Mutation and Transformation - Center for Precollegiate Education

Mutation and Transformation - A study of phenotypic change caused
by mutation and genetic engineering
Jonathan Benskin
Boca Raton Community High School
This unit was developed as part of Biomedical Explorations: Bench to Bedside, which was supported by the National
Center for Research Resources of the National Institutes of Health through Grant Number R25RR023294. This
project was also supported by a grant from the National Science Foundation to Dr. Nicole Horenstein, Department
of Chemistry, University of Florida.
Additional information regarding the Bench to Bedside project is available at http://www.cpet.ufl.edu/bench.
Please direct inquiries to the Center for Precollegiate Education and Training at [email protected].
©2012 University of Florida
Center for Precollegiate Education and Training
PO Box 112010 • Yon Hall, Room 331
Gainesville, FL 32611
Phone 352.392-2310 • Fax 352.392-2344
1
Contents
CURRICULUM UNIT
Author’s Note………………………............................................................................................................................... 3
Introduction……………………………………………………………………………………………………………………………………………………….4
Tips About this Curriculum…. ............................................................................................................................... 5-6
Lessons Summary ..................................................................................................................................................7
Lesson Sequencing Guide…………………………………………………………………………………………………………………………………..8
Vocabulary ............................................................................................................................................................ 9
Next Generation Sunshine State Standards………………………………………..................................................................10-11
AP Biology Learning Outcomes…………………………………………………………………………………………………………………………12-14
AICE Learning Outcomes……………………………………………………………………………………………………………………………….….14-15
Background Information…………………………………………………………………………………………………………………………………….16
Appendix 1: Ordering Instructions for Primers….………………………………………………………………………………………………..93
References………………………………………………………………………………………………………………………………………………………….94
LESSON ONE: The Transformation of Knowledge…………………………………………………………………………......................17-51
Student Pages: Introduction to SnapGene…………………………………………………………………………………………………………34-35
Student Pages: PCR, Gel Electrophoresis, and Translation....................................................................................36-37
Student Pages: Lab Methodologies and Questions……………………………..…………………………………………………………….32-44
Teacher Pages: Background Information – Answer Key……………………………………………...........................................45-47
Teacher Pages: Lab Methodologies and Questions – Answer Key………………………………………………………………………47-51
LESSON TWO: The Mutation of Understanding………………….................................................................................52-73
Student Pages: Primer Creation………………………………………….................................................................................60-63
Student Pages: Lab Methodologies and Questions…….........................................................................................63-68
Teacher Pages: Primer Creation – Answer Key......................................................................................................69-70
Teacher Pages: Lab Methodologies and Questions – Answer Key……………………………………………………………….…….70-73
LESSON THREE: The Engineering of Science…………………………………………..............................................................74-93
Student Pages: EBFP Primer Creation………………………….........................................................................................83-85
Student Pages: Lab Methodologies and Questions………………………………...............................................................85-88
Teacher Pages: EBFP Primer Creation – Answer Key..............................................................................................89-90
Teacher Pages: Lab Methodologies and Questions – Answer Key………………………………………….…………………….…….91-92
2
Author’s Note
In my years of teaching I have conducted many laboratory activities in my classroom and have attended
countless workshops to hone my skills. Through these, I have slowly come to the realization that there is no
substitute for time at “the bench” of an actual research laboratory in order to learn advanced concepts. Over the
last few years I have written advanced biology curriculum by spending time in laboratories at the University of
Florida. When I arrived this year I wondered to myself “what new curriculum could I even still come up with?” I had
already created diverse curricula and silently I was not sure if I had any creativity left. The biologist inside of me
was even more nervous when I was taken to the chemistry laboratory building. Cautiously, I entered my assigned
laboratory with an open, but nervous, mind.
After discussions with the laboratories principal investigator, an original “spark” of an idea turned into the
curriculum that is presented here. Original curriculum ideas involved fantastic methodologies, but proved too
complex to be easily incorporated into high schools. Through countless hours of time at “the bench” I believe that I
have honed a blunt idea into a product that is powerful and usable in many classrooms. The initial spark blossomed
into many more questions and investigations that led to a better understanding of the world around me and a
deeper love for the sciences. Our students deserve more (and better quality) “bench-time” in the hopes of also
creating this same spark that might grow into tomorrow’s discoveries.
As teachers, isn’t this our job?
3
Introduction
There is now little question that genetic engineering and gene modification will continue to be in the
forefront of biological research and news for years to come. It is of critical importance that today’s high-level
biology student is exposed to current research methods in a hands-on fashion. This curriculum was designed to
allow students to become experienced with unbelievably powerful tools used in many research facilities.
Many of the tools once found only in research facilities (such as polymerase chain reaction and gel
electrophoresis) have trickled their way into numerous high school classrooms. Too often these tools are brought
out once a year, possibly used for a simple activity, and then put back on their shelf until next year. Tools often used
on a daily basis in many laboratories should not be used once a year by students. This curriculum is one (of
countless) others that challenges both students and teachers to use cutting-edge methods to explore overarching
concepts that directly relate to current state/national science standards.
As an actual high school biology teacher I am well aware of the time constraints (both in instructional time
and setup time for activities) that we are faced with. Because of this, I sought to create a curriculum rich in diverse
topics but completed by making incremental changes to the same methodology. The outcome is a curriculum that
teaches students how to use modern laboratory tools to study natural selection, evolution, genetic engineering,
and molecular biology using similar methodologies that turn into varied and powerful results.
When reading this curriculum, please be warned that “Lesson 1” will be somewhat intimidating and
challenging to setup; however, fairly easy to actually complete. That being stated, once “Lesson 1” set up, the rest
of the lessons (“Lesson 2” and “Lesson 3”) are basically already setup. Within the framework of similar
methodologies, I assure you amazing variation can be found.
4
Tips about this Curriculum
Lesson Plan Format: All lessons in this curriculum unit are formatted in the same manner. In each lesson you will
find the following components:
KEY QUESTION(S): Identifies key questions the lesson will explore.
OVERALL TIME ESTIMATE: Indicates total amount of time needed for the lesson, including advanced preparation.
LEARNING STYLES: Visual, auditory, and/or kinesthetic.
VOCABULARY: Lists key vocabulary terms used and defined in the lesson. Also collected in master vocabulary list.
LESSON SUMMARY: Provides a 1-2 sentence summary of what the lesson will cover and how this content will be
covered. Also collected in one list.
STUDENT LEARNING OBJECTIVES: Focuses on what students will know, feel, or be able to do at the conclusion of
the lesson.
STANDARDS: Specific state benchmarks addressed in the lesson. Also collected in one list.
MATERIALS: Items needed to complete the lesson. Number required for different types of grouping formats (Per
class, Per group of 3-4 students, Per pair, Per student) is also indicated.
BACKGROUND INFORMATION: Provides accurate, up-to-date information from reliable sources about the lesson
topic.
ADVANCE PREPARATION: This section explains what needs to be done to get ready for the lesson.
PROCEDURE WITH TIME ESTIMATES: The procedure details the steps of implementation with suggested time
estimates. The times will likely vary depending on the class.
ASSESSMENT SUGGESTIONS: Formative assessment suggestions have been given. Additionally, there is a brief
summative assessment (pre/post-test) that can be given. Teachers should feel free to create additional formative
and summative assessment pieces.
EXTENSIONS: (ACTIVITIES/LITERATURE) There are many activities and reading sources available to augment and
enhance the curriculum. They have been included. If you find additional ones that should be added, please let us
know.
RESOURCES/REFERENCES: This curriculum is based heavily on primary sources. As resources and references have
been used in a lesson, their complete citation is included as well as a web link if available. All references and
resources are also collected in one list.
STUDENT PAGES: Worksheets and handouts to be copied and distributed to the students.
TEACHER PAGES: Versions of the student pages with answers or the activity materials for preparation.
Collaborative Learning: The lessons in this curriculum have been developed to include many collaborative learning
opportunities. Rather than presenting information in lecture format and teacher driven, the activities involve the
students in a more engaged manner. For classrooms not accustomed to using collaborative learning strategies,
have patience. It can be difficult to communicate instructions, particularly for students who are visual learners.
For these students, use of visual clues such as flowcharts and graphics can help them understand how they are to
move to different groups.
Groups: Most of the lessons are carried out in groups. While it isn’t necessary for students to remain in the same
groups the entire unit, if they work well together, it may foster students to think deeper as they are comfortable
with their teammates and willing to ask questions of each other.
Inquiry-based: The lessons in the curriculum invite students to be engaged and ask questions. They work through
background information in a guided fashion, but are challenged to think beyond what they have read or done. The
teacher serves as the facilitator in these activities, not the deliverer of information.
5
Technology: Lessons have been written to be mindful of varying availability of technology in schools and homes.
Some of the lessons would be very well suited to online environments and if your students are able, you might wish
to engage in some of the technology modifications.
Content: Often we teach in a manner that is very content heavy. With high-stakes testing the norm, students are
pushed to memorize and regurgitate numerous isolated facts. There is so much content that must be covered in a
biology class, for example, that often it is difficult to synthesize those discrete facts into a compelling context or a
story. This unit provides that opportunity: to take concepts learned such as muscles have a lot of glycogen or DNA
codes for RNA, and put them in the context of disease. The lessons aren’t designed to teach students what
lysosomes do or transcription is, but rather why these ideas are important and how they can be used by
researchers.
Implementation notes: This curriculum should be modified and adapted to suit the needs of the teacher and
students. To help make implementation easier in this first draft, notes have been included in lessons as needed.
Extensions: Possible/recommended extension activities that can be completed in addition to the written
curriculum.
Science Subject: Biology – AP, AICE, IB
Grade and ability: 10-12 grade Advanced Placement/AICE/IB Biology.
Science concepts: The overarching concepts within a unit.
6
Lesson Summaries
LESSON ONE: “The transformation of knowledge”
This lesson will focus on the background of how to successfully complete a polymerase chain reaction and
transform bacteria. There are many steps leading up to the actual cloning/transformation procedures, and this
lesson will use hands-on methods to introduce the topics of transformation and primer creation.
LESSON TWO: “The mutation of understanding”
In this lesson, students will use site-directed mutagenesis to study how a single, double, and triple base pair
substitution (mutation) can change the phenotype of an organism. This concept will then be tied to natural
selection and the possible change of a population over time.
LESSON THREE: “The engineering of science”
This lesson will focus on the specific genetic engineering of the pGLO gene. Students will research published data to
determine the best route to change the production of the green fluorescent protein (GFP) into the production of a
version of the enhanced blue fluorescent protein (EBFP).
7
Lesson Sequencing Guide
All lessons are based on a 55 minute class session:
DAY 1
WEEK 1
8
Lesson 1
DAY 2
DAY 3
DAY 4
DAY 5
Lesson 1
Lesson 1
Lesson 1
Lesson 1
WEEK 2
Lesson 2
Lesson 2
Lesson 2
WEEK 3
Lesson 3
Lesson 3
Lesson 3
Vocabulary
Aequorea victoria- The species of jellyfish that produced the first green fluorescent protein isolate.
Agarose- A common constituent of the gels used in gel electrophoresis.
Ampicillin- Common antibiotic that is used to screen against non-transformed bacteria that do not contain the plasmid
which offers resistance to the antibiotic.
Anneal- The process in which a primer attaches to the template DNA.
β-lactamase- An enzyme that some bacteria produce that destroys the antibiotic ampicillin.
Codon- A set of three nucleotides which code for one amino acid.
Cofactors- Molecules that “assist” enzymes (such as speeding up or allow enzymatic reactions to progress).
DNA ladder- A solution made up of DNA fragments of known lengths and concentrations.
DNA polymerase- The enzyme that adds nucleotides to the growing strand in polymerase chain reaction.
Enhanced blue fluorescent protein- spectral variant of the green fluorescent protein.
Error-prone PCR- An adjusted PCR methodology to ensure that errors are made by DNA polymerase during the
amplification process.
Fluorescent proteins- A group of proteins that have special properties that allow them to emit fluorescence when excited by
the correct wavelength of electromagnetic energy.
Fluorophore- Fluorescent chemical compound
Gel electrophoresis- The method used to separate DNA molecules based on size.
Green fluorescent protein (GFP)- A type of fluorescent protein that emits a specific wavelength of fluorescence (green
portion of the visible light spectrum)
L-arabinose- Sugar that induces the arabinose operon.
Ligate- To attach two segments of DNA together that have common sticky ends (portions of DNA that are complementary to
each other).
MasterMix- A solution used in polymerase chain reaction that contains many of the chemicals/enzymes needed to create
copies of a targeted segment of DNA.
Osamu Shimomura- The scientist who first successfully isolated and characterized the green fluorescent protein.
pGLO- Bacterial plasmid that contains the GFP
Point Mutation – A small mutation at a specific location on the DNA.
Polymerase chain reaction- Technology that uses cycles of heating and cooling to copy target DNA.
Primers- Single-stranded oligonucleotides (DNA) that are used in PCR to allow DNA polymerase to attach to the template
strand of DNA.
Q5® Site-Directed Mutagenesis Kit- This kit is used in all lessons of this curriculum. It contains the many of the reagents
necessary to mutate a specific portion of DNA on a template plasmid and then transform that mutated plasmid into
bacteria.
Random Mutation- Mutations in the DNA that are not caused by a specific influencing factor giving a specific
genetic result
Restriction enzymes- Enzymes that cut at specific, and predictable, locations in the DNA.
Transformation- The process in which bacterial cells uptake DNA from their environment.
9
Next Generation Sunshine State Standards – Science
Benchmark
Lesson
1
SC.912.L.15.1 Explain how the scientific theory of evolution is
supported by the fossil record, comparative anatomy, comparative
embryology, biogeography, molecular biology, and observed
evolutionary change.
SC.912.L.15.15 Describe how mutation and genetic recombination
increase genetic variation.
SC.912.L.16.3 Describe the basic process of DNA replication and how it
relates to the transmission and conservation of the genetic
information.
10
3
X
X
X
X
X
X
SC.912.L.16.4 Explain how mutations in the DNA sequence may or may
not result in phenotypic change.
SC.912.L.16.5 Explain the basic processes of transcription and
translation, and how they result in the expression of genes.
SC.912.L.16.6 Discuss the mechanisms for regulation of gene
expression in prokaryotes and eukaryotes at transcription and
translation level.
SC.912.L.16.7 Describe how viruses and bacteria transfer genetic
material between cells and the role of this process in biotechnology.
SC.912.L.16.10 Evaluate the impact of biotechnology on the individual,
society and the environment, including medical and ethical issues.
SC.912.L.16.11 Discuss the technologies associated with forensic
medicine and DNA identification
SC.912.L.16.12 Describe how basic DNA technology (restriction
digestion by endonucleases, gel electrophoresis, polymerase chain
reaction, ligation, and transformation) is used to construct
recombinant DNA molecules (DNA cloning).
SC.912.N.1.1 Define a problem based on a specific body of knowledge,
for example: biology, chemistry, physics, and earth/space science, and
do the following:
1. pose questions about the natural world,
2. conduct systematic observations,
3. examine books and other sources of information to see what is
already known,
4. review what is known in light of empirical evidence,
5. plan investigations,
6. use tools to gather, analyze, and interpret data (this includes the use
of measurement in metric and other systems, and also the generation
and interpretation of graphical representations of data, including data
2
X
X
X
X
X
X
X
X
X
X
X
Benchmark
tables and graphs),
7. pose answers, explanations, or descriptions of events,
8. generate explanations that explicate or describe natural phenomena
(inferences),
9. use appropriate evidence and reasoning to justify these
explanations to others,
10. communicate results of scientific investigations, and
11. evaluate the merits of the explanations produced by others
SC.912.N.1.3 Recognize that the strength or usefulness of a scientific
claim is evaluated through scientific argumentation, which depends on
critical and logical thinking, and the active consideration of alternative
scientific explanations to explain the data presented.
SC.912.N.1.4 Identify sources of information and assess their reliability
according to the strict standards of scientific investigation.
SC.912.N.1.6 Describe how scientific inferences are drawn from
scientific observations and provide examples from the content being
studied.
SC.912.N.1.7 Recognize the role of creativity in constructing scientific
questions, methods and explanations.
11
Lesson
1
2
3
X
X
X
X
X
X
X
X
Advanced Placement Biology Learning Outcomes & Science Practices
Outcomes & Practices
Lesson
1
LO 1.1 The student is able to convert a data set from a table of
numbers that reflect a change in the genetic makeup of a population
over time and to apply mathematical methods and conceptual
understandings to investigate the cause(s) and effect(s) of this change.
LO 1.2 The student is able to evaluate evidence provided by data to
qualitatively and quantitatively investigate the role of natural selection
in evolution.
LO 1.3 The student is able to apply mathematical methods to data
from a real or simulated population to predict what will happen to the
population in the future.
LO 1.4 The student is able to evaluate data-based evidence that
describes evolutionary changes in the genetic makeup of a population
over time.
LO 1.11 The student is able to design a plan to answer scientific
questions regarding how organisms have changed over time using
information from morphology, biochemistry and geology.
LO 2.1 The student is able to explain how biological systems use free
energy based on empirical data that all organisms require constant
energy input to maintain organization, to grow and to reproduce.
LO 2.2 The student is able to justify a scientific claim that free energy
is required for living systems to maintain organization, to grow or to
reproduce, but that multiple strategies exist in different living systems.
LO 2.15 The student can justify a claim made about the effect(s) on a
biological system at the molecular, physiological or organismal level
when given a scenario in which one or more components within a
negative regulatory system is altered.
LO 2.16 The student is able to connect how organisms use negative
feedback to maintain their internal environments.
LO 2.17 The student is able to evaluate data that show the effect(s) of
changes in concentrations of key molecules on negative feedback
mechanisms.
LO 2.18 The student can make predictions about how organisms use
negative feedback mechanisms to maintain their internal
environments.
LO 2.28 The student is able to use representations or models to
analyze quantitatively and qualitatively the effects of disruptions to
dynamic homeostasis in biological systems.
LO 3.1 The student is able to construct scientific explanations that use
the structures and mechanisms of DNA and RNA to support the claim
that DNA and, in some cases, that RNA are the primary sources of
heritable information.
LO 3.2 The student is able to justify the selection of data from
historical investigations that support the claim that DNA is the source
of heritable information.
12
2
3
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
Outcomes & Practices
Lesson
1
LO 3.3 The student is able to describe representations and models that
illustrate how genetic information is copied for transmission between
generations.
LO 3.4 The student is able to describe representations and models
illustrating how genetic information is translated into polypeptides.
LO 3.5 The student can justify the claim that humans can manipulate
heritable information by identifying at least two commonly used
technologies.
LO 3.6 The student can predict how a change in a specific DNA or RNA
sequence can result in changes in gene expression.
LO 3.19 The student is able to describe the connection between the
regulation of gene expression and observed differences between
individuals in a population.
LO 3.20 The student is able to explain how the regulation of gene
expression is essential for the processes and structures that support
efficient cell function.
LO 3.24 The student is able to predict how a change in genotype,
when expressed as a phenotype, provides a variation that can be
subject to natural selection.
LO 3.25 The student can create a visual representation to
illustrate how changes in a DNA nucleotide sequence can result in
a change in the polypeptide produced.
LO 3.26 The student is able to explain the connection between genetic
variations in organisms and phenotypic variations in populations.
LO 3.36 The student is able to describe a model that expresses the key
elements of signal transduction pathways by which a signal is
converted to a cellular response.
LO 3.37 The student is able to justify claims based on scientific
evidence that changes in signal transduction pathways can alter
cellular response. [See SP 6.1]
LO 4.3 The student is able to use models to predict and justify that
changes in the subcomponents of a biological polymer affect the
functionality of the molecule.
LO 4.17 The student is able to analyze data to identify how molecular
interactions affect structure and function.
LO 4.23 The student is able to construct explanations of the influence
of environmental factors on the phenotype of an organism.
LO 4.24 The student is able to predict the effects of a change in an
environmental factor on the genotypic expression of the phenotype.
LO 4.26 The student is able to use theories and models to make
scientific claims and/or predictions about the effects of variation
within populations on survival and fitness.
SP 1.2 The student can describe representations and models of natural
or man-made phenomena and systems in the domain.
SP 1.3 The student can refine representations and models of natural or
manmade phenomena and systems in the domain.
SP 1.4 The student can use representations and models to analyze
situations or solve problems qualitatively and quantitatively.
13
2
3
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
Outcomes & Practices
Lesson
1
2
3
SP 2.1 The student can justify the selection of a mathematical routine
to solve problems.
SP 2.2 The student can apply mathematical routines to quantities that
describe natural phenomena.
SP 2.3 The student can estimate numerically quantities that describe
natural phenomena.
SP 3.1 The student can pose scientific questions.
X
X
X
SP 3.2 The student can refine scientific questions.
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
SP 4.3 The student can collect data to answer a particular scientific
question.
SP 5.1 The student can analyze data to identify patterns or
relationships.
SP 6.1 The student can justify claims with evidence.
SP 6.2 The student can construct explanations of phenomena based
on evidence produced through scientific practices.
SP 6.4 The student can make claims and predictions about natural
phenomena based on scientific theories and models.
SP 6.5 The student can evaluate alternative scientific explanations.
X
X
X
X
SP 7.2 The student can connect concepts in and across domain(s) to
generalize or extrapolate in and/or across enduring understandings
and/or big ideas.
X
Advanced International Certificate of Education (AICE) Biology Learning
Outcomes
Outcome
F. (c) state that a polypeptide is coded for by a gene and that a gene is
a sequence of nucleotides that forms part of a DNA molecule and
state that a mutation is a change in the sequence that may result in an
altered polypeptide;
F. (e) describe how the information on DNA is used during
transcription and translation to construct polypeptides, including the
role of messenger RNA (mRNA), transfer RNA (tRNA) and the
14
Lesson
1
2
3
X
X
X
X
Outcome
Lesson
1
2
3
X
X
X
X
X
X
X
X
X
ribosomes (for genetic dictionaries see section 5);
F. (f) use the knowledge gained in this section in new situations or to
solve related problems.
O. (g) explain, with examples, how mutation may affect the
phenotype;
O. (h) explain, with examples, how the environment may affect the
phenotype;
O. (i) explain how a change in the nucleotide sequence in DNA may
affect the amino acid sequence in a protein and hence the phenotype
of the organism;
O. (j) use the knowledge gained in this section in new situations or to
solve related problems.
