Elevated
Plasma ACTH and Tall Stature in FGD
123-131
Tohoku J. Exp. Med., 2005, 205,
00-00
123
Possible Relationship between Elevated Plasma ACTH
and Tall Stature in Familial Glucocorticoid Deficiency
HIROKI IMAMINE, HARUO MIZUNO, YUKARI SUGIYAMA, YOICHIRO OHRO, TOKIO
SUGIURA and HAJIME TOGARI
Department of Pediatrics, Neonatology and Congenital Disorders, Nagoya City
University Graduate School of Medical Sciences, Nagoya, Japan
IMAMINE, H., MIZUNO, H., SUGIYAMA, Y., OHRO, Y., SUGIURA, T. and TOGARI, H. Possible Relationship between Elevated Plasma ACTH and Tall Stature in Familial Glucocorticoid Deficiency. Tohoku J. Exp. Med., 2005, 205 (2), 123-131 ── Familial glucocorticoid deficiency (FGD) is characterized clinically by severe glucocorticoid deficiency
associated with failure of adrenal responsiveness to ACTH but not with mineralcorticoid
deficiency. Excessive growth was described previously in some patients with FGD, many
of whom were shown to have mutations in the ACTH receptor gene. The mechanisms responsible for their excessive growth are unknown. We analyzed the ACTH receptor gene
in three patients with FGD and discussed the causes of excessive growth in FGD. No mutations were detected in the coding and promoter regions of the ACTH receptor gene of
one female patient who had tall stature (+ 2.41S.D.) and advanced bone age (10 years 9
months) when she was 4 years 9 months old. Her plasma ACTH level had been elevated
until then (124-2,684 pg/ml). Moreover, plasma estradiol was elevated for her age (21.3
pg/ml), and it decreased in response to the dexamethasone suppression test (from 25.4 to
6.9 pg/ml). Elevated plasma estradiol was apparently related to the increase in plasma
ACTH and played a major role in excessive growth in this patient. On the other hand, the
genetic analysis showed that the other two patients who were siblings were homozygous
for the R137W mutation. Clinically, they responded well to hydrocortisone replacement
therapy with almost normal plasma ACTH levels. Although all patients with the R137W
mutation reported previously were tall, our patients were of normal height. We speculate
that the major causes of excessive growth in FGD are not only from ACTH receptor mutation, but also from the action of elevated plasma ACTH. ──── familial glucocorticoid
deficiency; excessive growth; estradiol; ACTH receptor mutation; elevated plasma ACTH
© 2005 Tohoku University Medical Press
Familial glucocorticoid deficiency (FGD) is
a rare autosomal recessive disorder, and is characterized clinically by severe glucocorticoid deficiency associated with failure of adrenal responsiveness to ACTH but not with mineralcorticoid
deficiency. Following cloning of the ACTH receptor gene (Mountjoy et al. 1992), some cases of
FGD have been reported to have mutations in the
coding region of the gene (Clark et al. 1993;
Tsigos et al. 1993, 1995; Weber et al. 1995;
Received August 25, 2004; revision accepted for publication December 3, 2004.
Address for reprint: Hiroki Imamine, M.D., Department of Pediatrics, Neonatology and Congenital Disorders,
Nagoya City University Graduate School of Medical Sciences, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya
467-8601, Japan.
e-mail: [email protected]
123
124
H. Imamine et al.
Naville et al. 1996; Wu et al. 1998; Berberoglu et
al. 2001) and are classified as FGD type 1.
However, many FGD patients do not have mutations in the coding exon of the ACTH receptor
gene (Weber and Clark 1994; Naville et al. 1996,
1998), and they are classified as FGD type 2.
FGD is frequently associated with tall stature
(Kershnar et al. 1972; Coulter et al. 1991; Weber
et al. 1995; Clark and Weber 1998; Slavotinek et
al. 1998; Elias et al. 2000). Clark and Weber
(1998) noted that several children with FGD were
of tall stature and that the majority of them had
ACTH receptor mutations, whereas those children
with FGD but without such mutations were generally of normal height. However, all patients with
the same mutation did not have tall stature (Weber
et al. 1995). The mechanism of excessive growth
in FGD is unknown.
