Journal of General Virology (2009), 90, 2402–2412
DOI 10.1099/vir.0.012708-0
Cellular factor YY1 downregulates the human
papillomavirus 16 E6/E7 promoter, P97, in vivo and
in vitro from a negative element overlapping the
transcription-initiation site
Michael J. Lace,1,2 Yasushi Yamakawa,1 Masato Ushikai,1
James R. Anson,1 Thomas H. Haugen1,2 and Lubomir P. Turek1,2
Correspondence
1
Michael J. Lace
2
[email protected]
Received 15 April 2009
Accepted 19 June 2009
Veterans Affairs Medical Center, 601 Highway 6 West, Iowa City, IA 52246, USA
Department of Pathology, University of Iowa Roy J. and Lucille A. Carver College of Medicine, Iowa
City, IA 52242, USA
Cellular factors that bind to cis sequences in the human papillomavirus 16 (HPV-16) upstream
regulatory region (URR) positively and negatively regulate the viral E6 and E7 oncogene promoter,
P97. DNase I footprinting has revealed the binding of cellular proteins to two previously
undetected cis elements overlapping and 39 of the transcription-initiation site of the P97
promoter. Mutations within homologous motifs found in both of these cis elements abolished their
negative function in vivo and the binding of the same cellular complex in vitro. This factor was
identified as YY1 by complex mobility and binding specificity in comparison with vaccinia virusexpressed, purified recombinant YY1 protein and by antigenic reactivity with YY1 antisera. Cis
mutations in the ‘initiator’ YY1 site activated the P97 promoter in vivo and in vitro. P97 was also
activated threefold in vitro by depletion of endogenous YY1 with wild-type, but not mutant, YY1
oligonucleotides from the IgH kappa E39 enhancer. Furthermore, increasing concentrations of
exogenous, purified recombinant YY1 repressed wild-type P97 transcript levels by up to
threefold, but did not influence the P97 promoter mutated in the ‘initiator’ YY1 site. Thus, the
promoter-proximal YY1 site was not necessary for correct transcription initiation at the P97
promoter, but was found to be required for downregulation of P97 transcription in vivo and in
vitro. In contrast to other viral and cellular promoters, where YY1 is thought to function as a
positive transcription-‘initiator’ factor, HPV-16 P97 transcription is downregulated by YY1 from a
critical motif overlapping the transcription start site.
INTRODUCTION
Human papillomaviruses (HPVs) are small DNA tumour
viruses that infect, persist in and cause proliferative lesions
in the epithelial cells of the skin, ectoderm-derived
mucosae and their adnexa. Mucosal HPV types are
associated with the majority of carcinomas of the uterine
cervix, many anogenital cancers and approximately 25 % of
head and neck cancers (reviewed by Psyrri & DiMaio,
2008). HPV persistence is dependent on tightly regulated
expression of viral transforming genes (E6 and E7) and
limiting levels of critical replication factors (such as E1)
(Hebner & Laimins, 2006). However, a complete understanding of the mechanisms that maintain latent human
papillomavirus (HPV) infection or of cellular factors that
may restrict early papillomaviral gene expression in the
basal epithelium is limited (Thierry, 2009). The HPV-16
transforming proteins, E6 and E7, are transcribed from a
single major early promoter, P97. The HPV-16 P97
2402
promoter is regulated by upstream cis elements that
interact with multiple cellular and viral transcription
factors, such as TEF-1 (Ishiji et al., 1992), AP-1 (Cripe
et al., 1990), AP-2, PEF-1 (Cuthill et al., 1993), NF-1/CTF
(Gloss et al., 1987) and the HPV E2 gene products (Cripe
et al., 1987; Lace et al., 2008a; Soeda et al., 2006). Deletion
mutagenesis of the HPV-16 regulatory region has indicated
that, in addition to the TEF-1-dependent 63 nt proximal
enhancer fragment (PE), other cis-acting sequences influence early gene expression (Cripe et al., 1990; Ishiji et al.,
1992; Lace et al., 2008b); however, the role of cis sequences
spanning the P97 initiation site in the regulation of HPV16 transcription and the identity of cellular factors
interacting with them has remained poorly defined. The
low basal activity of the HPV-16 promoter in keratinocytes
suggests that one or more nuclear proteins downregulate
P97 promoter activity by interacting with the HPV-16
regulatory cis sequences. Downregulation of E6–E7 expres-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
012708
Printed in Great Britain
YY1 repression of HPV-16 early gene transcription
sion from the P97 promoter by this mechanism would be
expected to contribute to virus latency. This study focuses
on the identification of a cellular transcription factor
responsible for the downregulation of transcription from
the HPV-16 major early promoter.
The ubiquitous cellular factor YY1 (UCRBP, d, NF-E1, CF1
or NMP-1) is thought to play a critical role in tumorigenesis
(Gordon et al., 2006) and HPV infection (Baritaki et al.,
2007) and has been shown to function as both a positive
(Riggs et al., 1993; Satyamoorthy et al., 1993; Mills et al.,
1994) and a negative (Lee et al., 1992; Liu et al., 1994;
Margolis et al., 1994; Montalvo et al., 1995) regulator of
cellular and viral gene expression. YY1 is a zinc fingerbinding protein related to the Drosophila Krüppel repressor
family that was originally defined as a dual positive and
negative regulator of the same adeno-associated virus (AAV)
P5 promoter, depending on its binding position (Shi et al.,
1991). YY1 binding to a site located 60 bp upstream represses
P5 promoter activity, whereas its binding to an initiator-like
site overlapping the P5 transcription start site was observed
to activate the AAV P5 (+1) promoter in vitro (Seto et al.,
1991). YY1 has since been identified as a dual regulator of
other key cellular promoters (Shi et al., 1997; Weill et al.,
2003) and other examples of this dual functional role among
transcription factors have also been documented (reviewed
by Roberts & Green, 1995). YY1 has also been characterized
as an initiator of vaccinia virus late gene expression by
binding to the I1-L start site (Broyles et al., 1999).
The role of YY1 in the regulation of HPV early gene
expression has been supported by results suggesting that the
major early promoters (MEPs) of HPV-18 (Bauknecht et al.,
1992) and HPV-11 (Ralph et al., 2006) are repressed by YY1
binding to distal sites upstream of the MEPs. It has also been
shown that extrachromosomal or integrated HPV-16 DNA
isolated from malignant cervical biopsies contains mutated
or deleted YY1 sites upstream of the P97 start site (May et al.,
1994; Schmidt et al., 2001), resulting in increased P97
transcription, origin of replication (ori) function, initial
plasmid amplification and virus immortalization capacity
(Lace et al., 2009). It has also been suggested that YY1 bound
to several upstream motifs targets transcriptional activators
such as AP-1 (O’Connor et al., 1996). YY1 also appears to
exert both positive and negative effects on the cutaneous
HPV-8 E6 promoter, depending on its binding position
(Pajunk et al., 1997). YY1 may also act as an initiator of a
putative transcription start site, upstream and independent
of the early gene promoter, E6–E7, in HPV-16 (Tan et al.,
2003). However, in contrast to heterologous viral promoters
where YY1 clearly functions as an initiator of transcription,
e.g. the AAV P5(+1), we demonstrate that downregulation
of the HPV-16 E6–E7 promoter requires YY1 binding to a
critical motif adjacent to the P97 transcription start site.