X
X
P. (a) explain how natural selection may bring about evolution;
X
R. (d) explain why and how genes for enzymes that produce
fluorescent or easily stained substances are now used instead of
antibiotic resistance genes as markers in gene technology;
X
R. (g) [PA] outline the principles of electrophoresis as used in genetic
fingerprinting
X
R. (k) use the knowledge gained in this section in new situations or to
solve related problems.
X
15
X
X
Background Information
General background information is given here. More information can be found within the individual lessons.
The discovery, isolation, and creation of fluorescent proteins could be argued as one of the most
important steps in biotechnology of the last 40 years. These proteins in and of themselves do not show promise as
cancer or HIV-fighting drugs, but instead have allowed us to see a world that was once invisible to the naked eye.
Scientists can now observe the dynamic processes occurring inside of a living organism in order to better
understand interactions and activities. It is now common practice in laboratories and classrooms to transform
bacteria with the genes needed to produce green fluorescent proteins (GFPs). There is now an abundance of
fluorescent proteins/genes available on the market today, and many of these new proteins were created from
derivatives of the original gfp gene. This curriculum will introduce the concepts of how GFPs can be used in
laboratory settings and what is being done with them currently.
Even the simplest mutation can cause the phenotype of an organism to change, which can have drastic
implications on natural selection and population evolution. Part of this curriculum includes students creating a
sequence of genetic code (primers) that will allow possible base pair substitutions via site-specific mutagenesis.
This simple substitution mutation can change the normal GFP into a new product that will fluoresce differently
than the wild type GFP. It can be very difficult to study population change via mutations using mammals or other
larger organisms in classroom settings, but with the use of bacteria, these mutations can be completed and
observed within several days.
Although the aforementioned experiment is a form of genetic engineering, part of that activity is left up to
chance based on variation built into the primer design. Because of this, students will also be engineering a specific
change into the gfp gene via site-specific mutagenesis that will create a new product. It is not assumed that
students will know where specific changes to the gene need to be made. Because of this, students will use
published scientific data in order to create a primer that will cause the mutation of the gfp into a gene that will
produce a form of the enhanced blue fluorescent protein (EBFP). This form of genetic engineering and
manipulation is commonly conducted in laboratory settings. Upon completion of this activity, students will have a
much better understanding of how the genetic engineering of organisms is completed and how scientists use it.
16
LESSON ONE: “The transformation of knowledge”
KEY QUESTION(S): What is the green fluorescent protein (GFP)? How can gene cloning be completed in a laboratory? What
is the process to create successful DNA primers used in PCR? How does polymerase chain reaction (PCR) work? How, and for
what purpose, is bacterial transformation completed?
KEY SCIENCE CONCEPTS: Biotechnology, PCR, GFP, gel electrophoresis, gene cloning, transformation, DNA, software to
inspect aspects of genetic code.
OVERALL TIME ESTIMATE: 3-5 days
LEARNING STYLES: Auditory, kinesthetic, visual.
VOCABULARY:
Aequorea victoria- The species of jellyfish that produced the first green fluorescent protein isolate.
Agarose- A common constituent of the gels used in gel electrophoresis.
Ampicillin- Common antibiotic that is used to screen against non-transformed bacteria that do not contain the plasmid
which offers resistance to the antibiotic.
Anneal- The process in which a primer attaches to the template DNA.
β-lactamase- An enzyme that some bacteria produce that destroys the antibiotic ampicillin.
Cofactors- Molecules that “assist” enzymes (such as speeding up or allow enzymatic reactions to progress).
DNA ladder- A solution made up of DNA fragments of known lengths and concentrations.
DNA polymerase- The enzyme that adds nucleotides to the growing strand in polymerase chain reaction.
Fluorescent proteins- A group of proteins that have special properties that allow them to emit fluorescence when excited by
the correct wavelength of electromagnetic energy.
Fluorophore- Fluorescent chemical compound
Gel electrophoresis- The method used to separate DNA molecules based on size.
Green fluorescent protein (GFP) - A type of fluorescent protein that emits a specific wavelength of fluorescence (green
portion of the visible light spectrum)
L-arabinose- Sugar that induces the arabinose operon.
Ligate- To attach two segments of DNA together that have common sticky ends (portions of DNA that are complementary to
each other).
MasterMix- A solution used in polymerase chain reaction that contains many of the chemicals/enzymes needed to create
copies of a targeted segment of DNA.
Osamu Shimomura- The scientist who first successfully isolated and characterized the green fluorescent protein.
pGLO- Bacterial plasmid that contains the GFP
Polymerase chain reaction- Technology that uses cycles of heating and cooling to copy target DNA.
Primers- Single-stranded oligonucleotides (DNA) that are used in PCR to allow DNA polymerase to attach to the template
strand of DNA.
Q5® Site-Directed Mutagenesis Kit- This kit is used in all lessons of this curriculum. It contains the many of the reagents
necessary to mutate a specific portion of DNA on a template plasmid and then transform that mutated plasmid into
bacteria.
Restriction enzymes- Enzymes that cut at specific, and predictable, locations in the DNA.
Transformation- The process in which bacterial cells uptake DNA from their environment.
17
LESSON SUMMARY:
This lesson will focus on the background of how to successfully complete a polymerase chain reaction and
transform bacteria. There are many steps leading up to the actual cloning/transformation procedures, and this
lesson will use hands-on methods to introduce the topics of primer creation and transformation.
STUDENT LEARNING OBJECTIVES:
Students will be able to:
1. Describe the process of DNA replication in the context of polymerase chain reaction.
2. Describe the process of transcription and translation in the context of the green fluorescent protein.
3. Discuss how genes can be controlled via operons in prokaryotes.
4. Describe the process of bacterial transformation.
5. Explore how, and for what reason, certain biotechnological tools are used (such as polymerase chain reaction, gel
electrophoresis, and transformation.
6. Recognize that published scientific data must be trusted, but should continually be tested.
7. Describe how certain organisms rely on particular energy sources to maintain homeostasis.
8. Understand how gene expression can be controlled in specific scenarios.
9. Explain how the change in an organism’s environment can directly impact its phenotype.
10. Collect scientific data through experimentation and then interpret results.
STANDARDS
Next Generation Sunshine State Standards
SC.912.L.16.3
SC.912.L.16.5
SC.912.L.16.7
SC.912.L.16.11
SC.912.N.1.1
SC.912.N.1.3
SC.912.L.16.6
SC.912.L.16.12
SC.912.N.1.4
Advanced Placement (AP) Biology Learning Outcomes(LO)/Science Practices (SO):
LO 2.1
LO 2.2
LO 2.15
LO 2.16
LO 2.17
LO 2.18
LO 2.28
LO 3.1
LO 3.2
LO 3.3
LO 3.4
LO 3.20
LO 3.36
LO 3.37
LO 4.17
LO 4.23
LO 4.24
SP 1.2
SP 3.2
SP 6.1
SP 1.4
SP 4.3
SP 6.2
SP 3.1
SP 5.1
SP 6.4
Advanced International Certificate of Education (AICE) Biology Learning Outcomes:
F. (c)
F. (e)
F. (f)
O. (h)
O. (j)
R. (d)
R. (g)
R. (k)
MATERIALS:
Luria-Bertani (LB) Agar*
Petri dishes*
Ampicillin*
18
L-Arabinose
pGLO Plasmid
Sterile H2O
DNA Electrophoresis Sample Loading Dye **
Ethidium Bromide Solution**
10x Tris/Boric Acid/EDTA (TBE)**
Agarose**
1k DNA ladder**
Staining trays**
Q5® Site-Directed Mutagenesis Kit
NEB 5-alpha Competent E. coli
"Lesson 1" Forward Primer
"Lesson 1" Reverse Primer
Programmable Thermo cycler
PCR tubes (5 per group)
Micropipettes (P1000, P200, P10, or equivalent, required. One complete set per group, if possible)
Micropipette tips
1.5ml Microcentrifuge tubes (5 per group)
Longwave UV lamp/transilluminator (will be used for both gel electrophoresis, if completed, and transformation)
DNA gel electrophoresis chamber(s)*
Power supply for gel electrophoresis*
Casting/comb for gel preparation*
Orbital rocker/shake table (highly recommended)
Incubator (37°C)
Glass bacterial spreader with rotating petri dish stand (or sterile cotton swabs if this is not available)
Permanent fine-tip markers for labeling tubes (1 per group)
Hot water bath (42°C)
Computers with SnapGene installed and the pGLO plasmid file saved on the desktop
*It is possible to purchase already poured LB/Amp plates from biological supply companies, such as Fisher (R110846,
Thermo Scientific, No.:R110846) if cost allows. See preparation notes below for additional steps to further prepare premade plates.
** Because of the dilute nature of the PCR reaction, this author recommend that this step be completed only if staining with
ethidium bromide or silver stain, which are ~10x more sensitive than common non-toxic stains. It should be noted that
ethidium bromide is a known mutagen and is usually prohibited in high school settings.
BACKGROUND INFORMATION:
As mentioned in the curriculum background, fluorescent proteins (FPs) have become a vitally important part of
biotechnology - both in high schools and at advanced laboratories. Although the FPs now commonly used are synthesized in
laboratories, organisms have been making them for generations. The first documented recognition of organisms producing a
glowing product was by Pliny the Elder in AD77 when he made note that the Pulmo marinus (jellyfish) produced a substance
1
that was bright enough that it could “light the way like a torch.” Even as children we are all fascinated with the blinking of
common fireflies or the luminescence found on the bizarre anglerfish.
This curiosity brings us to the 1960s when Osamu Shimomura began his study of the Aequorea victoria jellyfish’s
luminescence. After the removal and “squeezing” of almost 10,000 luminescent rings from the underside of these jellyfish,
2
5mg of a purified product termed “aequorin” was produced. This molecule itself was not the green fluorescent protein
3
(GFP), but a closely associated molecule that was necessary for the GFP to give off its luminescence. Soon after, the
structure and function of the GFP was discovered. The first use of the GFP (other than the gene being cloned) was in 1992
4
when researchers used it to track gene expression in bacteria. Since then, researchers have utilized the GFP in a wide-range
of areas of biological/chemical research. At the time of this writing, a PubMed search for the term “gfp” came up with over
25,000 results. Because of its ease of use, the GFP has become a dominant research tool. There are now many derivatives of
the GFP which fluoresce in a wide-range of colors.
19
The GFP is unique because it only requires molecular oxygen to fluoresce (specifically for the formation of the
correct protein conformation). No cofactors or other enzymes are involved with the production of this protein’s
3
luminescence. The actual fluorophore (fluorescent chemical compound) is formed from the cyclization of the amino acids
3
5
in this protein. Three specific amino acids (Ser65-Tyr66-Gly67) are noted as being the most important in this structure. The
pGLO plasmid from Bio-Rad contains a slightly modified version of the original gfp (with enhancements for better
6
fluorescence) along with the common gene that offers ampicillin resistance and a modified arabinose operon. The
ampicillin resistance gene (bla)produces β-lactamase which destroys ampicillin and allows the bacteria that contain this
gene to grow on petri dishes that contain this drug. The modified arabinose operon is vital to the production of the GFP.
Several genes within the original arabinose operon were removed and replaced with the gfp gene. When grown in the
presence of L-arabinose, the operon turns on and produces the GFP instead of the enzymes that would normally break
down the L-arabinose.
Many of the tools used in this curriculum have been around for years and are now commonplace in even high
school laboratories. Polymerase chain reaction (PCR) has been around since the 1980s and is a common method used to
amplify DNA targets. The premise of PCR is relatively simple- cycles of heating and cooling allow complementary DNA
primers (oligonucleotides) to anneal (stick) to the template DNA which then allows heat-tolerant DNA polymerase to write
the rest of the strand of DNA based on complementary base pairing. This tool has become one of the most used procedures
in biological laboratories around the world.
Gel electrophoresis has been used in laboratories since the 1970s and is the most common method used to
separate DNA/proteins based on their size. There are now many different variations of gel electrophoresis (SDS-PAGE, 2-D,
etc.) but for the sake of simplicity in this curriculum, only agarose gels with common staining methods are used. The
principle that moves the DNA through the gel is based on the intrinsic negative charge of DNA. DNA is loaded into the wells
of a gel, an electrical charge (negative closest to the wells) is applied, and the DNA is “pushed” through the gel. The larger
DNA fragments move more slowly through the matrix of the gel than the smaller molecules. The supply of electricity is
halted, the DNA stops migrating, and staining then allows for the visualization of where the DNA ended up in context of a
DNA ladder (DNA sample with fragments of known sizes) run simultaneously next to the sample. This allows us to not only
see how many fragments of DNA the sample contains, but also relative molecular weights and concentrations (when
compared to the DNA ladder).
Bacterial transformation shares a similarity with FPs in that although just recently humans have exploited the
concept, organisms have been practicing it for much longer. Bacteria commonly incorporate “naked” DNA (DNA not inside of
an organism) from their environment and then can express new genes. This natural process was first replicated in a lab by
Fred Griffith in 1928. Griffith did not know that he stumbled upon transformation (it was not known at this point that DNA
was the genetic material) but made the following comment: “An interesting result was obtained with the 8th day specimen”
(in context that nonpathogenic bacteria became pathogenic), which he then tried to explain away with several interesting
7
(but ultimately incorrect) hypotheses. Future experimentation by other scientists concluded that DNA was moving from
8
bacterial cell to bacterial cell (transformation). Transformation is now common practice in order to add plasmids to
bacterial cells.
One unique tool that is incorporated into this curriculum is from New England Biolabs (NEB. Ipswich, MA) and is
called the “Q5® Site-Directed Mutagenesis Kit” (it will be referred to as the “Q5® kit” for the remainder of this curriculum).
This kit provides an ideal platform to conduct experiments in which small mutations are added to a gene. Typically,
modification are made to a gene which then has to be amplified via PCR, digested overnight with restriction enzymes that
are also shared by the plasmid, and then ligated back together. Although this method proves successful, it is not feasible to
conduct several times in a high school laboratory in a timely manner. The Q5® kit comes with everything (except the custom
primers) to accomplish gene modification in the matter of a few hours. Any mutations/changes to the gene of interest are
added to the primers, which are then incorporated during the PCR process. This allows for simple base pare substitutions
(which is what will be accomplished in this curriculum) to be easily added at very specific locations. There is no overnight
digestion/ligation needed. This step is substituted for by what is called the “KLD” (Kinase, Ligase & DpnI) reaction. This step
will phosphorylate and ligate the ends together, and digest old pieces of plasmid which are not new PCR products. Although
the Q5® kit comes with quality control items, there are four items (Q5® 2x MasterMix for PCR, 2x KLD reaction buffer, 10x
KLD enzyme mix, and NEB 5-alpha competent Escherichia coli cells) that will be used exhaustively during this curriculum.
The protocols that come with the kit from NEB have been slightly modified in this curriculum to “stretch” these supplies as
much as possible, allowing a maximal amount of groups to complete the activities.
In this first lesson, students will become familiar with the methodologies that will be used throughout this entire
curriculum. It is assumed that students have already mastered the use of the micropipettes (very small volumes are used
20
throughout this curriculum) and have a general understanding of DNA and biotechnology. It will allow students to
confidently conduct the advanced genetic modifications that will take place in lessons 2 and 3.
ADVANCE PREPARATION:
This is a relatively comprehensive procedure to initially setup. However, once “Lesson 1” is setup, the rest of the
lessons in this curriculum will require very few additional steps or materials (with minor, but key, differences in the primers
and PCR settings). In this lesson, students will be conducting gene cloning via PCR, inspecting the PCR results via gel
electrophoresis, and transforming E. coli in order to establish the baseline fluorescence of the wild type pGLO plasmid and
better understand tools used in biotechnology.
Based on cost, the limiting factor for how many groups can complete this curriculum will most likely be the Q 5® kit
from NEB. The reagents in the kit can be diluted by 50% (with sterile water) in order to stretch the longevity of the kit. If the
entire curriculum (three lessons) will be completed, then two Q5 kits (diluted by 50%) and one additional box of NEB 5alpha E. coli cells (C2987H) will be enough material for 10 groups of students. The quantities listed below will be adequate
for 10 groups and all three lessons (40 total Q5® reactions).
Table 1. Items that need to be ordered in advance from BioRad (Hercules, CA). All items can be stored for several months in
their appropriate locations, if not longer.
Item
Luria-Bertani (LB) Agar
(20g)*
BioRad Item #
Quantity
Notes
166-0600EDU
2
Enough for eighty 60mm plates
Petri dishes*
166-0470EDU
1
Contains 500, 60mm plates
Ampicillin*
166-0407EDU
1
30mg
L-Arabinose
166-0406EDU
1
600mg
pGLO Plasmid
166-0405EDU
2
20μg
Sterile H2O
DNA Electrophoresis
Sample Loading Dye **
Ethidium Bromide
Solution**
10x Tris/Boric Acid/EDTA
(TBE)**
163-2091EDU
1
550ml
166-0401EDU
1
1ml
161-0433EDU
1
10ml
161-0733EDU
1
1L
Agarose**
161-3100EDU
1
25g
700-7261
1
20 μl (enough for 20 gel runs)
1k DNA ladder**
Staining trays**
166-0477EDU
1
Pack of four trays
*It is possible to purchase already poured LB/Amp plates from biological supply companies, such as Fisher (R110846,
Thermo Scientific, No.:R110846) if cost allows. See preparation notes below for additional steps to further prepare prepoured plates.
** Because of the dilute nature of the PCR reaction, this author recommend that this step be completed only if staining with
ethidium bromide or silver stain, which are ~10x more sensitive than common non-toxic stains. It should be noted that
ethidium bromide is a known mutagen and is usually prohibited in high school settings.
21
Table 2. Items that need to be ordered in advance from New England Biolabs. The cells included in the Q5® kit and item
C2987H must be stored at -70°C. Storage in dry ice is necessary assuming no -70°C freezer is available. When ordering,
please indicate what dates you would like the items delivered (a day in advance of the activity).
New England
Biolabs #
Item
Q5® Site-Directed
Mutagenesis Kit
NEB 5-alpha
Competent E. coli
Quantity
E0554S
2
C2987H
1
Notes
Enough for all three lessons of curriculum.
Cells must stay on dry ice.
Order in addition to Q5® kit, but have arrive a day
before "Lesson 3". Must stay on dry ice. Twenty 0.05
ml/tubes.
Table 3. Items that need to be ordered in advance from Integrated DNA Technologies (Coralville, Iowa) that can will be used
for all portions of this curriculum. Items in italics are not needed for “Lesson 1”, but will be needed for “Lesson 2” and
“Lesson 3” and should be ordered at the same time. All items can be stored for several months at -20°C, if not longer.
Website instructions for order can be found in Appendix 1 at the end of this curriculum.
Item
Integrated DNA Technologies #
Lesson 1 Forward Primer
Custom Oligonucleotide Synthesis
1
Notes
5’ CAC TAC TTT CTC TTA TGG TGT TCA
AT 3’
Lesson 1 Reverse Primer
If completing all three
lessons, order these
primers at the same
time:
Custom Oligonucleotide Synthesis
1
5’ ACA AGT GTT GGC CAT GGA A 3’
Lesson 2 Forward Primer
Custom Oligonucleotide Synthesis
1
Lesson 2 Reverse Primer
Lesson 3 Forward Primer,
PCR reaction #1
Custom Oligonucleotide Synthesis
0
Custom Oligonucleotide Synthesis
1
Custom Oligonucleotide Synthesis
0
Custom Oligonucleotide Synthesis
1
5’ CAC TAC TTT CTC TYR KGG TGT TCA
ATG 3’
This is the same reverse primer used
in “Lesson 1,” none additional should
be needed.
5’ CAC TAC TCT GAC TCA TGG TGT TCA
ATG CTT TTC C3’
This is the same reverse primer used
in “Lesson 1,” none additional should
be needed.
5’ TCG AGT ACA ACT TTA ACT CAC ACA
ATG 3’
Custom Oligonucleotide Synthesis
1
5’ GTT TGT GTC CGA GAA TGT TTC 3’
Lesson 3 Reverse Primer,
PCR reaction #1
Lesson 3 Forward Primer,
PCR reaction #2
Lesson 3 Reverse Primer,
PCR reaction #2
Quantity
Once the above items have been received, the following needs to be done a day (or two) in advance to the commencement
of the lab:
1. If preparing LB/Amp/Arabinose Petri Dishes:
a. Ampicillin Stock Solution- Dissolve .1g ampicillin into 1ml sterile H2O (will require vigorous
shaking/vortexing and should be filter sterilized, if available).
b. L-Arabinose Stock Solution (NOTE- D-Arabinose will NOT work with this curriculum) - Dissolve .2g Larabinose into 10ml sterile H2O (should be filter sterilized, if available).
22
c. LB/ Ampicillin Agar Plates- each 20g LB agar package will make ~forty 60mm plates. For the preparation
of eighty, add both LB powder packages to 1L of distilled H2O and mix. Autoclave/boil for 15 minutes in
appropriate glass container(s). Once this product has cooled (below 55°C), add 1ml of the Ampicillin Stock
Solution to the solution and lightly mix. Pour solution into 10 of the petri dishes (these dishes will NOT
have arabinose and the GFP will not be actively produced on them, but bacteria will still grow). Once these
10 are poured, add 1.4ml of L-Arabinose Stock Solution to the remaining unpoured LB/Amp agar, and
proceed in pouring the remaining 70 petri dishes. Let cool, store in the incubator (37°C) overnight to
ensure sterility, and then place in refrigerator for storage.
1.1 If purchased pre-poured LB/Amp plates
a. L-Arabinose Stock Solution (NOTE- D-Arabinose will NOT work with this curriculum) - Dissolve
.2g L-arabinose into 10ml sterile H2O (should be filter sterilized, if available).
b. Add 50μL of L-Arabinose Stock Solution to 70 (out of the 80) plates. Spread with either a glass
bacterial spreader or sterile cotton swab ensuring the use of aseptic technique while this is being
completed.
2. pGLO plasmid- Add 1,000μL sterile H2O to the pGLO plasmid and mix by flicking several times. Separate this stock
solution into ten 1.5ml microcentrifuge tube aliquots (ten 4µl aliquots will be adequate for ten groups completing
all three lessons of the curriculum) and place in freezer until use.