We analyzed the ACTH receptor gene in one
FGD patient with tall stature and two FGD patients with normal height to explore whether or
not the only major cause of excessive growth in
FGD is from ACTH receptor mutation. The dibutyryl cyclic AMP stimulation test was performed
to detect a post receptor abnormality in adrenocortical cells after cyclic AMP production in the
patient without ACTH receptor mutation. In addition, since plasma estradiol was excessive when
plasma ACTH was elevated in the patient with tall
stature, we performed the dexamethasone suppression test to explore the relationship between
plasma estradiol and plasma ACTH. We compared these results to the clinical findings in each
case, focusing on the causes of excessive growth
in FGD type 1 and type 2.
MATERIALS AND METHODS
Subject
Patient 1. Patient 1 was a female, who was born to
non-consanguineous Japanese parents after an uneventful
vaginal delivery at 40 weeks of gestation, with a birth
weight of 2,960 g. At 8 months of age, she was referred
to a medical institution due to generalized hyperpigmentation. Her external genitalia showed normal development for her age without any evidence of virilization
such as clitromegaly. Furthermore, there were no signs
of achalasia or alacrima which are noted in triple A syn-
drome. Endocrinological analysis revealed extremely
low serum cortisol (2.9 μ g/100 ml), elevated plasma
ACTH (1,000 pg/ml), and low plasma 17α -hydroxyprogesterone (0.4 ng/ml). Serum electrolytes were within
normal ranges (sodium 136 mEq/liter, potassium 4.7
mEq/liter, chloride 107 mEq/liter). A rapid ACTH test
(0.25 mg/m2 bolus i.v., with blood sampling at 0, 30, 60
and 120 minutes) indicated no increase in serum cortisol
throughout the test (Table 1). Consequently, she was diagnosed as having adrenal insufficiency, and hydrocortisone replacement therapy was introduced (20 mg/m2/day)
at the age of 11 months. When she was 4 years and 9
months old, a furosemide provocation test showed a
good response of plasma aldosterone (Table 1). Plasma
dehydroepiandrosterone sulfate (DHEA-S) was within
TABLE 1. A: Effects of rapid ACTH test
(Serum cortisol [μ g/100 ml])
Before
Patient 1
Patient 2
Patient 3
< 1.0
< 1.0
< 1.0
Minutes
30
60
120
1.2
< 1.0
< 1.0
1.3
< 1.0
< 1.0
< 1.0
< 1.0
Normal range (less than 1 year old): 12.4
± 5.3 μ g/100 ml (male), 12.8 ± 7.1 μ g/100 ml
(female)
Normal response: > 18 μ g/100 ml
B: Effects of furosemide provocation test
(Plasma aldosterone [pg/ml])
Before
Patient 1a(at 4 y 9 m)
Patient 2 (at 8 y 10 m)
Patient 3 (at 4 y 6 m)
41
14
10
Minutes
30
120
295
145
96
158
25
59
After 1 mg/kg furosemide was administered in the supine position at rest, the upright
position was maintained for 60 min to
examine the effect of the renin-angiotensin
system on aldosterone secretion.
Normal range: 11.1-334 pg/ml (8 years
old, male), < 402 pg/ml (4 years old, female)
Normal response was assumed when the
stimulated plasma aldosterone level exceeded
the base line level at least 2-fold.
a
samples taken while on hydrocortisone.
