Receptor tyrosine kinases in granulosa cells of ovulating follicles in mice
Yasmin Schuermann, Department of Animal Science
Macdonald Campus, McGill University, Montreal
July 2014
A thesis submitted to McGill University in partial fulfillment of the requirements of the
degree of Master of Science
© Yasmin Schuermann, 2014
“Learn from yesterday, live for today, hope for tomorrow. The important thing is to not
stop questioning.”
-Albert Einstein
1
ABSTRACT
Successful expulsion of a fertilizable oocyte from follicles, ovulation, requires the
actions of extracellular and intracellular signals including those mediated by receptor
tyrosine kinases (RTKs) and growth factors. The activation of the epidermal growth
factor receptor (Egfr) has been well established during ovulation induced by the
preovulatory surge of luteinizing hormone (LH). However, potential roles for other RTKs
and their respective growth factors have not been thoroughly studied during ovulation.
Therefore, the aim of this project was to analyze growth factor signaling induced by LH
in mouse granulosa cells of ovulating follicles. Granulosa cell samples were collected
from immature mice, superstimulated with equine chorionic gonadotropin (eCG) and
human chorionic gonadotropin (hCG) at 48h apart. We used the Mouse Phospho-RTK
Array Kit to systematically catalogue the RTKs that are activated by LH signaling. There
was an increase in phosphorylation of fibroblast growth factor receptor 2 (Fgfr2) and
ephrin receptor B1 (EphB1) in granulosa cells at 4h post-hCG when compared to 0h
hCG. We measured the expression of the genes encoding Fgfr isoforms and EphB1
along with their respective ligands. The relative mRNA abundance of the receptors did
not change upon hCG treatment. However, transcript levels of their respective ligands,
fibroblast growth factor 2 (Fgf2) and ephrin-B1 (Efnb1), increased significantly at 4h
post-hCG. We also found that protein abundance of Fgf2 increased at hCG4h. Further
qPCR analyses revealed that increased Fgf2 expression was associated with
decreased mRNA abundance of Spry3, a member of the Sprouty family of proteins
known to inhibit FGF signaling. Finally, intraperitoneal treatment with two Fgfr inhibitors
(AZD4547 or BGJ398) did not alter ovulation rate when compared to vehicle treatment.
Taken together, the present study investigated two RTK pathways in granulosa
cells of preovulatory ovulating follicles in mice. The ovulatory stimulus with hCG induces
the expression of the ligands Fgf2 and Efnb1 in association with increased
phosphorylation of their respective receptors, Fgfr2 IIIC and Ephb1 in granulosa cells.
However, FGF and ephrin pathways do not appear to be obligatory for ovulation. Their
temporal association with luteinization suggests that they may participate in the
formation of the CL, which require further investigation.
2
RESUME
Expulsion d'un ovocyte fécondable à partir des follicules nécessite l'action des
signaux extracellulaires et intracellulaires, y compris ceux médiés par les récepteurs de
tyrosine kinase (RTK). L'activation du récepteur épidermique de facteur de croissance
(Egfr) a été bien établi suivant le pic préovulatoire de l'hormone lutéinisante (LH).
Cependant, les rôles potentiels pour les autres RTK et de leurs facteurs de croissance
respectifs n'ont pas été profondement étudiées au moment du pic LH. Par conséquent,
l'objectif de ce projet était d'analyser la signalisation des facteurs de croissance induite
par LH dans les cellules de la granulosa de souris. Des échantillons de cellules de la
granulosa ont été recueillies à partir des souris, superstimulé avec la gonadotrophine
chorionique équine (eCG) et la gonadotrophine chorionique humaine (hCG) à 48 h
d'intervalle. Nous avons utilisé le Mouse Phospho-RTK Array Kit afin de determiner les
RTK qui sont activés par une signalisation de LH. Il y avait une augmentation de la
phosphorylation du récepteur de fibroblastes de facteur de croissance 2 (Fgfr2) et le
récepteur éphrine B1 (Ephb1) dans les cellules de la granulosa à 4h hCG par rapport à
0h hCG. Nous avons mesuré l'expression des gènes codant pour des isoformes Fgfr et
Ephb1 avec leurs ligands respectifs. L'abondance de l'ARNm relative des récepteurs n'a
pas changé sur le traitement de l'hCG. Cependant, les niveaux de leurs facteurs de
croissance respectifs, Fgf2 et Efnb1, ont augmenté de manière significative à hCG4h.
Nous avons également constaté que l’abondance de protéine de Fgf2 a augmenté à
hCG4h. De plus, l'augmentation de l'expression du Fgf2 a été associée à une
diminution de la quantité d'ARNm Spry3, un membre de la famille Sprouty de protéines
connues pour inhiber la signalisation de Fgf. Enfin, le traitement par voie
intrapéritonéale avec deux inhibiteurs de Fgfr (AZD4547 ou BGJ398) n'a pas modifié le
taux d'ovulation. Dans l'ensemble, la présente étude a identifié deux nouvelles voies
RTK dans les cellules de la granulosa des follicules pré-ovulatoires chez la souris. Le
stimulus ovulatoire de hCG induit l'expression du Fgf2 et Efnb1 en liaison avec une
phosphorylation accrue de leurs récepteurs respectifs, Fgfr2 IIIC et EphB1 dans les
cellules de la granulosa. Cependant, les voies de signalization de Fgfs et éphrines ne
semblent pas être obligatoire pour l'ovulation. Leur association temporelle avec la
lutéinisation suggère qu'ils peuvent participer à la formation de la CL.
3
CONTRIBUTION OF AUTHORS
Authors of the presented manuscript
Yasmin Schuermann, Dayananda Siddappa, Melissa Pansera and Raj Duggavathi
Raj Duggavathi designed experiments, analyzed data, wrote the manuscript and
supervised the primary author. Yasmin Schuermann designed and conducted all of the
experiments, analyzed the data and wrote the manuscript. Dayananda Siddappa and
Melissa Pansera assisted Yasmin Schuermann in experiments and data analysis.
4
ACKNOWLEDGEMENTS
Another segment of my journey is coming to an end. I was given the opportunity
to work with a wonderful group of professors and students. My committee members,
Roger Cue and Vilceu Bordignon, have graciously assisted me throughout my Masters
for which I am very appreciative.
I would like to give special thanks to my supervisor Dr. Raj Duggavathi for all the
support throughout my studies, which include providing me with fundamental building
blocks for a future in animal science. Under his supervision, I was able to learn from my
mistake, gain confidence and overcome the struggles of writing concisely and
informatively. Dr. Duggavathi has given me the opportunity to take part in a number of
different projects, all of which gave me a chance to enhance my laboratory techniques
and broaden my knowledge in biology.
Furthermore, I would like to acknowledge Barbara Stewart and Cinthya Horvath
for their always friendly and helpful tips when it came to addressing what seemed like
endless administrative dilemmas. And of course, I would like to thank the amazing and
wonderful friends I have gained throughout this journey (Giustino (you are an
inspiration), Monique, Melissa, Daya, Karina, Guto, Keith, Eliza, Romain, Christine,
Tania, Naomi, Rodrigo, Ben, Joana and Lain). We shared a lot of laughs, which made
this experience truly enriching.
In addition, I am extremely thankful for the constant support I received from my
family. Together with my wonderful parents and my friends at the Macdonald Campus
Farm I have greatly enjoyed my experience.
I would like to recognize my sources of funding:
1. Department of Animal Science (McGill): Graduate Excellence Award obtained in
September 2013
2. Réseau Québécois en Reproduction: RQR-CREATE Scholarship received both
in April 2012 & May 2013
3. Department of Animal Science (McGill): Graduate Excellence Award obtained in
September 2012
4. Saputo Inc. : Saputo Award received March 2012
5
TABLE OF CONTENTS
ABSTRACT .................................................................................................................... 2
RESUME ......................................................................................................................... 3
CONTRIBUTION OF AUTHORS .................................................................................... 4
ACKNOWLEDGEMENTS ............................................................................................... 5
TABLE OF CONTENTS.................................................................................................. 6
LIST OF ABBREVIATIONS ............................................................................................ 9
CHAPTER I. INTRODUCTION ..................................................................................... 12
CHAPTER 2. REVIEW OF THE LITERATURE ............................................................ 14
2.1 Setting the scene ............................................................................................... 14
2.1.1 It just keeps going and going: Folliculogenesis .............................................. 14
2.1.2 Before there were gonadotropins .................................................................. 15
2.1.3 Welcome FSH signaling ................................................................................. 15
2.1.4 Ovarian steroidogenesis ................................................................................. 16
2.1.5 Almost there: Ovulation .................................................................................. 17
2.1.6 Vital remnants ................................................................................................ 17
2.2 Receptor Tyrosine Kinases (RTKs) ..................................................................... 18
2.2.1 Can you spot the difference ............................................................................ 18
2.2.2 Growth factors transmit messages via RTKs ................................................. 19
2.2.3 Message delivery............................................................................................ 20
2.2.4 This is why we should care............................................................................. 21
2.3 Activated RTKs in the Ovary ................................................................................ 22
2.3.1 RTK signaling and the ovary .......................................................................... 22
2.3.2 RTKs and gonadotropin signaling in granulosa cells ...................................... 24
2.3.3 The 7 wonders: Notable families in ovarian signaling ..................................... 24
2.3.3.1 Platelet-derived growth factor family ....................................................... 25
2.3.3.2 Neurotrophin family ................................................................................ 26
2.3.3.3 Vascular endothelial growth factor family ............................................... 26
6
2.3.3.4 Insulin-like growth factor family ............................................................... 27
2.3.3.5 Ephrin family ........................................................................................... 28
2.3.3.6 Epidermal growth factor family ............................................................... 29
2.3.3.7 Fibroblast growth factor family ................................................................ 30
2.4 Keeping it under control: Sprouty family ............................................................ 31
CHAPTER 3 RATIONALE, HYPOTHESIS AND OBJECTIVES ................................... 33
CHAPTER 4 ARTICLE: Activated receptor tyrosine kinases in granulosa cells of
murine ovulating follicles. ......................................................................................... 34
4.1 ABSTRACT ............................................................................................................ 35
4.2 INTRODUCTION ..................................................................................................... 36
4.3 MATERIALS AND METHODS ................................................................................ 37
4.3.1 Animals ...................................................................................................... 37
4.3.2 Superovulation ........................................................................................... 37
4.3.3 Granulosa Cell Collection .......................................................................... 37
4.3.4 Mouse Phospho-RTK Array Kit ................................................................. 38
4.3.5 RNA Extraction and Real-time PCR (qPCR) ............................................. 38
4.3.6 Immunohistochemistry ............................................................................... 39
4.3.7 Protein Extraction and Immunoblot ............................................................ 40
4.3.8 RTK inhibitor studies.................................................................................. 40
4.3.9 Statistical Analysis ..................................................................................... 41
4.4 RESULTS ............................................................................................................... 42
4.4.1 Global Approach: Phosphorylated RTKs ................................................... 42
4.4.2 Transcript abundance of RTKs in granulosa cells .................................... 42
4.4.3 Transcript abundance of ligands in granulosa cells .................................. 42
4.4.4 Fgf2 in the murine ovary ............................................................................ 43
4.4.5 The Sprouty genes .................................................................................... 43
4.4.6 Inhibition of Fgfr signaling during ovulation................................................ 43
4.5 DISCUSSION .......................................................................................................... 43
4.6 ACKNOWLEDGEMENTS ....................................................................................... 47
7
4.8 FIGURES AND FIGURE LEGENDS ....................................................................... 48
4.9 TABLE 1 ................................................................................................................. 55
CHAPTER 5 CONCLUSION ......................................................................................... 56
CHAPTER 6 REFERENCES ........................................................................................ 57
8
LIST OF ABBREVIATIONS
3β-HSD:
3β-hydoxysteroid dehydrogenase
Actb:
Beta actin
Adamts1:
A disintegrin and metalloproteinase 1
ADB:
Antibody diluting buffer
ANOVA:
Analysis of variance
Areg:
Amphiregulin
Bdnf:
Brain-derived neurotrophic factor
Btc:
Betacellulin
BMP15:
Bone morphogenic protein 15
cAMP:
Cyclic adenosine mono phosphate
cDNA:
complementary deoxyribonucleic acid
Cebpβ:
CCAAT enhancer binding protein Beta
CL:
Corpus luteum
Cyp19a1:
Aromatase
DMSO:
Dimethyl sulfoxide
E2:
Estradiol
eCG:
equine Chorionic Gonadotropin
ECL:
Electrochemiluminescence
ECM:
Extracellular matrix
EDTA:
Ethylenediminetetraacetic acid
Efnb1, b2:
Ephrin B1, B2
Egf:
Epidermal growth factor
Egfr:
Epidermal growth factor receptor
Egfr1:
Epidermal growth factor receptor-1
Egr1:
Early growth regulatory factor-1
EMT:
Epithelial-mesenchymal transition
Ephb1, b2:
Eph receptor B1, B2
ER:
Estrogen receptor
Erbb:
Epidermal-like growth factor receptor
Ereg:
Epiregulin
9
ERK1/2:
Extracellular regulated MAP kinase 1/2
Fgf:
Fibroblast growth factor
Fgf1,2,8,9:
Fibroblast growth factor 1,2,8,9,
Fgfr(1-4):
Fibroblast growth factor receptor (1-4)
Figla:
Factor in the germline alpha
FOXO3a:
Forkhead box O3a
FSH:
Follicle-stimulating hormone
FSHr:
Follicle-stimulating hormone receptor
GnRH:
Gonadotropin releasing hormone
G-D:
Gonadotropin-dependent
Gdf9:
Growth differentiation factor 9
G-I:
Gonadotropin-independent
Has2:
Hyaluronan synthase 2
hCG:
human Chorionic Gonadotropin
HDL:
High-density lipoprotein
HMW:
High molecular weight
HRP:
Horseradish peroxidase
IB:
Immunoblot
Igf-1,2,:
Insulin-like growth factor 1,2
Igfr:
Insulin-like growth factor receptor
Ir:
Insulin receptor
IU:
International unit
Kitl:
Kit ligand
LDL:
Low-density lipoprotein
LDL-R:
Low-density lipoprotein receptor
LH:
luteinizing hormone
Lhcgr:
LH/ choriogonadotropin receptor
LLC:
Large luteal cells
LMW:
Low molecular weight
Lrh1:
Liver receptor homolog 1
MAPK:
Mitogen-activated protein kinase
10
mRNA:
messenger ribonucleic acid
NBF:
Neutral buffered formalin
Ngf:
Nerve growth factor
NOBOX:
Newborn ovary homeobox
Nr4a2:
Nuclear receptor 4a1
Ntrk1:
Neurotrophic tyrosine kinase, receptor, type 1 (TrkA)
Ntrk2:
Neurotrophic tyrosine kinase, receptor, type 2 (TrkB)
P4:
Progesterone
P450 scc:
P450 side chain cleavage (Cyp11a1)
PI3K/AKT:
Phosphatidylinositol 3-kinase/protein kinase B
PBS:
Phosphate buffered saline
Pdgf:
Platelet-derived growth factor
PKA:
Protein kinase A
PKC:
Protein kinase C
Pgr:
Progesterone receptor
PTB:
Phosphotyrosine binding
Pten:
Phosphatase and tensin homolog
Ptgs2:
Prostaglandin-endoperoxide synthase 2
qPCR:
quantitative polymerase chain reaction
RTK:
Receptor tyrosine kinase
SH2:
Src homology 2
SLC:
Small luteal cells
Spry:
Sprouty
SRB1:
Scavenger receptor class B type 1
Star:
Steroidogenic acute regulatory protein
STAT:
Signal transducers and activators of transcription
TBS:
Tris buffered saline
TBS-T:
Tris buffered saline- tween
Vegf:
Vascular endothelial growth factor
Vegfr:
Vascular endothelial growth factor receptor
11
CHAPTER 1. INTRODUCTION
The study of ovarian biology has come a long way in last century and the field is
continuously growing in knowledge, yet a number of questions regarding follicular
development and oocyte maturation remain unanswered.