3. Gels for electrophoresis (only if completing gel electrophoresis) - It is left to the discretion of the instructor if
students pour their own gels, but for the sake of time it would be wise to pre-pour them. The methodology for
pouring plates will vary depending on the chamber being used. Please use manufacturer’s guidelines for your
chamber to prepare .8% agarose gels (.8g agarose in 100mL TBE buffer). The gels can be left submerged in the
buffer for a day in advance of the activity. It may be possible to order pre-cast gels, depending on your chamber
manufacturer and specifications.
4. 1K DNA Ladder (only if completing gel electrophoresis) - Separate aliquots of ladder should be made in PCR
tubes (or equivalent) and stored in the freezer. One aliquot will be used per gel. Add 1µl DNA ladder, 1µl sample
loading dye, and 4µl sterile water to a PCR tube, and freeze.
5. Fill ten PCR tubes (or equivalently small tubes) with 5μL of loading dye/buffer, following manufacturer
recommendations (only if completing gel electrophoresis).
6. Q5® Site-Directed Mutagenesis Kit. The following constituents need to be diluted by 50% with sterile H 2O:
a. Dilute Q5® 2x Mastermix by adding 125μL sterile, ice cold H2O directly to the tube and mix. Separate
stock solution into individual 1.5ml microcentrifuge tube aliquots (ten 125μL aliquots will be adequate for
10 groups completing all three lessons of the curriculum) and place in freezer until use (and keep on ice
when in use).
b. Dilute 2x KLD reaction buffer by adding 100μL sterile water directly to the tube and mix. Separate stock
solution into individual 1.5ml microcentrifuge tube aliquots (ten 50μL aliquots will be adequate for 10
groups completing all three lessons of the curriculum) and place in freezer until use.
c. Dilute 10x KLD Enzyme Mix by adding 10µl sterile water directly to the tube and mix (it is very important
to keep this item in freezer/on ice at all times and to only dilute this enzyme mix immediately prior to use).
23
It is not this author’s recommendation to split this enzyme solution into separate aliquots. Enzyme should
be made available to the class as a common resource (in ice or in freezer) in the lab.
7. Primer preparation. Primers need to be diluted to the correct concentration as follows:
a. Lesson 1 Forward Primer- Add 236µl of sterile H2O to primers to create stock solution (100uM).
Create 10uM aliquots from this stock solution (to be used by individual groups, or create just one
for the class and pass around) by adding 10µl forward primer stock solution to 90µl sterile H2O.
b. Lesson 1 Reverse Primer- Add 226µl of sterile H2O to primers to create stock solution (100uM).
Create 10uM aliquots from this stock solution (to be used by individual groups, or create just one
for the class and pass around) by adding 10µl forward primer stock solution to 90µl sterile H2O.
8. Fill ten 1.5 microcentrifuge tubes with 1000µl of sterile water.
Required Laboratory Equipment:
Programmable Thermo Cycler
PCR tubes (5 per group)
Micropipettes (P1000, P200, P10, or equivalent, required. One complete set per group, if possible)
Micropipette tips
1.5ml Microcentrifuge tubes (5 per group)
Longwave UV lamp/transilluminator (will be used for both gel electrophoresis, if completed, and observation of
transformation)
DNA gel electrophoresis chamber(s)*
Power supply for gel electrophoresis*
Casting/comb for gel preparation*
Orbital rocker/shake table (highly recommended)
Incubator (37°C)
Glass bacterial spreader with rotating petri dish stand (or sterile cotton swabs if this is not available)
Permanent fine-tip markers for labeling tubes (1 per group)
Hot water bath (42°C)
Ice, with appropriate containers
Waste bins/bags for each station
Gloves
Goggles
* Only if completing gel electrophoresis
Other Equipment
Computers with SnapGene installed and the pGLO plasmid file saved on the desktop (file can be found at
http://www.snapgene.com/resources/plasmid_files/fluorescent_protein_genes_and_plasmids/ ). “SnapGene Viewer” is
free and recommended (not needed for the wet lab portion, but needed for plasmid introduction and primer design).
PROCEDURE AND DISCUSSION QUESTIONS WITH TIME ESTIMATES:
Introduction to FPs and pGLO, 20 minutes
The concept of fluorescent proteins (FPs) needs to be introduced (if it has not been already). The best way to do
this is to look at pictures and videos of FPs in “action” (links below). In addition to this, remind students that the original GFP
was derived from the Aequorea jellyfish about 50 years ago and its derivatives (other FPs) have proven to be vitally
important in biotechnology today in the search for cures and drug development. The background (above) and student
handout for this lesson both include a brief historical recount of the discovery and development of this technology.
24
The best website to explore FPs in action is http://www.microscopyu.com/galleries/. This website has an
abundance of amazing videos and pictures of the FPs in use. There are no “right” or “wrong” pictures to show the class. All
of them are amazing! Remind students that for the first time, scientists can visualize what is occurring in a cell and can track
very specific molecules while the cell is still alive. This better allows us to understand complex interactions. Here are links to
pictures and videos to show to the class (feel free to add additional):
Gallery of mammalian cells: http://www.microscopyu.com/galleries/fluorescence/cells.html
Videos: http://www.microscopyu.com/moviegallery/sweptfield/index.html
Hand out the “Student Handout” worksheet. The pGLO plasmid should be introduced by showing the diagram of it
that can be seen in SnapGene (instructions below in student section), and found on their handout. Discuss the fact that the
plasmid contains three very important genes/operons.
1. gfp gene- slightly modified version of the original gfp gene in order to maximize fluorescence and stability.
r
2. Amp /bla gene- produces β-lactamase which is an enzyme that breaks down ampicillin. This gene being
present will allow only the transformed bacteria (with the gfp) to grow on the Amp+ petri dish.
3. Ara operon (modified by the removal of certain genes and the addition of the gfp gene) - Contains the
promoter than will turn on the gfp gene when grown in a media rich in L-arabinose.
Students should then answer questions 1-6 based on the introductory paragraph and class discussion of the plasmid.
Introduction to SnapGene, 30 Minutes
In order to complete PCR, students will need to create primers using SnapGene. The student handout “Instructions
for SnapGene” allows them to become more comfortable using the software (it is recommended to run-through the
procedure on the student handout before giving it to students). Remind students that they cannot really “mess up” beyond
recovery because they can just start with the original pGLO plasmid file again. Students should complete steps/questions 119 on the student handout “Instructions for SnapGene”.
Introduction to Polymerase Chain Reaction (PCR), 10 minutes (can be completed as homework)
Students should already be familiar with the overall concept of PCR (it makes copies of targeted sequences of
DNA). If students are already extremely familiar with it, this introduction (and handout) can be skipped. If not, the
“Introduction to PCR” student handout should be distributed, and questions 1-8 should be answered.
Introduction to Gel Electrophoresis, 10 minutes (can be completed as homework, only if completing the gel
electrophoresis step)
Students should already be familiar with the overall concept of gel electrophoresis (it separates DNA based on
molecular size via electrical charge). If students are already extremely familiar with it, this introduction (and handout) can
be skipped. If not, the “Introduction to Gel Electrophoresis” student handout should be distributed, and questions 1-10
should be answered.
Introduction to Transformation, 10 minutes (can be completed as homework)
Students should already be familiar with the overall concept of bacterial transformation (the addition of a DNA
plasmid to a bacterial cell). If students are already extremely familiar with it, this introduction (and handout) can be skipped.
If not, the “Introduction to Transformation” student handout should be distributed, and questions 1-7 should be answered.
25
Laboratory Activity, up to 4 days
Students will be using SnapGene to create primers that will be used in the PCR reaction creating additional wild
type (unmutated) gfp (methodology and questions can be found below). This PCR product will then be run on a 1% agarose
gel to ensure a PCR product was produced. If successful, the PCR product will undergo the “KLD” reaction and then be used
to transform competent E. coli cells. The student handout “Laboratory Activity- Production of Wild Type gfp via PCR and
Transformation” has all instructions for this activity (it would be wise to run through the procedure once before
implementing).
Primer Creation, 55 minutes
The following items are needed by each student:
- Computers with SnapGene, the pGLO file, and Internet connection.
PCR Reaction, 20 minutes (additional 2 hours to run the reaction, but students do not need to be present)
The following item(s) should be found in the common area for the PCR reaction:
- Thermo cycler
Each lab station should have the following for the PCR reaction:
- 1 empty PCR tube
- Set of micropipettes with appropriate tips
- 1 fine-point permanent maker for labeling
- Q5® 2x Mastermix aliquot
- Template DNA aliquot (pGLO)
- Microcentrifuge tube of Sterile H20
- Lesson 1 Forward primer aliquot (if not made available as a common item for the class)
- Lesson 1 Reverse primer aliquot (if not made available as a common item for the class)
- Waste bins/bags for each station
- Gloves
- Goggles
Students will add the following to the empty, labeled PCR tube for a total volume of 25µl:
- 12.5µl Q5® 2x Mastermix
- 1.0µl Template DNA
- 1.5µl forward primer
- 1.5µl reverse primer
- 8.5µl sterile H20
Thermocycler program “Q5, wild type”
Step 1. 98°C for 30 seconds
Step 2. 98°C for 15 seconds
Step 3. 55°C for 30 seconds
Step 4. 72°C for 4 minutes
Step 5. Repeat steps 2-4, 25 times
Step 6. 72°C for 10 minutes
Step 7. Hold at 4°C
26
Gel Electrophoresis, 30 minutes to /prepare load samples. Additional 1.5 hour to run and stain (which can be
completed outside of class). This activity is optional, but highly recommended if ethidium bromide/silver
staining is available).
The following item(s) should be found in the common area for gel electrophoresis:
- Gel chamber
- Power supply
- Pre-cast gel(s) loaded into the chamber and submerged in buffer solution
- One DNA ladder aliquot per gel being used
- Template DNA aliquot (pGLO)
Each lab station should have the following for gel electrophoresis:
- 1 empty PCR tube
- Set of micropipettes with appropriate tips
- 1 fine-point permanent maker for labeling
- PCR product
- Loading dye/buffer aliquot
- Waste bins/bags for each station
- Gloves
- Goggles
1. Students will add the following to the empty, labeled PCR tube for a total volume of 5µl:
- 4µl of the PCR product
- 1µl of loading dye.
2. Students will then load this prepared product in the gel. This can be tricky, and some students will need
assistance. Leave two lanes open in the middle of the gel, and have select groups/individuals load one with DNA
ladder (6µl), and the other with template DNA (this will need to be prepared by adding 2µl template DNA to 1µl
loading dye/buffer = 3µl). The gel should be run at 100 volts until loading dye has moved around ¾ of the way
down the gel. Gel can then be stained (follow manufacturer recommendations), de-stained, and photographed.
The gel can be saved temporarily by submerging it back into the buffer solution.
3. Figure 1* represents the NEB 1kd DNA ladder used in this curriculum development (this specific brand of DNA
ladder is not necessary, but a 1kb ladder is highly recommended). Figure 2* represents experimental results. The
Q5® PCR products should show up as a light band (Figure 2, lane 2, between the 5-6kb bands). The Q5® PCR
product should be ~5,400 bp because it should be the fully replicated pGLO plasmid. It should be once again noted
that the Q5® plasmid PCR product yield is low, but fully capable of producing an efficient transformation efficiency
of the NEB 5-alpha E. coli cells. Figure 2, lane 1 is the NEB 1kb DNA ladder.
27
*These pictures will need to be included on the student worksheet if gel electrophoresis is not completed in class.
Figure 1. NEB 1kb DNA ladder (image from
http://international.neb.com/products/n3232-1-kb-dna-ladder)
Figure 2. Experimental gel. Lane 1 =
NEB 1kb DNA ladder. Lane 2 = Q5® PCR
product
KLD Reaction (25 minutes)
It is important to note that if a gene of interest was being ADDED to the plasmid, the additional steps of
digestion using specific restriction enzymes and ligation of the products would be necessary. However, the Q5® kit
contains a step to bypass this step because we are making no modifications to the gene (this same kit will also be
used when we begin making small changes to the genotype). This step is called the “KLD”, which stands for Kinase,
Ligase & DpnI. This step will phosphorylate and ligate the ends together, and digest old pieces of plasmid which are
not new PCR products. This step is extremely easy, and is one reason the Q5® kit is unique.
The following item(s) should be found in the common area for the KLD reaction (It is vital to minimize time that this
enzyme is out of the freezer. It should only be out of the freezer for a couple minutes, and kept on ice) :
- 10x KLD Enzyme Mix (kept in ice)
Each lab station should have the following for the KLD reaction:
- 1 empty PCR tube
28
- Set of micropipettes with appropriate tips
- 1 fine-point permanent maker for labeling
- The groups PCR product
- 2x KLD reaction buffer aliquot
- Sterile H2O
- Waste bins/bags for each station
- Gloves
- Goggles
Students will:
1. Label a clean PCR tube with group name/number and “Q5 WT KLD”
2. Add the following to the empty PCR tube for a total volume of 10µl:
- 1µl PCR product
- 5µl KLD reaction buffer
- 1µl 10x KLD Enzyme mix
- 3µl Sterile H20
3. Incubate at room temperature for 5 minutes.
4. This product is now usable for transformation
Transformation of NEB 5-alpha E. coli cells (55 minutes, split over two days)
The last step of this lesson is the transformation of the included NEB 5-alpha E. coli cells. It is important to
note that E. coli cells can be made chemically competent through the addition of calcium chloride, but these cells
from NEB arrive as “highly competent”, and are ready to be transformed as soon as they arrive (and are held at 70°C). In theory, other E. coli could be successfully transformed if prepared correctly, but that methodology (to
make cells competent) is not included in this curriculum, nor is guaranteed to efficiently transform.
The following item(s) should be found in the common area for the transformation reaction:
- NEB 5-alpha E. coli cells (these must be kept on dry ice up until the transformation begins. One tube per
group completing the lab should be made available)
- Hot water bath (42°C)
- Incubator (37°C)
- Orbital rocker/shake table (highly recommended and should ideally be located inside the incubator)
- Glass bacterial spreader with rotating petri dish stand (or sterile cotton swabs if this is not available. This
item could also be found at each lab station).
- SOC outgrowth medium (included with the Q5® kit)
Each lab station should have the following for the transformation reaction:
- KLD reaction product
- Set of micropipettes with appropriate tips
- Permanent fine-tip markers for labeling tubes (1 per group)
- Container/beaker with ice
- Waste bins/bags for each station
- Gloves
- Goggles
- 1 LB/Amp+ petri dish
- 1 LB/Amp+/L-arabinose petri dish
Students will:
29
1. “Thaw” the NEB 5-alpha E. coli cells on ice for 3 minutes.
2. Add 5µl of KLD reaction product to the NEB 5-alpha E. coli and flick several times to mix.
3. Put on ice for 30 minutes.
4. Heat shock in hot water bath (42°C) for 30 seconds.
5. Immediately transfer back to ice and hold there for 5 minutes.
6. Pipette 950µl of SOC outgrowth medium into cells.
7. Incubate (on orbital rocker/shaker) at 37°C for 1 hour or longer (if in a “block” class, students can wait
an hour and immediately skip to “step 8”. If classes are not in a “block” then “step 7” time can be changed
to overnight, but would need to be incubated at room temperature to minimize growth).
8. After incubation, cells need to be transferred onto petri dishes.
- Add 10µl of culture (assuming 60mm plates, amount can be adjusted if using larger petri dishes)
to LB/Amp+ petri dish and spread using either glass spreader and turntable, or sterile cotton
swab. Make sure the petri dish is only cracked open, and the lid is promptly put back on.
- Add 10µl of culture (assuming 60mm plates, amount can be adjusted if using larger petri
dishes) to LB/Amp+/L-arabinose petri dish and spread using either glass spreader and turntable,
or sterile cotton swab. Make sure the petri dish is only cracked open, and the lid is promptly put
back on.
9. The remaining culture can be used to inoculate additional plates if available, or placed in the
refrigerator if it is thought it will be needed again.
10. Incubate petri dishes over night at 37°C.
Observations after growth (15 minutes)
Observation of the resulting growth is both exciting and important. Students should notice the cells grown
on the LB/Amp+ plates do not fluoresce, yet still grow (remember, the arabinose operon controls the production of
GFP. If no L-arabinose is present, the operon will be “off” and not produce the GFP. The LB/Amp+/L-arabinose petri
dishes should contain cells that are highly fluorescent. There should not be any variation in intensity of
fluorescence (any cells that demonstrate no fluorescence are possible contaminants). Remind students to NOT
open the petri dishes. All observations are made through the plastic. It was observed by this author that maximum
florescence was achieved after one day of incubation at 37°C followed by two days of room temperature
incubation.
Each lab station should have the following for observation:
- Longwave UV lamp/transilluminator (if the lab has only one large transilluminator, multiple groups can
use it at one time)
- Gloves
- Goggles
ASSESSMENT SUGGESTIONS:
By completing all of the questions included with “Lesson 1”, students will be able to:
1. Describe the process of DNA replication in the context of polymerase chain reaction for the pGLO plasmid.
2. Describe the process of transcription and translation in the context of the green fluorescent protein.
3. Discuss how the gfp gene can be controlled in E. coli via the arabinose operon.
4. Describe and demonstrate the process of bacterial transformation through actively producing a bacterial product that is
transformed.
5. Explore how, and for what reason, certain biotechnological tools are used (such as polymerase chain reaction, gel
electrophoresis, and transformation).
6. Recognize that published scientific data such as the pGLO plasmid sequence must be trusted, but should continually be
tested through scientific means (creation of primers that are truly complementary to the pGLO plasmid).
7. Describe how E. coli actively requires the agar media in order to maintain homeostasis.
30
8. Understand how gene expression can be controlled in specific scenarios such as the addition or subtraction of Larabinose.
9. Explain how the change in an organism’s environment can directly impact its phenotype by growing transformed E. coli on
varying amounts of L-arabinose (full concentration and none present).
10. Collect scientific data through primer creation, PCR, gel electrophoresis (if completed), and transformation. Data will
then be used to interpret results in a manor than demonstrates the understanding the basic principles of the
aforementioned technologies.
EXTENSIONS:
- Running gel electrophoresis (along with further gel electrophoresis analysis) is highly recommended, but not
necessary. Additionally, if ethidium bromide is prohibited, students could run 1k DNA ladder or pGLO stock plasmid
which should show up with environmentally friendly staining methods.
- Have students investigate the structure of other common plasmids (all available in the .zip file that the pGLO
plasmid sequence was found in) and possibly complete a “virtual” restriction enzyme digestion.
RESOURCES/REFERENCES:
1. Pliny, J. Bostock and H. T. Riley. The natural history of Pliny, Book XXXII.Remedies derived from aquatic animals. Chapter
52—Other aquatic productions. Adarca or Calamochnos: three remedies. Reeds: eight remedies. The ink of the sæpia. Gaius
Plinius Secundus (Pliny the Elder). AD77., H. G. Bohn, London. 1855.
2. Shimomura, O., Y. Saiga, and F. H. Johnson. "Purification and properties of aequorin, a bio-(chemi-) luminescent protein
from jelly-fish, Aequorea aequorea." Fed Proc., 1962, Vol. 21.
3. Chalfie, M. and S. Kain, Green fluorescent protein: properties, applications, and protocols, Wiley-Interscience, Hoboken,
NY, 2nd edn, 2006.
4. Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W. and Prasher, D. C. “Green fluorescent protein as a marker for gene
expression.” Science, 1994, 263, 802-805.
5. Cody, C. W., D. C. Prasher, W. M. Westler, F. G. Prendergast and W. W. Ward, Biochemistry, 1993, 32, 1212–1218.
6. http://www.bio-rad.com/LifeScience/pdf/Bulletin_9563.pdf
7. Griffith, F.. The significance of pneumococcal types. J. Hyg, 1928, 27:113-159.
8. Avery, O. T., C. M. MacLeod, and M. McCarty. “Studies on the chemical nature of the substance inducing transformation of
pneumococcal types. Induction of transformation by a deoxyribonucleic acid fraction isolated from pneumococcus type III.”
J. Exp. Med., 1944, 89:137-158.
31
STUDENT PAGES: Background Information
The discovery, isolation, and creation of fluorescent proteins could be argued as one of the most
important steps in biotechnology of the last 40 years. These proteins in and of themselves do not show promise as
cancer or HIV-fighting drugs, but instead have allowed us to see a world that was once invisible to the naked eye.
Scientists can now observe the dynamic processes occurring inside of a living organism in order to better
understand interactions and activities. These lessons will introduce you to methods used in order to study the
green fluorescent protein (GFP).
Fluorescent proteins (FPs) have become a vitally important part of biotechnology - both in high schools and at
advanced laboratories. Although the FPs now commonly used are synthesized in laboratories, organisms have been making
them for generations. The first documented recognition of organisms producing a glowing product was by Pliny the Elder in
AD77 when he made note that the Pulmo marinus (jellyfish) produced a substance that was bright enough that it could
1
“light the way like a torch.” Even as children we are all fascinated with the blinking of common fireflies or the luminescence
found on the bizarre anglerfish.
This curiosity brings us to the 1960s when Osamu Shimomura began his study of the Aequorea victoria jellyfish’s
luminescence. After the removal and “squeezing” of almost 10,000 luminescent rings from the underside of these jellyfish,
2
5mg of a purified product termed “aequorin” was produced. This molecule itself was not the green fluorescent protein
3
(GFP), but a closely associated molecule that was necessary for the GFP to give off its luminescence. Soon after, the
structure and function of the GFP was discovered. The first use of the GFP (other than the gene being cloned) was in 1992
4
when researchers used it to track gene expression in bacteria. Since then, researchers have utilized the GFP in a wide-range
of areas of biological/chemical research. At the time of writing, a PubMed search for the term “gfp” came up with over
25,000 results. Because of its ease of use, the GFP has become a dominant research tool. There are now many derivatives of
the GFP which fluoresce in a wide-range of colors.