Elevated Plasma ACTH and Tall Stature in FGD
normal range (< 50 ng/ml). Thus, a diagnosis of FGD
was confirmed. The level of plasma ACTH had been elevated until then (124-2,684 pg/ml). At that time, her
height was 114.2 cm (+2.41 S.D.) (father’s height: 169
cm, mother’s height: 154 cm) and her bone age was 10
years 9 months (TW2 RUS method standardized for
Japanese children) (Fig 1A). Her height velocity was
10.3 cm/year (+4.73 S.D.) (Table 2). Breast development
was at Tanner stage II, pubic hair development at Tanner
125
stage I, and plasma estradiol was elevated for her age
(21.3 pg/ml). The gonadotropin-releasing hormone
(GnRH) stimulation test using 100 μ g/m2 of GnRH administered as bolus i.v. and taking blood samples at 0,
30, 60, 90 and 120 minutes after the injection to evaluate
the responses of LH and FSH. Plasma LH levels were
suppressed throughout the test and FSH increased significantly for her age (LH basal: < 0.5, peak: < 0.5 mIU/
ml, FSH basal: 0.9, peak: 9.9 mIU/ml). The levels of
Fig. 1. The growth data of the patients plotted on normal Japanese standard curves.
Closed circles indicate the height of the patient, and open circles linked by lines with closed circles
indicate the bone age of the patient at that height.
A: patient 1, B: patient 2, C: patient 3.
126
H. Imamine et al.
TABLE 2. Clinical data of Patient 1 (plasma ACTH, estradiol), dosage of hydrocortisone replacement
therapy, and height velocity
Age
10m
1y1m
2y11m
4y1m
4y9m
5y0m
5y7m
6y2m
6y3m
6y7m
7y3m
7y6m
7y9m
8y5m
Plasma ACTH
(pg/ml)
Plasma estradiol
(pg/ml)
Dosage of HC
(mg/m2/day)
Height velocity
(cm/year)
2,684
1,360
1,940
769
124
117
9
227
48
196
217
671
7
42
ND
ND
ND
ND
21.3
19.9
<5
20.5
<5
23.4
39.4
34.6
<5
<5
20
↓
15
↓
20
10.3
↓
4.0
22
↓
25
↓
5.5
5.3
10.3
HC, hydrocortisone; ND, not done.
plasma insulin-like growth factor 1 (170.5 ng/ml), TSH
(3.08 μ U/ml), free T3 (3.6 pg/ml), free T4 (1.2 ng/100
ml), and testosterone (< 5 ng/100 ml), and the response
of plasma GH to the insulin tolerance test (basal: 4.8,
peak 16.0 ng/ml) were all within normal ranges.
Magnetic resonance imaging of her brain, and ultrasonography of her ovaries were also normal. The dosage
of hydrocortisone replacement therapy was gradually increased to 25 mg/m2/day. Consequently, plasma ACTH
was reduced (7 - 42 pg/ml) and plasma estradiol was
normalized (< 5 pg/ml) with a slowing of the acceleration of bone age (Fig. 1A).
Patient 2. A male patient with a birth weight of
3,190 g was born to non-consanguineous Japanese parents after a vaginal delivery with the use of forceps at 42
weeks of gestation. Generalized hyperpigmentation was
present since birth. The development of his external
genitalia was normal for his age. At 15 days of age, endocrinological analysis showed extremely low serum
cortisol (1.8 μ g/100 ml), elevated plasma ACTH (2,100
pg/ml), and low plasma 17α -hydroxyprogesterone level
(< 0.1 ng/ml). Serum electrolytes were within normal
ranges (sodium 137 mEq/liter, potassium 4.8 mEq/liter,
chloride 102 mEq/liter). The rapid ACTH test did not affect serum cortisol (Table 1). He was diagnosed as having adrenal insufficiency, and hydrocortisone replace-
ment therapy (20 mg/m2/day) was introduced when he
was 1 month old. When he was 8 years and 10 months
old, a furosemide provocation test showed a good response of plasma aldosterone (Table 1). Plasma
DHEA-S (< 50 ng/ml) and plasma testosterone (< 5
ng/100 ml) were within normal ranges. Thus, a diagnosis of FGD was confirmed. Plasma estradiol was not elevated (< 5.0 pg/ml) until the age of 9 years 0 month. His
growth and development continued to be normal
(father’s height: 170 cm, mother’s height: 155 cm) (Fig.