Communication between somatic cells and the oocyte is crucial for the
development of a fertilizable oocyte. Throughout follicular growth and development,
paracrine, autocrine and endocrine signaling within the follicular network of cells results
in activation of numerous transduction pathways 1. Specifically, phosphorylation of
receptor tyrosine kinases (RTKs) by growth factors can activate the MAPK-ERK1/2 and
PI3K-AKT pathways, which subsequently regulate expression of genes indispensable
for ovulation and development of the corpus luteum
2,3
. Moreover, it has been well
established, that phosphorylation of the c-kit receptor is pivotal for oocyte maturation,
while phosphorylation of vascular endothelial growth factors receptors (VEGFRs), in
theca cells, is necessary for vascularization and survival of the corpus luteum
4,5
. In
addition, stimulation by follicle-stimulating hormone (FSH) and luteinizing hormone (LH)
regulate the activation of certain RTKs by inducing expression of growth factors
required for RTK activation, including the insulin-like growth factor receptors (IGFRs)
and epidermal growth factor receptors (EGFRs), located on granulosa cells6,7.
Although, there is generally a broad pool of knowledge related to RTK signaling
in the ovary, of which over 60 RTKs that have been identified, there remain many
significant differences amongst signaling in different species that need to be further
investigated2. Moreover, induced RTK signaling during the LH surge has not been fully
investigated in murine granulosa cells, which will be addressed in this thesis.
Ultimately, exogenous stimulation by LH results in low molecular weight fibroblast
growth factor 2 (Fgf2) and ephrin-b1 (efnb1) being induced, which are linked to the
activation of Fgfr2 and Ephb1, respectively, and most probably trigger downstream
signaling cascades such as MAPK-ERK1/2 and/or PI3K-AKT. Therefore, the results
presented in this thesis can provide a simpler model to study fgfr signaling and can be
used for further bovine Fgfr signaling research. As for Ephrin signaling in granulosa
cells following the LH surge, limited research has been presented, suggesting that these
12
results can pave the way for further intrigue directed towards Efnb1-EphB1 signaling
prior to ovulation.
This thesis is organized in chapters that present background information on RTK
signaling in the ovary, followed by an article, which clearly presents the experimental
design and analyzed results.
13
CHAPTER 2. REVIEW OF THE LITERATURE
1.1 Setting the scene
The ovary is a complex organ vital for its role in reproduction. This female gonad
becomes differentiated during early embryonic development. Its recognition during
prenatal development can be attributed to its by the presence of germs cells that
migrate into the gonad and form specialized germs cells, known as oogonia 8. Following
mitosis, the germ cells undergo meiosis at which time they are engulfed within follicles.
At this stage, the ovary becomes an organized organ comprising of an outer cortex
region filled with primordial follicles characterized by oocytes surrounded by one layer of
granulosa cells 9.
2.1.1 It just keeps going and going: Folliculogenesis
Females are born with a set number of oocytes that with each menstrual/estrous
cycle will supply mature oocyte(s) for fertilization throughout reproductive life. Although
the majority of the available follicles undergo atresia, the rest are continuously recruited
for growth within the follicular pool 10,11. The oocytes, found in primordial follicles, will
remain arrested at prophase of meiosis I until ovulation. Only a selected few of the
primordial follicles will increase in size and gradually acquire capability to ovulate along
with oocyte acquiring ability to resume meiosis 12,13. A series of signaling cascades
within ovarian cells takes place in order to control oocyte maturation and ensure that
resumption of meiosis and ovulation are coordinated.
Traditionally, we have divided folliculogenesis, maturation of the follicles from the
primordial stage, into three stages, starting with (a) recruitment, defined by the rapid
growth of a pool of follicles, followed by (b) selection, which includes a specific group of
follicles that undergo further growth and ultimately, (c) dominance, at which time the
dominant follicle(s) experiences rapid growth and development
14
. Essentially,
folliculogenesis occurs in gonadotropin-independent (G-I) and gonadotropin-dependent
(G-D) phases. The second phase is characterized by gonadotropin-releasing hormone
(GnRH), released from the hypothalamus, which promotes the release of follicle
stimulating hormone (FSH) and luteinizing hormone (LH). These pituitary hormones act
14
directly on the ovary to stimulate growth and steroidogenesis
15
.
A wide array of growth factors are involved throughout the course
folliculogenesis. Continuous growth and maturation is clearly observed via changes in
the vasculature and nervous system in the follicles as well as by morphological and
functional changes of the oocyte and the surrounding somatic cells, granulosa and
theca 14. To sum up growth of the follicle, it undergoes a series of changes, which will
be explained in the following sections: Germ Cells (G-I) Primordial follicle (G-I)
Primary follicle (G-I) Secondary follicle (G-I) Antral Follicle (G-D) Ovulation (G-D),
2.1.2 Before there were gonadotropins
Primordial follicles are distinguishable from germ cells by the presence of
surrounding somatic cells. The oocyte transcription factor Newborn ovary homeobox
protein (NOBOX) is necessary for growth past the primordial stage
16
. Once follicles
begin to grow, Kit ligand (Kitl), a growth factor, expressed by granulosa cells binds to its
receptor tyrosine kinase (RTK), Kit, located on the oocyte and surrounding theca cells.
Together the somatic cells and the oocyte communicate via growth factors such as Kitl
which regulate follicular growth 17. Neurotrophins also play a pivotal role in
gonadotropin-independent follicular growth by influencing the differentiation from
squamous to cuboidal cells if signaling via neurotrophin receptor Ntrk2 is impaired there
is a decrease in the overall transition from primary to secondary follicles 18.
Another subset of growth factors, growth differentiation factor 9 (Gdf9) and bone
morphogenic protein 15 (BMP15) of oocyte origin play a key role in subsequent growth
from the primary follicle. Therefore, signaling among follicular cells through growth
factors and their receptors allows for development of the pre-antral follicle that
eventually becomes dependent on gonadotropin signaling 11.
2.1.3 Welcome FSH signaling
The follicle enters the gonadotropin-dependent stage as a small antral follicle subject
to stimulation by pituitary FSH. Granulosa cells are equipped with FSH-receptors
required for transmission of FSH signaling 19. Upon FSH stimulation there is an increase
in proliferation and growth of granulosa cells, and the formation of a fluid filled cavity,
15
the antrum 20. Ultimately, granulosa cells are divided into 2 distinct and functional
populations: cumulus and mural granulosa cells. The cumulus cells surround the
oocyte, while the mural granulosa cells surround the antrum
21
. In addition to the
phenotypical and morphological changes induced by FSH, over 100 genes are activated
in granulosa cells required for further growth of the dominant follicle(s) 20. This includes
activation of genes encoding the LH receptor, Lhcgr, exclusively found on granulosa
cells 20,22. Taken together, the follicle has undergone proliferation of granulosa cells, and
can now be established as a large antral follicle (preovulatory) characterized by
estradiol (E2) synthesis and expression of the LH receptor required for LH stimulation 23.
2.1.4 Ovarian steroidogenesis
The production of two major steroids, 17β-estradiol (E2) and progesterone (P4), is vital
for ferility 24. Cholesterol is the substrate that is found in one of two major forms: lowdensity lipoprotein (LDL) and high-density lipoprotein (HDL). They are predominantly
synthesized in the liver and delivered to ovarian tissue by transport provided by the
LDL-receptor (LDL-R) or the scavenger receptor class B type 1 (SRB1), respectively
25,26
. If there is an insufficient amount of cholesterol in circulation, luteal (theca and
granulosa) cells can synthesize it de novo from acetyl coenzyme A 27. Once in the
ovarian cells, cholesterol is transported from the outer to the inner mitochondrial
membrane, by means of the steroidogenic acute regulatory protein (Star), which is
increased following stimulation by LH. Cholesterol is then converted to pregnenolone by
the enzyme P450 side chain cleavage (P450scc) (also known as Cyp11a1). Theca cells
can synthesize androgens from pregnenolone, which then diffuses to the granulosa
cells where Cyp19a1 (aromatase) is aromatize androgens to E2. However, a shift from
E2 synthesis to progesterone occurs following the LH surge. Essentially, theca cells of
growing follicles and luteal cells from the corpus luteum (CL) can convert pregnenolone
to progesterone by 3β-hydoxysteroid dehydrogenase (3β-HSD) 27. In addition, the LH
surge initiates a significant decrease in Cyp19a1, resulting in a dramatic decrease in
estrogen produced by granulosa cells. The decrease in Cyp19a1 is a result of binding of
the transcription factor nuclear receptor 4a1(Nr4a2) to the Cyp19a1 promoter region to
repress its expression 28. However, in response to this decrease there is an increase in
16
Cyp11a1 and 3β-HSD, progesterone-producing and steroidogenic enzymes,
transitioning granulosa cells to progesterone-producing luteal cells 27,29.
2.1.5 Almost there: Ovulation
LH receptors, Lhcgr, are expressed on granulosa cells of large antral follicles and the
increasing concentration of E2 by the preovulatory follicle positively feeds back to the
hypothalamus causing an increase in GnRH, followed by a surge release of LH 30.
Granulosa cell stimulation by LH activates the mitogen activated protein kinase (MAPK)
and protein kinase A (PKA) signaling pathway, which leads to overall changes in gene
expression required for ovulation and luteinization. Some of these genes have been
thoroughly investigated including: CCAAT enhancer binding protein Beta (Cebpβ), early
growth regulatory factor-1 (Egr1), liver receptor homolog 1 (Lrh1), steroidogenic acute
regulatory protein (Star), the progesterone receptor (Pgr) and prostaglandinendoperoxide synthase 2 (Ptgs2) 31,32. Also, following LH stimulation proteins required
for remodeling of the extracellular matrix (ECM) such as a Disintegrin and
Metalloproteinase 1 (Adamts1) and certain growth factors assisting overall follicular
growth and maturation including epidermal like growth factors: epiregulin (Ereg),
amphiregulin (Areg) and betacellulin (Btc) are imperative to ovulation
3,33
. If any of the
previously mentioned genes and proteins are deleted, there is a deleterious effect on
ovulation since one, some or all of the following transformations are compromised:
granulosa cell differentiation, progesterone production, oocyte meiotic resumption,
cumulus cell expansion, follicular rupture and luteinization 31.
2.1.6 Vital remnants
Once the oocyte is expelled into the oviduct, follicular remnants from the ovulated
follicle remain in the ovary and morph into the corpus luteum, a vital endocrine gland.
The corpus luteum (CL) is responsible for the production of progesterone, which is
essential for the maintenance of pregnancy 29. Luteinized theca and granulosa cells are
named small and large luteal cells (SLC & LLC), respectively. The population of luteal
granulosa cells, expressing LH receptors, increases drastically and these LLC are key
regulators of progesterone synthesis 34 .
17
In summation, for a follicle to grow and mature with the eventual hope of ovulation, a
number of signaling cascades are successively initiated independent and dependent of
gonadotropins. It is the receptor tyrosine kinase (RTKs) signaling cascades, which act in
ovarian tissue that will be further reviewed.
2.2 Receptor Tyrosine Kinases (RTKs)
RTKs are activated by growth factors and transduce signals via a series of cascades
including: the mitogen activated protein kinase (MAPK), signal transducers and
activators of transcription (STAT), protein kinase C (PKC) or phosphatidylinositide 3kinase (PI3K) pathways. All of these pathways play central roles in cell proliferation,
differentiation, growth, maturation and survival 2.
2.2.1 Can you spot the difference
There are approximately 60 identified RTKs, which are carefully divided into 20
subfamilies (Figure 1 A) 35,36. Also, certain subfamilies contain various isoforms of a
specific receptor (i.e. fibroblast growth factor receptors) as a result of alternative
splicing37 (Figure 1 B). Each receptor is equipped with a binding site specific for one or
more ligands, indicating the diversity and promiscuous nature of these receptors. For
example, Ephrin receptor B1 (Ephb1), illustrated in class 12 in Figure 1 A, has the ability
to bind 3 ligands: ephrinA3 (efna3), ephrinB1 (efnb1) and ephrinB2 (efbn2)
38,39
.
Figure 1 B includes the subfamilies and their receptors that will be reviewed in
the chapter 3 for their participation in follicular growth and CL development. Ultimately,
signaling is initiated by ligand specific activation of cell surface receptors with intrinsic
tyrosine kinase activity.
A
18
B
Key Subfamilies
Key Receptors
Epidermal Growth Factor:
Egfr (Erbb1, Erbb2, Erbb3 and Erbb3)
Insulin:
Insulin receptor, Insulin-like growth factor receptor-1 and -2
Platelet-derived growth factor:
c-kit
Fibroblast growth factor:
(Alternative splicing has led to the
inclusion of many isoforms)
Fgfr1 (Fgfr1 –IIIb, -IIIc), Fgfr2 (Fgfr2 –IIIb, IIIc), Fgfr3 (Fgfr3 –IIIb,
37
IIIc) and Fgfr4
Vascular endothelial growth factor:
Vegfr-1, -2 and -3
Neurotrophic factor:
Ntrk1 (TrkA), Ntrk2 (TrkB) and Ntrk3 (TrkC)
Ephrin:
EphrinA1-8 (Epha1-8) and EphrinB1-6 (Ephb1-6)
Figure 1: A) A look at the structural components from the RTK subfamilies. Adapted
from 35. Only 16 established subfamilies are illustrated. B) 7 pivotal RTK families and
the receptors that belong to each family.
2.2.2 Growth factors transmit orders via RTKs
RTKs are typically located on the plasma membrane as inactive monomers or
dimers. Upon binding of the ligand to the receptor binding site, a signal cascade is
initiated and cell surface information is conveyed within the cell to the nucleus 2. When
inactive, the receptor is present as separate monomers, with the exception of one
19
subfamily of RTKs, the insulin-like growth factor subfamily in which case the receptors
are present as inactive dimers (Figure 1 A). Nonetheless, ligands attach to the receptorbinding site and induce a conformational change resulting in dimerization of the receptor
subunits. Following this structural transformation, the cytoplasmic tyrosine kinase
domains are autophosphorylated using adenosine triphosphate (ATP). At this point,
RTKs can recruit and activate various signaling proteins, leading to stimulation of
cellular growth, differentiation and proliferation, angiogenesis and tissue repair.
A specific RTK is equipped with approximately 10 tyrosine kinase domains that
can activate transduction of different signaling cascades, through docking sites provided
by autophosphorylated tyrosine kinase domains. These sites can bind Src homology 2
(SH2) or phosphotyrosine binding (PTB) domains of different signaling proteins leading
to subsequent activation of signaling cascades. In this way, RTKs are unique to other
receptors, such as G-protein coupled receptors, in their ability to regulate growth and
other cellular responses in more than one way through the many tyrosine kinase
domains (Figure 2) 2,35,40.
Figure 2: Simplistic version of the receptor tyrosine kinase activation. Where GF=
growth factor, Tyr= Tyrosine kinase domain and P= Phosphate group
2.2.3 Message delivery
A number of signaling cascades are activated by RTKs including: the mitogen
activated protein kinase (MAPK), signal transducers and activators of transcription
(STAT), protein kinase C (PKC) and phosphatidylinositide 3-kinase (PI3- K) pathways41,
as portrayed in figure 3.
20
Figure 3: Three signaling pathways activated by RTKs upon growth factor binding and
subsequent autophosphorylation.