The GFP is unique because it only requires molecular oxygen to fluoresce (specifically for the formation of the
correct protein conformation). No cofactors or other enzymes are involved with the production of this protein’s
3
luminescence. The actual fluorophore (fluorescent chemical compound) is formed from the cyclization of the amino acids
3
5
in this protein. Three specific amino acids (Ser65-Tyr66-Gly67) are noted as being the most important in this structure. The
pGLO plasmid from Bio-Rad contains a modified version of the original gfp (with enhancements for better fluorescence)
6
along with the common gene that offers ampicillin resistance and a modified arabinose operon. The ampicillin resistance
gene (bla)produces β-lactamase which destroys ampicillin and allows the bacteria that contain this gene to grow on petri
dishes that contain this drug. The modified arabinose operon is vital to the production of the GFP. Several genes within the
original arabinose operon were removed and replaced with the gfp gene. When grown in the presence of L-arabinose, the
operon turns on and produces the GFP instead of the enzymes that would normally break down the L-arabinose.
Figure 1: pGLO plasmid
32
Background Questions
33
1.
In your opinion, why was the discovery and implementation of FPs in scientific research so important?
2.
Why do you think multiple different colors are seen in the pictures/videos?
3.
Based on the above diagram of the pGLO plasmid, how many base pairs does it contain?
4.
The bacteria that contain this plasmid should be grown on petri dishes that contain the antibiotic Ampicillin.
Would the transformed bacteria grow on petri dishes without ampicillin? Why or why not?
5.
Why do the petri dishes contain the sugar L-arabinose?
6.
Hypothesize what would happen if NO L-arabinose was on the plates?
References
1. Pliny, J. Bostock and H. T. Riley. The natural history of Pliny, Book XXXII.Remedies derived from aquatic animals.
Chapter 52—Other aquatic productions. Adarca or Calamochnos: three remedies. Reeds: eight remedies. The ink of
the sæpia. Gaius Plinius Secundus (Pliny the Elder). AD77., H. G. Bohn, London. 1855.
2. Shimomura, O., Y. Saiga, and F. H. Johnson. "Purification and properties of aequorin, a bio-(chemi-) luminescent
protein from jelly-fish, Aequorea aequorea." Fed Proc., 1962, Vol. 21.
3. Chalfie, M. and S. Kain, Green fluorescent protein: properties, applications, and protocols, Wiley-Interscience,
Hoboken, NY, 2nd edn, 2006.
4. Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W. and Prasher, D. C. “Green fluorescent protein as a marker for gene
expression.” Science, 1994, 263, 802-805.
5. Cody, C. W., D. C. Prasher, W. M. Westler, F. G. Prendergast and W. W. Ward, Biochemistry, 1993, 32, 1212–1218.
6. http://www.bio-rad.com/LifeScience/pdf/Bulletin_9563.pdf
Instructions for SnapGene
1. Open the SnapGene program
2. Click on “open”
3. Select the “pGLO” plasmid file on the “desktop”
4. The plasmid should now show up in SnapGene
5. Find the gene entitled “GFP” on the plasmid and double-click
a. How many base pairs is the gfp gene?
b. What is the specific product of the gfp gene?
6. Close this window showing the gfp gene
7. All of the black text pointing to specific locations on the plasmid are restriction sites. Click on the tab (found on
the bottom, under the plasmid viewer) called “Enzymes”.
8. Right now, restriction enzymes that have only one restriction site on the plasmid are shown. Find the enzyme
“EcoRI” on the list and double-click.
a. At what specific sequence will this restriction enzyme cut?
34
b. What temperature does this enzyme work best at?
9. Close this window showing the “EcoRI” enzyme information
10. Click back the “Map” tab to view the whole plasmid
11. Find the plasmid feature “MCS” and put the mouse cursor over it (do not double-click)
a. What does “MCS” stand for?
b. In the context of restriction sites, what makes the “MCS” important?
12. Click on the “Sequence” tab on the bottom, under the plasmid.
13. You are now looking at the entire genetic sequence of the pGLO plasmid. All features of the plasmid are now
displayed, sequentially. Scroll down until you find the same “MCS” you found on the plasmid.
14. Click on the “MCS” once and notice how it now highlights the DNA of this feature.
15. Put your mouse cursor over the “EcoRI” restriction site inside of the “MCS”. Notice how it shows where it will
exactly cut the DNA.
16. Right above (sequentially) the “MCS” is the gfp. The gfp is a large gene, and not all of it can be displayed at one
time on your screen. There is a key difference in the information being displayed as part of the gfp versus the
“MCS”. Directly under the DNA sequence of the gfp we can find what amino acid (and the corresponding number
of the amino acid) the codon above it codes for. By scrolling over the individual amino acids, their positional
number will be displayed.
a. Why does the “MCS” not have any amino acids listed?
b. What is the 222 amino acid in the GFP?
th
17. Click this amino acid, hold, and drag the cursor through the 230 amino acid in the sequence (“Thr”). While still
holding down the button, make note of the three pieces of information being displayed- “2008..2034 = 27 bp, Tm
=59°C”. This information “translates” to: base pairs 2008 2034 are selected, which is a total of 27 base pairs. The
temperature (Tm) that this specific sequence will spilt and become single-stranded DNA is 59°C”.
a. Select amino acids 65  75 in the gfp. Which base pair numbers are now selected? How many base
pairs is this? What is the Tm of this selected sequence?
18. You are now going to add a “feature” into the gfp. Highlight the same amino acid sequence as before (65 75).
Once highlighted, find “features” on the top menu, and click. Select “add feature”. A new window will open
allowing you to add specific information about this new feature. Name the feature “test” (where it says “Feature:”)
and add a note on the bottom of the same window stating “feature test”. Click “Okay”, and this feature will now be
added to the sequence. You can also double-click it to see the notes that you wrote about it. This feature can now
be deleted by clicking the feature, and using the “delete” function on the keyboard.
19. This software has many other features that you will be using later in this curriculum, but feel free to explore
further if there is still time in class.
35
Introduction to PCR
Go to the following link and watch the animation to answer the following questions:
http://www.youtube.com/watch?v=2KoLnIwoZKU
1. How many different temperatures are used in the process of PCR?
2. What does the term “anneal” mean?
3. What happens at each of these temperatures?
~55°C =
~72°C =
~95°C =
4. How do you think the Tm feature in SnapGene relates to the annealing temperature?
5. Two different primers must be used in PCR (forward primer and reverse primer). What could the problem be if
the Tm of the primers is drastically different?
7.
Why would a PCR run of five cycles not be worthwhile?
8. At the start of the PCR run, would you have to have a greater amount of primers or target DNA? Why?
Introduction to Gel Electrophoresis
Go to: http://www.youtube.com/watch?v=6QYgN-toA1A and watch through 3:50.
1. Why do you load the DNA into the negatively charged end of the chamber?
2. What do the individual bands represent?
3. Which DNA moves the furthest through the gel?
4. What is a difference between gels of different agarose concentrations?
5. What would two different bands in different wells that moved the same distance through the gel represent?
36
Go to: http://www.youtube.com/watch?v=QEG8dz7cbnY and watch entire video.
6. What is the purpose of the loading buffer/dye?
7. What is the purpose of the DNA molecular weight ladder?
8. What voltage is being used in this procedure?
9. What is a simple way to make sure that electricity is moving through the chamber?
Go to: http://www.youtube.com/watch?v=tTj8p05jAFM and start video at 1:00.
10. What are three common “problems” when loading your sample in the gel?
Introduction to Transformation
Go to http://www.teachersdomain.org/asset/biot11_vid_transbact/ and watch through 1:10.
1. What is the overall goal of transformation?
2. What is the charge of both the bacterial cell and plasmid?
3. What is the purpose of the addition of calcium chloride?
4. At what temperature is the plasmid mixed with the cells?
5. What temperature is used to “heat shock” the cells?
6. What is the purpose of the heat shock?
7. What is the purpose of putting the bacteria back at 37°C?
37
STUDENT HANDOUT: Laboratory Methodologies and Questions
You will first complete a PCR reaction to replicate the wild type gfp gene (no mutations will be
incorporated into the primers). This replicated DNA will then be run on a gel (to ensure a PCR product was made),
and then used to transform the bacteria. You will first need to create an appropriate primer to anneal to the gfp.
Primer Creation
1. Open SnapGene
2. Load the pGLO plasmid
3. Click on the “Sequence” tab
4. Scroll down to the gfp
5. Although the entire gfp gene is important, three amino acids are the most important in dictating its
fluorescence. These three are Ser65-Tyr66-Gly67 (this could be restated as Serine at position 65,
Tyrosine at position 66, and Glycine at position 67). It is vitally important that our PCR reaction
replicates this section of the gfp.
6. The primer that we are going to first create is the forward primer and is going to run from nucleotide
base 1527  1552. Highlight this selected portion of DNA.
7. Once highlighted, click on the “Primers” option at the top of the window and then select “Add
Primer”.
8. A window will pop up and ask you are making a primer for the top or bottom strand. Select “Top
Strand”.
9. Give this primer a name. In the top of the window, name this primer “Q5 wild type forward primer.” It
would be smart to add this same text to the “comments” box below.
10. Click “Add primer to template” and the window will now close and you see your primer added to the
entire plasmid. You can move your cursor over the primer to see information about it.
a. How many base pairs is the forward primer?
b.
What is Tm of the forward primer?
c.
What is the actual DNA sequence of the forward primer?
11. The primer that we are now going to create is the reverse primer (on the opposite, or “bottom”
strand) and is going to run from nucleotide base 1508  1526. Highlight this selected portion of DNA.
12. Once highlighted, click on the “Primers” option at the top of the window and then select “Add
Primer”.
13. A window will pop up and ask you are making a primer for the top or bottom strand. Select “Bottom
Strand”.
14. Give this primer a name. In the top of the window, name this primer “Q5 wild type reverse primer.” It
would be smart to add this same text to the “comments” box below.
15. Click “Add primer to template” and the window will now close and you see your primer added to the
entire plasmid. You can move your cursor over the primer to see information about it.
a. How many base pairs is the forward primer?
38
b.
What is Tm of the forward primer?
c.
What is the actual DNA sequence of the reverse primer?
16. Now that you have the Tm for both primers, we need to come up with the annealing temperature we
will use in the PCR reaction. There is an allowable range of annealing temperatures that can be used;
however, if the temperature is too low then the primer will anneal to areas that it is not supposed to
and if it is too high then not enough product will be made. We will lean on the side of accuracy and
chose an annealing temperate slightly higher than the lower primer Tm temperate. This will be 55°C.
17. These primers now need to be checked for potential problems. To do this, we will go to the same
website we use to order the custom primers: http://www.idtdna.com/site.
a. Follow the above link and then click on the “SciTools” dropdown menu and select
“OligoAnalyzer”.
b. Copy and paste your forward primer DNA sequence into the “Sequence” box
c. Click on the “Analyze” button on the right side of the screen
d. It will give you some basic information about this sequence, including the Tm (notice how it
is slightly different than what we came up with in SnapGene, that is to be expected based on
variations in calculation methods).
d.i. What is this companies reported Tm for the forward primer?
d.ii. What is the GC content (how much of the primer is made of Guanine and Cytosine)?
e.
Under the “Analyze” button, click on “Hairpin”. This will tell us if our primer will create
“hairpin turns”, or two regions of the same DNA strand sticking to itself. We can see 6
potential hairpins (with associated pictures), but all of them have a very low Tm, and our PCR
reaction will never be close to those temperatures (the lowest temperature in the PCR
reaction will be 63°C.
e.i. What is the range of temperatures for potential hairpins?
f.
Under the “Hairpin” button, click on “Self-Dimer”. This will tell us if our primers will stick to
the other primers with the same sequence. You can see there are many potential self-dimers,
but none of them are held together that strongly.
f.i. In the “Sequence” box, create a 12 nucleotide sequence (including 2 different bases)
that will completely self-dimerize.
g.
It looks like our forward primer “checks out”. Now the same must be done with the reverse
primer. Repeat the same steps as above, but with the reverse primer.
g.i. What is the reported Tm?
g.ii. What is the GC content?
g.iii. Are there are problematic hairpins?
g.iv. Are there any severe self-dimers?
39
h.
We are now ready to run our PCR once these primers are purchased and delivered!
PCR Steps
1. Label PCR tube with group name/number and “Q5 WT” (WT = wild type)
2. Add the following to the empty PCR tube for a total volume of 25µl:
- 12.5µl Q5® 2x Mastermix (contains all the “ingredients” needed for PCR in one convenient
solution)
- 1.0µl Template DNA (pGLO plasmid)
- 1.5µl wild type forward primer
- 1.5µl wild type reverse primer
- 8.5µl sterile H20
3. Thermocycler program “Q5, wild type”
Step 1. 98°C for 30 seconds
Step 2. 98°C for 15 seconds
Step 3. 55°C for 30 seconds
Step 4. 72°C for 4 minutes
Step 5. Repeat steps 2-4, 25 times
Step 6. 72°C for 10 minutes
Step 7. Hold at 4°C
a. What is being done inside of the PCR reaction at each temperature?
98°C55°C72°C4. Once the PCR reaction has taken place, the product can be frozen or analyzed via gel electrophoresis.
Gel Electrophoresis Steps (optional)
We now want to see if this PCR reaction actually produced a product. To do this, we will use gel
electrophoresis. If a dark band shows up that that is a great indication that the reaction worked well. Even a
weak band would show us the reaction worked.
1. Label the PCR tube with your group name and “Q5 WT GE” (GE= gel electrophoresis)
2. Add the following to the empty, labeled PCR tube for a total volume of 5µl:
- 4µl of the PCR product
- 1µl of loading dye.
3. Load this prepared product on the gel into the wells directed by the instructor. This can be tricky!
a. What lane is your sample in?
4. The gel should be run at 100 volts until loading dye has moved around ¾ of the way down the gel. Gel can then
be stained (follow manufacturer recommendations), de-stained, and photographed. The gel can be saved
temporarily by submerging it back into the buffer solution.
40
5. There should be visible bands present in the DNA ladder lane, one visible band in the DNA template lane and the
PCR products should show up as light bands.
a. Make an accurate sketch/picture printout of the gel below (all lanes labeled with what they are and all
bands added, wells should be at the top of the figure)
b. Are there bands present in the PCR product lanes? What does this indicate? Roughly what size are they
(compare to the DNA ladder)?
c. Based on SnapGene, the pGLO plasmid is 5,371bp do the gel results support or refute this? What is your
evidence for this conclusion?
d. If the PCR reaction was successful, then one more step in the Q5® procedure is necessary before transformation
can take place.
KLD Reaction
It is important to note that if a gene of interest was being ADDED to the plasmid, the additional steps of
digestion using specific restriction enzymes and ligation of the products would be necessary. However, the Q5® kit
contains a step to bypass this step because we are making no modifications to the gene (this same kit will also be
used when we begin making small changes to the genotype). This step is called the “KLD”, which stands for Kinase,
Ligase and DpnI. This step will phosphorylate the PCR products, ligate the ends together, and digest old pieces of
plasmid which are not new PCR products. This step is extremely easy, and is one reason the Q5® kit is unique.
41
1. Label a clean PCR tube with group name/number and “Q5 WT KLD”
2. Add the following to the empty PCR tube for a total volume of 10µl:
- 1µl PCR product
- 5µl KLD reaction buffer
- 1µl 10x KLD Enzyme mix
- 3µl Sterile H20
3. Incubate at room temperature for 20 minutes.
4. This product is now usable for transformation
Transformation of NEB 5-alpha E. coli cells
The last step of this lesson is the transformation of the included NEB 5-alpha E. coli cells. It is important to
note that E. coli cells can be made chemically competent through the addition of calcium chloride, but these cells
arrive as “highly competent, and are ready to be transformed as soon as they arrive (and are held at -70°C).
In order to perform the transformation:
1. “Thaw” the NEB 5-alpha E. coli cells by placing the tube in the ice.
2. Add 5µl of KLD reaction product to the NEB 5-alpha E. coli and flick several times to mix.
3. Put on ice for 30 minutes.
4. Heat shock in hot water bath (42°C) for 30 seconds.
5. Immediately transfer back to ice and hold there for 5 minutes.
6. Pipette 950µl of SOC outgrowth broth into cells and then label tube with group name.
7. Incubate (on orbital rocker/shaker) at 37°C for 1 hour or longer (can be incubated overnight).
8. After incubation, cells need to be transferred onto petri dishes (make sure to label both with your group
name/number and “pGLO wild type”).
- Add 10µl of culture (assuming 60mm plates, amount can be adjusted if using larger petri dishes)
to LB/Amp+ petri dish and spread using either glass spreader and turntable, or sterile cotton
swab. Make sure the petri dish is only cracked open, and the lid is promptly put back on.
- Add 10µl of culture (assuming 60mm plates, amount can be adjusted if using larger petri
dishes) to LB/Amp+/L-arabinose petri dish and spread using either glass spreader and turntable,
or sterile cotton swab. Make sure the petri dish is only cracked open, and the lid is promptly put
back on.
9. The remaining culture can be used to inoculate additional plates if available, or placed in the
refrigerator if it is thought they will be needed again.
10. Incubate petri dishes over night at 37°C.
Observations after overnight growth
Noticeable growth should be seen after overnight incubation. You will need to illuminate the cells with
long-wave ultraviolet light in order to see the GFP fluoresce. Follow appropriate safety procedures given by the
instructor when working with the ultraviolet light.
1. Observations of the LB/Amp+ petri dish:
- Is there growth?
- Is growth abundant (more than ~100 colonies)?
42
- Do the cells fluoresce?
- Was the transformation successful? How do you know?
2. Observations of the LB/Amp+/L-arabinose petri dish
- Is there growth?
- Is growth abundant (more than ~100 colonies)?
- Do the cells fluoresce?
- Was the transformation successful? How do you know?
3. If there is a difference between the plates, offer a suggestion for what is causing this difference (use the
background information!)
Conclusions
1. What are the similarities and differences between PCR and natural DNA replication?
2. Explain the steps of the transcription and translation of the GFP:
43
3. What are the bacteria using to grow on the petri dishes?
4. How does ampicillin inhibit the growth of bacteria that were not transformed? How do the bacteria that were
transformed live on the ampicillin plates?
5. What would be one examples of a signal transduction pathway that we observed in this lesson (make sure to
include the three main steps)?
44
TEACHER PAGES: KEY FOR “BACKGROUND INFORMATION”
1. In your opinion, why was the discovery and implementation of FPs in scientific research so important? They
allow researchers to view intracellular activity in real-time, while the cell is still alive. This will allow researchers to
better understand cellular interactions.
2. Why do you think multiple different colors are seen in the pictures/videos? Each different color represents a
different molecule that was fluorescently tagged, allowing interactions to better be seen. Each color is a different
type of FP.
3. Based on the above diagram of the pGLO plasmid, how many base pairs does it contain? 5,371bp
4. The bacteria that contain this plasmid should be grown on petri dishes that contain the antibiotic Ampicillin.
Would the transformed bacteria grow on petri dishes without ampicillin? Yes, the ampicillin does not allow the nontransformed bacteria to grow, but transformed bacteria can grow on both Amp+ and Amp- petri dishes.
5. Why do the petri dishes contain the sugar L-arabinose? The bacterial plasmid contains the operator which will
allow the GFP to be produced when in the presence of L-arabinose.
6. Hypothesize what would happen if NO L-arabinose was on the plates? The bacteria will still grow, but no GFP will
be produced (this hypothesis will be tested in the activity).
Instructions for SnapGene
5. Find the gene entitled “GFP” on the plasmid and double-click
a. How many base pairs is the gfp gene? 720
b. What is the specific product of the gfp gene? Aequoria victoria green fluorescent protein
8. Right now, restriction enzymes that have only one restriction site on the plasmid are shown. Find the enzyme
“EcoRI” on the list and double-click.
a. At what specific sequence will this restriction enzyme cut?
G^AATTC
CTTAA^G
b. What temperature does this enzyme work best at? 37C
11. Find the plasmid feature “MCS” and put the mouse cursor over it (do not double-click)
a. What does “MCS” stand for? Multiple cloning site
b. In the context of restriction sites, what makes the “MCS” important? There are a large number of
restriction sites, including EcoRI.
16. Right above (sequentially) the “MCS” is the gfp. The gfp is a large gene, and not all of it can be displayed at one
time on your screen. There is a key difference in the information being displayed as part of the gfp versus the
“MCS”. Directly under the DNA sequence of the gfp we can find what amino acid (and the corresponding number
45
of the amino acid) the codon above it codes for. By scrolling over the individual amino acids, their positional
number will be displayed.
a. Why does the “MCS” not have any amino acids listed? It does not code for a protein, it is only a feature
of the plasmid.
b. What is the 222 amino acid in the GFP? Glu
17. Click this amino acid, hold, and drag the cursor through the 230th amino acid in the sequence (“Thr”). While
still holding down the button, make note of the three pieces of information being displayed- “2008..2034 = 27 bp,
The temperature (Tm) that this specific sequence will spilt and become single-stranded DNA is 59°C”.
is this? What is the Tm of this selected sequence? 1537  1569, 33bp, Tm= 62-63°C.
Introduction to PCR
Go to the following link and watch the animation to answer the following questions:
http://www.youtube.com/watch?v=2KoLnIwoZKU
1. How many different temperatures are used in the process of PCR? 3
2. What does the term “anneal” mean? To have one segment of single stranded DNA bond to its complement
3. What happens at each of these temperatures? ~55°C = annealing of primers, ~72°C = extension of DNA, ~95°C =
denaturing of DNA.
4. How do you think the Tm feature in SnapGene relates to the annealing temperature? The annealing temperate is
actually dictated by the actual primer user.
5. Two different primers must be used in PCR (forward primer and reverse primer). What could the problem be if
the Tm of the primers is drastically different? One primer might be able to anneal, and the other would not, giving
you an incomplete PCR product.
6. Why would a PCR run of five cycles not be worthwhile? Why? Not enough targeted DNA will be produced
At the start of the PCR run, would you have to have a greater amount of primers or target DNA? Primers,
because they are used up making the copies of the target DNA
Introduction to Gel Electrophoresis
Go to: http://www.youtube.com/watch?v=6QYgN-toA1A and watch through 3:50.
1. Why do you load the DNA into the negatively charged end of the chamber? DNA is negatively charged and will
be repelled to the other side of the gel
2. What do the individual bands represent? Different lengths of DNA fragments
3. Which DNA moves the furthest through the gel? The smallest
4. What is a difference between gels of different agarose concentrations? The higher the concentration of agarose,
the longer it will take for DNA to move through it.
5. What would two different bands in different wells that moved the same distance through the gel represent? DNA
fragments of the same size.