1B) and plasma ACTH level was almost normal (data not
shown) throughout the period of hydrocortisone replacement therapy.
Patient 3. The younger sister of Patient 2 was born
by an uneventful vaginal delivery at 40 weeks of gestation, with a birth weight of 3,090 g. Generalized hyperpigmentation was also present since birth. Her external
genitalia were normal for her age. At 1 month of age,
endocrinological analysis showed extremely low serum
cortisol (1.4 μ g/100 ml), elevated plasma ACTH (3,200
pg/ml) and low plasma 17α -hydroxyprogesterone (< 0.1
ng/ml). Serum electrolytes were within normal ranges
(sodium 137 mEq/liter, potassium 4.8 mEq/liter, chloride
103 mEq/liter). The rapid ACTH test did not affect serum cortisol (Table 1). She was diagnosed as having adrenal insufficiency and hydrocortisone replacement ther-
Elevated Plasma ACTH and Tall Stature in FGD
apy (20 mg/m2/day) was introduced when she was 1
month old. When she was 4 years and 6 months old, the
furosemide provocation test showed a good response of
plasma aldosterone (Table 1). Plasma DHEA-S (< 50
ng/ml) and plasma testosterone (< 5 ng/100 ml) were
within normal ranges. On the basis of these findings, a
diagnosis of FGD was also confirmed. Her growth and
development continued to be normal (Fig. 1C) and plasma ACTH level was almost normal (data not shown)
throughout the period of hydrocortisone replacement
therapy. Plasma estradiol was not elevated (< 5.0 pg/ml)
until the age of 9 years 11 months.
DNA preparation and analysis
Investigations of the ACTH receptor gene were performed with the approval of the institutional review
board of the Nagoya City University Graduate School of
Medical Sciences Institute for Molecular Research, and
informed consent for the investigation was obtained from
all patients’ parents.
Genomic DNA was extracted from 200 μ l of venous
blood using a commercial kit (QIAamp DNA blood mini
kit; Qiagen, Tokyo). All polymerase chain reaction (PCR)
analyses were carried out on 2-μ l samples of each DNA
preparation in a 20 μ l reaction volume containing 0.5 U
gold Taq polymerase (Takara, Otsu), 125 μ M of each deoxyribonucleoside triphosphate, 0.5 μ M of each primer
pair, 50 mM KCl, 1.5 mM MgCl2, and 10 mM Tris HCl
(pH 8.3). The entire coding and promoter sequence of
the ACTH receptor gene was amplified by PCR, using
the primers shown in Table 3; sense oligonucleotide 1
TABLE 3. Oligonucleotide primers
No
1
2
3
4
5
6
Sequences (5’ → 3’)
ATTCCACACTTCAACATTCC
CTGGGCAAAATGAATGAGAA
TGGCTGGTTTTTATTTTCTA
CAGATGACCGTAAGCACCAC
ACTCCCTGTTTGTCCTCTCC
TACATTATTCTGGCACTTGG
Position of
first base
−718
25
−188
464
320
956
The oligonucleotides are numbered from
5’ to 3’, and were either sense or antisense.
Nucleotide numbers of primers 1 and 2
were calculated from the major transcription
start site.
Nucleotide numbers of primers 3, 4, 5
and 6 were calculated from the ATG codon.
