptosis rate.
Fas expression did not correlate to the FAB subtype but the
expression intensity on CD34-positive cells inversely correlated with the number of blasts. Thus, they have suggested
that leukemic blast cells lose Fas antigen expression with
progression of myelodysplasia. The present data on Fas
expression by MDS bone marrow cells were basically
consistent with their data.
It is possible that the release of regulatory cytokines such
as TNF-␣, IFN-␥, TGF-␤, or others by bone marrow stromal
cells,11 results in the upregulation of not only Fas, but also
FasL in hematopoietic cells. Alternatively, MDS bone marrow
cells in the process of their evolution, may spontaneously
upregulate Fas, FasL or both, or show increased responsiveness to exogenous cytokines thereby facilitating upregulation.34 Bogdanovic et al23 observed that apoptosis developed
in ‘clusters’ of marrow cells and speculated that this phenomenon is related to the production of cytokines such as TNF-␣
or TGF-␤. These findings were consistent with the present data
suggesting that Fas-positive cells were mainly hematopoietic
cells and FasL-positive cells were a mixture of hematopoietic
cells as well as bone marrow macrophages. These results indicate that the Fas–FasL system can work in both an autocrine
(hematopoietic cell–hematopoietic cell interaction) and paracrine manner (hematopoietic cell–stromal cell interaction) in
the bone marrow of MDS patients, although further study for
the function and network of other factors may be necessary
to clarify the precise mechanism of apoptosis in the bone
marrow of MDS.
References
1 Delacretaz F, Schmidt P-M, Piguet D, Bachmann F, Costa J. The
FAB classification (proposals) applied to bone marrow biopsy. Am
J Clin Pathol 1987; 87: 180–186.
2 Jacobs A. Myelodysplastic syndromes: pathogenesis, functional
abnormalities, and clinical implications. J Clin Pathol 1985; 38:
1202–1217.
3 Kitagawa M, Kamiyama R, Takemura T, Kasuga T. Bone marrow
analysis of the myelodysplastic syndromes: histological and immunohistochemical features related to the evolution of overt leukemia.Virchows Arch B 1989; 57: 47–53.
4 Raza A, Mundle S, Shetty V, Alvi S, Chopra H, Span L, Parcharidou
A, Dar S, Venugopal P, Borok R, Gezer S, Showel J, Loew J, Robin
E, Rifkin S, Alston D, Hernandez B, Shar R, Kaizer H, Gregory
S. Novel insights into the biology of myelodysplastic syndromes:
excessive apoptosis and the role of cytokines. Int J Hematol 1996;
63: 265–278.
5 Mundle SD, Venugopal P, Cartlidge JD, Pandav DV, Broady-Robinson L, Gezer S, Robin EL, Rifkin SR, Klein M, Alston DE, Hernandez BM, Rosi D, Alvi S, Shetty VT, Gregory SA, Raza A. Induction
of an involvement of interleukin-1␤ converting enzyme-like protease in intramedullary apoptotic cell death in the bone marrow
of patients with myelodysplastic syndromes. Blood 1996; 88:
2640–2647.
6 Mayani H, Guilbert LJ, Janowska-Wieczorek A. Biology of the
hematopoietic microenvironment. Eur J Hematol 1992; 49: 225–
233.
7 Golde DW, Finley TN, Cline MJ. Production of colony-stimulating
factor by human macrophages. Lancet 1972; ii: 1397–1399.
8 Pelus LM, Broxmeyer HE, Moore MAS. Regulation of human myelopoiesis by prostaglandin E and lactoferrin. Cell Tissue Kinet 1981;
14: 515–526.
9 Rappolee DA, Mark D, Banda MJ, Werb Z. Wound macrophages
express TNF-␣ and other growth factors in vivo: analysis by mRNA
phenotyping. Science 1988; 241: 708–712.
10 Kitagawa M, Kamiyama R, Kasuga T. Increase in number of bone
marrow macrophages in patients with myelodysplastic syndromes.
Eur J Hematol 1993; 51: 56–58.
11 Kitagawa M, Saito I, Kuwata T, Yoshida S, Yamaguchi S, Takahashi
M, Tanizawa T, Kamiyama R, Hirokawa K. Overexpression of
tumor necrosis factor (TNF)-␣ and interferon (IFN)-␥ by bone
marrow cells from patients with myelodysplastic syndromes.
Leukemia 1997; 11: 2049–2054.
12 Nagata S. Apoptosis by death factor. Cell 1997; 88: 355–365.
13 Nagata S. Fas-mediated apoptosis. In: Gupta S, Cohen J (eds).
Mechanisms of Lymphocyte Activation and Immune Regulation
VI. Plenum Press, New York, 1996, pp 119–124.
14 Kawasaki ES, Clark SS, Coyne MY, Smith SD, Champlin R, Witte
ON, McCormick FP. Diagnosis of chronic myeloid and acute lymphatic leukemias by detection of leukemia-specific mRNA
sequences amplified in vitro. Proc Natl Acad Sci USA 1988; 85:
5698–5702.