The four pathways are required for their role in regulation of transcription factors
resulting in cellular proliferation and differentiation. Moreover, the MAPK and PI3K
pathways can be activated by all RTKs. The cascade of events that occurs to invoke a
cellular response begins with the phosphorylated tyrosine residues, which act as
docking sites for downstream signaling molecules. For example, an adaptor molecule,
such SH2 or PTB, use the phosphorylated tyrosine domains as docking sites, where
they bind to and act a signal relay proteins between the receptor and downstream
signaling proteins such as growth factor receptor-bound protein 2 (Grb2), which
subsequently activates signaling pathways. Typically, Grb2 recruits Ras to the activated
RTK, which is consequently phosphorylated and responsible for the activation of
multiple downstream signaling cascades, most notably MAPK. Ultimately, the activation
of different RTKs can have similar effects on a target cell leading to signal amplification
2,42
.
2.2.4 This is why we should care
RTKs are greatly appreciated for activation of signaling pathways (i.e. MAPK), which
ultimately play a role in gene regulation required for development and/or repair of the
21
reproductive, nervous, circulatory and skeletal systems. They are essential mediators of
cell proliferation and differentiation. For example, in the early stages of CL growth,
development of new blood cells is crucial for sustainability and thus, results in the
drastic up-regulation of activated RTKs including, the vascular endothelial growth factor
receptors (VEGFRs), ephrin receptors (EPHRs) and fibroblast growth factor receptors
(FGFRs) 5,43-46. In summary, RTK activation is pivotal for normal and healthy growth and
development of the tissue and the over-expression or deficiency of growth factor
signaling can be detrimental 47.
2.3 Activated RTKs in the ovary
Various RTKs along with their respective ligands have been identified and studied for
their role in follicular growth and maturation and the formation of the CL. Ultimately,
RTKs translate an extracellular signal into a transcriptional response at different stages
of folliculogenesis.
2.3.1 RTK signaling and the ovary
Autocrine and paracrine RTK signaling within and between the oocyte and somatic
cells are required for a primordial follicle to grow and mature into a fully competent
follicle that will ultimately ovulate. Thus far, RTKs along with their respective ligands
have been localized to different follicular compartments, while some are found either in
the same cell type or different ones, allowing for communication between the oocyte
and somatic cells 14. The following Table i provides a brief summary of RTK and growth
factor localization in the follicular cell types. The ovarian follicular fluid, stroma layer and
corpus luteum endothelial cells were not considered. However, it should be noted that
certain RTKs such as VEGFRs and/or their ligands are often localized to the ovarian
endothelial cells, due to their critical role during blood vessel formation of the corpus
luteum 5. Moreover, most of the listed information is based on murine and bovine
studies.
22
Table 1: RTK and ligand localization with respect to the oocyte and granulosa and theca
cells.
Subfamily
Epidermal
growth
factor
receptors
(Egfrs)
Insulin-like
growth
factor
receptors
(Igfrs)
Plateletderived
growth
factor
receptors
(Pdgfrs)
Receptor
Egfr1
Erbb2/Erbb3
(*unique Egfrs
that require
dimerization for
activation)
Location
Murine granulosa cells
48
Murine granulosa Cells
49
Ligands
Epidermal growth
factor (Egf),
Ampiregulin (Areg),
Epiregulin (Ereg) &
Betacellulin (Btc)
Neuregulin 1 (Nrg1)
50
Igf-1r
Murine oocyte Human
and bovine granulosa
51,52
cells
c-Kit
Murine oocyte Murine
55
theca cells Bovine
56
theca cells
Insulin-like growth
factor-1 (Igf1)
17
Kit
57
Poultry granulosa cells
58
Fibroblast
growth
factor
receptors
(Fgfrs)
Fgfr2
Fgfr3
Neurotrophic
tyrosine
kinase
receptors
(Ntrks)
Vascular
endothelial
growth
factor
receptors
(Vegfrs)
Ntrk1 (TrkA)
65
Ntrk2 (TrkB)
Murine oocyte
66
Hen granulosa cells
Vegr1
Swine and bovine theca
68,69
cells
Vegfr2
Epha5
Ephrins
(Ephs)
Murine oocyte,
granulosa and theca
61
cells
Murine oocyte,
granulosa and theca
61
cells
Bovine granulosa and
63
the theca cells
Murine and human
oocyte, granulosa and
17,64
theca cells
Ephb1
Ephb2
Swine and bovine theca
68
cells
Murine granulosa cells
39
Murine granulosa cells
48
Murine granulosa cells
49
Murine granulosa cells
53
Bovine and swine
granulosa and theca
7,54
cells i
Murine granulosa
17
cells
Bovine granulosa cells
56
Bovine granulosa cells
Fgfr1
Location
Fibroblast growth
factor-1, -2, -8 and -9
(Fgf1, Fgf2, Fgf8 and
Fgf9) *can bind to all
3 listed receptors
Nerve growth factor
(Ngf)
Brain-derived
neurotrophic factor
(Bdnf)
Vascular endothelial
growth factors (Vegfs,
isoforms in general)
Ephrin-a5 (Efna5)
Fgf1= Bovine
granulosa and theca
37
cells Fgf2= Murine
granulosa and theca
59
cells Bovine
granulosa and theca
57
cells
60
Fgf8= Murine oocyte
Fgf9= Murine theca
61
and granulosa cells
bovine granulosa
62
cells
Murine and human
oocyte, granulosa and
17,64
theca cells
Murine oocyte and
67
granulosa cells
66
Hen theca cells
Murine oocyte, theca
and granulosa cells
70,71
Swine granulosa cells
68
in swine Bovine
granulosa and theca
72
cells
Murine granulosa cells
39
44
Human theca cells
Human granulosa cells
44
Ephrin-b1 (Efnb1) and
Ephrin-b2 (Efnb2)
Human granulosa cells
73
*RTKs and ligands will not be equally expressed throughout follicular growth and corpus
luteum development in part due to hormonal regulation.
23
2.3.2 RTKs and gonadotropin signaling in granulosa cells
RTK signaling plays a crucial role in granulosa cells during follicular growth and
development. They act as important mediators of FSH or LH stimulation, as will be
clarified in the next section in relation to RTK signaling including the well-established
Egf and Igf subfamilies 21,48,74. Essentially, these gonadotropins use cAMP as a
secondary messenger, which then activates protein kinases such as protein kinase A
(PKA) signaling. Moreover, activation of cAMP allows for cross-talk amongst different
signaling cascades like MAPK and PI3K pathways 31,75, as illustrated in Figure 4.
Therefore, the synergy between various activated RTKs and gonadotropins allows for
amplified signaling within a cell. In short, different RTK signals can help propagate FSH
and/or LH in a paracrine and autocrine manner in the growing follicle.
Figure 4: Basic representation of the link between RTK and gonadotropin signaling in
granulosa cells.
2.3.3 The 7 wonders: Notable subfamilies in ovarian signaling
In the following section, 7 RTK subfamilies are addressed with their respective
ligands for their role during folliculogenesis including the gonadotropin-independent and
gonadotropin-dependent phases and the formation of the CL. Although many more
subfamilies exist, the following 7 have been previously studied for the roles they play in
activating downstream signaling pathways required for follicular growth and maturation.
24
2.3.3.1 Platelet-derived growth factor family (PDGF)
Signaling via the c-Kit receptor, a crucial PDGFR member, is accomplished upon
binding of Kit ligand (Kitl). It is well defined that Kitl expression is located on granulosa
cells and later mural granulosa cells, while c-Kit, is maintained on the oocyte and theca
cell surfaces. c-Kit signaling has been linked to meiotic arrest, oocyte growth and
development, antrum formation, theca cell differentiation and maximizing thecal
androgen output 4,76,77. Most importantly, c-kit signaling allows for oocyte apoptotic
protection, throughout folliculogenesis 78. In Kitl deficient mice, oocyte growth and
development are arrested at the primary stage and the lack of c-kit signaling leads to
infertility 79. c-kit phosphorylation is known to activate the PI3K/AKT pathway, which
enhances oocyte growth and survival. For example, PI3K/AKT signaling leads to
downstream phosphorylation of Forkhead box O3a (Foxo3a), which results in the
inactivation of this transcription factor regulating the expression of Fas (the death
receptor). Therefore, one mechanism of c-kit mediated PI3K signaling is to inhibit Fas
expression by Foxo3a 78,80. Hence, activation of the PI3K pathway is pivotal for oocyte
survival and growth, which in return aids granulosa cell proliferation and differentiation
80
.
Consequently, both kitl and c-kit are expressed on granulosa cells and the
oocyte, respectively, from primordial to pre-antral growth. Upon FSH signaling Kitl
expression is stimulated in granulosa cells and promotes formation of the theca cells 78.
In the antral follicle, the oocyte is nearly fully grown, but has not yet resumed meiosis,
this is in part related to the high expression of Kitl found in the granulosa cells
surrounding the oocyte 78.
However, murine research indicated a drastic induction of Kitl expression 2h to
6h post LH stimulation 31. This increase is limited to mural granulosa cells and not likely
observed in cumulus cells because the latter are surrounding the oocyte, which upon
reaching the stage of the late antral follicle is fully grown. Also, increased androgen
production from neighbouring theca cells could stimulate Kitl expression on granulosa
cells. Hence, there is significant communication between mural granulosa and theca
cells allowing for harmonized follicular growth78.
25
2.3.3.2 The Neurotrophins
Although the neurotrophin family plays a crucial role in neuronal development
and survival, it is also a key mediator during follicular growth. Phosphorylation of
neurotophin recptor kinases Ntrk1 (TrkA) and Ntrk2 (TrkB) receptors by their respective
ligands nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF),
respectively, has been linked with steroidogenesis and oocyte meiotic resumption 65,81.
Dissen et al (1996) concluded that in the ratboth NGF and its receptor Ntrk1 are
located to theca cells and up-regulated following a LH surge. Signaling via this
receptors’ pathway is important for cytodifferentiation of ovarian cells, especially during
the pre-ovulatory stage. NGF and Ntrk1 are also located on granulosa cells even though
they are predominantly located to theca cells. A pair of similar studies, where human
granulosa cells were collected from patients undergoing in vitro fertilization, revealed
that NGF signaling via Ntrk1 stimulates estradiol production directly by increasing FSH
receptor (FSHr) expression and concurrently prevents early luteinization by hindering
premature progesterone production64. They concluded that this activated RTK could
induce the MAPK and PI3K/AKT signaling pathways. Moreover, granulosa cells that
were cultured with NGF experienced an induction of VEGF (which is essential for
angiogenesis) and an inhibition of MAPK caused the opposite effect
81
. Therefore, RTK
signaling from various subfamilies can result in overlapping cellular responses.
2.3.3.3 Vascular Endothelial Growth Factor Family (VEGF)
VEGF occurs as 5 isoforms and signals via VEGFR and it is a pivotal regulator of
angiogenesis, which is initiated during early follicular development
43,82
. Therefore, in
primordial cells there is no VEGF expression. However, it is later found in the follicular
fluid, theca cells of antral follicles and in cumulus cells of preovulatory follicles 70.
Shin et al (2005) explain that FSH and LH stimulation promotes VEGF production
in mice. This leads to increased blood flow and thus increased input of gonadotropin to
the dominant follicle(s). Following ovulation, VEGF is expressed in cumulus and theca
luteal cells. PKA plays a role in gonadotropin-dependent increase of VEGF production.
They suggest that angiogenesis might be regulated through induction of VEGF
26
expression by FSH and LH70. Moreover, VEGF is detected in luteal cells of the corpus
luteum, but limited expression in mural granulosa cells46.
The RTKs which mediate VEGF signaling are termed VEGFR1 and -2 in luteal
granulosa cells of the CL, Vegfr1 is also expressed in the preovulatory follicle
83
.
Moreover, inhibition of VEGFR1 leads to near complete suppression of murine CL
angiogenesis, which is required for maintenance of the CL5. Studying the bovine model,
VEGF concentration increases with follicle growth in theca and granulosa cells, while
VEGFR1 and 2 were weakly expressed in granulosa cells, while it was high in theca
cells 69. Ultimately, VEGFR signaling studies in various species, attributes a key role to
this RTK for angiogenesis and the ability to sustain function of the corpus luteum, by
providing blood vessels which support nutrients and oxygen for maintenance of a
healthy pregnancy.
2.3.3.4 Insulin-Like Growth Factor family
Insulin, insulin-like growth factor-1 (Igf-1) and Igf-2 are the three hormone
peptides that embody the Igf family along with their respective RTKs. Insulin is known to
act principally in the liver by binding to the insulin receptor (IR), while Igf-1 and Igf-2
function in almost every tissue by binding to either the IR, Igf-1 or Igf-2 receptors 84.
Nonetheless, the entire family is known to induce intracellular signaling pathways within
the ovary 85-87.
During ovarian folliculogenesis, granulosa cells undergo critical morphological
changes mediated by gonadotropins and specific growth factor signaling cascades.
Insulin has been demonstrated to act synergistically with FSH to regulate aromatase
activity in granulosa cells and with LH to regulate progesterone production by luteal
cells and androgen production by thecal stromal cells. Female mice that lack insulin
receptors in their neurons show reduced fertility with less antral follicles and corpora
lutea88.
It is well established that Igf-1 is highly expressed in human, murine and bovine
granulosa cells 89,90. Early research has revealed that Igf-1 and FSH-receptor (FSHr)
are co-expressed in follicles, where the former has the ability to increase the expression
of the latter, allowing for increased responsiveness of granulosa cells to FSH 53.
27
Moreover, when comparing the reproductive phenotype of silenced Igf with that of
deleted FSH-Beta subunit, infertility is observed in both cases due to the inability for
follicles to reach full maturity 91,92. Taken together, FSH and Igf1 have the ability to
induce LH-receptors on granulosa cells later during follicular development
93
. Also, the
MAPK-Erk1/2 pathway is activated by Igf-1 signaling pathways for progesterone
production 94,95. Overall, insulin and Igf-1 signal in harmony with gonadotropins and
have the ability to stimulate steroidogenesis, low-density lipoprotein receptor, StAR and
CYP11A gene expression during follicular development required for reproductive
success 9,96. As for Igf-2, previous research has established that Igf-2 acts
predominantly via Igf1r as opposed to Igf2r on both theca and granulosa cells and aids
the induction of steroidogenesis although the effect is less potent than Igf1 7.
2.3.3.5 Ephrin family
The ephrin family is notably one of the largest RTK families, comprising of 14
receptors and 9 ligands 38,39 Within the family, receptors are divided into A-class
(EphA1-8) or B-class (EphB1-6) members depending on anchorage to the plasma
membrane 97. In general, ephrin signaling is implicated in cell location, morphology,
adhesion and migration during development of the mammary gland, kidney, lungs,
nervous system, retina and thyroid 98,99.
As for the role of the ephrin family in folliculogenesis, little is known. A murine in vitro
study conducted by Buensuceo et al (2013) revealed that eCG administration to
immature female mice, led to an increase in the expression of ephrin (Eph) receptors:
Epha3, Epha5 and Epha8 receptors as well as the ephrin (Efn) ligand Efna5 in
granulosa cells. They also located Efna5 and Epha5 to the membrane of granulosa cells
and noticed that the expression of Efna5 and Epha5 increased with follicle size. Most
importantly, they suggested that FSH regulates Epha5-Efna5 gene expression through
the cAMP/PKA pathway in granulosa cells. Overall, in vitro granulosa cell treatment with
Efna5 or Epha5 affect granulosa cell morphology and adhesion39.
In a human based study, during the early luteal phase, EphB1, B2 and B4 as well as
their ligands Efnb1 and Efnb2 were detected in human corpora lutea 44. Moreover,
Efnb1 was expressed on the theca interna and granulosa cells of preovulatory follicles,
28
with a drastic increase of Efnb1 on GCs following ovulation
44
. A more recent study,
where granulosa cells were collected via follicular puncture from women undergoing in
vitro fertilization treatment and cultured in vitro, confirmed the presence of Efnb1 and
Efnb2 in granulosa cells, with additional presence of EphA4, EphA7 and Efna473. In
addition, this group speculated that hCG is not involved in Ephrin regulation in human
granulosa cells. However, there is a lack of in vivo data addressing the role of ephrin
signaling within the ovary of different species.