127
and antisense oligonucleotide 2 for the promoter region,
sense oligonucleotide 3 and antisense oligonucleotide 4
for the 5’-fragment of the coding region, and oligonucleotide 5 and antisense oligonucleotide 6 for the 3’-fragment of the coding region. PCR for the promoter region
was started by an extended denaturation of 5 minutes at
95°C followed by 40 cycles of 30 seconds at 95°C, 30
seconds at 55°C, and 2 minutes at 72°C followed by an
extension at 72°C for 7 minutes, and the PCR for the
coding region was started by an extended denaturation of
5 minutes at 95°C followed by 30 cycles of 30 seconds at
95°C, 30 seconds at 58°C, and 40 seconds at 72°C followed by an extension at 72°C for 7 minutes in a commercial cycling system (GeneAmp PCR System 9700;
Applied Biosystems, Chiba). The amplified DNA products were separated by electrophoresis through a 2%
agarose gel, stained with ethidium bromide, and visualized using an ultraviolet trans-illuminator. The amplified
products were extracted from the agarose gel and purified
using a commercial kit (QIAquick gel extraction kit;
Qiagen) and were directly sequenced in both directions
by a fluorescent dye terminator cycle system, using the
specific primers described above and a commercial DNA
sequencing kit (Biosystems) and auto-analyzer (ABI
PRISM 310 Genetic Analyzer; Applied Biosystems), according to the manufacturer’s instructions.
Dibutyryl cyclic AMP stimulation test
For the patient without ACTH receptor mutations,
the dibutyryl cyclic AMP stimulation test was performed
to detect a post receptor abnormality in adrenocortical
cells after cyclic AMP production. After overnight fasting, dibutyryl cyclic AMP (12 mg/kg) dissolved in 200
ml of physiological saline was infused i.v., at a rate of 0.2
mg/kg/min for 60 minutes to the patient in the supine position. Venous blood samples were taken at 0, 30, 60, 90
and 120 minutes after the infusion to estimate serum cortisol and plasma glucose (Fukuda et al. 1986; Yamaoka
et al. 1992). Blood pressure and heart rate were monitored during the test.
Dexamethasone suppression test
In patient 1, the dexamethasone suppression test
was performed to explore the relationship between plasma estradiol and plasma ACTH using a modification of
the method described previously (Liddle 1960; Nugent et
al. 1965). Dexamethasone at a dose of 0.25 mg was given orally every 6 hours was administered for a total of 8
doses. Venous blood samples were taken before dexa-
128
H. Imamine et al.
methasone administration on the morning of the first day
of the test and on the second, third and fourth mornings
during the test. Serum cortisol, plasma estradiol and
ACTH were assayed.
Molecular analysis
RESULTS
tophan (R137W) (Fig. 2A, B). The mutation is in
the second intracellular loop of the receptor and
may impair G protein coupling (Flück et al.
2002).
Dibutyryl cyclic AMP stimulation test
In patient 1 who had tall stature and advanced bone age, no mutations in the coding region of the ACTH receptor gene were detected.
In addition, no mutations in the promoter region
of ACTH receptor gene were found. In both patients 2 and 3, who were of normal height, we detected a homozygous mutation in the coding region of the ACTH receptor gene, a cytosine to
thymidine transition at the first position of codon
137, resulting in substitution of arginine for tryp-
Patient 1, who had no mutations in the
ACTH receptor gene, showed little change in serum cortisol from 4.3 to 2.6 μ g/100 ml from the
dibutyryl cyclic AMP stimulation test. However,
her plasma glucose concentration increased from
102 to 198 mg/100 ml, similarly to the response
of a normal subject (Fukuda et al. 1986; Yamaoka
et al. 1992). During the infusion, diastolic blood
pressure decreased from 64 to 44 mmHg and
heart rate did not increase (Table 4).
Fig. 2. Partial DNA sequence of the ACTH receptor gene in patients 2 and 3.
Genetic analysis indicated a homozygous mutation in the coding region of the ACTH receptor gene,
consisting of a cytosine to thymidine transition at the first position of codon 137 (vertical arrow),
resulting in substitution of arginine for tryptophan (R137W).
A: patient 2, B: patient 3
TABLE 4. Effects of dibutyryl cyclic AMP stimulation test in patient 1
Before
Pulse (1/min)
Blood pressure (mmHg)
plasma glucose (mg/100 ml)
Serum cortisol (μ g/100 ml)
76
102/64
102
4.3
Minutes
30
60
90
120
80
104/44
169
2.7
64
108/58
116
3.0
84
92/52
198
2.8
70
100/62
92
2.6
Plasma glucose and cortisol are distinctly increased in normal adults, but the normal range in children is
not clear.