Go to: http://www.youtube.com/watch?v=QEG8dz7cbnY and watch entire video.
46
6. What is the purpose of the loading buffer/dye? To see where the sample is actually going, and to weigh it down
so it sinks to the bottom of the well.
7. What is the purpose of the DNA molecular weight ladder? To compare your DNA of interest with DNA standards.
8. What voltage is being used in this procedure? 130 v
9. What is a simple way to make sure that electricity is moving through the chamber? Look for the production of
bubbles.
Go to: http://www.youtube.com/watch?v=tTj8p05jAFM and start video at 1:00.
10. What are three common “problems” when loading your sample in the gel? 1. Bubbles in the tip. 2. Puncturing
the gel.
Introduction to Transformation
Go to http://www.teachersdomain.org/asset/biot11_vid_transbact/ and watch through 1:10.
1. What is the overall goal of transformation? To add foreign DNA (plasmid) to a bacterial cell.
2. What is the charge of both the bacterial cell and plasmid? Negative
3. What is the purpose of the addition of calcium chloride? It neutralizes the charge of the bacterial cells plasma
membrane.
4. At what temperature is the plasmid mixed with the cells? 4°C
5. What temperature is used to “heat shock” the cells? 42°C
6. What is the purpose of the heat shock? The creation of adhesion zones which allows the plasmid to enter the cell.
7. What is the purpose of putting the bacteria back at 37°C? To allow the bacteria to recover.
TEACHER PAGES: KEY FOR “Laboratory Methodologies and Questions”
10. Click “Add primer to template” and the window will now close and you see your primer added to the
entire plasmid. You can move your cursor over the primer to see information about it.
a. How many base pairs is the forward primer? 26
b. What is Tm of the forward primer? 54°C
c. What is the actual DNA sequence of the forward primer? 5’ CAC TAC TTT CTC TTA TGG TGT TCA AT 3’
15. Click “Add primer to template” and the window will now close and you see your primer added to the
entire plasmid. You can move your cursor over the primer to see information about it.
a. How many base pairs is the forward primer? 19
b. What is Tm of the forward primer? 55°C
c. What is the actual DNA sequence of the reverse primer? 5’ ACA AGT GTT GGC CAT GGA A 3’
17. These primers now need to be checked for potential problems. To do this, we will go to the same
website we use to order the custom primers: http://www.idtdna.com/site.
d. It will give you some basic information about this sequence, including the Tm (notice how it is
slightly different than what we came up with in SnapGene- that is to be expected).
i. What did this company report the Tm to be for the forward primer? 53.1°C
ii. What is the GC content (how much of the primer is made of Guanine and Cytosine)? 34.6%
47
e. Under the “Analyze” button, click on “Hairpin”. This will tell us if our primer will create “hairpin
turns”, or two regions of the same DNA strand sticking to itself. We can see 6 potential hairpins (with
associated pictures), but all of them have a very low Tm, and our PCR reaction will never be close to
those temperatures (the lowest temperature in the PCR reaction will be 55°C.
i. What is the range of temperatures for potential hairpins? 2.1°  22.7°C
f. Under the “Hairpin” button, click on “Self-Dimer”. This will tell us if our primers will stick to the
other primers with the same sequence. You can see there are many potential self-dimers, but none of
them are held together that strongly.
i. In the “Sequence” box, create a 12 nucleotide sequence (including 2 different bases) that will
completely self-dimerize. There are many possible answers to this question, but a possibility is
AAA AAA TTT TTT.
g. It looks like our forward primer “checks out”. Now the same must be done with the reverse primer.
Repeat the same steps as above, but with the reverse primer.
i. What is the reported Tm? 54.9°C
ii. What is the GC content? 47.4%
iii. Are there are problematic hairpins? 2 (28.1°  34.0°C)
iv. Are there any severe self-dimers? No
Gel Electrophoresis Steps (optional)
a. There should be visible bands present in the DNA ladder lane, one visible band in the DNA template lane (~5,000
kd), and the PCR products should show up as light bands.
b. Make an accurate sketch of the gel below (all lanes labeled with what they are and all bands added)
These pictures will need to be included on the student worksheet if gel electrophoresis is not completed in class.
48
Figure 1. NEB 1kb DNA ladder (image from
Figure 2. Experimental gel. Lane 1 = NEB 1kb
DNA ladder. Lane 2 = Q5® PCR product.
c. Are there bands present in the PCR product lanes? What does this indicate? Roughly what size are they (compare
to the DNA ladder)? Yes, it indicates that the PCR reaction was successful. The size of the product between 5kb and
6kb.
d. Based on SnapGene, the pGLO plasmid is 5,371bp; do the gel results support or refute this? What is your
evidence for this conclusion? The gel results support this information. The evidence is the DNA ladder which is
made up of DNA molecules of specific, known sizes. The DNA ladder band that the plasmid is most closely in line
with allows us to estimate the plasmids size, which is between 5kb and 6kb.
Observations after overnight growth
49
1. Observations of the LB/Amp+ petri dish:
- Do the cells fluoresce?
They should not. They need L-arabinose to produce the GFP.
- Was the transformation successful? How do you know?
If there is growth on this plate, the transformation was most likely successful.
2. Observations of the LB/Amp+/L-arabinose petri dish
- Do the cells fluoresce?
They should, brightly.
- Was the transformation successful? How do you know?
If there is growth on this plate, the transformation was most likely successful.
3. If there is a difference between the plates, offer a suggestion for what is causing this difference (use the
background information!)
The bacteria on the LB/Amp+ petri dish do not fluoresce because the lack of L-arabinose. The inducible
operon needs this sugar to turn on. Once turned on, this operon will produce the GFP.
Conclusions
1. What are some similarities and differences between PCR and natural DNA replication?
Similarities- In both cases DNA polymerase, attaches free nucleotides to the complementary strand.
Differences- There is no (minimal) temperature variation in DNA replication inside of the organism.
2. Explain the steps of the transcription and translation of the GFP:
When L-arabinose is present, the GFP will be produced. This is completed by two steps- transcription and
translation.
Transcription- RNA polymerase attaches to the promoter region of the gene and begins to write
mRNA that encodes the GFP. Once the RNA polymerase reaches the terminator region, it falls off
and transcription of the mRNA halts.
Translation- Simultaneously (as it is being written), the strand of mRNA will travel through a
ribosome which constructs the polypeptide by creating peptide bonds between the proper amino
acids.
50
3. What are the bacteria using to grow on the petri dishes?
Nutrients found in the agar
4. How does ampicillin inhibit the growth of bacteria that were not transformed? How do the bacteria that were
transformed live on the ampicillin plates?
Ampicillin works by inhibiting the formation of bacterial cell walls. The bacteria that were transformed produce
β-lactamase, which breaks down ampicillin.
5. What would be one example of signal transduction pathways that we observed in this lesson (make sure to
explain the three main steps in relation to pGLO)?
Example 1- Arabinose with the arabinose operon. Step 1- Reception (L-arabinose is detected). Step 2Transduction (arabinose operon turns on). Step 3- Response (GFP is produced. This operon would normally
produce the enzymes to break down arabinose, but they have been removed in the pGLO plasmid).
Class discussion topic:
Ampicillin breakdown by transformed bacteria is not an example of a signal transduction pathway. This plasmid
has been created to not have a regulatory site in front of the “bla” gene. Because of this lack of regulation, this
gene is going to be “on”, whether or not ampicillin is present.
51
LESSON TWO – “THE MUTATION OF UNDERSTANDING”
KEY QUESTION(S): How can we use site-specific mutagenesis techniques to change the phenotype of an organism?
Can we successfully predict the outcomes of a possible mutation? How does a mutation affect an individual
organism and how can this change a population?
KEY SCIENCE CONCEPTS: Mutagenesis, codons, transcription, translation, biotechnology, PCR, GFP, gene/plasmid
cloning, transformation, DNA, software to inspect and modify aspects of genetic code.
OVERALL TIME ESTIMATE: 3 days
LEARNING STYLES: Auditory, kinesthetic, visual.
VOCABULARY:
Codon- A set of three nucleotides which code for one amino acid.
Error-prone PCR- Adjusted PCR methodology to ensure that errors are made by DNA polymerase during the
amplification process.
Point Mutation- A small mutation at a specific location on the DNA.
Random Mutation- Mutations in the DNA that are not caused by a specific influencing factor giving a specific
genetic result
LESSON SUMMARY: In this lesson, students will focus on using site-directed mutagenesis to study how a single,
double, and triple base pair substitution (mutation) can change the phenotype of an organism. This concept will
then be tied to natural selection and the change of a population over time.
STUDENT LEARNING OBJECTIVES:
Students should be able to:
1. Explain how the scientific theory of evolution is supported by comparative anatomy and molecular biology.
2. Explain how mutations in the DNA sequence may or may not result in phenotypic change.
3. Describe how basic DNA technology is used to construct mutated DNA molecules.
4. Use theories and models to make scientific claims and/or predictions about the effects of variation within
populations on survival and fitness.
5. Convert a data set from a table of numbers that reflect a change in the genetic makeup of a population over time
and to apply mathematical methods and conceptual understandings to investigate the cause(s) and effect(s) of this
change.
6. Design a plan to answer scientific questions regarding how organisms have changed over time using information
from morphology, biochemistry and geology.
7. Justify the claim that humans can manipulate heritable information.
8. Predict how a change in a specific DNA or RNA sequence can result in changes in gene expression.
9. Describe the connection between the regulation of gene expression and observed differences between
individuals in a population.
10. Predict how a change in genotype, when expressed as a phenotype, provides a variation that can be subject to
natural selection.
11. Create a visual representation to illustrate how changes in a DNA nucleotide sequence can result in a change in
the polypeptide produced.
12. Explain the connection between genetic variations in organisms and phenotypic variations in populations.
13. Use models to predict and justify that change in the subcomponents of a biological polymer affect the
functionality of the molecule.
52
14. Analyze data to identify how molecular interactions affect structure and function.
15. Use representations and models to analyze situations or solve problems qualitatively and quantitatively.
16. Apply mathematical routines to quantities that describe natural phenomena.
17. Estimate numerically quantities that describe natural phenomena.
18. Analyze data to identify patterns or relationships.
19. Justify claims with evidence.
20. Construct explanations of phenomena based on evidence produced through scientific practices.
STANDARDS
Florida Next Generation Sunshine State Standards (NGSSS):
SC.912.L.15.1
SC.912.L.15.15
SC.912.L.16.12
SC.912.N.1.1
SC.912.N.1.4
SC.912.N.1.6
SC.912.L.16.4
SC.912.N.1.3
SC.912.N.1.7
Advanced Placement (AP) Biology Learning Outcomes(LO)/Science Practices (SO):
LO 1.1
LO 1.2
LO 1.3
LO 1.4
LO 1.11
LO 3.1
LO 3.5
LO 3.6
LO 3.19
LO 3.24
LO 3.25
LO 3.26
LO 4.3
LO 4.17
LO 4.26
SP 1.3
SP 1.4
SP 2.1
SP 2.2
SP 2.3
SP 3.1
SP 3.2
SP 4.3
SP 5.1
SP 6.1
SP 6.2
SP 6.4
SP 6.5
SP 7.2
Advanced International Certificate of Education (AICE) Biology Learning Outcomes:
F. (c)
F. (f)
O. (g)
O. (i)
O. (j)
P. (a)
R. (k)
MATERIALS:

ESSENTIAL: All materials used in “Lesson 1” will be used again with the exception of the “Lesson 1”
forward primer. In its place, you will need to provide the primer listed below. There should still be enough
of each solution from “Lesson 1” that no more should need to be ordered.
- Lesson 2 forward primer
BACKGROUND INFORMATION:
Although the methods used in this lesson are almost identical to those used in “Lesson 1,” the expected
outcomes are much different which opens the door for discussion about the factors at work. Students should
already be familiar with what a point mutation is, but very few know what affect they can have on an organism.
There is not usually an accurate way to predict what a random mutation will be (error-prone PCR was first
attempted in the developmental stages of this curriculum; but by the nature of the process, there is no way to
predict the outcome). As mentioned in “Lesson 1,” one of the most important regions of the GFP is the amino acid
sequence Ser65-Tyr66-Gly67. In this lesson, students will specifically target Tyr66 for semi-random mutations
53
(“semi-random” will be defined as having the possibility of mutating into several predefined variations). These
predefined variations result in phenotypic differences that are easily studied through observation.
The wild type DNA codon for the GFP features the nucleotide sequence “TAT” which codes for the amino
acid tyrosine at position 66. It is documented that if this tyrosine is changed to a histidine or tryptophan the new
product will emit a wavelength that is in the blue visible light spectrum (specifically histidine should be blue and
1
tryptophan should be cyan). This simple substitution makes this codon a great target for mutations. Additionally,
the mutation of this codon to “TAG” inserts a stop codon that prevents the GFP to be produced at all, even when
grown in the proper conditions. It can be suggested that other mutations at this position will most likely produce a
dim version of the GFP.
Because of the aforementioned factors, primer design that takes advantage of all of these opportunities is
essential. It is possible to purchase separate primers that meet all the necessary criteria to get all the possible
phenotypic outcomes, but this is logistically and financially unrealistic. A simple solution is provided through the
company Integrated DNA Technologies (IDT. Coralville, Iowa). IDT offers many services related to custom
oligonucleotide (DNA primers) production including the addition of “randomized” nucleotides added into the
primer at specific positions when it is manufactured. When ordering the custom oligonucleotides from IDT, the
following letters can be substituted into the sequence (in the place of the normal Adenine, Thymine, Cytosine, or
Guanine):
R= A,G
Y= C,T
M= A,C
K= G,T
S= C,G
W= A,T
H= A,C,T
B= C,G,T
V= A,C,G
D= A,G,T
N= A,C,G,T
(abbreviations and information in the above list from http://www.idtdna.com/order/OrderEntry.aspx?type=dna)
When the primer is engineered, multiple different primers are actually being produced. Because we are targeting
variation at codon 66 in the gfp, the primer that we will need for this lesson is:
5’ CAC TAC TTT CTC TYR KGG TGT TCA ATG 3’
The actual mixture of codons for amino acid 66 in these primers that will arrive from IDT as the “Lesson 2 Forward Primer”
is:
5’ TAT = Tyrosine (wild type codon of the gfp)
1
5’ CAT = Histidine (blue fluorescent protein)
1
5’ TGG = Tryptophan (cyan)
5’ TAG = Stop codon (no fluorescence)
5’ TGT = Cysteine
5’ CGT = Arginine
5’ CAG = Glycine
5’ CGG = Arginine
It is essential to note that the concentrations of each primer composing this mixture will most likely not be
equal, but this concept is explored in the laboratory activity through statistical analysis. When the “Lesson 2
Forward Primer” is used in the Q5® methodology (PCR, KLD, and transformation), multiple phenotypes are
produced on the petri dishes. It is also important to note that VERY close inspection of the petri dishes is required
to see differences in the colonies. Often, the population will look homogenous at first glance. It was noticed that
54
petri dishes that were incubated for 24-36 hours at 37° and then left at room temperature for an additional day
demonstrated the greatest apparent variation. It can be suggested that room temperature incubation is required
2
for the GFP protein to reach its final conformation and that a small mutation could impact the rate at which this
maturity occurs.
Most of these phenotypic differences are caused by actual point mutations in the bacterial plasmid (some
variation in brightness will be caused by differential gene expression in individual colonies). It is now possible to
investigate one of the causes of population change- random mutation. This lesson brings the concept of random
mutation back to the original jellyfishes that contain the wild type GFP and investigates how mutations can impact
one specific individual and then an entire species.
ADVANCE PREPARATION:
Very little advanced preparation is required for this lesson if “Lesson 1” was recently completed. If completing
“Lesson 2” much later than “Lesson 1” (such as a month), then new petri dishes should be prepared and fresh
solutions should be made unless the manufactured item directly states that it can successfully be stored for over a
month. If not completing “Lesson 1,” please refer to “Lesson 1” for laboratory items and solutions needed.
Table 1. Items needed from IDT. All items can be stored for several months at -20°C.
Item
Lesson 2 Forward
Primer
Lesson 2 Reverse
Primer
Integrated DNA Technologies #
Quantity
Notes
5’ CAC TAC TTT CTC TYR KGG TGT TCA
Custom Oligonucleotide Synthesis
Custom Oligonucleotide Synthesis
1 ATC 3’*
This is the same reverse primer
used in “Lesson 1,”you should not
1 need to order additional.
*The “YRK” nucleotides are specific possibilities when ordering the oligonucleotides from Integrated DNA Technologies.
When placing the order, the actual letters “YRK” are entered as the code in order to represent the following possible
primers:
“Y” = Thymine OR Cytosine
“R” = Adenine OR Guanine
“K” = Thymine OR Guanine
Once the above items have been received, the following needs to be done a day (or two) in advance to the commencement
of the lab:
1. Forward primer preparation. Primer needs to be diluted to the correct concentration as follows:
a. Lesson 2 Forward Primer- Add 219µl of sterile H2O to primers to create stock solution (100uM).
Create 10uM aliquots from this stock solution (to be used by individual groups, or create just one
for the class and pass around) by adding 10µl forward primer stock solution to 90µlµl sterile H2O.
This forward primer is a mixture of different primers (see above list) and ensures the random
nature of this lesson.
b. Switch the name of “Lesson 1” reverse primer to “Lesson 2” reverse primer (it is the same
primer). There should be plenty of this primer remaining after “Lesson 1” completion.
PROCEDURE AND DISCUSSION QUESTIONS WITH TIME ESTIMATES:
55
Students should already have a background in genetic mutations (point mutations versus chromosomal
mutations) and a general understanding of transcription and translation when this lesson is implemented. This
lesson should be introduced as an experimental exercise investigating semi-random mutations (only the
aforementioned mutation should give variation in the organism’s phenotype. Other mutations are always possible,
but not expected). Students will need to create primers in SnapGene that allow for variation in amino acid 66
(tyrosine) of the gfp. Because students are now much more familiar with the software, less time should be allotted
for this activity.
Background Activities:
1. Primer Creation, 30 minutes
The following items are needed by each student:
- Computers with SnapGene, the pGLO file, and Internet connection.
- Distribute the “Background Information and Primer Creation” student worksheet. Students
should answer all corresponding questions and complete all associated diagrams.
Laboratory Activities:
Distribute the “Laboratory Methodologies and Questions” student handout
1. PCR Reaction, 20 minutes (additional 2 hours to run the reaction, but students do not need to be present)
The following item(s) should be found in the common area for the PCR reaction:
- Thermo Cycler
Each lab station should have the following for the PCR reaction:
- 1 empty PCR tube
- Set of micropipettes with appropriate tips
- 1 fine-point permanent maker for labeling
- Q5® 2x Mastermix aliquot
- Template DNA aliquot (pGLO)
- Microcentrifuge tube of Sterile H20
- Lesson 2 Forward primer aliquot (if not made available as a common item for the class)
- Lesson 2 Reverse primer aliquot (if not made available as a common item for the class)
- Waste bins/bags for each station
- Gloves
- Goggles
Students will add the following to the empty, labeled PCR tube for a total volume of 25µl:
- 12.5µl Q5® 2x Mastermix
- 1.0µl Template DNA
- 1.5µl forward primer
- 1.5µl reverse primer
- 8.5µl sterile H20
Thermocycler program “Q5, semi random”
Step 1. 98°C for 30 seconds
Step 2. 98°C for 15 seconds
Step 3. 57°C for 30 seconds
56
Step 4. 72°C for 4 minutes
Step 5. Repeat steps 2-4, 25 times
Step 6. 72°C for 10 minutes
Step 7. Hold at 4°C
2. KLD Reaction (20 minutes)
The following item(s) should be found in the common area for the KLD reaction:
- 10x KLD Enzyme Mix (kept in ice- see notes in “Lesson 1” about proper storage of this enzyme)
Each lab station should have the following for the KLD reaction:
- 1 empty PCR tube
- Set of micropipettes with appropriate tips
- 1 fine-point permanent maker for labeling
- The groups PCR product
- 2x KLD reaction buffer aliquot
- Sterile H2O
- Waste bins/bags for each station
- Gloves
- Goggles
Students will:
1. Label a clean PCR tube with group name/number and “Q5 WT KLD”
2. Add the following to the empty PCR tube for a total volume of 10µl:
- 1µl PCR product
- 5µl KLD reaction buffer
- 1µl 10x KLD Enzyme mix
- 3µl Sterile H20
3. Incubate at room temperature for 20 minutes.
4. This product is now usable for transformation
3. Transformation of NEB 5-alpha E. coli cells (55 minutes, split over two days)
The following item(s) should be found in the common area for the transformation reaction:
- NEB 5-alpha E. coli cells (these must be kept on dry ice up until the transformation begins. One tube per
group completing the lab should be made available)
- Hot water bath (42°C)
- Incubator (37°C)
- Orbital rocker/shake table (highly recommended and should ideally be located inside the incubator)
- Glass bacterial spreader with rotating petri dish stand (or sterile cotton swabs if this is not available. This
item could also be found at each lab station).
- SOC outgrowth medium (included with the Q5® kit
Each lab station should have the following for the transformation reaction:
- KLD reaction product
- Set of micropipettes with appropriate tips
- Permanent fine-tip markers for labeling tubes (1 per group)
57
- Container/beaker with ice
- Waste bins/bags for each station
- Gloves
- Goggles
- 1 LB/Amp+ petri dish
- 1 LB/Amp+/L-arabinose petri dish
Students will:
1. “Thaw” the NEB 5-alpha E. coli cells on ice for 3 minutes.
2. Add 5µl of KLD reaction product to the NEB 5-alpha E. coli and flick several times to mix.
3. Put on ice for 30 minutes.
4. Heat shock in hot water bath (42°C) for 30 seconds.
5. Immediately transfer back to ice and hold there for 5 minutes.
6. Pipette 950µl of SOC outgrowth medium into cells.
7. Incubate (on orbital rocker/shaker) at 37°C for 1 hour or longer (if in a “block” class, students can wait
an hour and immediately skip to “step 8”. If classes are not in a “block” then “step 7” time can be changed
to overnight, but would need to be incubated at room temperature to minimize growth).
8. After incubation, cells need to be transferred onto petri dish.
- Add 10µl of culture (assuming 60mm plates, amount can be adjusted if using larger petri dishes)
to LB/Amp+/L-arabinose petri dish and spread using either glass spreader and turntable, or sterile
cotton swab. Make sure the petri dish is only cracked open, and the lid is promptly put back on.