2.3.3.6 Epidermal growth factor family
EGF-receptor (also known as Erbb1) signaling has been thoroughly investigated
in ovarian biology. This RTK is located on granulosa, theca and luteal cells. An early
study rat granulosa cell culture showed that FSH signaling increases the number of
EGFRs during granulosa cell differentiation100. EGFR phosphorylation activates
downstream signaling pathways including PI3K and MAPK24. It is important in oocyte
maturation and granulosa cell differentiation in LH-stimulated preovulatory follicle. Upon
LH stimulation amphiregulin (Areg), betacellulin (Btc) and epiregulin (Ereg) are induced
in granulosa cells and have the ability to bind to EGFR for further downstream
messaging6. Areg and Ereg knockout mice models experience delayed cumulus
expansion, however they remained fertile because the two growth factors are able to
compensate for one another6.
Egfr helps regulate Cyp19a1 expression and thus prevents over expression of
estradiol. In vivo, a mouse model with Egfr inactivating mutations (since egfr ko is
lethal), established a link between LHr and MAPK-Erk1/2 by which down regulation of
Cyp19a1 is mediated101. LH’s effects are indirect because of the restricted expression of
its receptor (specific to mural granulosa cells). LH induces expression of the growth
factors, which then signal through Egfr. EGF growth factors act in a paracrine manner to
spread the LH signal throughout the follicle. EGFR signaling is necessary for LH action
such as cumulus expansion and oocyte maturation48,102. Egfrs are predominantly
located to cumulus cells and this phosphorylation by Egf growth factors leads to
induction of Has2, Ptgs2 and Tnfaip6, all of which are necessary for cumulus
expansion6.
29
ERK1/2 is crucial and is activated by LH and EGFR and most likely via PKC
3,103
.
Therefore, early activation of the Egf network is crucial for ovulation. Ultimately, Egfr
mediates MAPK activation in cumulus cells for proper oocyte maturation
74
. Meiosis is
maintained at prophase arrest by a constant supply of cGMP from granulosa cells via
open gap junctions to the oocyte. Therefore, meiosis remains arrested until LH acts on
surrounding granulosa cells, by closing the gap junctions. Egfr assists LH in this action
and this is how it is involved in meotic resumption104.
Recently, it has been shown that the Erbb2/Erbb3 complex signals by binding of
neuregulin 1 (NRG1). Also, in culture, NRG1, which binds to the Erbb2/Erbb3 complex
is up-regulated in granulosa cells during ovulation and this enhances AREG-induced
ERK1/2phosphorylation, similar to EGFR phosphorylation, as well as activating the
PI3K/AKT pathway 49. The Egf network is one of the best-defined families of RTK
signaling in the ovary and its role for ovulation is indispensable.
2.3.3.7 Fibroblast growth factor family
Early research using cultured rat granulosa cells revealed that Fgf signaling
affects steroidogenesis by disrupting estradiol synthesis and enhancing progesterone
production 105. It has been well established that the Fgf network includes 23 ligands
along with 4 receptors (FGFR1-4) including splice variants resulting in isoforms 106,107.
Fgf9 and Fgf2 have been localized to theca and granulosa cells and are hormonally
regulated in the bovine ovary 57,62,108. Fgf9 has been shown to stimulate granulosa cell
proliferation, while Fgf2 is linked to survival of granulosa cells transitioning to luteal cells
in bovines 57,62.
The Fgf2 is expressed as multiple isoforms: Fgf2 low molecular weight (LMW)
(18kDa) & Fgf2 high molecular weight (HMW) (20.5, 21, 22, 22.5, 24, 34 kDa), being
species-specific 109. Davis et al 1997 demonstrated HMW Fgf2 in the nuclear
membrane, while LMW Fgf2 is found in both nuclear and cytoplasmic regions on
vascular smooth muscles and can be expelled into the extracellular environment
110
.
Moreover, immunohistochemical experiments by Berisha et al (2006) suggest that both
LMW and HMW isoforms are localized to the nucleus of bovine granulosa cells following
the LH surge 57. In the murine model, in situ hybridization revealed that Fgf2 is localized
30
to granulosa and theca cells during follicular development and found in the corpus
luteum following ovulation 59,111. Similar to VEGF, Fgf2 is known to play a role in
angiogenesis in development of the CL 37,45,112.
Berisha and colleagues noted that Fgfr1 IIIc is a receptor of bovine Fgf2 and both
of them are induced by the LH surge57. More importantly, the presence of Fgf2 was first
observed in the theca cells and re-located to the nucleus of granulosa cells following the
LH surge. In addition, protein abundance of both LMW and HMW increased at 4 hours
post-LH57. Fgf receptor signaling activates the MAPK-ERK1/2 pathway, where Fgf
receptor signals induce Sprouty expression in mural granulosa cells and keep receptor
phosphorylation controlled113,114.
2.4 Keeping it under control: Sprouty family
Hacohen et al (1998) first described the Sprouty protein in Drosophilia as an inhibitor
of RTK signaling 115. Later description of the protein in mammalian cells, revealed 4
Sprouty isoforms, encoded by Spry1-4, which are widely expressed in all tissues 116,117.
Sprouty orthologs act as negative feedback modulators of ERK1/2 signaling pathways
activated by specific growth factors113,118. Since MAPK is an indispensable downstream
pathway induced during gonadotropin and hormone stimulation of RTKs, it is important
to investigate the role of Sprouty during follicular growth.
In all organs, Sprouty gene expression is up regulated when induction of ERK is
mediated by up-stream phosphorylation of RTKs of ligands including, fibroblast growth
factors, vascular endothelial growth factors, platelet-derived growth factors, insulin,
nerve growth factors and kit ligand 113,116. Knockout models of Spry1, 2 and 4 have been
thoroughly studied for their role in angiogenesis, more specifically the ability to regulate
blood vessel branching through growth factor signaling 113. An increase in mRNA
abundance of Spry1 and Spry2 successfully inhibits FGF, EGF, and VEGF production in
endothelial cells. Ultimately, it is the combination of Sprouty proteins which determines
the level of inhibition of phosphorylated RTK signaling 113. However, very few attempts
have been made to characterize the function of Spry3
114,119
. Recently, Spry3 has been
designated a modulatory role in BDNF-NTrk2 signaling, by regulating axonal branching
31
of motor neurons. An increase in phosphorylated Ntrk2 induced expression of Spry3
and prevented excessive axonal branching 119.
In the ovary, EGF and FGF signaling regulated by Sprouty has been researched, with
focus placed on Fgf signaling in bovine granulosa cells
114,118,120
. Jiang et al (2011)
observed an increase in mRNA abundance of Spry1, 2 and 4, but not Spry3 in bovine
granulosa cells during in vitro culture with Fgf2. Therefore, Spry3 is not believed to play
a role in regulation of Fgf signaling. However, it was observed that Spry3 was
expressed at a significantly lower in healthy granulosa cells than transitional or atretic
ones, yet an explanation for this observation remains under investigation
114
. As a
result, Sprouty regulation of RTKs within follicles requires further investigation.
32
CHAPTER 3. RATIONALE, HYPOTHESIS AND OBJECTIVES
Increasing our understanding of the ovary is essential for improving the current
issues faced in livestock management. Reproduction is an integral part of farm
management 121,122. Parturition must occur in order to maintain maximal milk production
and economical stability 123. Unfortunately, the current literature has routinely indicated
that the demand for increased milk production has taken its toll on maintenance of
health and fertility 122,124. Hence, it has become progressively more important to
understand the various mechanisms that regulate follicular growth and the production of
a fertilizable oocyte. By means of gradually solving pieces of the reproductive puzzle we
can decipher new methods to improve fertility on our dairy farms. For this reason we
investigated another piece of the puzzle by enhancing our knowledge of growth factors
and their respective receptor tyrosine kinases (RTKs) within the ovary, more specifically
in the granulosa cells.
Growth factors and their RTKs have been studied for their roles in follicular growth
and ovulation 6,57,87,125. We hypothesized that certain RTKs and their respective ligands
are present in granulosa cells and have an impact on these somatic cells following
stimulation by luteinizing hormone. The objectives of this study are as follows:
1. To characterize growth factors and their receptor tyrosine kinases that are
stimulated by luteinizing hormone in granulosa cells.
2. To determine the importance of growth factor signaling for ovulation
Using the murine model, we can determine the phosphorylation status of various RTKs
in the preovulatory ovary and thus, further contribute to the general pool of knowledge
with respect to growth factor signaling for successful ovulation.
33
CHAPTER 4
Activated receptor tyrosine kinases in granulosa cells of murine ovulating
follicles.
Yasmin Schuermann, Dayananda Siddappa, Melissa Pansera, and Raj Duggavathi*
Department of Animal Science, McGill University, Sainte-Anne-de-Bellevue, QC H9X
3V9
*Corresponding author: [email protected]; Tel: 1-514-398-7803
Short title: RTKs in granulosa cells
Key words: receptor tyrosine kinases, RTKs, growth factors, ovulation, Fgf2, Efnb1,
granulosa cells, murine, Mouse Phospho-RTK Array Kit (R & D systems)
Grant Support: This work was supported by the Natural Science and Engineering
Research Council (NSERC) of Canada, and Fonds de recherche du Québec – Nature
et technologies (FRQNT) to RD.
34
4.1 ABSTRACT
Follicular growth and development is dependent upon activation of a series of
paracrine, autocrine and endocrine signals. The expulsion of a fertilizable oocyte
requires the luteinizing hormone (LH) surge. It has been well established that LH
induces activation of the epidermal growth factor receptor (Egfr), a receptor tyrosine
kinase (RTK), which in turn regulates ovulation via the mitogen-activated protein
kinase/extracellular signal-regulated kinase 1/2 (MAPK/ERK1/2) pathway. There are
over 60 RTKs that have been identified in mammalian cells but are not fully explored for
their role in granulosa cells of ovulating follicles. We used the Mouse Phospho-RTK
Array Kit to simultaneously catalogue the phosphorylation status of 39 RTKs in mouse
granulosa cells prior to and following exogenous stimulation by human chorionic
gonadotropin (hCG), which mimics the actions of LH. Densitometric analysis showed
that phosphorylation of the fibroblast growth factor receptor 2 (Fgfr2) and Ephrin B1
(Ephb1) was increased (P<0.05) in granulosa cells at 4h post-hCG compared to hCG0h.
We then investigated the mRNA abundance of the receptors and their respective
ligands of the FGF and ephrin families. Ovulatory stimulus with hCG treatment did not
affect the expression of receptors in granulosa cells. However, hCG treatment induced
transcript abundance of Fgf2 and Efnb1, ligands of FGF and ephrin families,
respectively. Using commercially available antibodies, we demonstrated that Fgf2
protein is present in granulosa and theca cells along with oocytes in the mouse ovary.
Immunoblot analyses showed that hCG treatment resulted in an increase in Fgf2 protein
in granulosa cells, corroborating the mRNA data. Further qPCR analyses revealed that
increased Fgf2 expression is associated with decreased (P<0.05) Spry3 expression, a
member of the Sprouty family of proteins known to inhibit FGF signaling. Finally,
intraperitoneal treatment with two specific Fgfr inhibitors (AZD4547 or BGJ398) 30
minutes prior to hCG stimulation did not alter ovulation rate when compared to vehicle
treatment.
Taken together, we concluded that: 1. Preovulatory LH surge induces Fgf2 and
Efnb1 signaling in granulosa cells of ovulating follicles in mice; 2. FGF signaling is either
dispensable for ovulation or is compensated by robust mechanisms in granulosa cells of
ovulating follicles in mice.
35
4.2 INTRODUCTION
Expulsion of a fertilizable oocyte requires subsequent activation of a series of
autocrine and paracrine signaling cascades in the oocyte and follicular somatic cells 1.
Throughout folliculogenesis, granulosa cells proliferate, differentiate and experience
morphological changes in part due to the activation of growth factor signaling pathways
mediated by hormonal stimulation
23,126
. Receptor tyrosine kinases (RTKs), a type of
cell-surface receptors which become phosphorylated upon binding of a ligand, induce
an intrinsic signal-transduction cascade, leading to changes in gene expression patterns
127
. Therefore, activation of RTKs is responsible for mediating cell proliferation,
differentiation, motility and angiogenesis in various organs, notably the ovary
43,128
.
Conti and colleagues have well defined the role of epidermal growth factor
receptor (EGFR), a receptor tyrosine kinase, signaling within the preovulatory
follicle3,74,102. Luteinizing hormone (LH) stimulation leads to increased expression of
amphiregulin (AREG), epiregulin (EREG) and betacellulin (BTC), all of which
subsequently bind to EGFR, triggering downstream activation of cascades including the
mitogen-activated protein kinase/extracellular signal-regulated 1/2 (MAPK/ERK1/2)
pathway48. Furthermore, activation of ERK1/2 generates the expression of genes
including Ptgs2, Tnfaip6 and Pgr, all of which are essential for successful ovulation129.
Therefore, EGFR signaling works as paracrine mediators of LH signaling41. Previous
research regarding inhibition of AREG and ERK1/2 both reveal impaired ovulation due
to a lack of oocyte maturation, cumulus cell expansion and luteinization. Moreover,
inhibition of ERK1/2 in granulosa cells leads to decreased expression of all 3 EGFR
ligands: AREG, EREG and BTC following the LH surge129. Alas, LH and EGFR
signaling within granulosa cells activate ERK1/2, which subsequently induce
progesterone production, cumulus expansion and follicle rupture all of which are pivotal
for ovulation1,23.
On another note, the Sprouty family regulates RTK activity and acts downstream
upon activation of the MAPK pathway113. Overall cellular health is greatly dependent
upon closely regulated signaling of growth factors113. However, follicular growth and
maturation lead to excessive proliferation and differentiation of granulosa cells, a
36
process that requires an intricate and timely organized signaling network for successful
ovulation to occur.
Over 60 RTKs have been identified with their respective ligands in various cell
types and species2,35,36. Moreover, a number of RTK pathways have been investigated
in the oocyte, theca and granulosa cells in the ovarian follicle in relation to early
follicular growth and development of the corpus luteum5,6,18,34,130. However, induced
RTK signaling during the LH surge has not been fully investigated in murine granulosa
cells.
The purpose of this study was A) to characterize growth factors and their receptor
tyrosine kinases stimulated by luteinizing hormone in granulosa cells and B) to
determine the importance of growth factor signaling for ovulation.
4.3 MATERIALS AND METHODS
4.3.1 Animals
Immature C57BL/6Ncrl female mice aged 23-25 days and weighing 12 to 14g,
were procured from Charles River Laboratories. All experiments were approved by the
Faculty Animal Care Committee of McGill University. Mice were housed in standard
animal cages and were provided with ad libitum feed (Rodent Diet, Harlan Teklad,
Canada) and water. They were maintained under 12-hour light and 12-hour dark cycle.
4.3.2 Superovulation
In each of the following experiments, mice were subject to a standard
superovulation protocol using equine Chorionic Gonadotropin (eCG) and human
Chorionic Gonadotropin (hCG). Induction of follicular development began with the
intraperitoneal administration of 5 IU of eCG, followed at 38h after with a 5 IU hCG.
Ovaries were collected at specific time-points indicated in Figure legends.
4.3.3 Granulosa Cell Collection
The ovaries were placed in a small (35 X 10mm) cell culture dish containing
PBS. Upon removal of fat pad, the ovary was transferred in a new dish containing 200µl
of PBS, where follicles were punctured using a 27-gauge needle. The ovarian remains
37
were removed, the cell groups were pipetted to separate cell clusters and samples were
filtered through a 40µm sterile cell strainers (Cat. 22363547,Fisher Scientific, Canada).