15 Saito I, Servenius B, Compton T, Fox RI. Detection of Epstein–
Barr virus DNA by polymerase chain reaction in blood and tissue
¨
biopsies from patients with Sjogren’s syndrome. J Exp Med 1989;
169: 2191–2198.
16 Gavrieli Y, Sherman Y, Ben-Sasson SA. Identification of programmed cell death in situ via specific labeling of nuclear DNA
fragmentation. J Cell Biol 1992; 119: 493–501.
17 Faille A, Prosch C. Prognostic value of in vitro bone marrow culture in refractory anemia with excess of myeloblasts. Scand J
Haematol 1987; 20: 286–288.
18 Francis GE, Wing MA, Miller EJ, Berney JJ, Wonke B, Hoffbrand
AV. Use of bone-marrow culture in prediction of acute leukaemic
transformation in preleukemia. Lancet 1983; i: 1409–1412.
19 Olofsson T, Olsson I. Biochemical characterization of a leukemiaassociated inhibitor (LAI) suppressing normal granulopoiesis in
vitro. Blood 1980; 55: 983–991.
20 Cukrova V, Neuwitova R, Vermak J, Neuwirt J. Inhibitor of normal
granulopoiesis produced by cells of MDS patients. Neoplasma
1989; 36: 83–89.
21 Raza A, Gezer S, Mundle S, Gao X-Z, Alvi S, Borok R, Rifkin S,
Iftikhar A, Shetty V, Parcharidou A, Loew J, Marcus B, Khan Z,
Chaney C, Showel J, Gregory S, Preisler H. Apoptosis in bone
marrow biopsy samples involving stromal and hematopoietic cells
in 50 patients with myelodysplastic syndromes. Blood 1995; 86:
268–276.
22 Kanter L, Hellstrom-Lindberg E, Kock Y, Rodensjo M, Ost A.
Erythropoietic effectiveness and apoptosis in patients with myelodysplastic syndromes (MDS) treated with G-CSF and EPO. Blood
1995; 86: (Suppl. 1): 338a (Abstr.).
23 Bogdanovic AD, Jankovic GM, Colovic MD, Trpinac DP, Bumbasirevic VZ. Apoptosis in bone marrow of myelodysplastic syndrome patients. Blood 1996; 87: 3064.
24 Lepelley P, Campergue L, Grardel N, Preudhomme C, Cosson A,
Fenaux P. Is apoptosis a massive process in myelodysplastic syndromes? Br J Haematol 1996; 95: 368–371.
25 Bouscary D, Vos JD, Guesnu M, Jondeau K, Viguier F, Melle J,
Picard F, Dreyfus F, Fontenay-Roupie M. Fas/Apo-1 (CD95)
expression and apoptosis in patients with myelodysplastic syndromes. Leukemia 1997; 11: 839–845.
26 Giordano C, Stassi G, De Maria R, Todaro M, Richiusa P, Papoff
G, Ruberti G, Bagnasco M, Testi R, Galluzzo A. Potential involvement of Fas and its ligand in the pathogenesis of Hashimoto’s thyroiditis. Science 1997; 275: 960–963.
27 Lynch DH. The role of FasL and TNF in the homeostatic regulation
of immune responses. In: Gupta S, Cohen J (eds). Mechanisms of
Lymphocyte Activation and Immune Regulation VI. Plenum Press,
New York, 1996, pp 135–138.
28 Selvakumaran M, Lin H-K, Miyashita T, Wang HG, Krajewski S,
Reed JC, Hoffman B, Liebermann D. Immediate early up-regulation of bax expression by p53 but not TGF␤1: a paradigm for
distinct apoptotic pathways. Oncogene 1994; 9: 1791–1798.
29 Selvakumaran M, Reed JC, Liebermann D, Hoffman B. Progression
of the myeloid differentiation program is dominant to transforming
growth factor-␤1-induced apoptosis in M1 myeloid leukemic
cells. Blood 1994; 84: 1036–1042.
491
Fas and Fas-L in MDS bone marrow
M Kitagawa et al
492
30 Sachs L. The control of hematopoiesis and leukemia: from basic
biology to the clinic. Proc Natl Acad Sci USA 1996; 93: 4742–
4749.
31 Sato T, Selleri C, Anderson S, Young NS, Maciejewski JP.
Expression and modulation of cellular receptors for interferon-␥,
tumor necrosis factor, and Fas on human bone marrow CD34+
cells. Br J Haematol 1997; 97: 356–365.
32 Maciejewski JP, Selleri C, Sato T, Anderson S, Young NS.
Increased expression of Fas antigen on bone marrow CD34+ cells
of patients with aplastic anemia. Br J Haematol 1995; 91: 245–
252.
33 Maciejewski J, Selleri C, Anderson S, Young NS. Fas antigen
expression on CD34+ human marrow cells is induced by interferon gamma and tumor necrosis factor alpha and potentiates
cytokine-mediated hematopoietic suppression in vitro. Blood
1995; 85: 3183–3190.
34 Gersuk GM, Lee JW, Beckham CA, Anderson J, Deeg HJ. Fas
(CD95) receptor and Fas-ligand expression in bone marrow cells
from patients with myelodysplastic syndrome. Blood 1996; 88:
1122–1123.