METHODS
Plasmid constructs. The wild-type P97– (nt 6530 to +153) cat
reporter was synthesized by PCR amplification followed by digestion
http://vir.sgmjournals.org
with BamHI and HindIII and insertion into a pUC 18-cat vector.
Nucleotide substitutions in the P97 cis elements were introduced by
PCR (Ishiji et al., 1992), followed by digestion with SphI/HindIII or
AgeI/HindIII and insertion into the P97 cat parent. The HPV-16
W12E plasmid (GenBank accession no. AF125673) was a gift from P.
Lambert, McArdle Laboratory for Cancer Research, Madison, WI,
USA (Flores & Lambert, 1997). The pUC-based precursors of the
HPV-16 genomic plasmids were digested with BamHI and recircularized as described previously (Lace et al., 2008b). YY1 expression
plasmids were gifts from J. Flanagan, University of Iowa, Iowa City,
IA, USA. The pCG-neo plasmid was constructed by using the BamHI–
HindIII fragment from SV2-neo and the pCG backbone (Ushikai et
al., 1994). The P97 G-free plasmids were synthesized via a single
round of PCR. The HPV-16 G-free PCR products extend to nt +111,
incorporating G-to-C transversions at nt +101 and +106. These
nucleotide substitutions were found to ensure that P97 initiated Gfree transcripts. The PCR products were digested with EcoRI and PmlI
and linked to a 380 nt G-free cassette, G-free 380 (a gift from R.
Cortese, CEINGE, Naples, Italy). The Ad MLP G-free110 plasmid was
a gift from R. Roeder, Rockefeller University, New York, NY, USA.
The TM-YY1 expression plasmid was constructed by digestion of
UCRBP (YY1) cDNA plasmid (Flanagan et al., 1992) with NcoI and
XbaI and insertion into the TM-1 vector (Moss, 1991). All PCRgenerated clones were sequenced by using an automated ABI
sequencer. All plasmids were column-purified (Promega).
Cells and transfections. HeLa and HaCaT (a gift from N. Fusenig,
DFKZ, Heidelberg, Germany) cell lines were cultured as described
previously (Cripe et al., 1990). SCC13 cells were cultured as described
elsewhere (Lace et al., 2008b). HeLa cells were transfected in duplicate
with 1.5 mg reporter construct DNA per 35 mm well by calcium
precipitation (Cripe et al., 1987), whilst HaCaT cells (Boukamp et al.,
1988) were transfected with 9 mg reporter construct per 100 mm dish
by lipofection (Life Technologies) as described previously (Ishiji et al.,
1992). Up to 40 mg recircularized HPV-16 genome was transfected
into HeLa cells (which do not support HPV replication) prior to RNA
harvest and analysis by RNase protection as described elsewhere
(Ushikai et al., 1994).
YY1 protein expression. The recombinant vaccinia virus (Moss,
1991) expressing the YY1 protein was isolated as described previously
(Ushikai et al., 1994). In vitro-translated YY1 was synthesized by using
the UCRBP (YY1) plasmid (Flanagan et al., 1992) as a transcription
template and the RNA translated in rabbit reticulocyte lysate
(Promega) according to the manufacturer’s protocol.
Extraction and purification of recombinant YY1 from vaccinia
virus-infected cells. Confluent HeLa cultures were infected as
described previously (Ushikai et al., 1994). Cells were harvested and
washed with 150 mM NaCl/10 mM Tris/HCl 14 h after infection.
The recombinant YY1 protein was then extracted by using a
previously described ammonium sulfate protocol (Cripe et al.,
1990) where both nuclear and cytoplasmic fractions were collected.
The protein was then purified by passage over a DEA–cellulose
column and elution in 600–800 mM KCl as described previously
(Ushikai et al., 1994), followed by three cycles of adsorption and
elution from a DNA affinity column. The affinity column was
constructed with 15 mg biotinylated PCR product, generated by
amplification of the Moloney murine leukemia virus (MLV)
upstream conserved region (UCR) element (Flanagan et al., 1992)
that was isolated on a 200 ml streptavidin–agarose bed. Purified
affinity fractions were then concentrated approximately sevenfold by
using a Centricon ultrafiltration column (molecular mass cut-off of
30 kDa; Amicon). The protein was then dialysed to a final KCl
concentration of 50 mM in a micro-collodium bag (Sartorius). The
purity of the YY1 preparation was checked by Western blotting with
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
2403
M. J. Lace and others
YY1 antisera, which revealed an enriched protein with a characteristic
apparent size (kDa) consistent with YY1 (data not shown).
Mobility-shift assays. Electrophoretic mobility-shift assays were
performed as described previously (Ishiji et al., 1992). YY1 binding
reactions included 5 % (v/v) glycerol, 0.2 mM EDTA, 1.0 mM
dithiothreitol (DTT), 1.0 mM MgCl2, 20 mM Tris (pH 7.6), 30 nM
BPV-1 E2 site #10 oligonucleotide (59-GGTCAAACCGTCTTCGGTGCTC) and 30 nM pdI : dC (Amersham) as non-specific competitors,
0.2 mg BSA ml21 and 50 mM KCl as well as 15 000 c.p.m. gel-purified,
[c-32P]dATP-labelled oligonucleotide probes. For antibody supershifts, YY1 binding was followed by incubation with pre-immune
serum or polyclonal YY1 antiserum (J. Flanagan, University of Iowa)
for 15–30 min on ice before loading onto a 6 % (w/v) polyacrylamide
gel.
In vitro transcription assays. In primer-extension assays, initial
transcription reactions were incubated for 45 min at 25 uC with 200–
400 ng HPV-16 cat plasmid template in the presence of 9 ml in vitro
transcription assay buffer, 3 mM MgCl2, 0.2 ml RNAguard
(Amersham), 10 ml pretested HeLa whole-cell extract (Xiao et al.,
1991), 5 mM cold rNTPs and 0.3 ml [a-32P]rUTP (15 pmol), then
stopped with 0.2 % SDS. Following phenol/chloroform extraction and
ethanol precipitation, the cDNA was then hybridized at 45 uC for
1.5 h with 4000 c.p.m. 59-labelled cat (reverse) primer (59TTAGCTCCTGAAAATCTCGCC) before incubation at 37 uC for
1 h with 10 U avian myeloblastosis virus reverse transcriptase
(Amersham), 20 mM Tris (pH 8.0), 10 mM MgCl2, 5 mM DTT,
0.33 mM dNTPs and 50 mg actinomycin D ml21. After ethanol
precipitation, primer-extension reactions were then run on a 6 %
(w/v) polyacrylamide gel in TBE buffer. G-free in vitro transcriptions,
using 200 ng P97 G-free templates per reaction, were performed with
HeLa nuclear extracts (Promega) as described previously (Ushikai
et al., 1994). In vitro competitions were performed with a known
YY1-binding motif from the kappa-immunoglobulin enhancer (IgH
kappa E39) (Park & Atchison, 1991). Transcripts were visualized on
X-ray film and quantified by densitometric scanning.