Filtration is an efficient method used to purify granulosa cells from other aggregates and
cumulus oocyte complex 131. The cell suspension was centrifuged for 5 minutes at 3,000
revolutions per minute. The granulosa cell was flash frozen in liquid nitrogen and further
stored at -80°C until protein or RNA extraction.
4.3.4 Mouse Phospho-RTK Array Kit
To establish the status of phosphorylated receptor tyrosine kinases (RTKs) in granulosa
cells, we used the Mouse Phospho-Receptor Tyrosine Kinase Array kit (ARY014, R&D
Systems, U.S.A). The phosphorylation status of 39 pre-determined RTKs was examined
in granulosa cells collected at eCG48h and hCG4h, prior to and following the LH surge,
respectively. Ovaries from 2mice/time-point were pooled in order to obtain the sufficient
number of granulosa cells (1,000,000). Cells were then subjected to protein extraction
according to the manufacturers protocol. Protein concentrations were measured using
the Pierce BCA Protein Assay (23221, Thermo Scientific, Canada). Subsequently,
protein samples were incubated on RTK antibody arrays, and phosphorylation status
was determined by subsequent incubation with horseradish peroxidase-conjugated antiphosphotyrosine, as described by the manufacturer. However, Chemi Reagent Mix from
the kit was substituted with Immun-Star Western Electrochemiluminescence ECL (1705070, Bio-Rad, Mississauga, Canada) to improve signal intensity. The
chemiluminescence was detected using the ChemiDoc (Bio-Rad) and densitometry
analysis was performed using the ImageLab software (Bio-Rad). The experiment was
performed three times.
4.3.5 RNA extraction and Real-time PCR (qPCR)
The Direct-Zol RNA MiniPrep Isolation Kit (R2050, Zymo Research, Cedarlane
Laboratories, Burlington, Canada) was used to extract RNA from granulosa cell
samples (N = 3-4 mice per time-point) as per manufacturer’s protocol. The quantity and
quality of RNA from each sample was measured using the Nanodrop 2000 (Thermo
Scientific). The 260/280 for all samples was within a range close to 2.0. cDNA was
38
synthesized from 250ng of total RNA by means of the iScript cDNA Synthesis kit
(1708890, Bio-Rad, Mississauga, Canada). All primers were purchased from Integrated
DNA technologies (Skokie, U.S.A). (Table 1). The qPCR assays were performed
according to MIQE guidelines 132 (Bio-Rad). The following conditions were performed for
mRNA analysis: an initial denaturation at 95°C for 5 minutes followed by 39 cycles of
95°C for 15 seconds, 58°C for 30 seconds for annealing and 95°C for 10 seconds. Each
primer sets were optimized so that the efficiency was between 90-110% and the
correlation coefficient was between 0.95-1.00. Transcript abundance for a gene of
interest in each sample was determined by taking starting quantity (SQ) values, as
displayed in CFX manager TM software (Bio-Rad). Relative transcript abundance for
each gene of interest was calculated by dividing their respective SQ values by the mean
SQ values of four reference genes (B2m, Gapdh, Rpl19 and Sdha).
4.3.6 Immunohistochemistry
Whole ovaries were collected at hCG0h (eCG48h) and hCG4h and fixed in 10%
Neutral Buffered Formalin (NBF) for 2 days at 4°C before being processed and
embedded in paraffin. The ovaries were then sectioned at 5µm using the microtome and
placed on coated slides. Sections were then de-paraffinized in 2 changes of xylene,
followed by re-hydration with 3-minute changes of 100%, 95% and 80% ethanol. Slides
were subsequently immersed in pre-heated citrate buffer for 20 minutes in the
microwave, followed by cooling down for 30 minutes. Sections were rinsed with PBS for
15 minutes before and after blocking with 3% hydrogen peroxidase for 45 minutes.
Sections were then blocked with antibody diluting buffer (ADB) for 45 minutes and after
incubated with Fgf2 (1:1000, sc-79, Santa Cruz, U.S.A) primary antibody, ADB
(negative control), or alpha-inhibin (1:750, positive control) for 2 hours. Subsequently,
sections were rinsed with PBS before and after incubation with secondary antibody
conjugated to horseradish peroxidase (HRP) prepared in ADB (1:200) for 2 hours. Next,
substrate chromogenic solution (DAB) was added to sections for 2 minutes and the
reaction was stopped with dipping in water. Lastly, slides were counterstained with
hemotoxylin for 10 seconds and cleaned in water before being observed under the
microscope.
39
4.3.7 Protein extraction and Immunoblot
Protein was extracted from granulosa cells collected by adding 100µl of lysis
buffer (laemmli and 2-mercaptoethanol) with 10µl of each protease inhibitor:
Mammalian Protease Arrest, Phosphatase Arrest III and EDTA (G Biosciences, St.
Louis, MO, U.S.A). The mixture was then boiled at 95°C for 5 minutes and stored at
80°C for immunoblot analysis as previously described
133
. A 12.5% SDS-PAGE gel was
used to separate proteins by electrophoresis. The gel was then transferred onto a
polyvinylidene fluoride (PVDF) membrane and afterwards blocked in 5% milk in Trisbuffered saline with 0.1% Tween-20 (TBS-T) for 1.5 hours at room temperature. An
overnight incubation at 4°C followed with primary antibodies: anti-rabbit Fgf2 (1:400, sc79, Santa Cruz, U.S.A), anti-rabbit beta-actin (Actb) (1:10 000, cat no. ab8227, Abcam,
Cambridge, U.S.A) and anti-rabbit StAR (1:10 000, cat no. sc-25806, Santa Cruz,
U.S.A). The next morning, membranes were washed 3 times for 10 minutes in TBST
before and after incubation with secondary antibody Goat anti-rabbit-IgG (1:10 000, cat
no. ab6721, Abcam, Cambridge, U.S.A) for 1.5 hours at room temperature. The ImmunStar Western Chemi luminescent Kit (Bio-Rad) and Chemidoc Analyzer was used to
detect immunoblotted proteins.
4.3.8 RTK inhibitor studies
To evaluate the role of phosphorylated Fgfr in granulosa cells two distinct Fgfr
inhibitors were separately investigated: AZD4547 and BGJ398 (Selleckchem.com,
Houston, U.S.A). The first experiment comprised 5 mice in the control group (N=5) and
7 mice treated with AZD4547 (N=7), while the second experiment comprised 8 mice in
the control group (N=8) and 8 mice treated with NVP-BGJ398 (N=8). Each inhibitor was
dissolved in dimethyl sulfoxide (DMSO) (CAS 67-68-5, Fisher Scientific, Whitby,
Canada) to prepare stock solution of 100 µg/µl, working solution of 25 µg/µl was
prepared in saline solution to a final 5% DMSO concentration. Mice were superovulated
with eCG followed by administration of a single dose of 5% DMSO in saline (control) or
AZD4547 intraperitoneal (25µg/g body weight) 30 minutes prior to administration of
40
hCG. Mice were monitored for overall health of the animals during the treatment
protocol. The ovaries and oviducts were collected from both groups (Control vs.
AZD4547 treated) 18h post-hCG to determine any difference in ovulation rate between
control and inhibitor treated mice. Each oviduct was separated from the ovary and
placed in a dish containing PBS. A 27-gauge needle was used to disrupt the “bulge” of
the oviduct, which allows the oocytes to flow out into the medium and were then
counted. The same procedure was executed for Control vs. BGJ398.
4.3.9 Statistical analysis
Data analyses were performed using SigmaPlot 12.3 Software (San Jose, CA,
U.S.A). The significance level employed for all experiments was P<0.05.
Mouse Phospho-RTK Array Kit: Using densitometry, the spot intensities were
measured and checked for normality by the Shapiro-Wilk test and analyzed by
Student’s t-test. The following model was used for analysis:
Where,
animal,
.
represents phosphorylated protein abundance at the ith time for the jth
is the overall mean,
protein abundance, and lastly,
is the effect of the ith time point on phosphorylated
is the random residual effect of the jth animal in the ith
time point.
Real-time (RT) PCR of the receptors and ligands: One-way analysis of variance
(ANOVA) was carried out to analyze mRNA abundance according to the model:
. Where,
time for the jth animal,
represents the value for mRNA abundance at the ith
is the overall mean,
mRNA abundance, and lastly,
is the effect of the ith time point on
is the random residual effect of the jth animal in the ith
time point.
RTK inhibitor studies: Ovulation rates, deducted by the number of retrieved
oocytes, between control mice and AZD4547 or BGJ398 treated mice were checked for
normality by the Shapiro-Wilk test and examined by unpaired Student’s t-test with a
significance level of P<0.05. Analysis for each experiment was carried out using the
following model:
. Where,
represents the value for the
number of oocytes from the ith treatment for the jth animal,
41
is the overall mean,
is the effect of the ith treatment (control or inhibitor) on number of oocytes,
and lastly,
is the random residual effect of the jth animal in the ith treatment.
4.4 RESULTS
4.4.1 Global approach: Phosphorylated RTKs
The Mouse-Phospho Array Kit was first used to profile activated RTKs in
granulosa cells of murine ovulating follicles. Simultaneous protein analysis of thirty-nine
receptors revealed an increase in phosphorylation of RTKs including Egfr, ErbB2, Fgfr2
IIIC, Fgfr3, Fgfr4, InsR, Igf1r and Ephb1 at hCG4h as compared to hCG0h (Fig. 1).
Densitometric analyses revealed statistically significant increase in the abundance of
phosphorylated Fgfr2 IIIC and Ephb1 at hCG4h (P < 0.05; Fig. 2). Though
phosphorylation level of Fgfr3 and 4 was numerically higher at 4h post-hCG, there was
no statistical difference (P > 0.05; Fig. 2). Based on these results we focused on
signaling molecules of Fgf and Eph families for further investigation.
4.4.2 Transcript abundance of RTKs in granulosa cells
We then determined the expression profiles of the receptors of fibroblast growth
factor and ephrin families in pure populations of granulosa cells at hCG0h, hCG1h, and
hCG4h. Quantitative-PCR analyses revealed no significant changes in the mRNA
abundance of Fgfr2, Fgfr3, Fgfr4 and Ephb1 in granulosa cells across the time-points
tested (P > 0.05; Fig. 3).
4.4.3 Transcript abundance of ligands in granulosa cells
It has been well established that Fgfr2, specifically Fgfr2 IIIc isoform, binds with
high affinity to FGF family ligands, Fgf1, 2 and 9 in various cell types and species
62,134,135
. Likewise, Efnb1, Efnb2 and Efna3 can bind with high affinity to EphB1
38,39
. Of
the FGF ligands, mRNA abundance of Fgf2 but not Fgf1 and 9, was significantly higher
at hCG4h (P < 0.05; Fig. 4). Of the ephrin family ligands, transcript abundance of Efnb1,
but no Efnb2 and Efna3, was significantly higher at hCG4h (P < 0.05; Fig. 4).
However, Fgf2 can be expressed as various isoforms, including low molecular
weight (LMW) and high molecular weight (HMW), (the primer used for qPCR analysis
42
includes all isoforms, NCBI blast). This was kept in mind, since LMW Fgf2 acts via
RTKs, while HMW Fgf2 is largely independent of Fgf-receptors 136.
4.4.4 Fgf2 in the murine ovary
Immunohistochemistry was used to determine the localization of Fgf2 in the ovary
collected at hCG4h (Fig. 5 A). It is evident that Fgf2 can be found in the granulosa and
theca cell layer as well as the oocyte. Immunoblot analysis revealed an increase in
LMW Fgf2 in granulosa cells collected at hCG4h compared to those at hCG0h (Fig. 5
B). However, no change in HMW Fgf2 protein was observed (Fig. 5 B). Due to the lack
of commercially effective Efnb1 antibodies, we did not analyze Efnb1 protein in the
mouse ovary.
4.4.5 The Sprouty genes
FGF signaling is regulated by negative feedback signaling from Sprouty genes
113
. All
four mammalian orthologs of Sprouty genes (Spry1-4) were profiled in granulosa cells at
hCG0h, hCG1h and hCG4h. Transcript abundance was constant for Spry1, 2 and 4 in
granulosa cells at all time-points (P > 0.05; Fig. 6). However, mRNA levels of Spry3 in
granulosa cell were lower at hCG4h (P < 0.05; Fig 6).
4.4.6 Inhibition of Fgfr signaling during ovulation
As there is no commercially available pharmacological inhibitor of Ephb1, we focused
on the effect of inhibition of Fgfr on ovulation. Inhibitors of Fgfr AZD4547 137 and
BGJ398 138 have been previously used. Treatment of either inhibitor 30 minutes prior to
hCG stimulus did not alter ovulation rate, as determined by the number of oocytes in
oviducts at 18h post-hCG, as compared to vehicle treated mice (P > 0.05; Fig. 7).
4.5 DISCUSSION
It has been well established by using pharmacological inhibition or gene knockout
models that epidermal growth factor signaling is critical for LH signaling6. LH induced
phosphorylation of the Egf-receptor (Egfr) in granulosa cells is a key regulator of
ovulation 3,6,48,53,74,129. However, deletion of the Egfr gene does not completely abolish
LH-driven reduction in cGMP or activation of PI3K-AKT pathway 139. Therefore, it is
43
possible that additional growth factors may be involved in modulation of LH signaling
during ovulation. There are about 60 RTKs, divided into 20 subfamilies, which are
activated by growth factors and thus regulate cell growth, proliferation and differentiation
35
. Our objective was to examine if RTK signaling cascades, other than Egfr, are
induced following the LH surge and thus, play a role in ovulation.
Using the mouse phospho-RTK array kit, we were able to systematically
characterize the effect of hCG on phosphorylation status of thirty-nine RTKs in mouse
granulosa cells. Densitometric analyses of three separate replications showed that hCG
stimulus increased the abundance of phosphorylated Fgfr2 IIIC, an isoform of the Fgfr
family, and Ephb1, an isoform of the ephrin family, in granulosa cells at hCG4h.
When we checked the expression pattern of RTK genes, we found that mRNA
abundance of Fgfr2 also did not change from hCG0h to hCG4h in granulosa cells. Fgfr2
IIIC mRNA was previously demonstrated in granulosa and theca cells of bovine follicles
collected from abattoir 37. In that study, mRNA levels of Fgfr2 IIIC did not show any
developmental variation in both theca and granulosa cells of follicles at different stages
of growth. Another study from the same group also observed no change in Fgfr2 IIIC
transcripts in bovine whole follicles57. Along with these studies, our protein and mRNA
data suggest that preovulatory LH surge promotes Fgfr signaling in granulosa cells
through regulation of the receptor phosphorylation without affecting Fgfr gene
expression.
Among 23 known FGFs, Fgfr2, Fgf1 and Fgf9 are known to activate FGFR2 IIIC
107
.
Of these ligands transcript abundance of Fgf2 was uniquely induced in granulosa cells
at 4h after hCG stimulus. Using immunohistochemistry, we found that Fgf2 protein is
present in granulosa cells along with moderate expression in theca cells and the oocyte.
Furthermore, immunoblot analyses demonstrated an increase in LMW Fgf2 isoform in
granulosa cells at hCG4h. Fgf2 exists as HMW (20.5-34 kDa) and LMW (18 kDa)
isoforms 140. HMW isoforms are retained in the nucleus and thus do not affect Fgfr
signaling. Conversely, LMW is found in the cytoplasm, the nucleus and the extracellular
matrix 110. Fgf2 has been widely studied in rat and bovine ovarian biology. Early
research in rats showed that Fgf2 mRNA is not detected from granulosa cells collected
at 48h post-eCG 141. However, numerous studies have demonstrated that Fgf2 plays a
44
role in proliferation, differentiation, steroidogenesis and apoptosis in cultured granulosa
cells apoptosis 142-145. Fgf2 was also demonstrated in the rat oocyte and was proposed
to play a role in the transition from primordial to primary follicular stage by assisting the
development of granulosa and theca cells146. Intriguingly, the Fgf2 knockout mice
develop normally with no reproductive deficits 147. These data suggest that while Fgf2 is
important for granulosa cells, there may be mechanisms to compensate for its absence.