Elevated Plasma ACTH and Tall Stature in FGD
129
TABLE 5. Effects of dexamethasone suppression test in patient 1
Plasma ACTH (pg/ml)
Serum cortisol (μ g/100 ml)
Plasma estradiol (pg/ml)
Day 1
Day 2
Day 3
Day 4
65
3.9
25.4
<3
1.5
9.3
<3
< 1.0
6.9
5
16.4
11.6
Plasma ACTH was decreased to less than 10 pg/ml in normal subjects after the
dexamethasone suppression test.
Dexamethasone suppression test
In patient 1, plasma ACTH decreased from
65 to less than 3 pg/ml and serum cortisol decreased from 3.9 to below 1.0 μ g/100 ml in response to dexamethasone. Similarly, plasma estradiol decreased from 25.4 to 6.9 pg/ml (Table 5).
DISCUSSION
The majority of patients diagnosed as FGD
type 1 are of tall stature, whereas patients diagnosed as FGD type 2 are generally of normal
height (Clark and Weber 1998). However, the
mechanism responsible for excessive growth in
FGD is unknown. We analyzed the ACTH receptor gene in three FGD patients. Patient 1 has no
mutations in the coding and promoter regions of
the ACTH receptor gene. After dibutyryl cyclic
AMP infusion, serum cortisol did not increase,
despite an increase in plasma glucose similar to
that in a normal subject (Yamaoka et al. 1992).
We considered that patient 1 has FGD type 2, and
that the defect could be due to a post receptor abnormality occurring in adrenocortical cells after
cyclic AMP production (Fukuda et al. 1986;
Yamaoka et al. 1992). However, she had tall stature and advanced bone age. On the other hand, in
our patients 2 and 3, genetic analysis showed a
homozygous R137W mutation in the ACTH receptor gene. We considered that patients 2 and 3
have FGD type 1. The R137W mutation was reported in three previous cases (Katsumata et al.
1998; Ishii et al. 2000; Flück et al. 2002), all of
whom were tall. However, our patients were of
normal height. These results are contrary to the
relationship between ACTH receptor mutation
and tall stature previously described (Clark and
Weber 1998). Thus, we surmised that FGD has
another major cause of excessive growth other
than the effects of ACTH receptor mutation.
In the present study, in patient 1 who has no
mutations in the ACTH receptor gene, plasma
ACTH and estradiol were elevated when her
growth velocity was accelerated. Her plasma insulin-like growth factor 1, TSH, free T3, free T4,
and testosterone levels, and the response of plasma GH to the insulin tolerance test, were all within normal ranges. Plasma estradiol decreased in
response to the dexamethasone suppression test.
Moreover, after plasma ACTH was reduced and
plasma estradiol was normalized in response to
increased hydrocortisone replacement therapy, the
rates of her bone ageing and growth velocity were
also reduced. Thus, elevated plasma estradiol was
apparently related to the increase in plasma
ACTH in this patient. This is the first report of
elevated plasma estradiol in FGD with tall stature.
Elevated plasma ACTH may have indirectly affected the increase in height and advanced bone
age due to an increase in plasma estradiol in patient 1. In patients 2 and 3 who are homozygous
for the R137W mutation, hydrocortisone replacement therapy was introduced at the age of 1
month and their plasma ACTH levels remained
almost normal after clinical intervention, and they
were of normal height. On the other hand, three
patients with the R137W mutation described previously had tall stature. In two of three patients
(Katsumata et al. 1998; Flück et al. 2002), hydrocortisone replacement therapy was introduced after the age of 2 years, but they already had tall
stature for their age before clinical intervention.