DNase I footprinting and Southern blotting. A DNA-footprinting
probe was PCR-amplified from an HPV-16 cat plasmid template
containing HPV-16 nt 7453 to +191 linked to the cat gene. An
unlabelled HPV-16 primer (59-TGCATATTTGGCATAAGGTTTAAACTT) and [c-32P]dATP 59-labelled cat (reverse) primer were used
to amplify the 360 nt HPV-16 probe template. Footprints were
generated with 20 000 c.p.m. probe, 10 ml crude HaCaT nuclear
extract, 30 nM pdI : dC and 30 nM BPV-1 E2 site #10 oligonucleotide
as non-specific competitors, and 1.25 ng DNase I (Amersham) in
20 mM Tris (pH 7.6), 5 % (v/v) glycerol, 0.2 mM EDTA, 50 mM KCl,
1 mM DTT and 1 mM MgCl2. The footprinting reactions were
incubated at 30 uC for 30 min as described previously (Cripe et al.,
1990) and resolved on an 8 % (w/v) polyacrylamide gel. A total of 3 mg
religated HPV-16 DNA was transfected into SCC13 cells with Effectene
(Qiagen). Total DNA was then isolated from transfected cells (QIAamp
DNA Blood kit; Qiagen) 5 days post-transfection and 4 mg of each
DNA sample was digested with DpnI and linearized with BamHI before
Southern blotting as described previously (Lace et al., 2008b).
RESULTS
Cellular factors bind to the HPV-16 P97
transcription start site region
DNase I footprinting was performed with HPV-16
sequences spanning the P97 start site and unfractionated
nuclear extracts from a human keratinocyte cell line
2404
(HaCaT). Cellular proteins formed footprints over two
distinct regions, one overlapping (nt +82 to +113) and the
other 39 (nt +129 to +157) of the P97 start site (Figs 1 and
2). These previously unidentified footprints, ‘fp X’ and ‘fp
Y’, fell within two homologous regions that could
potentially modulate initiation of P97 transcription (‘initiators’ Inr I and Inr III, respectively). Having demonstrated
cellular protein interaction with promoter-proximal HPV16 Inr elements, we examined the identity of cellular
transcription factors binding to these cis elements and their
role in the regulation of HPV-16 transcription.
A cellular factor bound to the promoter-proximal
HPV-16 P97 Inr elements is indistinguishable
from YY1
A sequence comparison of the two cis-acting Inr elements
encompassed by cellular footprints ‘fp X’ and ‘fp Y’
revealed a homologous motif, CCA(C/A)A (Fig. 1). Several
additional homologous HPV-16 motifs located upstream
of the P97 start site were examined and found to be
important for the negative function of distal ‘silencer’
elements in a parallel study (M. J. Lace, unpublished data).
We sought to identify the cellular factors forming specific
complexes with these homologous Inr motifs in mobilityshift assays by using fractionated keratinocyte (HaCaT)
nuclear extracts and the oligonucleotides listed in Fig. 1.
We compared the homologous motifs in HPV-16 with
recognition sites of known negative-regulatory transcription factors, revealing a match with the core of the
degenerate consensus site (CCAT) for the ubiquitous
transcription factor YY1 (Lee et al., 1992) (Fig. 1). A
cellular factor formed indistinguishable, specific complexes
with both of the homologous HPV-16 Inr I and Inr III
motifs and the YY1 control sequence, ‘UCR wt’, from the
MLV long terminal repeat (LTR) (Flanagan et al., 1992)
(Fig. 2b, lanes 1, 3 and 5). Mutations within the
homologous Inr motifs and the control YY1-binding site
abolished formation of this complex (Fig. 2b, lanes 2, 4 and
6). Vaccinia virus-expressed YY1 also formed a complex
with the UCR probe that is indistinguishable from those
formed on the HPV-16 Inr motifs (Fig. 2b, compare lane 7
with 9 and 11). Mutations that disrupted binding of the
cellular factor to the Inr cis elements also abolished
recombinant YY1 binding (Fig. 2b, lanes 8, 10 and 12).
These results show that YY1 binding to promoter-proximal
cis elements contributes to the formation of cellular
footprints overlapping and 39 of the P97 start site.
Dissociation constants were determined as described
previously (Ushikai et al., 1994) for in vitro-translated
YY1 binding to the promoter-proximal HPV-16 Inr YY1
sites (Fig. 2c). The addition of unlabelled wild-type HPV16 Inr competitor oligonucleotides to YY1 complexes
formed on the MLV UCR motif specifically depleted the
YY1/UCR complex (Fig. 2c, lanes 1–4 and 8–10). Addition
of the mutant competitors (Fig. 2c, lanes 5–7 and 11–13),
however, did not deplete the YY1 complex as efficiently as
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
Journal of General Virology 90
YY1 repression of HPV-16 early gene transcription
Fig. 1. Oligonucleotides used in this study. The HPV-16 P97 promoter and its transcription factor-binding sites are represented
in the schematic. Nucleotide substitutions within each oligonucleotide are represented in lower case below the corresponding
wild-type sequence, spanning the P97 start site. The boxed portions of the oligonucleotides indicate homologous motifs. Shaded
areas represent homologous cis elements. Nucleotide coordinates for oligonucleotides are also indicated. The underlined
segment of the MLV UCR (oligo f ) represents nucleotides found to be critical for YY1 binding. The kappa E39 YY1 binding site
(oligo h) is from an immunoglobin enhancer. The match per nucleotide between the homologous HPV-16 motifs and the YY1
consensus (oligo j ) is indicated. The degenerate code for the consensus is used, where S5G or C and N5A, T, G or C.
the wild-type competitors. The approximate dissociation
constants for YY1 binding to the HPV-16 Inr I, Inr III and
UCR control sites were quantified by densitometric
scanning of two or three independent experiments and
found to be 5, 3 and 15 nM, respectively.
A polyclonal antibody directed against the C terminus of
the YY1 protein was used to test the antigenicity of the
cellular complexes formed with the promoter-proximal cisacting motifs. Whilst the pre-immune serum did not react
with either of the complexes (Fig. 2d, lanes 4 and 8), the
YY1 antiserum produced a supershifted complex with the
cellular factor bound to each of the HPV-16 cis elements
(Fig. 2d, lanes 3 and 7). Taken together, these results
demonstrate that the cellular factor binding to negative cisacting motifs in the HPV-16 regulatory region is
indistinguishable from YY1 by complex mobility, binding
specificity and antigenicity.
YY1 downregulates the HPV-16 P97 promoter
from the Inr I site in vivo
Mutations in the homologous Inr motifs were introduced
into the native HPV-16 P97 promoter CAT construct and
http://vir.sgmjournals.org
assayed in transient transfections in both the keratinocytederived cell line HaCaT and a cervical carcinoma cell line
(HeLa), in which endogenous YY1 has been shown to
function as a transcriptional repressor of other viral
promoters (Shi et al., 1991). Interestingly, mutation of
the homologous Inr III site (Fig. 3a, clone c) had little effect
in the context of the intact, 1 kb HPV-16 promoter.