Sprouty family proteins, Spry1-4, act as negative feedback modulators of RTKmediated signaling pathways 113,118,148. Sprouty proteins inhibit the ERK pathway
activated by specific RTK ligands such as FGF, vascular endothelial growth factors
(VEGF), platelet-derived growth factors (PDGF), nerve growth factor (NGF) and brainderived neurotrophic factor (BDNF) 113,116. Expression of Spry3 was shown to be
unaffected by Fgf2 treatment in bovine granulosa cells114. However, it has been shown
in human 293T and 3T3 cell lines that Spry3 forms a heterodimer with Spry1 and 4
leading to efficient inhibition of FGF-stimulated ERK1/2 pathway116. Our qPCR assays
showed that mRNA level of Spry3, but not Spry1, 2 and 4, decreased in granulosa cells
at hCG4h. As hCG treatment induces ERK1/2 phosphorylation in granulosa cells of
ovulating follicles, one can speculate that reduction in Spry3 mRNA contributes to
increased ERK1/2 phosphorylation. Indeed, evidence from bovine granulosa studies
supports this hypothesis. It has been shown that Spry3 mRNA levels are high in
granulosa cells of bovine atretic follicles114. In line with this, we have recently shown that
granulosa cells of atretic follicles have reduced phosphorylation of ERK1/2 in cattle
(Gasperin and Duggavathi, Unpublished). Therefore, our Fgf2, Fgfr2 IIIC and Spry3
data suggest that LH surge increases FGF signaling in granulosa cells, through
induction of Fgf2 expression and activation of Fgfr2 IIIC, which is further potentiated by
reduction in Spry3 expression.
The second RTK activated in granulosa cells of our study was Ephb1. This
increased phosphorylation of Ephb1 was associated with increased expression of its
ligand, Efnb1 at 4h post0hCG. While Efnb1 mRNA has been shown in human granulosa
lutein cells 73. Ephb1 has been shown in theca cells of human ovulating follicles 44.
Similar to Fgfr2 gene expression, mRNA abundance of Ephb1 remained constant in
granulosa cells from hCG0h to hCG4h. Collectively, data from this study indicate that
45
preovulatory LH surge promotes Ephb1 signaling in granulosa cells through regulation
of the receptor phosphorylation with concomitant induction of its ligand Efnb1. Given
that Efna5 regulates FSH-regulated granulosa cell shape and adhesion
39
, it is tempting
to hypothesize Efnb1-Ephb1 signaling may play similar roles in LH-regulated granulosa
cells. Eph receptors and Ephrins are intercellular signaling molecules that establish cell
polarity during mesenchymal-to-epithelial transition of the paraxial mesoderm 149. The
Ephb1-Efnb1 interaction in LH stimulated granulosa cells could be involved in epithelialmesenchymal transition (EMT), which occurs during luteinization
150
. EMT is mainly
characterized by the loss of epithelial markers such as cytokeratins, tight junction
proteins and E-cadherin, the acquisition of mesenchymal markers such as vimentin and
N-cadherin, and increased expression of the Snail, Twist and Zeb transcription factors
151
. Indeed, hCG-induced loss of E-cadherin and up regulation of N-cadherin has been
demonstrated in granulosa cells of ovulating follicles in rats152.
Having shown that two RTK signaling pathways are activated in granulosa cells of
ovulating follicles, we wanted to test the importance of these pathways for ovulation. We
focused on Fgfr signaling because of the availability of multiple specific inhibitors from
commercial sources. Two inhibitors AZD4547 137 of BGJ398 153 with high selectivity
against Fgfr1, 2 and 3 were used in the present study. Treatment with AZD4547 or
BGJ398 did not affect ovulatory response to superstimulation in immature mice. These
observations indicate that Fgf2-Fgfr2 signaling is either dispensable for ovulation or
there are robust compensatory mechanisms in granulosa cells of ovulating follicles that
triggered in inhibitor treated mice. Alternatively, previous studies have proposed that
bovine follicles, Fgf2 assists in relocating from the theca layer to granulosa cell layer
following LH surge 37,57,69.
In summary, the present study investigated two RTK pathways in granulosa cells
of preovulatory ovulating follicles in mice. The ovulatory stimulus with hCG induces the
expression of the ligands Fgf2 and Efnb1 in association with increased phosphorylation
of their respective receptors, Fgfr2 IIIC and Ephb1 in granulosa cells. These RTKs
appear to be regulated at the level of receptor phosphorylation, as their transcript
abundance remained constant during initial phases of hCG-stimulated ovulation. Also,
46
the ability to study FGF and ephrin signaling using the mouse model and apply
observations from mice to cattle allows for a simpler and more cost efficient model.
Therefore, unlike well-established activation of the EGFR during LH signaling 3,6,48,74,
FGF and ephrin pathways do not appear to be obligatory for ovulation. Their temporal
association with luteinization suggests that they may participate in the formation of the
CL43-45,154, which require further investigation.
4.6 ACKNOWLEDGEMENTS
We would like to thank Drs. Sarah Kimmins and Vilceu Bordignon for the use of
their facilities as well as Dr. Roger Cue for assistance with the statistical analysis.
Moreover, we are greatly appreciative for our funding. YS and DS were supported by
the RQR-CREAT Scholarship and Department of Animal Science Graduate Excellence
Fellowship.
47
4.8 FIGURES AND FIGURE LEGENDS
Figure 1: Activation of RTKs in granulosa cells of ovulating follicles.
Representative blots of the three replicates of the phosphorylated RTK array of
granulosa cells collected at 0h (A) and 4h post-hCG (B). Total protein extracts were
incubated on RTK antibody arrays, and phosphorylation status was determined by
subsequent incubation with horseradish peroxidase-conjugated anti-phosphotyrosine.
The pairs of dots in black rectangles are positive controls and the box with dashed lines
represents negative control. Specific RTKs with qualitative differences in signal intensity
at hCG4h are identified.
48
Figure 2: Quantitative analyses of the abundance of phosphorylated RTKs.
Densitometry analysis for Fgfr2 IIIC, Fgfr3, Fgfr4 and Ephb1 (D) from three
Mouse-Phospho RTK Arrays. Experimental details are given in the legend of Fig. 1.
Data are expressed as a mean ± S.E.M. * denotes P<0.05.
49
Figure 3: Relative mRNA abundance of RTKs in granulosa cells. Quantitative-PCR
was performed to determine the expression pattern of Fgfr2, Fgfr3, Fgfr4 and Ephb1 in
granulosa cells collected at hCG0h, hCG1h and hCG4h (N=3-4/time-point). Data were
normalized to control genes B2m, Gapdh, L19 and Sdha. Data are expressed as a
mean ± S.E.M. There were no significant changes for any genes across the time-points
considered.
50
Figure 4: Relative mRNA abundance of RTK ligands in granulosa cells.
Quantitative-PCR was performed to determine the expression pattern of ligands of FGF
(Fgf2, Fgf1 and Fgf9) and ephrin (Efnb1, Efnb2 and Efna3) in granulosa cells collected
at hCG0h, hCG1h and hCG4h (N=3-4/time-point). Data were normalized to control
genes B2m, Gapdh, L19 and Sdha. Data are expressed as a mean ± S.E.M. * denotes
P < 0.05.
51
Figure 5: Protein abundance and localization of Fgf2 in the mouse ovary. A and B
Demonstration of Fgf2 by immunohistochemistry in the mouse ovary collected at hCG0h
(A) and hCG4h (B) (magnification 20X) C. Representative immunoblot demonstrating
the protein abundance of high molecular weight (HMW) and low molecular weight
(LMW) Fgf2 isoforms in granulosa cells collected at hCG0h and hCG4h. Immunoblots
for Star and Actb are also presented to confirm granulosa cell differentiation and loading
of equal amount of proteins between samples, respectively.
52
Figure 6: Relative mRNA abundance of regulators of RTK signaling in granulosa
cells. Quantitative-PCR was performed to determine the expression pattern of genes of
Sprouty family (Spry1, Spry2, Spry3 and Spry4) in granulosa cells collected at hCG0h,
hCG1h and hCG4h (N=3-4/time-point). Data were normalized to control genes B2m,
Gapdh, L19 and Sdha. Data are expressed as a mean ± S.E.M. * denotes P < 0.05.
53
Figure 7: Effect of specific Fgfr inhibitors on ovulation in mice. Immature female
mice were superstimulated with exogenous gonadotropins (eCG and hCG) and treated
either with DMSO (control) or Fgfr inhibitors (AZD4547 or BGJ398), at 30 minutes
before hCG stimulation. Ovulation rate for each mouse was determined by counting the
number of oocytes in both oviducts (N=5-8) at 18h post-hCG (A and B). Data are
expressed as a mean ± S.E.M. There were no significant changes for any genes across
the time-points considered.
54
4.9 TABLE
Table 1: Primers used in real-time PCR experiments
Gene
Name
Forward Primer
Reverse Primer
Efna3
CGTGCAGGTGAACGTGAAC
GTAACGCTGGAACTTCTCGGA
Efnb1
TGTGGCTATGGTCGTGCTG
CCAAGCCCTTCCCACTTAGG
Efnb2
ATTATTTGCCCCAAAGTGGACTC
GCAGCGGGGTATTCTCCTTC
Ephb1
ACCCATTCACTTATGAGGACCC
CTGCTCCGATGACCTCTTCA
Fgf1
CAGCTCAGTGCGGAAAGTG
TGTCTGCGAGCCGTATAAAAG
Fgf2
GCGACCCACACGTCAAACTA
CCGTCCATCTTCCTTCATAGC
Fgf9
ATGGCTCCCTTAGGTGAAGTT
TCATTTAGCAACACCGGACTG
Fgfr2
AATCTCCCAACCAGAAGCGTA
CTCCCCAATAAGCACTGTCCT
Fgfr3
TGGATCAGTGAGAATGTGGAGG
CCTATGAAATTGGTGGCTCGA
Spry1
GGTCATGGTCAGATCGGGTC
CTTGCCACACTGTTCGCAG
Spry2
TCCAAGAGATGCCCTTACCCA
GCAGACCGTGGAGTCTTTCA
Spry3
CTGAGCAATCTGTAGGGCATTC
AAGTGCCATAATCAAGGAGGC
Spry4
GCAGCGTCCCTGTGAATCC
TCTGGTCAATGGGTAAGATGGT
B2m
TTCTGGTGCTTGTCTCACTGA
CAGTATGTTCGGCTTCCCATTC
Gapdh
AGGTCGGTGTGAACGGATTTG
TGTAGACCATGTAGTTGAGGTCA
L19
AGTATGCTCAGGCTACAGA
CGATTGGCGATTTCATTGGTC
Sdha
GGAACACTCCAAAAACAGACCT
CCACCACTGGGTATTGAGTAGAA
55
CHAPTER 5. CONCLUSION
In summary, the present study investigated two RTK pathways in granulosa cells
of preovulatory ovulating follicles in mice. The ovulatory stimulus with hCG induces the
expression of the ligands Fgf2 and Efnb1 in association with increased phosphorylation
of their respective receptors, Fgfr2 IIIC and Ephb1 in granulosa cells. These RTKs
appear to be regulated at the level of receptor phosphorylation, as their transcript
abundance remained constant during initial phases of hCG-stimulated ovulation. Also,
the ability to study FGF and ephrin signaling using the mouse model and apply
observations from mice to cattle allows for a simpler and more cost efficient model.
Therefore, unlike well-established activation of the EGFR during LH signaling 3,6,48,74,
FGF and ephrin pathways do not appear to be obligatory for ovulation. Their temporal
association with luteinization suggests that they may participate in the formation of the
CL43-45,154, which require further investigation.
56
CHAPTER 6. REFERENCES
1
Richards, J. S. & Pangas, S. A. The ovary: basic biology and clinical implications.
The Journal of clinical investigation 120, 963-972, doi:10.1172/jci41350 (2010).
2
Schlessinger, J. Cell signaling by receptor tyrosine kinases. Cell 103, 211-225
(2000).
3
Conti, M., Hsieh, M., Zamah, A. M. & Oh, J. S. Novel signaling mechanisms in
the ovary during oocyte maturation and ovulation. Molecular and cellular
endocrinology 356, 65-73, doi:10.1016/j.mce.2011.11.002 (2012).
4
Thomas, F. H. & Vanderhyden, B. C. Oocyte-granulosa cell interactions during
mouse follicular development: regulation of kit ligand expression and its role in
oocyte growth. Reproductive biology and endocrinology : RB&E 4, 19,
doi:10.1186/1477-7827-4-19 (2006).
5
Ferrara, N. et al. Vascular endothelial growth factor is essential for corpus luteum
angiogenesis. Nature medicine 4, 336-340 (1998).
6
Hsieh, M. et al. Luteinizing hormone-dependent activation of the epidermal
growth factor network is essential for ovulation. Molecular and cellular biology 27,
1914-1924, doi:10.1128/mcb.01919-06 (2007).
7
Spicer, L. J. & Aad, P. Y. Insulin-like growth factor (IGF) 2 stimulates
steroidogenesis and mitosis of bovine granulosa cells through the IGF1 receptor:
role of follicle-stimulating hormone and IGF2 receptor. Biology of reproduction
77, 18-27, doi:10.1095/biolreprod.106.058230 (2007).
8
Peters, H. & McNatty, K. P. The ovary: A correlation of structure and function in
mammals. (Univ of California Press, 1980).
9
Leung, P. C. & Adashi, E. Y. The ovary. (Academic Press, 2003).
10
Holt, J. E., Lane, S. I. & Jones, K. T. The control of meiotic maturation in
mammalian oocytes. Current topics in developmental biology 102, 207-226,
doi:10.1016/b978-0-12-416024-8.00007-6 (2013).
11
Eppig, J. J. Oocyte control of ovarian follicular development and function in
mammals. Reproduction (Cambridge, England) 122, 829-838 (2001).
57
12
Kishimoto, T. Cell-cycle control during meiotic maturation. Current opinion in cell
biology 15, 654-663 (2003).
13
Eppig, J. Maintenance of meiotic arrest and the induction of oocyte maturation in
mouse oocyte-granulosa cell complexes developed in vitro from preantral
follicles. Biology of reproduction 45, 824-830 (1991).
14
Armstrong, D. G. & Webb, R. Ovarian follicular dominance: the role of
intraovarian growth factors and novel proteins. Reviews of reproduction 2, 139146 (1997).
15
Metallinou, C., Asimakopoulos, B., Schröer, A. & Nikolettos, N. Gonadotropinreleasing hormone in the ovary. Reproductive Sciences 14, 737-749 (2007).
16
Rajkovic, A., Pangas, S. A., Ballow, D., Suzumori, N. & Matzuk, M. M. NOBOX
deficiency disrupts early folliculogenesis and oocyte-specific gene expression.
Science 305, 1157-1159 (2004).
17
Choi, Y. & Rajkovic, A. Genetics of early mammalian folliculogenesis. Cellular
and molecular life sciences : CMLS 63, 579-590, doi:10.1007/s00018-005-53947 (2006).
18
Kerr, B., Garcia-Rudaz, C., Dorfman, M., Paredes, A. & Ojeda, S. R. NTRK1 and
NTRK2 receptors facilitate follicle assembly and early follicular development in
the mouse ovary. Reproduction (Cambridge, England) 138, 131-140 (2009).
19
George, J. W., Dille, E. A. & Heckert, L. L. Current concepts of follicle-stimulating
hormone receptor gene regulation. Biology of reproduction 84, 7-17 (2011).