9. The remaining culture can be used to inoculate additional plates if available, or placed in the
refrigerator if it is thought it will be needed again.
10. Incubate petri dishes over night at 37°C.
4. Observations after overnight* growth (40 minutes)
Students should be looking for variation in the colonies. It may be helpful to allow students to add dots to the
plastic petri dish in order to help keep track of what they have already seen. This step will take longer in “Lesson 2”
than in “Lesson 1” because of the associated analysis of the results. Plates can be kept (sealed) in the refrigerator
for further analysis if need be.
Each lab station should have the following for observation:
- Longwave UV lamp/transilluminator (if the lab has only one large transilluminator, multiple groups can
use it at one time)
- Gloves
- Goggles
*As stated in the background information, ideally incubation should be for 24-36 hours at 37° and then left at room
temperature for an additional day or more
ASSESSMENT SUGGESTIONS:
By completing the included questions, students:
1. Explained how the scientific theory of evolution is supported by comparative anatomy and molecular biology by
comparing molecular evidence (different/mutated primers) to phenotypic results (variation in the population).
2. Explained how mutations in the DNA sequence may or may not result in phenotypic change by modifying a
specific codon in the gfp and then observing the possible differences.
58
3. Used DNA technology to construct mutated DNA molecules.
4. Used theories and models to make scientific claims and/or predictions about the effects of variation within
populations on survival and fitness by examining the connection between GFP brightness and an individual’s fitness
in the environment.
5. Converted a data set from a table of numbers that reflect a change in the genetic makeup of a population over
time and applied mathematical methods and conceptual understandings to investigate the cause(s) and effect(s) of
this change by creating a scatter plot graph depicting jellyfish population change over time and then discussing
possible causes for this change.
6. Designed a plan to answer scientific questions regarding how organisms have changed over time using
information from biochemistry by suggesting that scientists look at the gfp in different ocean organisms to see how
the organisms might be related based on variation (or lack thereof).
7. Justified the claim that humans can manipulate heritable information by actually manipulating plasmid DNA.
8. Predicted how a change in a specific DNA sequence resulted in changes in gene expression.
9. Described the connection between the regulation of gene expression and observed differences between
individuals in a population by explaining that the addition of a stop codon caused some colonies of bacteria not to
fluoresce.
10. Predicted how a change in genotype, when expressed as a phenotype, provides a variation that can be subject
to natural selection by examining the connection between GFP brightness and an individual’s fitness in the
environment.
11. Created a visual representation to illustrate how changes in a DNA nucleotide sequence can result in a change
in the polypeptide produced by manipulating primer design in SnapGene.
12. Explained the connection between genetic variations in organisms and phenotypic variations in populations.
13. Used models to predict and justify that change in the subcomponents of a biological polymer affect the
functionality of the molecule by explaining how different variants of the GFP are caused by differing DNA
sequences.
14. Analyzed data to identify how molecular interactions affect structure and function of the gfp/GFP.
15. Used representations and models to analyze situations or solve problems qualitatively and quantitatively by
determining why the predicted phenotypic ratios of phenotypes were not observed.
16. Applied mathematical routines to quantities that describe natural phenomena by completing a Chi-Squared
analysis of their collected data.
17. Estimated numerically quantities that describe natural phenomena.
18. Analyzed data to identify patterns or relationships.
19. Justified claims with evidence.
20. Constructed explanations of phenomena based on evidence produced through scientific practices.
EXTENSIONS:
- Although gel electrophoresis is not included in this lesson, it can be completed to analyze the PCR
product.
- Further analysis of the use of the GFP in jellyfish could be completed.
- Specific primers could be ordered to create color “standards.” A popular example would the forward
primer specifically for the blue fluorescent protein (5’CATGGTGTTCAATGCTTTTCCCGTTAT). The addition of
this primer would require separate questions and lightly different PCR methodologies.
RESOURCES/REFERENCES:
1.Heim, R., Prasher, D. C., and Tsien, R. Y. (1994). Wavelength mutations and posttranslational autoxidation of green
fluorescent protein. Proc Natl Acad Sci, USA. Dec 20;91(26):12501-4.
2. Cody, C. W., Prasher, D. C., Westler, W. M., Prendergast, F. G. and Ward, W. W., Biochemistry, 1993, 32, 1212–
1218.
59
STUDENT PAGES: Background Information and Primer Creation
There is not usually an accurate way to predict what a random mutation will be. As mentioned in “Lesson
1,” one of the most important regions of the GFP is the amino acid sequence Ser65-Tyr66-Gly67. In this lesson, you
will specifically target Tyr66 for semi-random mutations (“semi-random” will be defined as having the possibility of
mutating into several predefined variations). These predefined variations result in phenotypic differences that are
easily studied through observation.
The wild type DNA codon for the GFP features the nucleotide sequence “TAT” which codes for the amino
acid tyrosine at position 66 (Tyr66). It is documented that if this tyrosine is changed to a histidine or tryptophan the
new product will emit a wavelength that is in the blue visible light spectrum (specifically histidine should be blue
1
and tryptophan should be cyan).
Because of the aforementioned factors, primer design that takes advantage of all of these opportunities is
essential. It is possible to purchase separate primers that meet all the necessary criteria to get all the possible
phenotypic outcomes, but this is logistically and financially unrealistic. A simple solution is provided through the
company Integrated DNA Technologies (IDT. Coralville, Iowa). IDT offers many services related to custom
oligonucleotide (DNA primers) production including the addition of “randomized” nucleotides added into the
primer at specific positions when it is manufactured. When ordering the custom oligonucleotides from IDT, the
following letters can be substituted into the sequence (in the place of the normal Adenine, Thymine, Cytosine, or
Guanine):
R= A,G
Y= C,T
M= A,C
K= G,T
S= C,G
W= A,T
H= A,C,T
B= C,G,T
V= A,C,G
D= A,G,T
N= A,C,G,T
(abbreviations and information in the above list from http://www.idtdna.com/order/OrderEntry.aspx?type=dna)
When the primer is engineered, multiple different primers are actually being produced. Because we are targeting
variation at codon 66 in the gfp, the forward primer that we will need for this lesson is:
5’ CAC TAC TTT CTC TYR KGG TGT TCA ATG 3’
In order to successfully create a primer that will introduce semi-random mutations into the gfp, we must
complete many of the same steps of primer creation that were conducted in “Lesson 1.” Refer back to the software
methodology in “Lesson 1” if you have trouble remembering how to use any features in SnapGene. Tables 1 and 2
will be helpful in answering some of the questions in this lesson.
60
Table 1. DNA codon chart. Make note that this table features DNA and not mRNA codons (from
http://www.chemguide.co.uk/organicprops/aminoacids/dna6.html)
Amino Acid
Alanine
Arginine
Asparagine
Aspartic acid
Cysteine
Glutamic acid
Glutamine
Glycine
Histidine
Isoleucine
Leucine
Lysine
Methionine
Phenylalanine
Proline
Serine
61
Three Letter
Abbreviation
Ala
Arg
Asn
Asp
Cys
Glu
Gln
Gly
His
Ile
Leu
Lys
Met
Phe
Pro
Ser
Single Letter
Abbreviation
A
R
N
D
C
E
Q
G
H
I
L
K
M
F
P
S
Threonine
Tryptophan
Tyrosine
Valine
Thr
Trp
Tyr
Val
T
W
Y
V
Table 2. Amino acids and their abbreviations.
References
1.Heim, R., Prasher, D. C., and Tsien, R. Y. (1994). Wavelength mutations and posttranslational autoxidation of green
fluorescent protein. Proc Natl Acad Sci, USA. Dec 20;91(26):12501-4.
Primer Creation
th
1. Using SnapGene, scroll down to the gfp and find the 66 amino acid, tyrosine. If using the same file from “Lesson
1,” the wild type forward primer should start (and include) this same amino acid.
2. Create a new forward primer (keep the old one in the file) by highlighting an appropriate segment of DNA
nucleotides 1527  1553) and following the same steps used in “Lesson 1” to name and add it to the template
(name it “Random mutant forward primer”).
3. Once the primer has been created, double-click it to open it.
a. Write the sequence of the forward primer:
b. What is the Tm of this primer?
4. A new dialog box will open showing this primer. Directly under the name (“Primer:”) you will find the primer
sequence listed from 5’  3’. You now need to add your planned mutation into the primer sequence. The planned
mutation included the substitution of nucleotides 1540  1542. Find these nucleotides in the primer sequence
(“TAT”) and change them to “YRK.”
5. Click “Okay” to return to the main window and ensure the primer has been modified by the addition of “YRK.”
a. What specifically happened to the Tm, and why do you think that this happened?
b. Based on the above chart from Integrated DNA technologies, what possible codons could this sequence
create (include the amino acids that they will be translated into)?
c. The mutations Y66H and Y66W can cause a color change of the GFP. These mutations can cause the gfp
to produce a protein that produces a very dim blue fluorescence. Based on the above possible codons in
the forward primer, what are the probabilities that this will occur?
62
d. What is the possibility that a stop codon was introduced into the plasmid? What affect will it have on
the production of the GFP?
e. What is the chance that the wild type codon will be incorporated into the plasmid?
f. Create a hypothesis for what effect the incorporation of the other possible codons could have on the
GFP?
g. Create an additional hypothesis that summarizes what you believe will happen when we use these to
ultimately transform bacteria (after PCR and KLD):
6. Create a reverse primer that corresponds to your new forward primer and name it “Random mutant reverse
primer”
a. Write the sequence of the reverse primer:
b. What is the Tm of the reverse primer?
7. Go back to the “OligoAnalyzer” tool at http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
a. Complete all of the same diagnostics on the forward and reverse primers that were completed in
“Lesson 1”. Additionally, why do you think that there is a range of Tms given?
63
STUDENT HANDOUT: Laboratory Methodologies and Questions
PCR Steps
1.Label PCR tube with group name/number and “Q5 RM” (RM = Random Mutant)
2.Add the following to the empty PCR tube for a total volume of 25µl:
- 12.5µl Q5® 2x Mastermix (contains all the “ingredients” needed for PCR in one convenient
solution)
- 1.0µl Template DNA (pGLO plasmid)
- 1.5µl Lesson 2 forward primer
- 1.5µl Lesson 2 reverse primer
- 8.5µl sterile H20
3. Thermocycler program “Q5, semi random”
Step 1. 98°C for 30 seconds
Step 2. 98°C for 15 seconds
Step 3. 57°C for 30 seconds
Step 4. 72°C for 4 minutes
Step 5. Repeat steps 2-4, 25 times
Step 6. 72°C for 10 minutes
Step 7. Hold at 4°C
4. Once the PCR reaction has taken place, the product can be frozen or enter directly into the KLD reaction.
KLD Reaction
1. Label a clean PCR tube with group name/number and “Q5 RM KLD”
2. Add the following to the empty PCR tube for a total volume of 10µl:
- 1µl PCR product
- 5µl KLD reaction buffer
- 1µl 10x KLD Enzyme mix
- 3µl Sterile H20
3. Incubate at room temperature for 20 minutes.
4. This product is now usable for transformation
Transformation of NEB 5-alpha E. coli cells
1. “Thaw” the NEB 5-alpha E. coli cells by placing the tube in the ice.
2. Add 5µl of KLD reaction product to the NEB 5-alpha E. coli and flick several times to mix.
3. Put on ice for 30 minutes.
4. Heat shock in hot water bath (42°C) for 30 seconds.
5. Immediately transfer back to ice and hold there for 5 minutes.
6. Pipette 950µl of SOC outgrowth broth into cells and then label tube with your group name.
7. Incubate (on orbital rocker/shaker) at 37°C for 1 hour or longer (can be incubated overnight at room
temperature).
8. After incubation, cells need to be transferred onto petri dish
- Add 10µl of culture (assuming 60mm plates, amount can be adjusted if using larger petri dishes) to LB/Amp+/Larabinose petri dish and spread using either glass spreader and turntable, or sterile cotton swab. Make sure the
petri dish is only cracked open, and the lid is promptly put back on.
9. The remaining culture can be used to inoculate additional plates if available, or placed in the refrigerator if it is
thought they will be needed again.
10. Incubate petri dishes over night at 37°C.
64
Observations after overnight growth
Noticeable growth should be seen after overnight incubation (differences in phenotypes might not be noticeable
until 24 hours of 37°C incubation followed by 1-2 days of room temperature growth/maturation) . You will need to
illuminate the cells with long-wave ultraviolet light in order to see the GFP fluoresce. Follow appropriate safety
procedures given by the instructor when working with the ultraviolet light. Close inspection will be required to
answer the following questions:
1. What are the immediately noticeable results on the transformation?
2. Was this transformation as apparently efficient as the transformation in “Lesson 1”?
3. After close inspection of the growth on the plate, there should be different phenotypes present. List all
phenotypes found on the plate and offer an estimated portion of the population that they compose:
4. Connect the phenotypes present on the petri dish to the possible codons that you established above:
5. Complete a chi-squared analysis to determine if the actual estimated percentages are statistically the “same” as
the predicted phenotypes (from background section 4, questions c-e).
65
(Above figures from http://media.collegeboard.com/digitalServices/pdf/ap/biomanual/CB_Bio_TM_APPENDIX_A_WEB.pdf)/.
6. If the null hypothesis is not supported, create a hypothesis for why this is?
Summary Questions and Analysis of Outcomes
1. How does this experiment support the idea that genetic change can cause phenotypic diversity in a population?
2. What role do mutations have in the diversity of organisms within the same species?
3. Based on the results of “Lesson 1” and the fact that the GFP was not produced on a petri dish with no Larabinose and the results of “Lesson 2”, do you think that “Nature” (organism’s genotype) or “Nurture” (conditions
that the bacteria are grown in) has a greater impact on the phenotype? Genotype?
4. Remember that the GFP is found in some species of jellyfish (in fact, more than half of jellyfish demonstrate
some type of bioluminescence). It is thought that many of these jellyfish (or closely related organisms) produce
luminescence to scare off potential predators in the deep sea by producing bright flashes of light or even “clouds”
of luminescence by releasing these chemicals into the water. Relate change caused by random mutations in the gfp
of these jellyfish to their survival and reproductive success.
66
5. Create an appropriate graph of the data below to show the population trend over the course of several years.
Years
Population (in
thousands)
1
5
2
5
3
5
4
5
5
5
6
6
7
7
8
9
9
11
10
13
11
14
12
15
13
15
14
15
15
15
16
15
a. Determine the rate of population growth of the jellyfish from years 5 through 10.
b. Why do you think there could have been such a drastic increase in the population from years 5-10
(make sure to relate to the topic of this lesson)?
67
c. If there are no sudden environmental changes in the 10 years after the end of the collected data, predict
what will happen to this population.
d. If there is a sudden environmental change in the 10 years after the end of the collected data, predict
what will happen to this population.
6. Thousands of open ocean species demonstrate bioluminescence. How could a scientists figure out if these
organisms were possibly related?
7. Based on the results in your petri dish, do you think most mutations hurt or help an individual? A species?
68
TEACHER PAGES: KEY to Background Information and Primer Creation
3. Once the primer has been created, double-click it to open it.
a. Write the sequence of the forward primer:
5’ CAC TAC TTT CTC TTA TGG TGT TCA ATG 3’
b. What is the Tm of this primer? 55°C
5. Click “Okay” to return to the main window and ensure the primer has been modified by the addition of “YRK.”
a. What specifically happened to the Tm, and why do you think that this happened?
The Tm changed to 57°C because of the non-specificity of the new primer to the template DNA.
This is a very minor change.
b. Based on the above chart from Integrated DNA technologies, what possible codons could this sequence
create (include the amino acids that they will be translated into)?
TAT = Tyrosine (wild type codon of the gfp)
1
CAT = Histidine (blue fluorescent protein)
1
TGG = Tryptophan (dim cyan)
TAG = Stop codon (no fluorescence)
TGT = Cysteine
CGT = Arginine
CAG = Glycine
CGG = Arginine
c. The mutations Y66H and Y66W can cause a color change of the GFP... Based on the above possible
codons in the forward primer, what are the probabilities that this will occur?
These mutations can cause the gfp to produce a protein that produces a very dim blue
fluorescence. Based on the above possible codons in the forward primer, what are the
probabilities that this will occur? ¼
d. What is the possibility that a stop codon was introduced into the plasmid? What affect will it have on
the production of the GFP?
1/8 chance. The GFP will not be produced.
e. What is the chance that the wild type codon will be incorporated into the plasmid?
1/8
f. Create a hypothesis for what effect the incorporation of the other possible codons could have on the
GFP?
There are many possible hypotheses for this, but the hypothesis should be based around the fact
that there most likely will be some sort of change to the GFP (it will most likely cause the GFP to
be less fluorescent).
g. Create an additional hypothesis that summarizes what you believe will happen when we use these to
ultimately transform bacteria (after PCR and KLD):
The hypothesis should include something that indicates that there might be variation in the
phenotypes of the bacteria that were successfully transformed.
6. Create a reverse primer that corresponds to your new forward primer and name it “Random mutant reverse
primer”
a. Write the sequence of the reverse primer:
5’ ACA AGT GTT GGC CAT GGA A 3’
69
b. What is the Tm of the reverse primer? 55°C
7. Go back to the “OligoAnalyzer” tool at http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
a. Complete all of the same diagnostics on the forward and reverse primers that were completed in
“Lesson 1”. Additionally, why do you think that there is a range of Tms given?
There should not be any major hairpins or self-dimers. There is a range of Tms because of the
variation in the possible primers that will be created in the production process (the “YRK” codon).
TEACHER PAGES: KEY to Laboratory Methodologies and Questions
Observations after overnight growth
1. What are the immediately noticeable results on the transformation?
There should be growth of fluorescent (transformed) colonies. Keep in mind, a 24 hour, 37°C incubation is
needed and should be followed by 24-28 hours of room temperature growth/maturation. Although there
should be growth after 24 hours, it might not yet be florescent (especially if the blue florescent protein is
being produced).
2. Was this transformation as apparently efficient as the transformation in “Lesson 1”?
All trials demonstrated comparable transformation efficiencies.
3. After close inspection of the growth on the plate, there should be different phenotypes present. List all
phenotypes found on the plate and offer an estimated portion of the population that they compose:
Dim green colonies: ~80%*
Bright green colonies: ~2%*
Colonies with no apparent color: ~18%*
*These percentages are from repeated trials using the same “Lesson 2” forward primer mix to repeat all
trials. A “Lesson 2” forward primer mix purchased at a different time might produce slightly different
products (see question #6 below for reasoning).
4. Connect the phenotypes present on the petri dish to the possible codons that you established above:
TAT = Tyrosine (wild type codon of the gfp)
1
CAT = Histidine (blue fluorescent protein)
1
TGG = Tryptophan (dim cyan)
TAG = Stop codon (no fluorescence)
TGT = Cysteine*
CGT = Arginine*
CAG = Glycine*
CGG = Arginine*
*Although literature is scarce for these specific mutations, it can be suggested by this author that these
will most likely produce proteins that are much dimmer than the wild type GFP.
5. Complete a chi-squared analysis to determine if the actual estimated percentages are statistically the “same” as
the predicted phenotypes (from background section 4, questions c-e).
70
Students will most likely all come up with different answers for this, and most likely the null hypothesis that
1/4 are blue, 1/8 are wild type green, and 1/8 do not glow, 1/2 are dim will NOT be supported (see
question #6 in this section for possible explanation).
6. If the null hypothesis is not supported, create a hypothesis for why this is?
This is more of a class discussion question; it is unlikely that students will come up with the correct answers
from their background knowledge. There are two most likely possibilities:
1. Some primers anneal to the template DNA more frequently than others, giving us unequal
exponential replication during PCR.
2. This quote can be found on Integrated DNA Technologies website
(http://www.idtdna.com/pages/products/dna-rna/custom-dna-oligos):
“IDT offers oligonucleotides containing randomized, or “mixed bases”. Mixed Bases are
used in primers to bind to templates that contain variability or a mixture of sequences at
the primer binding site. Mixed Bases can also be used to create diversity in clone libraries
and in site-directed mutagenesis.
IDT offers two types of randomization, Machine Mixed and Hand Mixed Bases. Machine
Mixed Bases can be made at any/all base sites at no additional charge. At these base
positions, the synthesizer pulls an equal ratio of the desired bases, but their different
coupling rates do not guarantee an equal ratio of incorporation.”
It is possible (because of the “Machine Mixing” method used to create the primers) that there are
NOT the predicted primer variations actually in the “Lesson 2 Forward Primer” mix.
Summary Questions and Analysis of Outcomes
1. How does this experiment support the idea that genetic change can cause phenotypic diversity in a population?
Students should connect that differing primers (DNA) are causing the change in phenotypes of the bacteria
in the population found on the petri dish.
2. What role do mutations have in the diversity of organisms within the same species?
Within a species, mutations can cause differences between individuals. These mutations could be silent
(not expressed), or expressed and cause a change in phenotypic traits.
3. Based on the results of “Lesson 1” and the fact that the GFP was not produced on a petri dish with no Larabinose and the results of “Lesson 2”, do you think that “Nature” (organism’s genotype) or “Nurture” (conditions
that the bacteria are grown in) has a greater impact on the phenotype? Genotype?
This is an interesting scenario where both the environment and genotype can visibly affect the phenotype
very easily. For this specific case, it could be successfully argued that “nature” (environment) played a
larger role in the phenotype of the organism (remember, when the bacteria are not grown in the presence
of L-arabinose, they produce no GFP). When the genotype was modified, many still produced some sort of
fluorescent protein. Overall, both factors play a role in the phenotype of the bacteria.
4. Remember that the GFP is found in some species of jellyfish (in fact, more than half of jellyfish demonstrate
some type of bioluminescence). It is thought that many of these jellyfish (or closely related organisms) produce
luminescence to scare off potential predators in the deep sea by producing bright flashes of light or even “clouds”
of luminescence by releasing these chemicals into the water. Relate change caused by random mutations in the gfp
of these jellyfish to their survival and reproductive success.
71
Any mutation that causes the brightness to be more dim than the “wild type” (unmutated) gene would
hypothetically cause those organisms to be killed more easily by predators because they cannot scare them
away as easily. Any mutation that could cause an increase in the brightness of the gfp could hypothetically
increase the chance the jellyfish would scare off a predator, helping ensure that it will get a chance to
reproduce (increasing reproductive success).