Mutation of the Inr I motif, however, resulted in an
increase in CAT activity in both cell types (clone b),
indicating that YY1 downregulates P97 promoter activity
from the pivotal Inr I site.
To verify that the Inr I YY1-binding site influenced the
levels of correctly initiated transcripts from the P97 start
site, mutation of the Inr I YY1-binding site in the HPV16 promoter was also shown to increase the steady-state
HPV-16 P97 mRNA levels by 4.3-fold in an RNaseprotection assay (Fig. 3b, lanes 1–2, template a). A
comparable increase in transcription was also detected in
constructs that included the Inr I mutation in the
intact 7.9 kb HPV-16 genome (Fig. 3b, lanes 3–4,
template b); this discrete mutation (Inr mut 14)
similarly abolished YY1 binding in vitro and activated
P97 transcription. As in all RNase-protection assays in
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
2405
M. J. Lace and others
Fig. 2. In vitro footprints formed near the HPV-16 P97 transcription start site identify homologous Inr elements forming
complexes indistinguishable from cellular factor YY1. (a) A probe spanning the HPV-16 P97 start site was used to identify the
binding of cellular proteins in this region. 32P-Labelled PCR-generated HPV-16 DNA (nt 7736 to +191) and crude HaCaT
nuclear extract were included in DNase I reactions in lanes 2 and 3, forming protected areas, footprint fp‘X’ (nt +82 to +113)
and footprint fp‘Y’ (nt +129 to +157). Lane 1 is the control reaction without nuclear extract. Arrows indicate hypersensitivity
sites. (b) Oligonucleotides used as probes and competitors in these mobility-shift assays are listed in Fig. 1. The MLV UCR and
the HPV-16 Inr elements (Inr I and Inr III) were 32P-labelled as probes to form specific complexes with fractionated nuclear
keratinocyte (HaCaT) extracts and recombinant vaccinia virus-expressed YY1 protein. (c) In vitro-translated YY1 was used to
determine the dissociation constants (Kd) for the HPV-16 Inr I and III motifs. Titrations of both wild-type and mutant Inr I and Inr
III oligonucleotides were used as unlabelled competitors. (d) Both fractionated cellular (HaCaT) extract and recombinant
vaccinia virus-expressed YY1 protein were complexed with the HPV-16 YY1-binding elements, Inr I and Inr III, then supershifted
with a polyclonal serum (YY1-Ab; I) that recognizes the UCRBP/YY1 (the MLV UCR-binding protein) in a mobility-shift assay.
The pre-immune serum (P) was included as a negative control. ns, Non-specific bands.
this study, P97 transcription from the replicationcompetent HPV-16 W12E plasmid was measured in
the absence of detectable viral plasmid amplification
(data not shown). However, the Inr I mutation did not
affect HPV plasmid replication in a keratinocyte cell
line, as measured by Southern blotting (Fig. 3b, lanes 5–
2406
6). Overexpression of wild-type YY1 was shown to reduce
P97 promoter activity in vivo, whereas addition of the
defective, YY1-reverse expression plasmid had little effect
(Fig. 3c). Mutation of the P97 Inr I YY1 site relieved the
negative effects of endogenous levels of YY1. Addition of
the YY1 wt plasmid, expressing high levels of exogenous
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
Journal of General Virology 90
YY1 repression of HPV-16 early gene transcription
Fig. 3. YY1 represses the HPV-16 P97 promoter from the Inr I site in vivo. (a) Mutations (shown as black bars, clones b–d)
were introduced into the two HPV-16 YY1-binding sites Inr I and Inr III (shown as white bars) and their promoter activities were
analysed in CAT assays. All values are expressed as a ratio of the mutant to wild-type (clone a) P97 CAT activities and are
averages of three or four independent experiments. All constructs tested include the nt 6153 to +153 HPV-16 fragment linked
to the cat reporter gene and tested in keratinocyte (HaCaT) and cervical carcinoma (HeLa) cell lines. (b) The effect of mutation
of the promoter YY1 site on P97 activity was analysed in the context of the 1 kb HPV-16 promoter (template a) and the whole
7.9 kb HPV-16 genome (template b) in RNase-protection assays using HeLa cells. HPV-16 replication in transfected SCC13
cells was detected as BamHI-linearized, DpnI-resistant 7.9 kb DNA by Southern blotting. An SV40-cat plasmid was
cotransfected as an internal control. The nucleotide substitution for this mutation (Inr mutant 14) was position 91–92, AA to CC
(Fig. 1). (c) The P97 cat reporter was cotransfected with equivalent amounts of pCG neo or the YY1 expression plasmids
generating functional (YY1) or inactive (YY1-rev) protein. These values represent averages of three independent CAT assays.
YY1, however, had no effect on this mutated HPV-16
target (Fig. 3c). Taken together, these results demonstrate
that downregulation of HPV-16 P97 transcription in vivo
requires YY1 binding to a motif overlapping the P97 start
site.
http://vir.sgmjournals.org
YY1 binding to the P97 start site is required for
downregulation of the HPV-16 promoter in vitro
Having shown that the YY1-binding sites are involved in
P97 downregulation in vivo, we then examined the effect of
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
2407
M. J. Lace and others
YY1 on P97 transcription in vitro, using transcriptioncompetent HeLa extracts (Fig. 4a). Primer extensions were
performed with the same native P97 templates that were
tested in vivo (Fig. 2a, b), including those carrying
mutations in the Inr YY1-binding sites (clones b, c and d
in Fig. 2a). Consistent with the results seen in vivo,
mutation of the Inr III YY1 site had no effect (Fig. 4a, lane
9), whereas mutation of the promoter-proximal YY1binding site (Inr I) increased in vitro P97 transcription in a
primer-extension assay (Fig. 4a, lane 6). G-free P97
templates were also constructed and tested in a more
stringently defined in vitro system to ensure that the
transcription levels measured were indeed initiated from
the HPV-16 P97 start site. Mutation of the Inr I
Fig. 4. Mutation in the HPV-16 P97 promoter-proximal YY1-binding site Inr I activates P97 transcription in vitro. (a) The primerextension templates (clones a–d) include the HPV-16 sequence from the BamHI site (nt 6153) to +153 linked to the cat gene.
The activities of these constructs in vitro were determined by titrating increasing amounts (100, 200 and 400 ng) of each
template in a primer-extension assay. (b) Transcription from the wt and Inr I mut 2 P97 G-free constructs was also monitored via
in vitro transcription assays. The adenovirus major late promoter (Ad MLP) was used as an internal control in these experiments.
(c) Increasing amounts of vaccinia virus-expressed YY1 were added to in vitro transcription reactions containing a P97 wildtype (wt) or P97 Inr I mut 2 template. (d) A YY1-binding oligonucleotide from an immunoglobulin enhancer (IgH kappa E39) was
titrated to a final concentration of 0, 33 and 100 nM against a P97 G-free template. (e) The same high-affinity YY1 competitor
was also used against the HPV-16 and AAV P5 (+1) CAT constructs in primer-extension assays. HeLa nuclear extract was
used in all of the in vitro transcription assays and each assay was quantified by densitometric scanning.