20
Hunzicker-Dunn, M. & Maizels, E. T. FSH signaling pathways in immature
granulosa cells that regulate target gene expression: branching out from protein
kinase A. Cellular signalling 18, 1351-1359, doi:10.1016/j.cellsig.2006.02.011
(2006).
21
Khamsi, F. & Roberge, S. Granulosa cells of the cumulus oophorus are different
from mural granulosa cells in their response to gonadotrophins and IGF-I.
Journal of endocrinology 170, 565-573 (2001).
22
Ascoli, M., Fanelli, F. & Segaloff, D. L. The lutropin/choriogonadotropin receptor,
a 2002 perspective. Endocrine reviews 23, 141-174 (2002).
58
23
Duggavathi, R. & Murphy, B. D. Ovulation signals. Science Signaling 324, 890
(2009).
24
Wood, J. R. & Strauss Iii, J. F. Multiple signal transduction pathways regulate
ovarian steroidogenesis. Reviews in endocrine and metabolic disorders 3, 33-46
(2002).
25
Niswender, G. D., Juengel, J. L., Silva, P. J., Rollyson, M. K. & McIntush, E. W.
Mechanisms controlling the function and life span of the corpus luteum.
Physiological reviews 80, 1-29 (2000).
26
Strauss III, J. F., Paavola, L. G., Rosenblum, M. F., Tanaka, T. & Gwynne, J. T.
in Regulation of Target Cell Responsiveness
27
361-390 (Springer, 1984).
Stocco, C., Telleria, C. & Gibori, G. The molecular control of corpus luteum
formation, function, and regression. Endocrine reviews 28, 117-149,
doi:10.1210/er.2006-0022 (2007).
28
Wu, Y. et al. The orphan nuclear receptors NURR1 and NGFI-B modulate
aromatase gene expression in ovarian granulosa cells: a possible mechanism for
repression of aromatase expression upon luteinizing hormone surge.
Endocrinology 146, 237-246 (2005).
29
Christenson, L. K. & Devoto, L. Cholesterol transport and steroidogenesis by the
corpus luteum. Reproductive biology and endocrinology : RB&E 1, 90 (2003).
30
Edson, M. A., Nagaraja, A. K. & Matzuk, M. M. The mammalian ovary from
genesis to revelation. Endocrine reviews 30, 624-712 (2009).
31
Carletti, M. Z. & Christenson, L. K. Rapid effects of LH on gene expression in the
mural granulosa cells of mouse periovulatory follicles. Reproduction (Cambridge,
England) 137, 843-855, doi:10.1530/rep-08-0457 (2009).
32
Duggavathi, R. et al. Liver receptor homolog 1 is essential for ovulation. Genes &
development 22, 1871-1876, doi:10.1101/gad.472008 (2008).
33
Richards, J. S. et al. Regulated expression of ADAMTS family members in
follicles and cumulus oocyte complexes: evidence for specific and redundant
patterns during ovulation. Biology of reproduction 72, 1241-1255 (2005).
59
34
Schams, D. & Berisha, B. Regulation of corpus luteum function in cattle--an
overview. Reproduction in domestic animals = Zuchthygiene 39, 241-251,
doi:10.1111/j.1439-0531.2004.00509.x (2004).
35
Pawson, T. Regulation and targets of receptor tyrosine kinases. European
journal of cancer (Oxford, England : 1990) 38 Suppl 5, S3-10 (2002).
36
Yarden, Y. & Ullrich, A. Growth factor receptor tyrosine kinases. Annual review of
biochemistry 57, 443-478 (1988).
37
Berisha, B., Sinowatz, F. & Schams, D. Expression and localization of fibroblast
growth factor (FGF) family members during the final growth of bovine ovarian
follicles. Molecular reproduction and development 67, 162-171,
doi:10.1002/mrd.10386 (2004).
38
Pasquale, E. B. The Eph family of receptors. Current opinion in cell biology 9,
608-615 (1997).
39
Buensuceso, A. V. & Deroo, B. J. The ephrin signaling pathway regulates
morphology and adhesion of mouse granulosa cells in vitro. Biology of
reproduction 88, 25, doi:10.1095/biolreprod.112.100123 (2013).
40
Perona, R. Cell signalling: growth factors and tyrosine kinase receptors. Clinical
& translational oncology : official publication of the Federation of Spanish
Oncology Societies and of the National Cancer Institute of Mexico 8, 77-82
(2006).
41
Fan, H. Y., Liu, Z., Mullany, L. K. & Richards, J. S. Consequences of RAS and
MAPK activation in the ovary: the good, the bad and the ugly. Molecular and
cellular endocrinology 356, 74-79, doi:10.1016/j.mce.2011.12.005 (2012).
42
Marshall, C. Specificity of receptor tyrosine kinase signaling: transient versus
sustained extracellular signal-regulated kinase activation. Cell 80, 179-185
(1995).
43
Robinson, R. S. et al. Angiogenesis and vascular function in the ovary.
Reproduction (Cambridge, England) 138, 869-881, doi:10.1530/rep-09-0283
(2009).
44
Egawa, M. et al. Ephrin B1 is expressed on human luteinizing granulosa cells in
corpora lutea of the early luteal phase: the possible involvement of the B class
60
Eph-ephrin system during corpus luteum formation. The Journal of clinical
endocrinology and metabolism 88, 4384-4392 (2003).
45
Gospodarowicz, D. et al. Corpus luteum angiogenic factor is related to fibroblast
growth factor. Endocrinology 117, 2383-2391, doi:10.1210/endo-117-6-2383
(1985).
46
Phillips, H. S., Hains, J., Leung, D. W. & Ferrara, N. Vascular endothelial growth
factor is expressed in rat corpus luteum. Endocrinology 127, 965-967,
doi:10.1210/endo-127-2-965 (1990).
47
Steelman, L. S. et al. Roles of the Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR
pathways in controlling growth and sensitivity to therapy-implications for cancer
and aging. Aging (Albany NY) 3, 192 (2011).
48
Park, J.-Y. et al. EGF-Like Growth Factors As Mediators of LH Action in the
Ovulatory Follicle. Science 303, 682-684 (2004).
49
Noma, N. et al. LH-induced neuregulin 1 (NRG1) type III transcripts control
granulosa cell differentiation and oocyte maturation. Molecular endocrinology
(Baltimore, Md.) 25, 104-116, doi:10.1210/me.2010-0225 (2011).
50
Pitetti, J.-L. et al. Insulin receptor and IGF1R are not required for oocyte growth,
differentiation, and maturation in mice. Sexual Development 3, 264-272 (2009).
51
el-Roeiy, A. et al. Expression of insulin-like growth factor-I (IGF-I) and IGF-II and
the IGF-I, IGF-II, and insulin receptor genes and localization of the gene products
in the human ovary. The Journal of clinical endocrinology and metabolism 77,
1411-1418 (1993).
52
Perks, C., Peters, A. & Wathes, D. Follicular and luteal expression of insulin-like
growth factors I and II and the type 1 IGF receptor in the bovine ovary. Journal of
reproduction and fertility 116, 157-165 (1999).
53
Zhou, J., Kumar, T. R., Matzuk, M. M. & Bondy, C. Insulin-like growth factor I
regulates gonadotropin responsiveness in the murine ovary. Molecular
endocrinology (Baltimore, Md.) 11, 1924-1933 (1997).
54
Spicer, L. & Echternkamp, S. The ovarian insulin and insulin-like growth factor
system with an emphasis on domestic animals. Domestic animal endocrinology
12, 223-245 (1995).
61
55
Motro, B. & Bernstein, A. Dynamic changes in ovarian c‐kit and Steel expression
during the estrous reproductive cycle. Developmental Dynamics 197, 69-79
(1993).
56
Parrott, J. A. & Skinner, M. K. Direct Actions of Kit-Ligand on Theca Cell Growth
and Differentiation During Follicle Development 1. Endocrinology 138, 3819-3827
(1997).
57
Berisha, B., Steffl, M., Amselgruber, W. & Schams, D. Changes in fibroblast
growth factor 2 and its receptors in bovine follicles before and after GnRH
application and after ovulation. Reproduction (Cambridge, England) 131, 319329, doi:10.1530/rep.1.00798 (2006).
58
Lin, J., Jia, Y., Zeng, W., Mi, Y. & Zhang, C. Basic FGF promotes proliferation of
ovarian granulosa cells in the laying chickens via FGFR1 and PKC pathway.
Reproduction in domestic animals = Zuchthygiene 47, 135-142,
doi:10.1111/j.1439-0531.2011.01813.x (2012).
59
Puscheck, E., Patel, Y. & Rappolee, D. Fibroblast growth factor receptor (FGFR)4, but not FGFR-3 is expressed in the pregnant ovary. Molecular and cellular
endocrinology 132, 169-176 (1997).
60
Sugiura, K. et al. Oocyte-derived BMP15 and FGFs cooperate to promote
glycolysis in cumulus cells. Development (Cambridge, England) 134, 2593-2603,
doi:10.1242/dev.006882 (2007).
61
Drummond, A. E., Tellbach, M., Dyson, M. & Findlay, J. K. Fibroblast growth
factor-9, a local regulator of ovarian function. Endocrinology 148, 3711-3721,
doi:10.1210/en.2006-1668 (2007).
62
Schreiber, N. B. & Spicer, L. J. Effects of fibroblast growth factor 9 (FGF9) on
steroidogenesis and gene expression and control of FGF9 mRNA in bovine
granulosa cells. Endocrinology 153, 4491-4501, doi:10.1210/en.2012-1003
(2012).
63
Buratini, J. et al. Expression of fibroblast growth factor-8 and regulation of
cognate receptors, fibroblast growth factor receptor-3c and-4, in bovine antral
follicles. Reproduction (Cambridge, England) 130, 343-350 (2005).
62
64
Salas, C. et al. Nerve growth factor-dependent activation of trkA receptors in the
human ovary results in synthesis of follicle-stimulating hormone receptors and
estrogen secretion. The Journal of clinical endocrinology and metabolism 91,
2396-2403, doi:10.1210/jc.2005-1925 (2006).
65
Zhang, L., Liang, Y., Liu, Y. & Xiong, C.-L. The role of brain-derived neurotrophic
factor in mouse oocyte maturation< i> in vitro</i> involves activation of protein
kinase B. Theriogenology 73, 1096-1103 (2010).
66
Jensen, T. & Johnson, A. Expression and function of brain-derived neurotrophin
factor and its receptor, TrkB, in ovarian follicles from the domestic hen (Gallus
gallus domesticus). Journal of Experimental Biology 204, 2087-2095 (2001).
67
Paredes, A. et al. TrkB receptors are required for follicular growth and oocyte
survival in the mammalian ovary. Developmental biology 267, 430-449,
doi:10.1016/j.ydbio.2003.12.001 (2004).
68
Shimizu, T. et al. Induction of follicular development by direct single injection of
vascular endothelial growth factor gene fragments into the ovary of miniature
gilts. Biology of reproduction 69, 1388-1393 (2003).
69
Berisha, B., Schams, D., Kosmann, M., Amselgruber, W. & Einspanier, R.
Expression and localisation of vascular endothelial growth factor and basic
fibroblast growth factor during the final growth of bovine ovarian follicles. The
Journal of endocrinology 167, 371-382 (2000).
70
Shin, S.-Y., Lee, H.-J., Ko, D.-S., Lee, H.-C. & Park, W. I. The regulators of
VEGF expression in mouse ovaries. Yonsei medical journal 46, 679-686 (2005).
71
Celik-Ozenci, C., Akkoyunlu, G., Kayisli, U. A., Arici, A. & Demir, R. Localization
of vascular endothelial growth factor in the zona pellucida of developing ovarian
follicles in the rat: a possible role in destiny of follicles. Histochemistry and cell
biology 120, 383-390 (2003).
72
Yang, M. & Fortune, J. Vascular endothelial growth factor stimulates the primary
to secondary follicle transition in bovine follicles in vitro. Molecular reproduction
and development 74, 1095-1104 (2007).
73
Xu, Y., Zagoura, D., Keck, C. & Pietrowski, D. Expression of Eph receptor
tyrosine kinases and their ligands in human Granulosa lutein cells and human
63
umbilical vein endothelial cells. Experimental and clinical endocrinology &
diabetes : official journal, German Society of Endocrinology [and] German
Diabetes Association 114, 590-595, doi:10.1055/s-2006-950499 (2006).
74
Panigone, S., Hsieh, M., Fu, M., Persani, L. & Conti, M. Luteinizing hormone
signaling in preovulatory follicles involves early activation of the epidermal growth
factor receptor pathway. Molecular endocrinology (Baltimore, Md.) 22, 924-936,
doi:10.1210/me.2007-0246 (2008).
75
SEGALOFF, D. L. & ASCOLI, M. The Lutropin/Choriogonadotropin Receptor… 4
Years Later*. Endocrine reviews 14, 324-347 (1993).
76
Horie, K. et al. The expression of c-kit protein during oogenesis and early
embryonic development. Biology of reproduction 45, 547-552 (1991).
77
Reynaud, K., Cortvrindt, R., Smitz, J. & Driancourt, M. A. Effects of kit ligand and
anti‐kit antibody on growth of cultured mouse preantral follicles. Molecular
reproduction and development 56, 483-494 (2000).
78
Driancourt, M.-A., Reynaud, K., Cortvrindt, R. & Smitz, J. Roles of KIT and KIT
LIGAND in ovarian function. Reviews of reproduction 5, 143-152 (2000).
79
Moniruzzaman, M., Sakamaki, K., Akazawa, Y. & Miyano, T. Oocyte growth and
follicular development in KIT-deficient Fas-knockout mice. Reproduction
(Cambridge, England) 133, 117-125 (2007).
80
Liu, K. Stem cell factor (SCF)-kit mediated phosphatidylinositol 3 (PI3) kinase
signaling during mammalian oocyte growth and early follicular development.
Frontiers in bioscience : a journal and virtual library 11, 126-135 (2006).
81
Julio-Pieper, M. et al. Nerve growth factor induces vascular endothelial growth
factor expression in granulosa cells via a trkA receptor/mitogen-activated protein
kinase-extracellularly regulated kinase 2-dependent pathway. The Journal of
clinical endocrinology and metabolism 94, 3065-3071, doi:10.1210/jc.2009-0542
(2009).
82
Klagsbrun, M. & D'Amore, P. A. Regulators of angiogenesis. Annual review of
physiology 53, 217-239, doi:10.1146/annurev.ph.53.030191.001245 (1991).
83
Farkkila, A. et al. Vascular endothelial growth factor (VEGF) and its receptor
VEGFR-2 are highly expressed in ovarian granulosa cell tumors. European
64
journal of endocrinology / European Federation of Endocrine Societies 164, 115122, doi:10.1530/eje-10-0849 (2011).
84
Flier, J. S., Underhill, L. H. & Le Roith, D. Insulin-like growth factors. New
England Journal of Medicine 336, 633-640 (1997).
85
Poretsky, L. & Kalin, M. F. The gonadotropic function of insulin. Endocrine
reviews 8, 132-141, doi:10.1210/edrv-8-2-132 (1987).
86
Poretsky, L., Cataldo, N. A., Rosenwaks, Z. & Giudice, L. C. The insulin-related
ovarian regulatory system in health and disease. Endocrine reviews 20, 535-582,
doi:10.1210/edrv.20.4.0374 (1999).
87
Adashi, E. Y., Resnick, C. E., D'Ercole, A. J., Svoboda, M. E. & Van Wyk, J. J.
Insulin-like growth factors as intraovarian regulators of granulosa cell growth and
function. Endocrine reviews 6, 400-420, doi:10.1210/edrv-6-3-400 (1985).