5. Create a graph of the data below to show the population trend of several years.
Years
Population (in
thousands)
1
5
2
5
3
5
4
5
5
5
6
6
7
7
8
9
9
11
10
13
11
14
12
15
13
15
14
15
15
15
16
15
a. Determine the rate of population growth from years 5 through 10.
(y2-y1)/(x2-x1)= rate
(13-5)/(10-5)=1.6 (thousand) organisms/year
b. Why do you think there could have been such a drastic increase in the population from years 5-10
(make sure to relate to the topic of this lesson)?
Although there could be many ecological reasons for this increase, this lesson is about mutation.
It is possible that a mutation allowed some organisms to better win limited resources (or survives
in harsh conditions), reproduce, and then pass on those successful genes. Most likely, there would
have to be some sort of environmental change that also occurred because the organism is
probably already well-adapted to live there.
c. If there are no sudden environmental changes in the 10 years after the end of the collected data, predict
what will happen to this population.
The population would most likely continue the trend of no (significant) net increase in population
number.
72
d. If there is a sudden environmental change in the 10 years after the end of the collected data, predict
what will happen to this population.
The population number would change. The actual environmental change would dictate if the
population would increase or decrease.
6. Thousands of open ocean species demonstrate bioluminescence. How could a scientists figure out if these
organisms were possibly related?
By examining the sequence of the gfp it may be possible to determine if organisms are closely related (if
there are few differences) or distantly related (possibly the production of a different fluorescent protein no
related to the gfp).
7. Based on the results in your petri dish, do you think most mutations hurt or help an individual? A species?
Based on the growth results, there should not be any colonies that are actually brighter than the wild type
GFP. Most mutations that occurred will cause the colonies to be more dim/different color/or display no
fluorescence at all. It can be assumed that most mutations will be harmful to the individual, and because
of that, limit reproductive success. Therefore, it can be deduced that most harmful mutations will have a
minimal impact on a species as a whole.
73
LESSON THREE: “THE ENGINEERING OF SCIENCE”
KEY QUESTION(S):How is genetic engineering completed? How do scientists modify genes to obtain specific
products? For what reason is genetic engineering completed?
KEY SCIENCE CONCEPTS: Genetic engineering, mutagenesis, codons, transcription, translation, biotechnology, PCR,
GFP, gene/plasmid cloning, transformation, DNA, software to inspect and modify aspects of genetic code, scientific
literature.
OVERALL TIME ESTIMATE: 3-4 Days
LEARNING STYLES: Kinesthetic, auditory, visual
VOCABULARY:
Enhanced blue fluorescent protein- spectral variant of the green fluorescent protein.
LESSON SUMMARY:
This lesson will focus on the specific genetic engineering of the pGLO gene. Students will research published data to
determine the best route to change the production of the green fluorescent protein (GFP) into the production of
the enhanced blue fluorescent protein (EBFP).
STUDENT LEARNING OBJECTIVES:
Students should be able to:
1. Describe how mutation and genetic recombination increase genetic variation.
2. Explain how mutations in the DNA sequence may or may not result in phenotypic change
3. Evaluate the impact of biotechnology on the individual, society and the environment, including medical and
ethical issues.
4. Describe how basic DNA technology (restriction digestion by endonucleases, gel electrophoresis, polymerase
chain reaction, ligation, and transformation) is used to construct recombinant DNA molecules (DNA cloning).
5. Recognize that the strength or usefulness of a scientific claim is evaluated through scientific argumentation,
which depends on critical and logical thinking, and the active consideration of alternative scientific explanations to
explain the data presented.
6. Identify sources of information and assess their reliability according to the strict standards of scientific
investigation.
7. Construct scientific explanations that use the structures and mechanisms of DNA and RNA to support the claim
that DNA and, in some cases, that RNA are the primary sources of heritable information.
8. Justify the selection of data from historical investigations that support the claim that DNA is the source of
heritable information.
9. Justify the claim that humans can manipulate heritable information by identifying at least two commonly used
technologies.
10. Predict how a change in a specific DNA or RNA sequence can result in changes in gene expression
11. Create a visual representation to illustrate how changes in a DNA nucleotide sequence can result in a change in
the polypeptide produced.
12. Use models to predict and justify that change in the subcomponents of a biological polymer affect the
functionality of the molecule.
13. Analyze data to identify how molecular interactions affect structure and function.
14. Refine representations and models of natural or manmade phenomena and systems in the domain.
74
15. Use representations and models to analyze situations or solve problems qualitatively and quantitatively.
16. State that a polypeptide is coded for by a gene and that a gene is a sequence of nucleotides that forms part of a
DNA molecule and state that a mutation is a change in the sequence that may result in an altered polypeptide;
17. Explain, with examples, how mutation may affect the phenotype;
18. Explain how a change in the nucleotide sequence in DNA may affect the amino acid sequence in a protein and
hence the phenotype of the organism;
SANDARDS:
Florida Next Generation Sunshine State Standards (NGSSS):
SC.912.L.15.15
SC.912.L.16.4
SC.912.L.16.12
SC.912.N.1.3
Advanced Placement (AP) Biology Learning Outcomes:
LO 3.1
LO 3.2
LO 3.6
LO 3.25.
LO 4.17
SP 1.3
SP 1.4
SP 3.2
SP 4.3
SP 6.1
SP 6.2
SC.912.L.16.10
SC.912.N.1.4
LO 3.5
LO 4.3
SP 3.1
SP 5.1
SP 6.4
Advanced International Certificate of Education (AICE) Biology Learning Outcomes:
F. (c)
O. (g)
O. (i)
MATERIALS:

ESSENTIAL: All materials used in “Lesson 1” will be used again with the exception of the “Lesson 1”
forward and reverse primers. In its place, you will need to provide the primers listed below. There should
still be enough of each solution from “Lesson 1” and “Lesson 2” that no more should need to be ordered.
- Lesson 3 forward primer, Q5® reaction 1
- Lesson 3 reverse primer, Q5® reaction 1
- Lesson 3 forward primer, Q5® reaction 2
- Lesson 3 reverse primer, Q5® reaction 2
BACKGROUND INFORMATION
If lessons “1” and “2” of this curriculum have been completed then students have used many tools to
observe how mutating the DNA of a plasmid used to transform bacteria can result in a variety of results. All of the
outcomes in “Lesson 2” were semi-random, and the exact phenotypic results/ratios that were present on the petri
dishes probably varied for each group in order to study the effects of mutation. In “Lesson 3”, students will once
again be targeting the gfp, but in a different way. Students will be using published scientific literature to design a
plan to mutate the gfp into a gene that produces the “enhanced blue fluorescent protein” (EBFP). The
methodology to complete this lesson is very closely aligned with previous lessons and only primer design and PCR
conditions need to be changed. This very exact end goal target (EBFP) closely mimics how a laboratory would
genetically engineer a strain of bacteria to produce a specific, enhanced protein product.
It has long been recognized that enzymes can be used by humans to complete a specific task, but many of
these enzymes lacked specifically desired characteristics. These characteristics offer targets that can be used to
1
optimize their performance. The optimization of these enzymes often begins with modification of the genes that
code for them. This is often completed through a method called “directed evolution.” A gene of interest is modified
75
2-5
through various methods (such as error-prone PCR and even more complicated methods ) and then screened for
changes. Because the original modifications are usually not specific, some products will be less efficient, some will
1
show no change, while others will show an improvement (over the wild type). The genes that show improvement
1
will be further modified to see if any additional improvements can be made. These directed evolution methods
6
have been used successfully for many years to create optimized proteins.
These same methods to optimize enzyme function can, and have, been employed to find spectral variants
of the GFP. In “The fluorescent protein palette: tools for cellular imaging” Day and Davidson describe the immense
7
amount of variation that has been discovered using the Aequorea GFP derivatives. The specific variant that this
8
lesson focuses on is the “enhanced blue fluorescent protein” (EBFP) first described by Yang et al in 1998. This
derivative of the GFP features four point mutations (Phe-64 to Leu, Ser-65 to Thr, Tyr-66 to His, and Tyr-145 to Phe
and will be abbreviated as F64L, S65T, Y66H, and Y145F).
In this lesson, students will conduct two separate Q5® reactions to introduce all needed mutations to the
plasmid. ”Q5® Reaction 1” will add mutations F64L, S65T, Y66H and “Q5® Reaction 2” will introduce the mutation
Y145F. This “optimization” of the GFP into a new product allows students to explore how a single gene can be
manipulated by human hands and turn into a new product. Specific examples of genes that have been (or can be
manipulated) will be used in the student section to investigate possible ethical/social concerns.
ADVANCE PREPARATION:
Very little advanced preparation is required for this lesson if “Lesson 1/2” was recently completed. If
completing “Lesson 3” much later than “Lesson 1/2” (such as a month), then new petri dishes should be poured
and fresh solutions should be made unless the manufactured item directly states that it can successfully be stored
for over a month. If not completing “Lesson 1/2,” please refer to “Lesson 1” for laboratory items and solutions
needed.
Table 1. Items that need to be ordered in advance from IDT. All items can be stored for several months at -20°C.
Item
Lesson 3 Forward
Primer, Q5® Reaction 1
Lesson 3 Reverse Primer,
Primer, Q5® Reaction 1
Lesson 3 Forward
Primer, Q5® Reaction 2
Lesson 3 Reverse Primer,
Primer, Q5® Reaction 2
Integrated DNA Technologies #
Quantity
Custom Oligonucleotide Synthesis
1
Custom Oligonucleotide Synthesis
0
Custom Oligonucleotide Synthesis
1
Notes
5’ CAC TAC TCT GAC TCA TGG TGT TCA
ATG CTT TTC C3’
This is the same reverse primer used
in “Lesson 1,” none additional should
be needed.
5’ TCG AGT ACA ACT TTA ACT CAC ACA
ATG 3’
Custom Oligonucleotide Synthesis
1
5’ GTT TGT GTC CGA GAA TGT TTC 3’
Once the above items have been received, the following needs to be done a day (or two) in advance to the commencement
of the lab:
1. Forward primer preparation. Primers need to be diluted to the correct concentration as follows:
a. Lesson 3 Forward Primer, Reaction 1- Add 243µl of sterile H2O to primers to create stock
solution (100uM). Create 10uM aliquots from this stock solution (to be used by individual groups,
or create just one for the class and pass around) by adding 10µl forward primer stock solution to
90µl sterile H2O.
76
b. Switch the name of “Lesson 1/2” reverse primer to “Lesson 3” reverse primer (it is the same
primer for all three lessons). There should be plenty of this primer remaining after “Lesson 1/2”
completion.
c. Lesson 3 Forward Primer, Reaction 2- Add 190µl of sterile H2O to primers to create stock
solution (100uM). Create 10uM aliquots from this stock solution (to be used by individual groups,
or create just one for the class and pass around) by adding 10µl forward primer stock solution to
90µl sterile H2O.
d. Lesson 3 Reverse Primer, Reaction 2- Add 271µlµl of sterile H2O to primers to create stock
solution (100uM). Create 10uM aliquots from this stock solution (to be used by individual groups,
or create just one for the class and pass around) by adding 10µl forward primer stock solution to
90µl sterile H2O.
PROCEDURE AND DISCUSSION QUESTIONS WITH TIME ESTIMATES:
Assuming lessons 1 and 2 have been completed, students should not need much of an introduction for
this activity. Instruct students that instead of the introduction of semi-random mutations (see “Lesson 2”) into the
plasmids, they will be using published literature to determine the best route to produce a specific variant of the
GFP. Instead of random mutations, they will be optimizing a protein for a specific purpose (to create the EBFP).
Background Activities:
1. Research and Primer Creation, 50 minutes
The following items are needed by each student:
- Computers with SnapGene and the pGLO file
- Distribute the “Background Information and EBFP Primer Creation” student worksheet. Students
should answer all corresponding questions and complete all associated diagrams.
Laboratory Activities:
Distribute the “Laboratory Methodologies and Questions” student handout
1. PCR Reaction 1, 20 minutes to setup (additional 2 hours to run each reaction, but students do not need to be
present)
The following item(s) should be found in the common area for the PCR reaction:
- Thermo Cycler
Each lab station should have the following for EACH PCR reaction:
- 1 empty PCR tube
- Set of micropipettes with appropriate tips
- 1 fine-point permanent maker for labeling
- Q5® 2x Mastermix aliquot
- Template DNA aliquot (pGLO)
- Microcentrifuge tube of Sterile H20
- Lesson 3 Forward primers, reaction 1 aliquot (if not made available as a common item for the
class)
- Lesson 3 Reverse primers, reaction 1 aliquot (if not made available as a common item for the
class)
77
- Waste bins/bags for each station
- Gloves
- Goggles
Students will add the following to the empty, labeled PCR tube for a total volume of 25µl:
- 12.5µl Q5® 2x Mastermix
- 1.0µl Template DNA
- 1.5µl forward primer
- 1.5µl reverse primer
- 8.5µl sterile H20
Thermocycler program “Q5, triple mutant”
Step 1. 98°C for 30 seconds
Step 2. 98°C for 15 seconds
Step 3. 57°C for 30 seconds
Step 4. 72°C for 4 minutes
Step 5. Repeat steps 2-4, 25 times
Step 6. 72°C for 10 minutes
Step 7. Hold at 4°C
2. KLD Reaction (20 minutes)
The following item(s) should be found in the common area for the KLD reaction:
- 10x KLD Enzyme Mix (kept in ice- see notes in “Lesson 1” about proper storage of this enzyme)
Each lab station should have the following for the KLD reaction:
- 1 empty PCR tube
- Set of micropipettes with appropriate tips
- 1 fine-point permanent maker for labeling
- The groups PCR product
- 2x KLD reaction buffer aliquot
- Sterile H2O
- Waste bins/bags for each station
- Gloves
- Goggles
Students will:
1. Label a clean PCR tube with group name/number and “Q5 EBFP1 KLD”
2. Add the following to the empty PCR tube for a total volume of 10µl:
- 1µl PCR product
- 5µl KLD reaction buffer
- 1µl 10x KLD Enzyme mix
- 3µl Sterile H20
3. Incubate at room temperature for 20 minutes.
4. This product is now usable for PCR reaction 2.
3. PCR Reaction 2, 20 minutes to setup (additional 2 hours to run each reaction, but students do not need to be
present)
The following item(s) should be found in the common area for the PCR reaction:
78
- Thermo Cycler
Each lab station should have the following for EACH PCR reaction:
- 1 empty PCR tube
- Set of micropipettes with appropriate tips
- 1 fine-point permanent maker for labeling
- Q5® 2x Mastermix aliquot
- Template DNA aliquot (PRODUCT OF KLD REACTION FROM PCR REACTION 1)
- Microcentrifuge tube of Sterile H20
- Lesson 3 Forward primers, reaction 2 aliquot (if not made available as a common item for the
class)
- Lesson 3 Reverse primers, reaction 2 aliquot (if not made available as a common item for the
class)
- Waste bins/bags for each station
- Gloves
- Goggles
Students will add the following to the empty, labeled PCR tube for a total volume of 25µl:
- 12.5µl Q5® 2x Mastermix
- 1.0µl PRODUCT OF KLD REACTION FROM PCR REACTION 1
- 1.5µl forward primer
- 1.5µl reverse primer
- 8.5µl sterile H20
Thermocycler program “Q5, EBFP Single”
Step 1. 98°C for 30 seconds
Step 2. 98°C for 15 seconds
Step 3. 55°C for 30 seconds
Step 4. 72°C for 4 minutes
Step 5. Repeat steps 2-4, 25 times
Step 6. 72°C for 10 minutes
Step 7. Hold at 4°C
2. KLD Reaction (20 minutes)
The following item(s) should be found in the common area for the KLD reaction:
- 10x KLD Enzyme Mix (kept in ice- see notes in “Lesson 1” about proper storage of this enzyme)
Each lab station should have the following for the KLD reaction:
- 1 empty PCR tube
- Set of micropipettes with appropriate tips
- 1 fine-point permanent maker for labeling
- The groups PCR product
- 2x KLD reaction buffer aliquot
- Sterile H2O
- Waste bins/bags for each station
- Gloves
- Goggles
79
Students will:
1. Label a clean PCR tube with group name/number and “Q5 EBFP2 KLD”
2. Add the following to the empty PCR tube for a total volume of 10µl:
- 1µl PCR product
- 5µl KLD reaction buffer
- 1µl 10x KLD Enzyme mix
- 3µl Sterile H20
3. Incubate at room temperature for 20 minutes.
4. This product is now usable for transformation*
* The quantity of DNA present for transformation will be relatively small because of the dilute nature of
running two consecutive Q5® reactions but still adequate for proper results.
3. Transformation of NEB 5-alpha E. coli cells (55 minutes, split over two days)
The following item(s) should be found in the common area for the transformation reaction:
- NEB 5-alpha E. coli cells (these must be kept on dry ice up until the transformation begins. One tube per
group completing the lab should be made available)
- Hot water bath (42°C)
- Incubator (37°C)
- Orbital rocker/shake table (highly recommended and should ideally be located inside the incubator)
- Glass bacterial spreader with rotating petri dish stand (or sterile cotton swabs if this is not available. This
item could also be found at each lab station).
- SOC outgrowth medium (included with the Q5® kit
Each lab station should have the following for the transformation reaction:
- KLD reaction 2 product
- Set of micropipettes with appropriate tips
- Permanent fine-tip markers for labeling tubes (1 per group)
- Container/beaker with ice
- Waste bins/bags for each station
- Gloves
- Goggles
- 1 LB/Amp+ petri dish
- 1 LB/Amp+/L-arabinose petri dish
Students will:
1. “Thaw” the NEB 5-alpha E. coli cells on ice for 3 minutes.
2. Add 5µl of KLD reaction 2 product to the NEB 5-alpha E. coli and flick several times to mix.
3. Put on ice for 30 minutes.
4. Heat shock in hot water bath (42°C) for 30 seconds.
5. Immediately transfer back to ice and hold there for 5 minutes.
6. Pipette 950µl of SOC outgrowth medium into cells.
7. Incubate (on orbital rocker/shaker) at 37°C for 1 hour or longer (if in a “block” class, students can wait
an hour and immediately skip to “step 8”. If classes are not in a “block” then “step 7” time can be changed
to overnight, but would need to be incubated at room temperature to minimize growth).
8. After incubation, cells need to be transferred onto petri dish.
- Add 10µl of culture (assuming 60mm plates, amount can be adjusted if using larger petri dishes)
to LB/Amp+/L-arabinose petri dish and spread using either glass spreader and turntable, or sterile
cotton swab. Make sure the petri dish is only cracked open, and the lid is promptly put back on.
80
9. The remaining culture can be used to inoculate additional plates if available, or placed in the
refrigerator if it is thought it will be needed again.
10. Incubate petri dishes over night at 37°C.
4. Observations after overnight* growth (20 minutes)
Students should be looking for variation in the colonies. It may be helpful to allow students to add dots to the
plastic petri dish in order to help keep track of what they have already seen. Plates can be kept (sealed) in the
refrigerator for further analysis if need be.
Each lab station should have the following for observation:
- Longwave UV lamp/transilluminator (if the lab has only one large transilluminator, multiple groups can
use it at one time)
- Gloves
- Goggles
*As stated in the background information, ideally incubation should be for 24-36 hours at 37° and then left at room
temperature for an additional day or more.
ASSESSMENT SUGGESTIONS:
By completing the included questions, students:
1. Described how mutation and genetic recombination increase genetic variation by creating a genetic variant of
the gfp with a new phenotype.
2. Explained how mutations in the DNA sequence result in phenotypic change by creating the EBFP from the wild
type gfp.
3. Evaluated the impact of biotechnology on the individual, society and the environment, including medical and
ethical issues by investigating specific cases of genetic modification.
4. Described how basic DNA technology (restriction digestion by endonucleases, polymerase chain reaction,
ligation, and transformation) is used to construct recombinant DNA molecules.
5. Recognized that the strength or usefulness of a scientific claim is evaluated through scientific argumentation,
which depends on critical and logical thinking, and the active consideration of alternative scientific explanations to
explain the data presented by interpreting a portion of a scientific article in order to create appropriate DNA
primers.
6. Identified sources of information and assess their reliability according to the strict standards of scientific
investigation by interpreting a portion of a scientific article in order to create appropriate DNA primers.
7. Constructed scientific explanations that use the structures and mechanisms of DNA and RNA to support the
claim that DNA and, in some cases, that RNA are the primary sources of heritable information by manipulating
genetic code and observing the visible difference in the phenotype.
8. Justified the selection of data from historical investigations that support the claim that DNA is the source of
heritable information by manipulating genetic code and observing the visible difference in the phenotype.
9. Justified the claim that humans can manipulate heritable information by actually manipulating genetic code and
observing the visible difference in the phenotype.
10. Predicted how a change in a specific DNA or RNA sequence can result in changes in gene expression by actively
changing the genotype of a plasmid and predicting the outcome based on published literature.
11. Created a visual representation to illustrate how changes in a DNA nucleotide sequence can result in a change
in the polypeptide produced by manipulating primer design in SnapGene.
12. Used models to predict and justify that change in the subcomponents of a biological polymer affect the
functionality of the molecule by explaining how different variants of the GFP are caused by differing DNA
sequences.
13. Analyzed data to identify how molecular interactions affect structure and function of the gfp/GFP
81
14. Used representations and models to analyze situations or solve problems qualitatively and quantitatively by
constructing primers in SnapGene.
EXTENSIONS:
- Additional research projects which investigate practical human manipulation of genes (genetic engineering) can
be assigned
- Alternative methods to produce the EBFP can be investigated and completed
RESOURCES/REFERENCES:
1. Kuchner, O., Arnold, F. H. 1997. Directed Evolution of Enzyme Catalysts. Trends in Biotechnology,15, 523-530.
2. Stemmer, W.P.C. 1994. Rapid evolution of a protein in vitro by DNA shuffling. Nature, 370, 389–391.
3. Stemmer, W.P.C.1994. DNA shuffling by random fragmentation and reassembly: In vitro recombination for
molecular evolution. Proc. Natl. Acad. Sci. USA, 91, 10747–10751.