2408
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
Journal of General Virology 90
YY1 repression of HPV-16 early gene transcription
YY1-binding site also elevated levels of P97 transcripts
threefold in these experiments (Fig. 4b, lane 2).
Vaccinia virus-expressed YY1 was titrated against the wildtype P97 G-free construct and its corresponding mutant in
the promoter-proximal YY1-binding site (Inr I) (Fig. 4c).
Transcription from the wild-type P97 template was
repressed by at least twofold upon the addition of purified
YY1 protein (Fig. 4c, lane 3), whilst mutation of the Inr I
YY1 site rendered the HPV-16 promoter unresponsive to
YY1 repression in parallel (Fig. 4c, lanes 4–6), indicating
that the promoter-proximal (Inr I) YY1 site is necessary for
YY1-mediated repression in vitro.
To verify that endogenous YY1 was responsible for P97
downregulation in these experiments, we used an unrelated
high-affinity YY1-binding motif (Fig. 1, oligo h) from the
39 kappa immunoglobin enhancer (Park & Atchison, 1991)
as an in vitro competitor (Fig. 4d). Addition of the wildtype YY1-binding site resulted in a threefold increase in
P97 transcription, whereas the YY1 mutant competitor
(Fig. 1, oligo i) had no effect (Fig. 4d, compare lanes 2 and
3 with 4 and 5). Either mutation of the Inr I motif or
depletion of endogenous YY1 by addition of an unrelated
YY1-binding competitor sequence resulted in an identical
threefold increase in P97 transcription in G-free transcription assays (Fig. 4d) and primer extensions (Fig. 4e, lanes
1–4). Therefore, the binding of endogenous YY1 to the
target sequences is required for P97 promoter repression in
vitro. In contrast, the same YY1 competitor was able to
reduce transcription from the initiator-dependent AAV P5
(+1) promoter in parallel primer-extension assays (Fig. 4e,
lanes 5 and 6). These results demonstrate that YY1 binding
to the promoter-proximal YY1 site is necessary for
downregulation of P97 transcription in vitro – a mechanism distinct from YY1-dependent initiation of AAV (P5)
transcription.
DISCUSSION
In summary, this study has demonstrated that, contrary to
the dual positive/negative YY1 regulation of other promoters, cellular factor YY1 downregulates the HPV-16 P97
promoter in in vitro and in vivo assays by binding to a
previously undefined cis motif located immediately
upstream of the P97 start site. In contrast to previous
studies, we examined YY1-mediated modulation of HPV16 transcription not only with promoter fragments, but
also with viral constructs capable of expressing endogenous
levels of the entire complement of viral genes from an
intact genomic plasmid.
YY1 downregulation of HPV transcription
Multiple functional YY1 sites have been identified in HPV
regulatory sequences (this study), in HPV-18 (Bauknecht et
al., 1992) and in extrachromosomal (May et al., 1994) and
integrated (Schmidt et al., 2001) HPV-16 DNA isolates
http://vir.sgmjournals.org
from clinical cervical carcinoma biopsies. Mutations or
deletions of multiple HPV/YY1 sites in defined intratypic
HPV-16 variants relieve downregulation of P97 promoter
activity and plasmid replication (Hubert, 2005) and
contribute to a greater potential for the altered HPV
genome to transform primary keratinocytes in culture
(Lace et al., 2009). These observations indicate that YY1mediated regulation of early viral gene expression in HPVimmortalized keratinocytes is a conserved mechanism. The
nature of this mechanism, however, is only partially
defined.
This study demonstrated that YY1 binding to a promoterproximal site is sufficient to downregulate HPV-16 E6–E7
transcription, but does not exclude the possibility of
cooperative interaction with YY1 bound to additional sites
in the HPV-16 promoter. The cooperative interaction
between multiple repressor-binding sites and their cognate
factor has been described in other systems; for example, the
Drosophila Krüppel-like repressor eve has been shown to
repress the ubx promoter by binding to a pivotal highaffinity site and cooperating with eve bound to additional
distal sites (TenHarmsel et al., 1993) via displacement of
the trans-activating factor zeste. YY1 has been shown to
displace transcription activators such as serum response
factor (SRF) at the c-fos SRE (Gualberto et al., 1992) and
mammary growth factor (MGF) (Meier & Groner, 1994);
however, YY1 displacement of activators bound to the
HPV-16 E6–E7 promoter has yet to be demonstrated.
YY1 binding to upstream HPV-16 silencer elements had
little effect when each site was mutated individually in the
context of the native P97 promoter. Simultaneous
mutation of multiple distal YY1 sites, however, resulted
in increased P97 transcription in vivo (Lace et al., 2009).
The distal YY1 cis elements may be regulated by YY1mediated mechanisms distinct from that of the promoter
(Inr) YY1-binding elements, perhaps by interference with
transcription activators bound to the adjacent HPV-16
enhancer, while YY1 bound to the promoter-proximal sites
targets the general transcription machinery directly via
displacement or quenching. It is also possible that both
mechanisms function alternately or cooperatively in the
course of YY1-mediated downregulation of P97 transcription in the course of the virus life cycle and that additional
YY1-binding sites not defined in this study may also
contribute to this effect.
Mechanisms of YY1 repression
YY1 repression, or activation, of viral and cellular
promoters may involve a multicomponent mechanism
(Galvin & Shi, 1997). YY1 has been shown to interact with
a promoter-proximal Sp1 (Lee et al., 1993; Seto et al., 1993)
and the TBP-associated factor, TAF(II)55, in vitro
(Martinez et al., 1994), indicating that it may disrupt
promoter activation by cellular transactivators and/or
inhibit the assembly or function of the general transcription machinery itself. These observations may be particu-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
2409
M. J. Lace and others
larly relevant in view of the close proximity of the
functional Sp1- and TBP-binding sites to the critical Inr I
YY1-binding site in the HPV-16 promoter. The YY1related Krüppel repressor has similarly been shown to
inhibit Sp1-mediated activation in a selective manner by
contacting the acidic activation domain of Sp1, but not that
of the GAL 4 protein (Licht et al., 1993). Such selectivity of
YY1 interaction with other factors could introduce an
additional level of complexity to the mechanisms of YY1
repression. The Drosophila Krüppel protein also appears to
shift from an activator to a repressor of TFIIB-mediated
activity in a concentration-dependent manner as it begins to
form dimers at higher concentrations (Sauer & Jäckle, 1993).
No such concentration-dependent shift in YY1 function,
however, has been demonstrated. Post-translational modification of the YY1 protein by phosphorylation or acetylation
also appears to provide additional modulation of its function
(Yao et al., 2001).
The YY1-mediated downregulation of HPV-16 transcription, as well as other promoters, may be modulated further
by interactions between YY1 and other secondary proteins.