In the third patient (Ishii et al. 2000), hydrocortisone replacement therapy was introduced at 3
months of age. However, this patient’s compli-
130
H. Imamine et al.
ance with the therapy was poor and plasma ACTH
levels remained high, and later this patient also
became tall. Thus, elevated plasma ACTH level
may have as yet unrecognized actions on growth
as previously suggested (Elias et al. 2000). From
a previous report (Clark and Weber 1998), we
considered that ACTH receptor mutation is related
to excessive growth in FGD type 1. However,
there may be another important cause of excessive growth in FGD. We suggest that the action
of elevated plasma ACTH is possibly a major
cause of excessive growth in both of FGD type 1
and type 2 in the presence or absence of ACTH
receptor mutation.
In summary, we compared the results of molecular analyses of the ACTH receptor gene with
the clinical findings in three patients with FGD.
Patient 1 who had no mutations in the ACTH receptor gene was of tall stature. It appears that elevated plasma estradiol level was related to the
increase in plasma ACTH and played a major role
in excessive growth and advanced bone age in
this patient. On the other hand, patients 2 and 3
who were homozygous for the R137W mutation
were of normal height and their plasma ACTH
levels remained almost normal, in contrast to patients with the R137W mutation described previously. From these results, we speculate that the
major causes of excessive growth in FGD are not
only from ACTH receptor mutation, but also from
the action of elevated plasma ACTH.
References
Berberoglu, M., Aycan, Z., Ocal, G., Begeot, M.,
Naville, D., Akar, N., Adiyaman, P., Evliyaoglu,
O. & Penhoat, A. (2001) Syndrome of congenital adrenocortical unresponsiveness to ACTH.
Report of six patients. J. Pediatr. Endocrinol.
Metab., 14, 1113-1118.
Clark, A.J.L., McLoughrin, L. & Grossmann, A.
(1993) Familial glucocorticoid deficiency associated with point mutation in the adrenocorticotropin receptor. Lancet, 341, 461-462
Clark, A.J.L., Cammas, F.M., Watt, A., Kapas, S. &
Weber, A. (1997) Familial glucocorticoid deficiency: one syndrome, but more than one gene.
J. Mol. Med., 75, 394-399.
Clark, A.J.L. & Weber, A. (1998) Adrenocorticotropin
insensitivity syndromes. Endocr. Rev., 19,
828-843.
Coulter, J.B.S., Diver, M.J., Isherwood, D.M. &
Smith, C.S. (1991) Tall stature in isolated glucocorticoid deficiency: a case report and review
of the literature. J. Pediatr. Endocrinol., 4,
271-276.
Elias, L.L.K., Huebner, A., Metherell, L.A., Canas, A.,
Warne, G.L., Bitti, M.L.M., Cianfarani, S.,
Clayton, P.E., Savage, O.M. & Clark, A.J.L.
(2000) Tall stature in familial glucocorticoid
deficiency. Clin. Endocrinol., 53, 423-430.
Flück, C.E., Martens, J.W.M., Conte, F.A. & Miller,
W.L. (2002) Clinical, genetic, and functional
characterization of adrenocorticotropin receptor
mutations using a novel receptor assay. J. Clin.
Endocrinol. Metab., 87, 4318-4323.
Fukuda, N., Honda, M. & Hatano, M. (1986) Effects
of dibutyryladenosine 3’,5’-monophosphate on
steroid biosynthesis in humans. Endocrinol.
Jpn., 33, 323-332.
Ishii, T., Ogata, T., Sasaki, G., Sato, S., Kinoshita, E.
& Matsuo, N. (2000) Novel mutations of the
ACTH receptor gene in a female adult patient
with adrenal unresponsiveness to ACTH. Clin.
Endocrinol., 53, 389-392.
Katsumata, N., Nagabuchi, N., Ito, J., Nimura, A.,
Horikawa, R. & Tanaka, T. (1998) A novel
compound heterozygous mutation in the adrenocorticotropin receptor gene in a Japanese
case with syndrome of congenital adrenocortical unresponsiveness to adrenocorticotropin.