4. Moore, J.C., Jin, H.-M., Kuchner, O. and Arnold, F.H. 1997.Strategies for the in vitro evolution of protein function:
enzyme evolution by random recombination of improved sequences. J Mol Biol. Sep 26;272(3):336-47.
5. Shao, Z., Zhao, H., Giver, L., and Arnold, F.H. 1998. Random-priming in vitro recombination: an effective tool for
directed evolution. Nucleic Acids Research, Vol. 26, No. 2.
6. Liao, H., McKenzie, T. and Hageman, R. 1986. Proc. Natl. Acad. Sci. USA. 83, 576-580.
7. Day, R.N. and Davidson, M. W. 2009. The fluorescent protein palette: tools for cellular imaging. Chem. Soc. Rev.,
38, 2887-2921.
8. Yang, T. T., Sinai, P., Green, G., Kitts, P. A., Chen, Y. T., Lybarger, L., Chervenak, R., Patterson, G. H., Piston, D. W.,
and Kain, S. R. 1998. Improved fluorescence and dual color detection with enhanced blue and green variants of the
green fluorescent protein. J. Biol. Chem. 273, 8212-8216.
82
STUDENT PAGES: Background Information and EBFP Primer Creation
If you have completed lessons “1” and “2” of this curriculum then you have used many tools to observe how
mutating the DNA of a plasmid used to transform bacteria can result in a variety of results. All of the outcomes in
“Lesson 2” were semi-random, and the exact phenotypic results/ratios that were present on the petri dishes
probably varied for each group in order to study the effects of mutation. In “Lesson 3”, you will once again be
targeting the gfp, but in a different way. You will be using published scientific literature to design a plan to mutate
the gfp into a gene that produces the “enhanced blue fluorescent protein”. The methodology to complete this
lesson is very closely aligned with previous lessons and only primer design and PCR conditions need to be changed.
This very exact end goal target (EBFP) closely mimics how a laboratory would genetically engineer a strain of
bacteria to produce a specific, enhanced protein product.
It has long been recognized that enzymes can be used by humans to complete a specific task, but many of
these enzymes lacked specifically desired characteristics. These characteristics offer targets that can be used to
1
optimize their performance. The optimization of these enzymes often begins with modification of the genes that
code for them. This is often completed through a method called “directed evolution.” A gene of interest is modified
2-5
through various methods (such as error-prone PCR and even more complicated methods ) and then screened for
changes. Because the original modifications are usually not specific, some products will be less efficient, some will
1
show no change, while others will show an improvement (over the wild type). The genes that show improvement
1
will be further modified to see if any additional improvements can be made. These directed evolution methods
6
have been used successfully for many years to create optimized proteins.
These same methods to optimize enzyme function can, and have, been employed to find spectral variants
of the GFP. In “The fluorescent protein palette: tools for cellular imaging” Day and Davidson describe the immense
7
amount of variation that has been discovered using the Aequorea GFP derivatives. The specific variant that this
8
lesson focuses on is the “enhanced blue fluorescent protein” (EBFP) first described by Yang et al in 1998.
In this lesson, you will need to conduct two separate Q5® reactions to introduce all needed mutations to
the plasmid. In ”Q5® Reaction 1”, you will need to add three mutations to the plasmid to turn it into a gene that
codes for a blue fluorescent protein (BFP) and in “Q5® Reaction 2” you will need to introduce a mutation to
optimize the protein product into the EBFP. You will need to use the included published information to create and
optimize primers for the two consecutive PCR reactions.
This “optimization” of the GFP into a new product allows you to explore how a single gene can be
manipulated by human hands and turn into a new product. The implication of what you will attempt to complete
goes beyond changing the color of bacteria and extend into genetically modified foods and animals.
1. Use the following section of the article entitled: “Improved fluorescence and dual color detection with
enhanced blue and green variants of the green fluorescent protein” (Yang et al, 1998) to determine a best
strategy to produce the EBFP.
“Various blue emission mutants of GFP have been reported previously (4, 12) but have lacked
broad utility due to the relatively low fluorescence intensities produced by these reporter proteins. The
initial variant of this type referred to as P4 (7) contains the single point mutation Tyr-66 to His in the
chromophore region of the protein and yields a strong cobalt blue signal but only dim fluorescence. An
improvement in this variant termed P4–3 (4) contains an additional Tyr-145 to Phe substitution that
improves the folding properties of the protein and thereby the subsequent fluorescence output. The P4–3
double mutant is approximately 2-fold brighter than P4, primarily due to a higher fluorescence quantum
yield (QY). Moreover, all previous reports with blue emission variants such as P4–3 have used GFP genes
containing wild type jellyfish codons, which leads to inefficient expression in higher eukaryotes (13).
In the present study, we describe a blue emission variant of GFP termed EBFP, which contains
four point mutations: Phe-64 to Leu, Ser-65 to Thr, Tyr-66 to His, and Tyr-145 to Phe. We and others have
shown previously that the Phe-64 to Leu substitution improves the efficiency of chromophore formation
83
at 37 °C, thereby increasing the intracelluar level of functional protein expressed at this temperature (14,
15). These mutations were placed in a coding sequence that was further modified with approximately 190
silent base changes to contain codons preferentially found in highly expressed human proteins (13, 16).
The “humanized” backbone used in EBFP contributes to efficient expression of this variant in mammalian
cells and subsequently brighter fluorescent signals. We further illustrate that EBFP can be used in
conjunction with a humanized red-shifted variant termed EGFP (16) for dual color detection in mammalian
cells by flow cytometry.”
2. Using the article above and the pGLO Snapgene file, create optimal primers for two consecutive PCR
reactions. Keep in mind to use as few mutations as possible in the primer to ensure optimal annealing
opportunity.
a. PCR reaction 1 forward primer (introduction of the triple mutation) sequence, Tm, and
“OligoAnalyzer” results:
b. PCR reaction 1 reverse primer sequence, Tm, and “OligoAnalyzer” results:
c. Ideal PCR annealing temperature for PCR reaction 1:
d. PCR reaction 2 forward primer (introduction of the single mutation) sequence, Tm, and
“OligoAnalyzer” results:
e. PCR reaction 2 reverse primer sequence, Tm, and “OligoAnalyzer” results:
f. Ideal PCR annealing temperature for PCR reaction 2:
3. Did you feel that this scientific paper was difficult to interpret into a primer hypothesis? What
challenges were there?
4. At this point, your pGLO file should have a great deal of primers added to the sequence. If the file is still
available, take a screenshot of your additions and include it in this report.
84
RESOURCES/REFERENCES:
1. Kuchner, O., Arnold, F. H. 1997. Directed Evolution of Enzyme Catalysts. Trends in Biotechnology,15, 523-530.
2. Stemmer, W.P.C. 1994. Rapid evolution of a protein in vitro by DNA shuffling. Nature, 370, 389–391.
3. Stemmer, W.P.C.1994. DNA shuffling by random fragmentation and reassembly: In vitro recombination for
molecular evolution. Proc. Natl. Acad. Sci. USA, 91, 10747–10751.
4. Moore, J.C., Jin, H.-M., Kuchner, O. and Arnold, F.H. 1997.Strategies for the in vitro evolution of protein function:
enzyme evolution by random recombination of improved sequences. J Mol Biol. Sep 26;272(3):336-47.
5. Shao, Z., Zhao, H., Giver, L., and Arnold, F.H. 1998. Random-priming in vitro recombination: an effective tool for
directed evolution. Nucleic Acids Research, Vol. 26, No. 2.
6. Liao, H., McKenzie, T. and Hageman, R. 1986. Proc. Natl. Acad. Sci. USA. 83, 576-580.
7. Day, R.N. and Davidson, M. W. 2009. The fluorescent protein palette: tools for cellular imaging. Chem. Soc. Rev.,
38, 2887-2921.
8. Yang, T. T., Sinai, P., Green, G., Kitts, P. A., Chen, Y. T., Lybarger, L., Chervenak, R., Patterson, G. H., Piston, D. W.,
and Kain, S. R. 1998. Improved fluorescence and dual color detection with enhanced blue and green variants of the
green fluorescent protein. J. Biol. Chem. 273, 8212-8216.
85
STUDENT HANDOUT: Laboratory Methodologies and Questions
PCR Reaction to add Triple Mutation
1. Label PCR tube with group name/number and “Q5 TripMut”
2. Add the following to the empty PCR tube for a total volume of 25µl:
- 12.5µl Q5® 2x Mastermix
- 1.0µl Template DNA
- 1.5µl Lesson 3 Forward primers, reaction 1
- 1.5µl Lesson 3 Reverse primers, reaction 1
- 8.5µl sterile H20
3. Thermocycler program “Q5, triple mutant”
Step 1. 98°C for 30 seconds
Step 2. 98°C for 15 seconds
Step 3. 57°C for 30 seconds
Step 4. 72°C for 4 minutes
Step 5. Repeat steps 2-4, 25 times
Step 6. 72°C for 10 minutes
Step 7. Hold at 4°C
KLD Reaction
1. Label a clean PCR tube with group name/number and “Q5 TripMut KLD”
2. Add the following to the empty PCR tube for a total volume of 10µl:
- 1µl PCR product
- 5µl KLD reaction buffer
- 1µl 10x KLD Enzyme mix
- 3µl Sterile H20
3. Incubate at room temperature for 20 minutes.
4. This product is now usable for PCR reaction 2.
PCR Reaction to add Single Mutation
1. Label PCR tube with group name/number and “Q5 EBFP”
2. Add the following to the empty PCR tube for a total volume of 25µl:
- 12.5µl Q5® 2x Mastermix
- 1.0µlPRODUCT OF KLD REACTION FROM PCR REACTION TRIPLE MUTATION
- 1.5µl forward primer
- 1.5µl reverse primer
- 8.5µl sterile H20
3. Thermocycler program “Q5, EBFP Single”
Step 1. 98°C for 30 seconds
Step 2. 98°C for 15 seconds
Step 3. 55°C for 30 seconds
Step 4. 72°C for 4 minutes
Step 5. Repeat steps 2-4, 25 times
Step 6. 72°C for 10 minutes
86
Step 7. Hold at 4°C
KLD Reaction
1. Label a clean PCR tube with group name/number and “Q5 EBFP KLD”
2. Add the following to the empty PCR tube for a total volume of 10µl:
- 1µl PCR product
- 5µl KLD reaction buffer
- 1µl 10x KLD Enzyme mix
- 3µl Sterile H20
3. Incubate at room temperature for 20 minutes.
4. This product is now usable for transformation*
* The quantity of DNA present for transformation will be relatively small because of the dilute nature of
running two consecutive Q5® reactions but still adequate for proper results.
Transformation of NEB 5-alpha E. coli cells
1. “Thaw” the NEB 5-alpha E. coli cells on ice for 3 minutes.
2. Add 5µl of KLD reaction 2 product to the NEB 5-alpha E. coli and flick several times to mix.
3. Put on ice for 30 minutes.
4. Heat shock in hot water bath (42°C) for 30 seconds.
5. Immediately transfer back to ice and hold there for 5 minutes.
6. Pipette 950µl of SOC outgrowth medium into cells.
7. Incubate (on orbital rocker/shaker) at 37°C for 1 hour or longer (if in a “block” class, students can wait
an hour and immediately skip to “step 8”. If classes are not in a “block” then “step 7” time can be changed
to overnight, but would need to be incubated at room temperature to minimize growth).
8. After incubation, cells need to be transferred onto petri dish.
- Add 10 µl of culture (assuming 60mm plates, amount can be adjusted if using larger petri
dishes) to LB/Amp+/L-arabinose petri dish and spread using either glass spreader and turntable,
or sterile cotton swab. Make sure the petri dish is only cracked open, and the lid is promptly put
back on.
9. The remaining culture can be used to inoculate additional plates if available, or placed in the
refrigerator if it is thought it will be needed again.
10. Incubate petri dishes over night at 37°C.
Observations after overnight* growth (20 minutes)
As stated in the background information, ideally incubation should be for 24-36 hours at 37° and then left
at room temperature for an additional day or more.
1. What are the first noticeable results? Take pictures of your results and include.
87
2. Were there any colonies that were this bright in “Lesson 2”? Why or why not?
3. The primers that you came up with and used in this activity were hypotheses based on scientific literature. Do
your results support or refute your hypothesis?
4. What theories in your biology class are supported in these laboratory activities?
5. What other factors besides the genotype could affect the phenotype of the bacteria?
6. Go to:
http://www.mnn.com/green-tech/research-innovations/photos/12-bizarre-examples-of-genetic-engineering/madscience#
a. Choose three of the organisms that are in the above slideshow and explain if you think that the genetic
changes were justifiable?
7. After completing these activities, you have successfully genetically modified an organism. Come up with two
hypothetical changes to organisms around us that would directly benefit mankind. Keep the ideas rooted in reality
(sorry, no flying pigs…. yet….)
88
TEACHER PAGES: KEY to Background Information and Primer Creation
2. Using the article above and the pGLO Snapgene file, create optimal primers for two consecutive PCR
reactions.
a. PCR reaction 1 forward primer (introduction of the triple mutation) sequence, Tm, and
“OligoAnalyzer” results:
There are actually MANY different possible solutions to this question. In all cases, the
following mutations should be made: F64L, S65T, Y66H. For the sake of these activities,
this author recommends the following forward primer to introduce the triple mutation
into the pGLO plasmid:
5’ CAC TAC TCT GAC TCA TGG TGT TCA ATG CTT TTC C 3’
Snapgene Tm= 54°C
“OligoAnalyzer” results: No major problems
This forward primer was chosen because of the compatible Tm it shares with the reverse
primer used in “Lesson 1/2". The letters of the sequence above that are blue represent
the bases that were substituted.
b. PCR reaction 1 reverse primer sequence, Tm, and “OligoAnalyzer” results:
5’ ACA AGT GTT GGC CAT GGA A 3’
Snapgene Tm= 55°C
“OligoAnalyzer” results: No major problems
This reverse primer was chosen because it was the same one used in “Lesson 1/2"
c. Ideal PCR annealing temperature for PCR reaction 1:
57°C was used by this author, but the PCR reaction will most likely be successful if it is a
slightly different temperature
d. PCR reaction 2 forward primer (introduction of the single mutation) sequence, Tm, and
“OligoAnalyzer” results:
5’ TCG AGT ACA ACT TTA ACT CAC ACA ATG 3’
Snapgene Tm= 52°C
“OligoAnalyzer” results: No major problems
This forward primer was chosen because of stability and length but other options that
contain the same mutation could be acceptable answers as well.
e. PCR reaction 2 reverse primer sequence, Tm, and “OligoAnalyzer” results:
5’ GTT TGT GTC CGA GAA TGT TTC 3’
89
Snapgene Tm= 53°C
“OligoAnalyzer” results: No major problems
f. Ideal PCR annealing temperature for PCR reaction 2:
55°C was used by this author, but the PCR reaction will most likely be successful if it is a
slightly different temperature
3. Did you feel that this scientific paper was difficult to interpret into a primer hypothesis? What
challenges were there?
The section of the article that was chose for this project was fairly short and concise. Students
should not struggle with it but reading student challenges can reveal weaknesses and strengths.
4. At this point, your pGLO file should have a great deal of primers added to the sequence. If the file is still
available, take a screenshot of your additions and include it in this report.
Although this can be an optional question, having some pictures of their design is encouraged
(documentation).
90
TEACHER PAGES: KEY to Laboratory Methodologies and Questions
Observations after overnight* growth (20 minutes)
As stated in the background information, ideally incubation should be for 24-36 hours at 37° and then left
at room temperature for an additional day or more.
1. What are the first noticeable results? Take pictures of your results and include.
There should be bacterial growth. Depending on if it was left to mature (one to two days) then it should be
blue.
2. Were there any colonies that were this bright in “Lesson 2”? Why or why not?
Although this is possible, this is very unlikely. There was a small chance of blue colonies showing up in
“Lesson 2”, and if any did, they were most likely dim.
3. The primers that you came up with and used in this activity were hypotheses based on scientific literature. Do
your results support or refute your hypothesis?
Although they might not have used the EXACT primers that they designed in SnapGene, the results should
be similar. Their results (the production of the EBFP) should support their primer hypothesis.
4. What theories in your biology class are supported in these laboratory activities?
Depending on the level of biology this activity is being completed in, theories could include (but are not
limited to):
-
Cell theory
-
Transformation
-
Genetic manipulation and mutation
-
DNA replication
5. What other factors besides the genotype could affect the phenotype of the bacteria?
Inhibitors, activators, ideal pH, oxygen.
6. Go to:
http://www.mnn.com/green-tech/research-innovations/photos/12-bizarre-examples-of-genetic-engineering/madscience#
a. Choose three of the organisms that are in the above slideshow and explain if you think that the genetic
changes were justifiable?
This section is based on student’s opinions.
91
7. After completing these activities, you have successfully genetically modified an organism. Come up with two
hypothetical changes to organisms around us that would directly benefit mankind. Keep the ideas rooted in reality
(sorry, no flying pigs…. yet….)
This section is based on student’s creativity. Encourage practical ideas.
92
Appendix 1. Ordering instructions for primers*
1. Go to http://www.idtdna.com/site
2. Find the “Products” dropdown menu go to “DNA/RNA synthesis” and then “Custom DNA Oligos.” You should
now be on the “Custom Oligonucleotide Synthesis” webpage.
3. Find the “Multiple Entry” option on this webpage and enter “6” (if completing all three lessons in this
curriculum) and then click “Go”.
4. There are now six places to add a custom oligonucleotide names/sequences. There are many possible options on
this website, but none of them need to be used. For each sequence you will need to add a specific name and actual
sequence. Use the below chart to simply ordering (make sure all letters are entered on the website in upper case):
Name
Sequence
1 Lesson 1 Forward Primer
2 Lesson 1 Reverse Primer
3 Lesson 2 Forward Primer
5’ CAC TAC TTT CTC TTA TGG TGT TCA AT 3’
5’ ACA AGT GTT GGC CAT GGA A 3’
5’ CAC TAC TTT CTC TYR KGG TGT TCA ATG 3’
Lesson 3 Forward Primer,
4 PCR reaction #1
5
6
5’ CAC TAC TCT GAC TCA TGG TGT TCA ATG CTT TTC C3’
Lesson 3 Forward Primer,
PCR reaction #2
Lesson 3 Reverse Primer,
PCR reaction #2
5’ TCG AGT ACA ACT TTA ACT CAC ACA ATG 3’
5’ GTT TGT GTC CGA GAA TGT TTC 3’
5. Once all sequences are added, click “Add to Order” and you will be taken to your “Shopping Cart”.
6. Click “Checkout” and you will be prompted to setup an account
7. Fill in the account creation form and submit
8. Now that you have an account, return to your “Shopping Cart” and click “Checkout”
9. Fill out all information and submit order
th
*All instructions were current as of July 14 , 2013. Future website updates cannot be accounted for.
93
References
1. Pliny, J. Bostock and H. T. Riley. The natural history of Pliny, Book XXXII.Remedies derived from aquatic animals. Chapter
52—Other aquatic productions. Adarca or Calamochnos: three remedies. Reeds: eight remedies. The ink of the sæpia. Gaius
Plinius Secundus (Pliny the Elder). AD77., H. G. Bohn, London. 1855.
2. Shimomura, O., Y. Saiga, and F. H. Johnson. "Purification and properties of aequorin, a bio-(chemi-) luminescent protein
from jelly-fish, Aequorea aequorea." Fed Proc., 1962, Vol. 21.
3. Chalfie, M. and S. Kain, Green fluorescent protein: properties, applications, and protocols, Wiley-Interscience, Hoboken,
NY, 2nd edn, 2006.
4. Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W. and Prasher, D. C. “Green fluorescent protein as a marker for gene
expression.” Science, 1994, 263, 802-805.
5. Cody, C. W., D. C. Prasher, W. M. Westler, F. G. Prendergast and W. W. Ward, Biochemistry, 1993, 32, 1212–1218.
6. http://www.bio-rad.com/LifeScience/pdf/Bulletin_9563.pdf
7. Griffith, F.. The significance of pneumococcal types. J. Hyg, 1928, 27:113-159.
8. Avery, O. T., C. M. MacLeod, and M. McCarty. “Studies on the chemical nature of the substance inducing transformation of
pneumococcal types. Induction of transformation by a desoxyribonucleic acid fraction isolated from pneumococcus type III.”
J. Exp. Med., 1944, 89:137-158.
9.Heim, R., Prasher, D. C., and Tsien, R. Y. (1994). Wavelength mutations and posttranslational autoxidation of green
fluorescent protein. Proc Natl Acad Sci, USA. Dec 20;91(26):12501-4.
10. Cody, C. W., Prasher, D. C., Westler, W. M., Prendergast, F. G. and Ward, W. W., Biochemistry, 1993, 32, 1212–
1218.
11. Kuchner, O., Arnold, F. H. 1997. Directed Evolution of Enzyme Catalysts. Trends in Biotechnology,15, 523-530.
12. Stemmer, W.P.C. 1994. Rapid evolution of a protein in vitro by DNA shuffling. Nature, 370, 389–391.
13. Stemmer, W.P.C.1994. DNA shuffling by random fragmentation and reassembly: In vitro recombination for
molecular evolution. Proc. Natl. Acad. Sci. USA, 91, 10747–10751.
14. Moore, J.C., Jin, H.-M., Kuchner, O. and Arnold, F.H. 1997.Strategies for the in vitro evolution of protein
function: enzyme evolution by random recombination of improved sequences. J Mol Biol. Sep 26;272(3):336-47.
15. Shao, Z., Zhao, H., Giver, L., and Arnold, F.H. 1998. Random-priming in vitro recombination: an effective tool for
directed evolution. Nucleic Acids Research, Vol. 26, No. 2.
16. Liao, H., McKenzie, T. and Hageman, R. 1986. Proc. Natl. Acad. Sci. USA. 83, 576-580.
17. Day, R.N. and Davidson, M. W. 2009. The fluorescent protein palette: tools for cellular imaging. Chem. Soc. Rev.,
38, 2887-2921.
18. Yang, T. T., Sinai, P., Green, G., Kitts, P. A., Chen, Y. T., Lybarger, L., Chervenak, R., Patterson, G. H., Piston, D. W.,
and Kain, S. R. 1998. Improved fluorescence and dual color detection with enhanced blue and green variants of the
green fluorescent protein. J. Biol. Chem. 273, 8212-8216.
94