YY1 complexed with LSF (late SV40 transcription factor)
can recruit histone deacetylase to repress transcription
from the human immunodeficiency virus type 1LTR (Coull
et al., 2000). YY1 has also been shown to recruit histone
methyl transferases, such as the H4-specific PRMT1, to a
YY1-activated promoter to influence its activity, presumably through chromatin remodelling (Rezai-Zadeh et al.,
2003). Furthermore, YY1 appears to play a role in cell
cycle-dependent gene expression through nuclear localization of existing pools of YY1 protein prior to G1/S phase
(Palko et al., 2004). The adenovirus E1a transforming
protein has been shown to convert YY1 from a repressor
into an activator (Shi et al., 1991; Lewis et al., 1995) via
interaction with a YY1–p300 complex (Lee et al., 1995).
The addition of p300 relieved YY1-mediated repression
when E1a was present and this effect was dependent on two
distinct p300 domains necessary for protein–protein
interaction with E1a and YY1, respectively. As E1a and
the HPV-16 E7 proteins share significant sequence
similarities and functional properties, one would predict
the same effect on YY1-mediated repression with increasing levels of E7. In transient-transfection CAT assays
performed in HPV E6- and E7-negative cell lines, however,
we observed no relief of YY1-mediated repression of
upstream HPV-16 reporters upon addition of HPV-16 E7
or E1a expression plasmids, whilst the Ad E1a and HPV-16
E7-responsive control (Ad E2 cat) was activated by both E7
and AdE1a cotransfection in parallel, indicating expression
of functional levels of each protein in these experiments
(data not shown).
Whilst we have found that the trans-activation domain of
the viral E2 protein can cooperate with YY1 to activate
transcription from a heterologous minimal promoter in
CAT assays (data not shown), we have not seen an E2dependent reversal of YY1 downregulation of the HPV-16
E6–E7 promoter in our assays. In fact, in transcription
2410
assays, where functional endogenous levels of the HPV-16
E2 protein are expressed from the intact viral genome, YY1
continues to downregulate the E6–E7 promoter effectively
in vivo (this study).
Additional examples of protein–protein interactions potentiating YY1 function include the c-Myc protein, which
appears to contact YY1, inhibiting both the positive and
negative YY1 functions at the AAV P5 promoter
(Shrivastava et al., 1993). A related example of this
phenomenon has been documented with the human
thyroid hormone receptor (hTRbeta), which is also
converted from a repressor to an activator upon complexation with its thyroid hormone ligand (Roberts &
Green, 1995). Similar effects on YY1 function were also
demonstrated by association with the murine nucleolar
phosphoprotein B23 (Inouye & Seto, 1994). Nuclear
matrix protein 1 has also been identified as YY1 (Guo
et al., 1995), suggesting that YY1 also interacts selectively
with matrix-associated transcription factors, such as E1a
and c-Myc, by compartmentalization of YY1-bound
promoters and potentially providing an additional layer
of YY1-dependent gene regulation.
YY1 functions as a downregulator, not an
initiator, of HPV-16 early transcription at the P97
start site
In our examination of the promoter-proximal YY1 site in
HPV-16, three independent overlapping nucleotide-substitution mutations in the Inr I YY1 site relieved YY1mediated downregulation of the P97 promoter and
abolished YY1 binding; this result argues against the
possibility of generation of a novel binding site for a
positive cis-acting factor or disruption of an existing cisactivator-binding site in our experiments.
Nucleotide-substitution mutagenesis of the P97 start site
has identified nucleotides that are required for YY1 binding
and YY1-mediated inhibition of P97 transcription, but not
required for correct initiation of P97 transcripts. These
results demonstrate clearly that YY1 is not an ‘initiator’
factor at the P97 promoter and that mutual competition
between YY1, as a transcriptional inhibitor binding to the
Inr I site, and an additional ‘initiator’ factor(s) binding at
or near the P97 transcription start site results in downregulation of P97 transcription. These results do not rule
out the potential contribution of additional cellular factors,
binding to cis elements in the HPV-16 promoter, in
negatively potentiating P97 transcription independently or
in cooperation with YY1. Interestingly, although the HPV16 URR is composed of a complex array of cis elements
that can regulate multiple virus functions, mutation of the
P97-proximal YY1 site relieved transcription from this
major early promoter, but did not influence plasmid
replication. This demonstrates that YY1 primarily modulates E6–E7 expression when bound to the P97 promoter
start site without affecting other critical early virus
functions. Further studies into the mechanisms of YY1-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
Journal of General Virology 90
YY1 repression of HPV-16 early gene transcription
mediated downregulation of HPV-16 gene expression
would include the identification of (i) initiator-like factors
binding near HPV promoter start sites as potential targets
for YY1-mediated displacement, and (ii) additional viral or
cellular secondary proteins interacting with YY1 and the
role of these mechanisms in establishing and maintaining
persistent papillomaviral infection.
In conclusion, YY1 continues to emerge as a critical
component in the regulation of virus functions necessary
for establishment and persistence of HPV infection,
including early gene transcription. This study underscores
the expanding inventory of diverse strategies employed by
DNA tumour viruses such as HPV and AAV that have
evolved to use the same cellular factors, for example YY1,
to achieve distinct modulation of critical early viral gene
expression.
ACKNOWLEDGEMENTS
activation of the human papillomavirus-16 P97 promoter by an 88nucleotide enhancer containing distinct cell-dependent and AP-1responsive modules. New Biol 2, 450–463.
Cuthill, S., Sibbet, G. J. & Campo, M. S. (1993). Characterization of a
nuclear factor, papilloma enhancer binding factor-1, that binds the
long control region of human papillomavirus type 16 and contributes
to enhancer activity. Mol Carcinog 8, 96–104.
Flanagan, J. R., Becker, K. G., Ennist, D. L., Gleason, S. L., Driggers,
P. H., Levi, B. Z., Appella, E. & Ozato, K. (1992). Cloning of a negative
transcription factor that binds to the upstream conserved region of
Moloney murine leukemia virus. Mol Cell Biol 12, 38–44.
Flores, E. R. & Lambert, P. F. (1997). Evidence for a switch in the
mode of human papillomavirus type 16 DNA replication during the
viral life cycle. J Virol 71, 7167–7179.
Galvin, K. M. & Shi, Y. (1997). Multiple mechanisms of transcriptional
repression by YY1. Mol Cell Biol 17, 3723–3732.
Gloss, B., Bernard, H. U., Seedorf, K. & Klock, G. (1987). The
upstream regulatory region of the human papilloma virus-16 contains
an E2 protein-independent enhancer which is specific for cervical
carcinoma cells and regulated by glucocorticoid hormones. EMBO J 6,
3735–3743.
The authors wish to thank James Flanagan (University of Iowa) for
generously providing YY1 antisera and expression vectors, B. Moss
(NIH, Bethesda, MD, USA) for vaccinia vectors and protocols, R.
Cortese (CEINGE, Naples, Italy) and R. Roeder (Rockefeller
University, New York, USA) for plasmids, I. Davidson for assistance
with in vitro transcription assays and Aloysius Klingelhutz for
comments on the manuscript. This work was supported by merit
awards to L. P. T and T. H. H. from the Department of Veterans
Affairs.