Hormone to Rinsyo., 46, 955-958. (in Japanese)
Kershnar, A.K., Roe, T.F. & Kought, M.D. (1972) Adrenocorticotropic hormone unresponsiveness:
Report of a girl with excessive growth and review of 16 reported cases. J. Pediatr., 80,
610-619.
Liddle, G.W. (1960) Tests of pituitary-adrenal suppressibility in the diagnosis of Cushing’s syndrome. J. Clin. Endocrinol. Metab., 20,
1539-1560.
Mountjoy, K.G., Robbins, L.S., Mortrud, M.T. &
Cone, R.D. (1992) The cloning of a family of
genes that encode the melanocortin receptors.
Science., 257, 1248-1251.
Naville, D., Barjhoux, L., Jaillard, C., Faury, D.,
Despert, F., Esteva, B., Durand, P., Saez, J.M.
& Begeot, M. (1996) Demonstration by transfection studies that mutations in the adrenocorticitropin receptor gene are one cause of the hereditary syndrome of glucocorticoid deficiency.
J. Clin. Endocrinol. Metab., 81, 1442-1448.
Naville, D., Weber, A., Genin, E., Durand, P., Clark,
A.J.L. & Begeot, M. (1998) Exclusion of the
adrenocorticotropin (ACTH) receptor (MC2R)
Elevated Plasma ACTH and Tall Stature in FGD
locus in some families with ACTH resistance
but no mutations of the MC2R coding sequence
(Familial Glucocorticoid Deficiency Type2). J.
Clin. Endocrinol. Metab., 83, 3592-3596.
Nugent, C.A., Nichols, T. & Tyler, F.H. (1965) Diagnosis of Cushing’s syndrome, single dose dexamethasone suppression test. Arch. Intern.
Med., 116, 172-176.
Slavotinek, A.M., Hurst, J.A., Dunger, D. & Wilkie,
A.O.M. (1998) ACTH receptor mutation in a
girl with familial glucocorticoid deficiency.
Clin. Genet., 53, 57-62.
Tsigos, C., Arai, K., Hung, W. & Chrousos, G.P.
(1993) Hereditary isolated glucocorticoid deficiency is associated with abnormalities of the
adenocorticotropin receptor gene. J. Clin. Invest., 92, 2458-2461.
Tsigos, C., Arai, K., Latronico, A.C., DiGeorge, A.M.,
Rapaport, R. & Chrousos, G.P. (1995) A novel
mutation of the adrenocorticotropin receptor
(ACTH-R) gene in a family with the syndrome
of isolated glucocorticoid deficiency, but no
ACTH-R abnormalities in two families with the
triple A syndrome. J. Clin. Endocrinol. Metab.,
131
80, 2186-2189.
Weber, A. & Clark, A.J.L. (1994) Mutations of ACTH
receptor gene are only one cause of familial
glucocorticoid deficiency. Hum. Mol. Genet.,
3, 585-588.
Weber, A., Toppari, J., Harvey, R.D., Klann, R.C.,
Shaw, N.J., Ricker, A.T., Näntö-Salonen, K.,
Bevan, J.S. & Clark, A.J.L. (1995) Adrenocorticotropin receptor gene mutations in familial
glucocorticoid deficiency: relationships with
clinical features in four families. J. Clin. Endocrinol. Metab., 80, 65-71.
Wu, S.M., Stratakis, C.A., Chan, C.H.Y., Hallermeier,
K.M., Bourdony, C.J., Rennert, O.M. & Chan,
W.Y. (1998) Genetic heterogeneity of adrenocorticotropin (ACTH) resistance syndrome:
Identification of a novel mutation of the ACTH
receptor gene in hereditary glucocorticoid deficiency. Mol. Genet. Metab., 64, 256-265.
Yamaoka, T., Kudo, T., Takuwa, Y., Kawakami, Y.,
Itakura, M. & Yamasita, K. (1992) Hereditary
adrenocortical unresponsiveness to adrenocorticotropin with a postreceptor defect. J. Clin.
Endocrinol. Metab., 75, 270-274.