88
Samoto, T. et al. Insulin receptor expression in follicular and stromal
compartments of the human ovary over the course of follicular growth, regression
and atresia. Endocrine journal 40, 715-726 (1993).
89
Zhou, J., Chin, E. & Bondy, C. Cellular pattern of insulin-like growth factor-I (IGFI) and IGF-I receptor gene expression in the developing and mature ovarian
follicle. Endocrinology 129, 3281-3288, doi:10.1210/endo-129-6-3281 (1991).
90
Sudo, N. et al. Insulin-like growth factor-I (IGF-I) system during follicle
development in the bovine ovary: relationship among IGF-I, type 1 IGF receptor
(IGFR-1) and pregnancy-associated plasma protein-A (PAPP-A). Molecular and
cellular endocrinology 264, 197-203, doi:10.1016/j.mce.2006.10.011 (2007).
91
Hammond, J. M., Mondschein, J. S., Samaras, S. E. & Canning, S. F. The
ovarian insulin-like growth factors, a local amplification mechanism for
steroidogenesis and hormone action. The Journal of steroid biochemistry and
molecular biology 40, 411-416 (1991).
92
Baker, J. et al. Effects of an Igf1 gene null mutation on mouse reproduction.
Molecular endocrinology (Baltimore, Md.) 10, 903-918,
doi:10.1210/mend.10.7.8813730 (1996).
65
93
Hirakawa, T. et al. A role of insulin-like growth factor I in luteinizing hormone
receptor expression in granulosa cells. Endocrinology 140, 4965-4971,
doi:10.1210/endo.140.11.7112 (1999).
94
Seto-Young, D., Zajac, J., Liu, H.-C., Rosenwaks, Z. & Poretsky, L. The role of
mitogen-activated protein kinase in insulin and insulin-like growth factor I (IGF-I)
signaling cascades for progesterone and IGF-binding protein-1 production in
human granulosa cells. Journal of Clinical Endocrinology & Metabolism 88, 33853391 (2003).
95
Seto-Young, D. et al. Differential roles of MAPK-Erk1/2 and MAPK-p38 in insulin
or insulin-like growth factor-I (IGF-I) signaling pathways for progesterone
production in human ovarian cells. Hormone and metabolic research 43, 386
(2011).
96
Rao, J. U., Shah, K. B., Puttaiah, J. & Rudraiah, M. Gene expression profiling of
preovulatory follicle in the buffalo cow: effects of increased IGF-I concentration
on periovulatory events. PLoS One 6, e20754, doi:10.1371/journal.pone.0020754
(2011).
97
Arvanitis, D. & Davy, A. Eph/ephrin signaling: networks. Genes & development
22, 416-429, doi:10.1101/gad.1630408 (2008).
98
Andres, A. C. et al. Expression of two novel eph-related receptor protein tyrosine
kinases in mammary gland development and carcinogenesis. Oncogene 9, 14611467 (1994).
99
Triplett, J. W. & Feldheim, D. A. Eph and ephrin signaling in the formation of
topographic maps. Seminars in cell & developmental biology 23, 7-15,
doi:10.1016/j.semcdb.2011.10.026 (2012).
100
Feng, P., Knecht, M. & Catt, K. Hormonal control of epidermal growth factor
receptors by gonadotropins during granulosa cell differentiation. Endocrinology
120, 1121-1126 (1987).
101
Andric, N., Thomas, M. & Ascoli, M. Transactivation of the epidermal growth
factor receptor is involved in the lutropin receptor-mediated down-regulation of
ovarian aromatase expression in vivo. Molecular endocrinology (Baltimore, Md.)
24, 552-560, doi:10.1210/me.2009-0450 (2010).
66
102
Ashkenazi, H. et al. Epidermal growth factor family members: endogenous
mediators of the ovulatory response. Endocrinology 146, 77-84,
doi:10.1210/en.2004-0588 (2005).
103
Woods, D. C. & Johnson, A. Protein kinase C activity mediates LH-induced
ErbB/Erk signaling in differentiated hen granulosa cells. Reproduction
(Cambridge, England) 133, 733-741 (2007).
104
Norris, R. P., Freudzon, M., Nikolaev, V. O. & Jaffe, L. A. Epidermal growth factor
receptor kinase activity is required for gap junction closure and for part of the
decrease in ovarian follicle cGMP in response to LH. Reproduction (Cambridge,
England) 140, 655-662, doi:10.1530/rep-10-0288 (2010).
105
Baird, A. & Hsueh, A. J. Fibroblast growth factor as an intraovarian hormone:
differential regulation of steroidogenesis by an angiogenic factor. Regulatory
peptides 16, 243-250 (1986).
106
Powers, C., McLeskey, S. & Wellstein, A. Fibroblast growth factors, their
receptors and signaling. Endocrine-related cancer 7, 165-197 (2000).
107
Ornitz, D. M. et al. Receptor specificity of the fibroblast growth factor family. The
Journal of biological chemistry 271, 15292-15297 (1996).
108
Schreiber, N. B., Totty, M. L. & Spicer, L. J. Expression and effect of fibroblast
growth factor 9 in bovine theca cells. The Journal of endocrinology 215, 167-175,
doi:10.1530/joe-12-0293 (2012).
109
Bugler, B., Amalric, F. & Prats, H. Alternative initiation of translation determines
cytoplasmic or nuclear localization of basic fibroblast growth factor. Molecular
and cellular biology 11, 573-577 (1991).
110
Davis, M. G. et al. Intracrine and autocrine effects of basic fibroblast growth
factor in vascular smooth muscle cells. Journal of molecular and cellular
cardiology 29, 1061-1072 (1997).
111
Bertolini, J., Cowling, J., Hearn, M. & Guthridge, M. Localization of bFGF mRNA
in cyclic rat ovary, diethylstilbesterol primed rat ovary, and cultured rat granulosa
cells. Growth factors (Chur, Switzerland) 7, 15-25 (1992).
112
Yamashita, H. et al. Effect of local neutralization of basic fibroblast growth factor
or vascular endothelial growth factor by a specific antibody on the development
67
of the corpus luteum in the cow. Molecular reproduction and development 75,
1449-1456 (2008).
113
Cabrita, M. A. & Christofori, G. Sprouty proteins, masterminds of receptor
tyrosine kinase signaling. Angiogenesis 11, 53-62, doi:10.1007/s10456-0089089-1 (2008).
114
Jiang, Z. L., Ripamonte, P., Buratini, J., Portela, V. M. & Price, C. A. Fibroblast
growth factor-2 regulation of Sprouty and NR4A genes in bovine ovarian
granulosa cells. Journal of cellular physiology 226, 1820-1827,
doi:10.1002/jcp.22509 (2011).
115
Hacohen, N., Kramer, S., Sutherland, D., Hiromi, Y. & Krasnow, M. A. sprouty
encodes a novel antagonist of FGF signaling that patterns apical branching of the
Drosophila airways. Cell 92, 253-263 (1998).
116
Ozaki, K. et al. ERK pathway positively regulates the expression of Sprouty
genes. Biochemical and biophysical research communications 285, 1084-1088,
doi:10.1006/bbrc.2001.5295 (2001).
117
Felfly, H. & Klein, O. D. Sprouty genes regulate proliferation and survival of
human embryonic stem cells. Scientific reports 3, 2277, doi:10.1038/srep02277
(2013).
118
Reich, A., Sapir, A. & Shilo, B. Sprouty is a general inhibitor of receptor tyrosine
kinase signaling. Development (Cambridge, England) 126, 4139-4147 (1999).
119
Panagiotaki, N., Dajas-Bailador, F., Amaya, E., Papalopulu, N. & Dorey, K.
Characterisation of a new regulator of BDNF signalling, Sprouty3, involved in
axonal morphogenesis in vivo. Development (Cambridge, England) 137, 40054015, doi:10.1242/dev.053173 (2010).
120
Jiang, Z. & Price, C. A. Differential actions of fibroblast growth factors on
intracellular pathways and target gene expression in bovine ovarian granulosa
cells. Reproduction (Cambridge, England) 144, 625-632, doi:10.1530/rep-120199 (2012).
121
Yaniz, J. et al. Relationships between milk production, ovarian function and
fertility in high-producing dairy herds in north-eastern Spain. Reproduction in
68
domestic animals = Zuchthygiene 43 Suppl 4, 38-43, doi:10.1111/j.14390531.2008.01227.x (2008).
122
Oltenacu, P. & Broom, D. The impact of genetic selection for increased milk yield
on the welfare of dairy cows. Animal welfare 19, 39-49 (2010).
123
Ferguson, J. Production and Reproduction In Dalry Cows. (1993).
124
Lucy, M. Reproductive loss in high-producing dairy cattle: where will it end?
Journal of dairy science 84, 1277-1293 (2001).
125
Asakai, R. et al. Differential gene expression of fibroblast growth factor receptor
isoforms in rat ovary. Molecular and cellular endocrinology 104, 75-80 (1994).
126
Fan, H. Y. & Richards, J. S. Minireview: physiological and pathological actions of
RAS in the ovary. Molecular endocrinology (Baltimore, Md.) 24, 286-298,
doi:10.1210/me.2009-0251 (2010).
127
Lodish, H., Berk, A. & Zipursky, S. Molecular Cell Biology 4th edition. (2000).
128
Belfiore, A., Frasca, F., Pandini, G., Sciacca, L. & Vigneri, R. Insulin receptor
isoforms and insulin receptor/insulin-like growth factor receptor hybrids in
physiology and disease. Endocrine reviews 30, 586-623, doi:10.1210/er.20080047 (2009).
129
Fan, H. Y. et al. MAPK3/1 (ERK1/2) in ovarian granulosa cells are essential for
female fertility. Science 324, 938-941, doi:10.1126/science.1171396 (2009).
130
Koch, D. et al. KIT variants in bovine ovarian cells and corpus luteum. Growth
factors (Chur, Switzerland) 27, 100-113 (2009).
131
Ferrero, H. et al. Efficiency and purity provided by the existing methods for the
isolation of luteinized granulosa cells: a comparative study. Human reproduction
(Oxford, England) 27, 1781-1789, doi:10.1093/humrep/des096 (2012).
132
Bustin, S. A. et al. The MIQE guidelines: minimum information for publication of
quantitative real-time PCR experiments. Clinical chemistry 55, 611-622 (2009).
133
Dupuis, L. et al. Role of leptin receptors in granulosa cells during ovulation.
Reproduction (Cambridge, England) 147, 221-229, doi:10.1530/rep-13-0356
(2014).
134
Miki, T. et al. Determination of ligand-binding specificity by alternative splicing:
two distinct growth factor receptors encoded by a single gene. Proceedings of
69
the National Academy of Sciences of the United States of America 89, 246-250
(1992).
135
Singh, S., Singh, M., Mak, I. W., Turcotte, R. & Ghert, M. Investigation of FGFR2IIIC signaling via FGF-2 ligand for advancing GCT stromal cell differentiation.
PLoS One 7, e46769, doi:10.1371/journal.pone.0046769 (2012).
136
Chlebova, K. et al. High molecular weight FGF2: the biology of a nuclear growth
factor. Cellular and molecular life sciences : CMLS 66, 225-235,
doi:10.1007/s00018-008-8440-4 (2009).
137
Gavine, P. R. et al. AZD4547: an orally bioavailable, potent, and selective
inhibitor of the fibroblast growth factor receptor tyrosine kinase family. Cancer
research 72, 2045-2056, doi:10.1158/0008-5472.can-11-3034 (2012).
138
Guagnano, V. et al. FGFR genetic alterations predict for sensitivity to NVPBGJ398, a selective pan-FGFR inhibitor. Cancer discovery 2, 1118-1133,
doi:10.1158/2159-8290.cd-12-0210 (2012).
139
Hsieh, M., Thao, K. & Conti, M. Genetic dissection of epidermal growth factor
receptor signaling during luteinizing hormone-induced oocyte maturation. PLoS
One 6, e21574, doi:10.1371/journal.pone.0021574 (2011).
140
Azhar, M. et al. Gene targeted ablation of high molecular weight fibroblast growth
factor-2. Developmental dynamics : an official publication of the American
Association of Anatomists 238, 351-357, doi:10.1002/dvdy.21835 (2009).
141
Koos, R. D. & Olson, C. E. Expression of basic fibroblast growth factor in the rat
ovary: detection of mRNA using reverse transcription-polymerase chain reaction
amplification. Molecular endocrinology (Baltimore, Md.) 3, 2041-2048,
doi:10.1210/mend-3-12-2041 (1989).
142
Gospodarowicz, D. & Bialecki, H. Fibroblast and epidermal growth factors are
mitogenic agents for cultured granulosa cells of rodent, porcine, and human
origin. Endocrinology 104, 757-764, doi:10.1210/endo-104-3-757 (1979).
143
Roberts, R. D. & Ellis, R. C. Mitogenic effects of fibroblast growth factors on
chicken granulosa and theca cells in vitro. Biology of reproduction 61, 1387-1392
(1999).
70
144
Tilly, J. L., Billig, H., Kowalski, K. I. & Hsueh, A. J. Epidermal growth factor and
basic fibroblast growth factor suppress the spontaneous onset of apoptosis in
cultured rat ovarian granulosa cells and follicles by a tyrosine kinase-dependent
mechanism. Molecular endocrinology (Baltimore, Md.) 6, 1942-1950 (1992).
145
Adashi, E. Y., Resnick, C. E., Croft, C. S., May, J. V. & Gospodarowicz, D. Basic
fibroblast growth factor as a regulator of ovarian granulosa cell differentiation: a
novel non-mitogenic role. Molecular and cellular endocrinology 55, 7-14 (1988).
146
Nilsson, E., Parrott, J. A. & Skinner, M. K. Basic fibroblast growth factor induces
primordial follicle development and initiates folliculogenesis. Molecular and
cellular endocrinology 175, 123-130 (2001).
147
Ortega, S., Ittmann, M., Tsang, S. H., Ehrlich, M. & Basilico, C. Neuronal defects
and delayed wound healing in mice lacking fibroblast growth factor 2.
Proceedings of the National Academy of Sciences of the United States of
America 95, 5672-5677 (1998).
148
Mason, J. M., Morrison, D. J., Basson, M. A. & Licht, J. D. Sprouty proteins:
multifaceted negative-feedback regulators of receptor tyrosine kinase signaling.
Trends in cell biology 16, 45-54, doi:10.1016/j.tcb.2005.11.004 (2006).
149
Barrios, A. et al. Eph/Ephrin signaling regulates the mesenchymal-to-epithelial
transition of the paraxial mesoderm during somite morphogenesis. Current
biology : CB 13, 1571-1582 (2003).
150
Irving-Rodgers, H. F., Harland, M. L. & Rodgers, R. J. A novel basal lamina
matrix of the stratified epithelium of the ovarian follicle. Matrix biology : journal of
the International Society for Matrix Biology 23, 207-217,
doi:10.1016/j.matbio.2004.05.008 (2004).
151
Kalluri, R. & Neilson, E. G. Epithelial-mesenchymal transition and its implications
for fibrosis. The Journal of clinical investigation 112, 1776-1784,
doi:10.1172/jci20530 (2003).
152
Machell, N. H. & Farookhi, R. E- and N-cadherin expression and distribution
during luteinization in the rat ovary. Reproduction (Cambridge, England) 125,
791-800 (2003).
71
153
Konecny, G. E. et al. Activity of the fibroblast growth factor receptor inhibitors
dovitinib (TKI258) and NVP-BGJ398 in human endometrial cancer cells.
Molecular cancer therapeutics 12, 632-642, doi:10.1158/1535-7163.mct-12-0999
(2013).
154
Robinson, R. S. et al. Fibroblast growth factor 2 is more dynamic than vascular
endothelial growth factor A during the follicle-luteal transition in the cow. Biology
of reproduction 77, 28-36, doi:10.1095/biolreprod.106.055434 (2007).
72