Gordon, S., Akopyan, G., Garban, H. & Bonavida, B. (2006).
REFERENCES
Hebner, C. M. & Laimins, L. A. (2006). Human papillomaviruses: basic
Baritaki, S., Sifakis, S., Huerta-Yepez, S., Neonakis, I. K., Soufla, G.,
Bonavida, B. & Spandidos, D. A. (2007). Overexpression of VEGF
and TGF-b1 mRNA in Pap smears correlates with progression of
Hubert, W. G. (2005). Variant upstream regulatory region sequences
cervical intraepithelial neoplasia to cancer: implication of YY1 in
cervical tumorigenesis and HPV infection. Int J Oncol 31, 69–79.
Bauknecht, T., Angel, P., Royer, H. D. & zur Hausen, H. (1992).
Identification of a negative regulatory domain in the human
papillomavirus type 18 promoter: interaction with the transcriptional
repressor YY1. EMBO J 11, 4607–4617.
Boukamp, P., Petrussevska, R. T., Breitkreutz, D., Hornung, J.,
Markham, A. & Fusenig, N. E. (1988). Normal keratinization in a
spontaneously immortalized aneuploid human keratinocyte cell line.
J Cell Biol 106, 761–771.
Broyles, S. S., Liu, X., Zhu, M. & Kremer, M. (1999). Transcription
factor YY1 is a vaccinia virus late promoter activator. J Biol Chem 274,
35662–35667.
Coull, J. J., Romerio, F., Sun, J. M., Volker, J. L., Galvin, K. M., Davie,
J. R., Shi, Y., Hansen, U. & Margolis, D. M. (2000). The human factors
YY1 and LSF repress the human immunodeficiency virus type 1 long
terminal repeat via recruitment of histone deacetylase 1. J Virol 74,
6790–6799.
Cripe, T. P., Haugen, T. H., Turk, J. P., Tabatabai, F., Schmid, P. G.,
Dürst, M., Gissmann, L., Roman, A. & Turek, L. P. (1987).
Transcriptional regulation of the human papillomavirus-16 E6-E7
promoter by a keratinocyte-dependent enhancer, and by viral E2
trans-activator and repressor gene products: implications for cervical
carcinogenesis. EMBO J 6, 3745–3753.
Cripe, T. P., Alderborn, A., Anderson, R. D., Parkkinen, S., Bergman, P.,
Haugen, T. H., Pettersson, U. & Turek, L. P. (1990). Transcriptional
http://vir.sgmjournals.org
Transcription factor YY1: structure, function, and therapeutic
implications in cancer biology. Oncogene 25, 1125–1142.
Gualberto, A., LePage, D., Pons, G., Mader, S. L., Park, K., Atchison,
M. L. & Walsh, K. (1992). Functional antagonism between YY1 and the
serum response factor. Mol Cell Biol 12, 4209–4214.
Guo, B., Odgren, P. R., Van Wijnen, A. J., Last, T. J., Nickerson, J.,
Penman, S., Lian, J. B., Stein, J. L. & Stein, G. S. (1995). The nuclear
matrix protein NMP-1 is the transcription factor YY1. Proc Natl Acad
Sci U S A 92, 10526–10530.
mechanisms of pathogenesis and oncogenicity. Rev Med Virol 16, 83–
97.
differentially regulate human papillomavirus type 16 DNA replication
throughout the viral life cycle. J Virol 79, 5914–5922.
Inouye, C. J. & Seto, E. (1994). Relief of YY1-induced transcriptional
repression by protein–protein interaction with the nucleolar phosphoprotein B23. J Biol Chem 269, 6506–6510.
Ishiji, T., Lace, M. J., Parkkinen, S., Anderson, R. D., Haugen, T. H.,
Cripe, T. P., Xiao, J. H., Davidson, I., Chambon, P. & Turek, L. P.
(1992). Transcriptional enhancer factor (TEF)-1 and its cell-specific
co-activator activate human papillomavirus-16 E6 and E7 oncogene
transcription in human keratinocytes and cervical carcinoma cells.
EMBO J 11, 2271–2281.
Lace, M. J., Anson, J. R., Thomas, G. S., Turek, L. P. & Haugen, T. H.
(2008a). The E8–E2 gene product of human papillomavirus type 16
represses early transcription and replication but is dispensable for
viral plasmid persistence in keratinocytes. J Virol 82, 10841–10853.
Lace, M. J., Anson, J. R., Turek, L. P. & Haugen, T. H. (2008b).
Functional mapping of the human papillomavirus type 16 E1 cistron.
J Virol 82, 10724–10734.
Lace, M. J., Isacson, C., Anson, J. R., Lörincz, A. T., Wilczynski, S. P.,
Haugen, T. H. & Turek, L. P. (2009). Upstream regulatory region
alterations found in human papillomavirus type 16 (HPV-16) isolates
from cervical carcinomas increase transcription, ori function, and
HPV immortalization capacity in culture. J Virol 83, 7457–7466.
Lee, T. C., Shi, Y. & Schwartz, R. J. (1992). Displacement of BrdUrdinduced YY1 by serum response factor activates skeletal a-actin
transcription in embryonic myoblasts. Proc Natl Acad Sci U S A 89,
9814–9818.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
2411
M. J. Lace and others
Lee, J. S., Galvin, K. M. & Shi, Y. (1993). Evidence for physical
interaction between the zinc-finger transcription factors YY1 and Sp1.
Proc Natl Acad Sci U S A 90, 6145–6149.
Lee, J. S., Galvin, K. M., See, R. H., Eckner, R., Livingston, D.,
Moran, E. & Shi, Y. (1995). Relief of YY1 transcriptional repression by
adenovirus E1A is mediated by E1A-associated protein p300. Genes
Dev 9, 1188–1198.
Rezai-Zadeh, N., Zhang, X., Namour, F., Fejer, G., Wen, Y. D., Yao,
Y. L., Gyory, I., Wright, K. & Seto, E. (2003). Targeted recruitment of a
histone H4-specific methyltransferase by the transcription factor YY1.
Genes Dev 17, 1019–1029.
Riggs, K. J., Saleque, S., Wong, K. K., Merrell, K. T., Lee, J. S., Shi, Y. &
Calame, K. (1993). Yin-yang 1 activates the c-myc promoter. Mol Cell
Biol 13, 7487–7495.
Lewis, B. A., Tullis, G., Seto, E., Horikoshi, N., Weinmann, R. &
Shenk, T. (1995). Adenovirus E1A proteins interact with the cellular
Roberts, S. G. E. & Green, M. R. (1995). Transcription: dichotomous
YY1 transcription factor. J Virol 69, 1628–1636.
Satyamoorthy, K., Park, K., Atchison, M. L. & Howe, C. C. (1993). The
Licht, J. D., Ro, M., English, M. A., Grossel, M. & Hansen, U. (1993).
Selective repression of transcriptional activators at a distance by the
Drosophila Krüppel protein. Proc Natl Acad Sci U S A 90, 11361–11365.
intracisternal A-particle upstream element interacts with transcription factor YY1 to activate transcription: pleiotropic effects of YY1 on
distinct DNA promoter elements. Mol Cell Biol 13, 6621–6628.
Liu, R., Baillie, J., Sissons, J. G. P. & Sinclair, J. H. (1994). The
Sauer, F. & Jäckle, H. (1993). Dimerization and the control of
transcription factor YY1 binds to negative regulatory elements in the
human cytomegalovirus major immediate early enhancer/promoter
and mediates repression in non-permissive cells. Nucleic Acids Res 22,
2453–2459.
Schmidt, M., Kedzia, W. & Gozdzicka-Jozefiak, A. (2001). Intratype
Margolis, D. M., Somasundaran, M. & Green, M. R. (1994). Human
Seto, E., Shi, Y. & Shenk, T. (1991). YY1 is an initiator sequence-
transcription factor YY1 represses human immunodeficiency virus
type 1 transcription and virion production. J Virol 68, 905–910.
Martinez, E., Chiang, C. M., Ge, H. & Roeder, R. G. (1994). TATA-
binding protein-associated factor(s) in TFIID function through the
initiator to direct basal transcription from a TATA-less class II
promoter. EMBO J 13, 3115–3126.
May, M., Dong, X. P., Beyer-Finkler, E., Stubenrauch, F., Fuchs, P. G.
& Pfister, H. (1994). The E6/E7 promoter of extrachromosomal
HPV16 DNA in cervical cancers escapes from cellular repression by
mutation of target sequences for YY1. EMBO J 13, 1460–1466.
Meier, V. S. & Groner, B. (1994). The nuclear factor YY1 participates
in repression of the b-casein gene promoter in mammary epithelial
cells and is counteracted by mammary gland factor during lactogenic
hormone induction. Mol Cell Biol 14, 128–137.
Mills, L. K., Shi, Y. & Millette, R. L. (1994). YY1 is the cellular factor
shown previously to bind to regulatory regions of several leaky-late
(bc, c1) genes of herpes simplex virus type 1. J Virol 68, 1234–1238.
Montalvo, E. A., Cottam, M., Hill, S. & Wang, Y. C. J. (1995). YY1 binds
to and regulates cis-acting negative elements in the Epstein–Barr virus
BZLF1 promoter. J Virol 69, 4158–4165.
Moss, B. (1991). Vaccinia virus: a tool for research and vaccine
development. Science 252, 1662–1667.
O’Connor, M. J., Tan, S. H., Tan, C. H. & Bernard, H. U. (1996). YY1
represses human papillomavirus type 16 transcription by quenching
AP-1 activity. J Virol 70, 6529–6539.
regulators. Nature 375, 105–106.
transcription by Krüppel. Nature 364, 454–457.
HPV16 sequence variation within LCR of isolates from asymptomatic
carriers and cervical cancers. J Clin Virol 23, 65–77.
binding protein that directs and activates transcription in vitro.
Nature 354, 241–245.
Seto, E., Lewis, B. & Shenk, T. (1993). Interaction between
transcription factors Sp1 and YY1. Nature 365, 462–464.
Shi, Y., Seto, E., Chang, L. S. & Shenk, T. (1991). Transcriptional
repression by YY1, a human GLI-Krüppel-related protein, and relief
of repression by adenovirus E1A protein. Cell 67, 377–388.
Shi, Y., Lee, J. S. & Galvin, K. M. (1997). Everything you have ever
wanted to know about Yin Yang 1. Biochim Biophys Acta 1332, F49–F66.
Shrivastava, A., Saleque, S., Kalpana, G. V., Artandi, S., Goff, S. P. &
Calame, K. (1993). Inhibition of transcriptional regulator Yin-Yang-1
by association with c-Myc. Science 262, 1889–1892.
Soeda, E., Ferran, M. C., Baker, C. C. & McBride, A. A. (2006).
Repression of HPV16 early region transcription by the E2 protein.
Virology 351, 29–41.
Tan, S. H., Baker, C. C., Stunkel, W. & Bernard, H. U. (2003). A
transcriptional initiator overlaps with a conserved YY1 binding site in
the long control region of human papillomavirus type 16. Virology
305, 486–501.
TenHarmsel, A., Austin, R. J., Savenelli, N. & Biggin, M. D. (1993).
Cooperative binding at a distance by even-skipped protein correlates
with repression and suggests a mechanism of silencing. Mol Cell Biol
13, 2742–2752.
Thierry, F. (2009). Transcriptional regulation of the papillomavirus
Pajunk, H. S., May, C., Pfister, H. & Fuchs, P. G. (1997). Regulatory
oncogenes by cellular and viral transcription factors in cervical
carcinoma. Virology 384, 375–379.
interactions of transcription factor YY1 with control sequences of the E6
promoter of human papillomavirus type 8. J Gen Virol 78, 3287–3295.
Ushikai, M., Lace, M. J., Yamakawa, Y., Kono, M., Anson, J., Ishiji, T.,
Parkkinen, S., Wicker, N., Valentine, M. E. & other authors (1994).
Palko, L., Bass, H. W., Beyrouthy, M. J. & Hurt, M. M. (2004). The Yin
Yang-1 (YY1) protein undergoes a DNA-replication-associated switch
in localization from the cytoplasm to the nucleus at the onset of S
phase. J Cell Sci 117, 465–476.
Park, K. & Atchison, M. L. (1991). Isolation of a candidate repressor/
activator, NF-E1 (YY- 1, d), that binds to the immunoglobulin k 39
enhancer and the immunoglobulin heavy-chain mE1 site. Proc Natl
trans activation by the full-length E2 proteins of human papillomavirus type 16 and bovine papillomavirus type 1 in vitro and in vivo:
cooperation with activation domains of cellular transcription factors.
J Virol 68, 6655–6666.
Weill, L., Shestakova, E. & Bonnefoy, E. (2003). Transcription factor
Acad Sci U S A 88, 9804–9808.
YY1 binds to the murine beta interferon promoter and regulates its
transcriptional capacity with a dual activator/repressor role. J Virol
77, 2903–2914.
Psyrri, A. & DiMaio, D. (2008). Human papillomavirus in cervical and
head-and-neck cancer. Nat Clin Pract Oncol 5, 24–31.
Xiao, J. H., Davidson, I., Matthes, H., Garnier, J. M. & Chambon, P.
(1991). Cloning, expression, and transcriptional properties of the
Ralph, W. M., Jr, Liu, K. & Auborn, K. J. (2006). CCAAT/enhancerbinding protein b represses human papillomavirus 11 upstream
Yao, Y. L., Yang, W. M. & Seto, E. (2001). Regulation of transcription
regulatory region expression through a promoter-proximal YY1binding site. J Gen Virol 87, 51–59.
factor YY1 by acetylation and deacetylation. Mol Cell Biol 21, 5979–
5991.
2412
human enhancer factor TEF-1. Cell 65, 551–568.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Wed, 14 Jun 2017 14:55:05
Journal of General Virology 90